MXPA01005353A - Methods for transforming plastids - Google Patents

Abstract

An improved method is provided for the transformation of a plant cell plastid. The improved method allows for the increased efficiency of the foreign DNA penetrating the plastid membrane. The method generally involves the use of a plant tissue source having an altered plastid morphology in plastid transformation methods. The present invention finds use in plastid transformation methods for a wide variety of plant species.

Description

METHODS FOR TRANSFORMING PLASTIDES FIELD OF THE INVENTION This invention relates to the application of genetic engineering techniques to plants. More specifically, the invention relates to methods for the transformation of plant cell plastids.

BACKGROUND OF THE INVENTION The plastids of higher plants are an attractive target for genetic engineering. Plant plastids (chloroplasts, amyloplasts, elaioplast, chromoplasts, etc.), are the main biosynthetic centers that, in addition to photosynthesis, are responsible for the production of industrially important compounds such as amino acids, complex carbohydrates, fatty acids and pigments. The plastids are derived from a common precursor known as proplástido, and in this way the plastids present in a certain plant species, have the same genetic content. The plant cells contain 500-10,000 copies of a small circular genome of 120-160 kilobases, of which each molecule has a large inverted repeat (approximately 25 kb). In this way, it is possible to design plant cells containing up to 20,000 copies of a a gene of particular interest that can potentially result in very high levels of expression of introduced genes. The current methods of transformation of plastids are inefficient, so there is a need for constructions and methods that improve the transformation of them.

BRIEF DESCRIPTION OF THE INVENTION By this invention, methods are provided that allow the improved transformation of a DNA introduced into plant cell plastids. Such methods generally involve using a source of plant tissue containing cells with an altered plastid morphology in the transformation methods. The alteration in the plastid morphology of the plant includes, among other things, plastid size and number. By using tissue derived from said plants in plastid transformation methods, the transformation efficiency of a DNA introduced into the plastid of a plant cell can be increased. As exemplified herein, useful constructs are provided to genetically engineer plant cells to provide a method for increasing plastid transformation efficiency. The constructs include nucleic acid sequences that code for protein sequences that are involved in the control of the organelle division of the plant cell. The expression of said nucleic acid sequences in a plant cell provides an altered number and / or size of the chloroplasts within the host cell. The DNA sequences, also referred to herein as polynucleotides, for use in transformation, contain an expression construct comprising a promoter region that is functional in a plastid, and a DNA sequence encoding a gene involved in the control of the division of organelles of the plant cell. Methods for the use of transformed plastics with altered plastid morphology are described. Such methods include plant breeding or transformation methods to provide plant cells having the nuclear and plastid constructs. The present invention also provides methods for increasing the transformation efficiency of chloroplasts. The method generally comprises transforming the plastids of a plant tissue that has been modified, so that it has an altered number and / or size of the plastids contained within the plant cell. The present invention also provides a mechanism for enhancing the transformation efficiency of chloroplasts in plant species. The present invention also provides methods for improving the selectivity of plants, which comprise transforming a plant cell source having altered plastid morphology, with a construction comprising a functional promoter in a plant cell plastid operably associated with a nucleic acid sequence encoding a selectable marker. Selectable markers of interest in the present invention include herbicide tolerance genes such as glyphosate tolerance genes and antibiotic resistance genes. Glyphosate tolerance genes include the CP4 gene of Agrobacterium. Another aspect of the present invention provides methods for preparing a plant cell source with increased efficiency of plastid transformation, which comprise transforming a plant cell with a construct comprising a functional promoter into a plant cell operably associated with a nucleic acid sequence encoding an FtsZ protein. Also considered as part of this invention are the plants and plant cells obtained using the methods described herein.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 provides an amino acid sequence alignment of the FtsZ1 protein sequences of Arabidopsis (SEQ ID NO: 2), FtsZ1 of Brassica (SEQ ID NO: 6), FtsZ1 of tobacco (SEQ ID NO: 9), FtsZ1 of soy (SEQ ID NO: 72) and FtsZ1 of corn (SEQ ID NO: 73). * 3 ^ wfe? ^ ^ DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, methods are provided that allow the improved transformation of a DNA introduced into plant cell plastids. Such methods generally involve using a plant cell source that contains an altered morphology of the plastids of the plant. By using tissue derived from said plants in plastid transformation methods, the transformation efficiency of a DNA introduced into the plastids of a plant cell can be increased. In one embodiment of the present invention, vsgetal tissue having an altered morphology of the plastids of the plant in plastid transformation methods is used. Such alterations in the morphology of the plastids of the plant include, but are not limited to, alterations in the size, shape and number of plastids with respect to a wild-type plastid morphology of a target plant cell. In general, the morphology of wild-type plastids consists of round organelles and small contents within the plant cell, depending on the species. In addition, a plant cell typically contains between about 50 and about 100 plastids. The source of plant tissue used in the plastid transformation methods of the present invention contains an increase in the size of the plastids contained in plant cells. Such increases in the size of the plastids provide a larger surface area for the introduced DNA to penetrate the plastid membrane during transformation. Large plastids preferably contain almost the same number of plastid genomes that would be contained in a corresponding number of wild-type plastids. For example, in a wild type plant cell containing 100 plastids per cell and 100 copies of the plastid genome in each plastid (a total of 10,000 copies of the plastid genome per cell), the corresponding source of mutant tissue would almost preferably contain the same number of plastid genomes, contained only in one or several large plastids. Alternatively, a plant tissue source with an increased number of plastids, with a corresponding reduced size, may also find use in the plastid transformation methods of the present invention. As is known in the art, other methods for obtaining plants with alterations in the size and number of plastids are known. The person skilled in the art will recognize a number of methods for providing an alteration in the cell division of plastids. Such methods are described, for example, by Strepp, et al. (1998) Proc. Nati Acad. Sci. \ USA, 95: 4368-4373. Cell division, also referred to as cytokinesis, has been the subject of study in many organisms such as bacteria, fungi and animal cells. The division of bacterial cells occurs through the formation of an FtsZ ring (also referred to as a Z ring) in the division cell (Lutkenhaus, et al (1997) Ann.Rev. Biochem. 66: 93-116). The location and formation of the Z ring acts to direct septation (cytocyptosis). The ring is formed of a FtsZ protein similar to tubulin which has GTPase activity. Mutations in the ñsZ gene in E. coli lead to the production of temperature-sensitive filaments with nucleotides regularly separated at certain temperatures (Lutkenhaus (1992) in Prokaryotic Structure and Function: A New Perspective, ed. S. Mohán, C Dow, pp 123-152, Cambridge: Cambridge Univ. Press). Such mutations in bacteria leads to inability to divide correctly. The plastids of the plant cells, as well as the mitochondria, are derived from prokaryotic ancestry and, in this way, the division apparatus of these organelles resembles that of the bacteria. Recently, the identification of sequences related to FtsZ in Arabidopsis and Physcomitrella patens (Osteryoung, et al., 1995) has been reported.

Nature; 376-473-474; and Strepp, et al. (1998), cited above). It was found that the protein encoded by the ftsZ gene of Arabidopsis is introduced into the chloroplast, and it was therefore speculated that it is a component of the plastid cleavage machinery (Osteryoung, et al. (1995), cited I above). More recently, the participation of FtsZ in the plastid division was more directly demonstrated. The dissolution of the ftsZ gene in a lower plant, Physcomitrella patens, prevented the plastid from dividing, thus giving rise to mutant cell lines with a few »J ^ big plastids or only one of them (Strepp, et al. (1998), cited above). The use of plants with an altered number and / or size of plastids containing a few large plastids or a single one of them could therefore be used as a target for the transformation of plastids into any plant species. Such plants that contain an altered size and / or number can be obtained using various methods, including mutagenesis, antisense suppression, or co-suppression. Methods for mutagenesis of plant genomes are well known in the art and include chemicals such as ethyl methane sulfonate (EMS) and nitrosoguanidine (NTG), as well as physical mutagenesis methods such as rapid neutron bombardment. Other methods for obtaining a plant source with an alteration in the size and / or number of plastids contained in the cell are also contemplated. For example, tissue can be obtained for use in the transformation methods of the present invention, from plants grown under culture conditions that provide said altered content of plastids. For example, tissue obtained from plants grown in vitro under culture conditions in which inhibitors of bacterial cell division, such as 5,5'-bis- (8-anilino-1-naphthalenesulfonate) (Yu, et al. (1998 J. Biol Chem. 273: 10216-10222) are present, it can be used as a cellular source for the plastid transformation methods of the present invention.

In a preferred embodiment, said plants containing cells with an alteration in the size and / or number of the plastids, are generated by antisense expression of the FtsZ gene. Once plastid transformation is achieved and homoplasmic pons are identified, the antisense transgene can be eliminated by exogamy, and the wild-type condition can be restored from 50 to 100 plastids per cell. Similarly, plants regenerated from tissue transformed from plastids containing an altered number and / or size of plastids from mutations can also be reverted to the conditions of wild-type plastids using said exogamy methods. In the case of the use of culture conditions to obtain plant cells with an altered number and / or size of plastids, it is possible to obtain wild-type plastids by releasing the tissue from said culture conditions. In another embodiment of the present invention, novel nucleic acid sequences encoding proteins related to proteins involved in the division of plastids and bacterial cells are provided. In particular, novel nucleic acid sequences from Arabidopsis, soy, corn and Brassica are provided, which code for the FtsZ-related proteins. Said nucleic acid sequences find use in the preparation of DNA constructs. Said constructions find use in the production of plants with an altered number and / or size of chloroplasts. The person skilled in the art will recognize that other DNA sequences useful for the production of plants with an altered number and / or size of chloroplasts are available in the art. Sequences include, but are not limited to, ftsA, physical, fts \, ftsQ, ftsN, ftsW and ZifsK ((Lutkenhaus, et al. (1997), cited above), and are genes (Pyke, et al. 1992) Plant Physiol. 99: 1005-1008; Pyke et al. (1994) Plant Physiol. 104: 201-207; and Pyke (1997) Am. J. Botany 84: 1017-1027). To obtain other ftsZ sequences, a genomic library or other appropriate library prepared from the candidate plant source of interest can be treated with probe with sequences conserved from one or more ftsZ sequences of plants and / or bacteria, to identify sequences homologously. related Positive clones can be analyzed by restriction enzyme digestion and / or sequencing. When a genomic library is used, one or more sequences that provide the coding region can be identified, as well as the regulatory elements of the transcription of the ftsZ gene of said plant source. The probes can also be considerably shorter than the complete sequence. Oligonucleotides, for example, may be used, but should be at least about 10, preferably at least about 15, more I preferably at least 20 nucleotides in length. When regions of shorter length are used for comparative purposes, a greater degree of sequence identity is required than for more argon sequences.

Shorter probes are often particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be identified (see Gould, et al., PNAS USA (1989) 86: 1934-1938). When longer nucleic acid fragments (> 100 bp) are used as probes, especially when full or long cDNA sequences are used, they can still be selected with moderately high stringency (for example, using 50% formamide at 37 ° C). with minimal washing), to obtain a signal from the target sample with 20 to 50% deviation, ie, homologous sequences (for more information about selection techniques, see Beitz, ef al., Meth. Enzymology (1983) 100 : 266-285). Another aspect of the present invention relates to isolated FtsZ polynucleotides. The polynucleotide sequences of the present invention include isolated polynucleotides that encode the polypeptides of the invention having a deduced amino acid sequence selected from the group of sequences described in the sequence listing, and other polynucleotide sequences closely related to said sequences, and variants of them. The invention provides an identical polynucleotide sequence over its total length to each coding sequence described in the sequence state. The invention also provides the coding sequence for the mature polypeptide or a fragment thereof, as well as the coding sequence for the mature polypeptide or a fragment thereof in a reading frame with other coding sequences such as those coding for a guiding or secretory sequence, a sequence of pre-, pro- or prepro-protein. The polynucleotide can also include non-coding sequences including, but not limited to, 5 'and 3' non-coding sequences, such as transcribed non-translated sequences, termination signals, ribosome binding sites, sequences which stabilize messenger RNA, introns, signal polyadenylation, and other coding sequences that code for other amino acids. For example, a marker sequence can be included to facilitate purification of the fused polypeptide. The polynucleotides of the present invention also include polynucleotides that comprise a structural gene and the naturally associated sequences that control gene expression. The invention also includes polynucleotides of the formula: wherein, at the 5 'end, X is hydrogen, and at the 3' end Y is hydrogen or a metal, Ri and R3 are any nucleic acid residue, n is an integer between 1 and 3000, preferably between 1 and 1000, and R2 is a nucleic acid sequence of the invention, particularly a nujcleic acid sequence selected from the group described in the sequence listing, and preferably SEQ ID NOS: 1, 3, 5, 7, 8 and 10-31. In the formula, R2 is oriented so that its terminal residue 5 'is on the left, joined to R1 t and its terminal residue 3' is on the right, joined to R3. Any stretch of nucleic acid residue denoted by any group R, wherein R is greater than 1, may be a heteropolymer or a homopolymer, preferably a heteropolymer. The invention also relates to variants of the polynucleotides described herein that encode variants of the polypeptides of the invention. Variants that are fragments of the polynucleotides of the invention can be used to synthesize the full length polynucleotides of the invention. Preferred embodiments are polynucleotides that encode polypeptide variants wherein 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residue of a polypeptide sequence of the invention are substituted, added or deleted in any combination. Particularly preferred are substitutions, additions and deletions that are silent, so as not to alter the properties or activities of the polynucleotide or polypeptide. Other preferred embodiments of the invention are those that are at least 50%, 60% or 70% identical over their total length, with a polynucleotide that codes for a polypeptide of the invention, and polynucleotides that are complementary to said polynucleotides. More preferable are polynucleotides that comprise a region that is at least 80% identical over its total length, with a polynucleotide that codes for a polypeptide of the invention, and polynucleotides that are complementary thereto. In this regard, polynucleotides at least 90% identical over their total length are particularly preferred, and those which are at least 95% identical are especially preferred. In addition, those with at least 97% identity are highly preferred, and those with at least 98% and 99% identity are particularly highly preferred, with those with at least 99% identity being most highly preferred. Preferred embodiments are polynucleotides that encode polypeptides that retain substantially the same function or biological activity as the mature polypeptides encoded by the polynucleotides described in the sequence listing. The invention also relates to polynucleotides that hybridize microgram / milliliter of disintegrated salmon I sperm DNA and denatured I, then washing the hybridization support in 0.1x SSC at about 65 ° C. Other hybridization and lavadp conditions are well known and are exemplified in Sambrook, et al., Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor, NY (1989), particularly chapter 11. The invention also provides a polynucleotide which consists essentially of a polynucleotide sequence obtainable by selecting an appropriate library containing the complete gene for a polynucleotide sequence described in the sequence listing under stringent hybridization conditions, with a probe having the sequence of said polynucleotide sequence or a fragment of the same; and isolating said polynucleotide sequence. Useful fragments for obtaining said polynucleotide include, for example, probes and primers as described herein. As described herein with polynucleotide assays of the invention, for example, polynucleotides of the invention can be used as a hybridization probe for RNA, cDNA or genomic DNA to isolate full-length cDNA molecules, or genomic clones that encode for a polypeptide, and isolate cDNA or genomic clones from other genes having high sequence similarity to a polynucleotide described in the sequence listing. Said probes will generally comprise at least 15 bases. Preferably, said probes will have at least 30 bases, and may have at least 50 bases. Particularly preferred probes will have ben 30 bases and 50 bases, inclusive.

The coding region of each gene comprising or being formed of a polynucleotide sequence included in the sequence listing can be isolated by selection using a DNA sequence provided in the sequence listing to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to that of a gene of the invention is then used to select a library of cDNA, genomic DNA or messenger RNA to identify members of the library that hybridize with the probe. For example, synthetic oligonucleotides corresponding to the FtsZ EST sequences are prepared. Oligonucleotides are used as primers in polymerase chain reaction (PCR) techniques to obtain 5 'and 3' terminal sequences of FtsZ genes. Alternatively, when low degeneracy oligonucleotides can be prepared from FtsZ peptides in particular, such probes can be used directly to select gene genes for FtsZ gene sequences. In particular, the selection of cDNA libraries in phage vectors is useful in such methods due to the low levels of background hybridization. Typically, a FtsZ sequence obtainable from the use of nucleic acid probes will show 60 to 70% sequence identity ben the target FtsZ sequence and the coding sequence used as a probe. However, long sequences can also be obtained with as little as 50-60% sequence identity. The nujcleic acid probes can be a long fragment of the nucleic acid sequence, or they can be a shorter oligonucleotide probe. When longer nucleic acid fragments (greater than about 100 bp) are used as probes, it is possible to select minor astringents to obtain sequences from the target sample that have 20 to 50% deviation (ie, 50 to 80% homology). of sequences) from the sequences used as a probe. The oligonucleotide probes can be considerably shorter than the entire nucleic acid sequence encoding a FtsZ enzyme, but must have at least about 10, preferably at least about 15, and more preferably at least about 20 nucleotides. A greater degree of sequence identity is desired when using shorter regions, in opposition to longer regions. In this way, it may be desirable to identify regions of highly conserved amino acid sequences to design oligonucleotide sondks to detect and recover other related FtsZ genes. Frequently, shorter probes for polymerase chain reactions (PCR) are particularly useful, especially when highly conserved sequences can be identified (see Gould, et al., PNAS USA (1989) 86: 1934-1938). Another aspect of the present invention relates to FtsZ polypeptides. Such polypeptides include isolated polypeptides included in the sequence listing, as well as polypeptides and fragments thereof, particularly those polypeptides that exhibit FtsZ activity, and also those polypeptides having at least 50%, 60% or 70% identity. , preferably at least 80% identity, more preferably at least 90% identity, and most preferably at least 95% identity, with a polypeptide sequence selected from the group of sequences included in the sequence listing, and portions of said polypeptides are also included, wherein said portion of the polypeptide preferably includes at least 30 amino acids, and more preferably includes at least 50 amino acids. "Identity", as is well understood in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, which is determined by comparing the sequences. In the art, "identity" also means the degree of sequence similarity between polypeptide or polynucleotide sequences, which is determined by inter-row matching of said sequences. "Identity" can be easily calculated by known methods including, but not limited to, those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, I 993; Computer Analysis of Sequence Data, Part I, Griffin, A.M. and Griffin, H.G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M and Devereux, J., eds., Stockton Press, New York (1991); and Carillo, H. and Lipman, D., SIAM J. Aplied Math, 48: 1073 (1998). The methods for determining identity are designed to give the longest pairing I among the sequences tested. In addition, methods to determine identity are encoded in programs available to the public. Computer programs that can be used to determine identity between two sequences include, but are not limited to, GCG (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984); BLAST programs, three designed for questions about nucleotide sequences (BLASTN, BLASTX and TBLASTX), and two designed for doubts about protein sequences (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12: 76-80 (1994); , et al., Genome Analysis, 1: 543-559 (1997).) The BLAST X program is available to the public from NCBI and other sources. {BLAST Manual, Altschul, S., et al., NCBI NLM NIH, Bethesda, MD 20894; Altschul, S., Biol., 215: 403-410 (1990)). Smith's well-known algorithm can also be used to determine identity. Parameters for making polypeptide sequence comparisons typically include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970) Comparison matrix: BLOSSUM62 by Hentikoff and Hentikoff, Proc. Nati Acad. Sci. USA 89: 10915-10919 (1992) Penalty for space: 12 Penalty for space length: 4 A program that can be used with the parameters is available to the public as the "gap" program of Genetics Computer Group, Madison Wisconsin. The above parameters, together with the non-penalty parameter for final space, are the default parameters for peptide comparisons. The parameters for comparisons of polynucleotide sequences include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970) Comparison matrix: matings = + 10; no matings = 0 Penalty for space: 50 Penalty for length of space: 3 A program that can be used with these parameters is available to the public as the "gap" program of Genetics Computer Group, Madison Wisconsin. The above parameters are the default parameters for nucleic acid comparisons. The invention also includes polypeptides of the formula: X- (R?) N- (R2) - (3) nY wherein, at the amino terminus, X is hydrogen, and at the carbohydrate end, Y is hydrogen or a metal Ri and R3 are any amino acid residue, n is an integer between 1 and 1000, and R2 is an amino acid sequence of the invention, particularly an amino acid sequence selected from the group included in the sequence listing, and preferably SEQ ID NOS: 2, 4, 6 and 9. In the formula, R2 is oriented so that its amino terminal residue is on the left, linked to Ri, and its carboxy terminal residue is at the right, bound to R3. Any stretch of amino acid residues denoted by any group R, wherein R is greater than 1, may be a hetero hetero or a homopolymer, preferably a heteropolymer. The polypeptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising a sequence selected from the group of a sequence contained in the sequence listing described herein. The polypeptides of the present invention can be a mature protein, or they can be part of a fusion protein. The fragments and variants of the polypeptides are also considered as part of the invention. A fragment is a variant polypeptide having an amino acid sequence that is entirely equal as part of, but not all of, the amino acid sequence of the polypeptides described above. The fragments may be "freestanding", or may be comprised within a larger polypeptide of which the fragment forms a part or a region, more preferably as an individual continuous region. Preferred fragments are biologically active fragments which are those fragments that mediate activities of the polypeptides of the invention, including those with similar activity or improved activity or with decreased activity. Also included are those fragments that are antigenic or immunogenic in an arjimal, particularly a human. Variants of the polypeptide also include polypeptides that vary from the sequences included in the sequence listing! by conservative amino acid substitutions, substitution of one residue by another with similar characteristics. In general, such substitutions are within Ala, Val, Leu e lie; between Ser and Thr; between Asp and Glu; between Asn and Gln; between Lys and Arg; or between Phe and Tyr. Particularly preferred are variants in which 5 to 10; 1 to 5; 1 to 3 amino acids or no amino acids, are substituted, eliminated or added, in any combination. Variants that are fragments of the polypeptides of the invention can be used to produce the corresponding full-length polypeptide by peptide synthesis. Therefore, these variants can be used as intermediates to produce the full-length polypeptides of the invention. The polynucleotides and polypeptides of the invention can be used, for example, in the transformation of host cells, such as plant host cells, as described in greater detail herein. The invention also provides polynucleotides that encode a polypeptide that is a mature protein, plus other amino or carboxy terminal amino acids, or amino acids within the mature polypeptide (eg, when the mature form of the protein has more than one polypeptide chain). Said sequences may have, for example, a function in the processing of a protein from a precursor to a mature form, allow the transport of the protein, shorten or lengthen the half-life of the protein, or facilitate the manipulation of the protein in tests. of production.

It is contemplated that cellular enzymes can be used to remove any additional I amino acid from the mature protein. A precursor protein, having the mature form of the polypeptide fused to one or more prosequences, may be an inactive form of the polypeptide. Inactive precursors are generally activated when prosequences are removed. All prosequences or some of them can be removed before activation. Said precursor proteins are generally referred to as proproteins. Homologous sequences are found when there is a sequence identity, and can be determined after comparing sequence information, nucleic acid or amino acid, or by hybridization reactions between a known FtsZ and a candidate source. Conservative changes, such as Glu / Asp, Val / lie, Ser / Thr, Arg / Lys and Gln / Asn, can also be considered to determine sequence homology. Typically, a long nucleic acid sequence can display as little as 50 to 60% sequence identity, and more preferably at least about 60% sequence identity, between the target sequence and the determined FtsZ sequence of interest, excluding those deletions that may be present, and still be considered related. The amino acid sequences are considered as homologous with as little as 25% identity of I sequences between two complete mature proteins (see generally, Doolittle, R.F., OF URFS and ORFS (University Science Books, CA, 1986).

Furthermore, not only the sequences provided herein can be used to identify homologous FtsZ sequences, but the resulting sequences obtained therefrom can also provide an additional method to obtain FtsZ sequences from other plant and / or bacterial sources. In particular, PCR can be a useful technique for obtaining related FtsZ sequences from the sequence data provided herein. The person skilled in the art will be able to design oligonucleotide sondes based on comparisons of sequences or regions of typically highly conserved sequences. Once the nucleic acid sequence is obtained, the transcription, or transcription and translation (expression), of the FtsZ sequence in a host cell is desired to produce a ready source of the enzyme a, and / or to modify the number and / or the size of the plastids found therein. Other useful applications can be found when the host cell is a host plant cell, in vitro and in vivo. Nucleic acids (genomic DNA, plasmid DNA, cDNA, synthetic DNA, messenger RNA, etc.) coding for amino acid or FtsZ sequences of purified enzymes, which allow the design of nucleic acid probes that facilitate DNA isolation which codes for sequences for them are known in the art, and are available for use in the methods of the present invention. It is generally recognized by one skilled in the art in the field to which the present invention pertains, that the nucleic acid sequences provided herein, and the amino acid sequences derived therefrom, can be used to isolate other potential FtsZ genes. of the dye bank, using peptide and DNA search techniques generally known in the art. In addition to the sequences described in the present invention, the DNA coding for sequences useful in the present invention can be derived from algae, fungi, bacteria, plants, etc. Homology searches can be used in existing databases that use rubric sequences corresponding to conserved nucleotide and amino acid sequences of FtsZ, to isolate related and equivalent genes from other sources such as plants and microorganisms. Searches in EST databases can also be used. In addition, the use of DNA sequences encoding enzymes functionally equivalent to those described herein, wherein said DNA sequences are degenerate equivalents of the nucleic acid sequences described herein in accordance with the degeneracy of the genetic code, is also encompassed by the present invention. Demonstration of the functionality of the coding sequences identified by any of these methods can be carried out by complementation of mutants of appropriate organisms, such as E. coli. The sequences of the DNA coding regions can be optimized by gene resynthesis, based on the use of codons, for maximum expression in particular hosts.

The nucleic acid sequences encoding FtsZ can be used in various constructs, for example, as probes to obtain other sequences. Alternatively, these sequences can be used in conjunction with appropriate regulatory sequences to increase the levels of the respective FtsZ sequence of interest in a host cell to recover or study the enzyme in vitro or in vivo, or to decrease the levels of the FtsZ sequence of interest for some applications when the host cell is an entity of a plant, including plant cells, plant parts (including, but not limited to, seeds, barbs or tissues), and plants. In this way, depending on the desired use; the constructs may contain the nucleic acid sequence encoding the complete FtsZ protein, or a portion thereof. For example, when antisense inhibition of a given FtsZ protein is desired, the complete sequence of FtsZ will not be required. In addition, since the FtsZ constructs are intended for use as probes, it may be advantageous to prepare constructs containing only a particular portion of a sequence encoding FtsZ, for example; a sequence that is discovered codes for a highly conserved FtsZ region. As described above, the nubleic acid sequence I encoding the proteins of a plant or other FtsZ proteins of this invention can include a genomic, cDNA or messenger RNAi I I sequence. By "coding for", it is understood that the sequence corresponds to a particular amino acid sequence in a senate or antisense I orientation. By "extrachromosomal" is meant that the sequence is outside the genome of the plant with which it is naturally associated. By "recombinant" is meant that the sequence contains a genetically engineered modification by manipulation by mutagenesis, restriction enzymes, and the like. A cDNA sequence may or may not contain pre-processing sequences, such as transit peptide sequences or localization sequences to facilitate delivery of the FtsZ protein to a given organelle or membrane site. The use of any FtsZ DNA precursor sequence for uses of expression in plant cells is preferred. A FtsZ genomic sequence may contain the transcription and translation initiation regions, introns and / or termination regions of the plant FtsZ transcript, whose sequences can be used in a variety of DNA constructs, with or without the structural gene of FtsZ. In this manner, nucleic acid sequences corresponding to the FtsZ sequences of this invention, can also provide useful signal sequences to direct the delivery of proteins to an organellar or membrane site in particular, regulatory regions (promoters) of non-coding towards the 5 'end having utility in synchronization tissues and profiles, regulatory regions of non-coding towards the 3' end useful as Once the desired nucleic acid sequence of FtsZ is obtained, it can be manipulated in various ways. When the sequence includes non-coding flanking regions, the flanking regions may be subject to restriction, mutagenesis, etc. In this way, transitions, transversions, deletions and insertions can be carried out in the naturally occurring sequence. In addition, the entire sequence or part of it can be synthesized. In the structural gene, one or more codons can be modified to provide a modified amino acid sequence, or one or more codon mutations can be introduced to provide a convenient restriction site or other purpose having to do with construction or expression. The structural gene can also be modified by using synthetic adapters, linkers to introduce one or more convenient restriction sites, or similar. For the most part, the constructions will include functional regulatory regions in plants, which will provide the altered size and number of plastids in a plant cell. The open reading frame encoding the FtsZ protein, FtsZ-related proteins, or functional fragments thereof, will be linked at its 5 'end to a transcriptional initiation regulatory region, such as the wild-type sequence present naturally. towards the 5 'end of the structural gene of FtsZ or the structural gene related to FtsZ, or to a heterologous regulatory region of a gene that is naturally expressed in plant tissues. Examples of useful regulatory gene regions of plants include those of T-DNA genes, such as nopaline or octapina synthase, plant virus genes, such as 35S of CaMV, or of native plant genes. The DNA sequence encoding a p-tant protein or other FtsZ protein of this invention can be used in conjunction with all gene sequences or part thereof normally associated with FtsZ. In its component parts, a DNA sequence coding for FtsZ is combined into a DNA construct having, in the 5 'to 3' direction of transcription, a control region of the start of transcription capable of promoting transcription and translation into a host cell, the DNA sequence encoding FtsZ of plants, and a terminus region of transcription and translation. Potential host cells include prokaryotic and eukaryotic cells. A host cell can be unicellular or be present in a differentiated or undifferentiated multicellular organism, depending on the desired use. The cells of this invention can be distinguished by having a FtsZ sequence foreign to the wild-type cells of the present, for example, having a recombinant nucleic acid construct encoding a FtsZ protein of the present non-native host species. . Depending on the host, the regulatory regions will vary, including regions of viral, plasmid or chromosomal genes, or the like. For expression in prokaryotic or eukaryotic microorganisms, particularly unicellular hosts, a wide variety of constitutive or regulatable promoters can be used. Expression in a microorganism can provide a viable source of the plant enzyme. Among the regions of initiation of transcription that have been described, it is in the regions of host bacteria and yeasts, such as E. coli, B. subtilis, Saccharomyces cerevisiae, including genes such as beta-galactosidase, T7 polymerase, tryptophan E , and similar. In a preferred embodiment, the constructions will include functional regulatory regions in plants that provide the modified production of FtsZ from plants and, possibly, modification of plastids from the plant cell. The open reading frame that codes for the FtsZ of plants or functional fragment thereof, will be joined at its 5 'end to a regulatory region at the start of transcription. In embodiments wherein the expression of the FtsZ protein is desired in a host plant, the use of the complete FtsZ gene of plants or part thereof is desired, namely, the non-coding (promoter) regions can be used towards the end. 5 ', or part thereof, together with the sequence of the structural gene and the non-coding regions towards the 3' end. If a different promoter is desired, such as a promoter native to the host plant of interest or a modified promoter, i.e., having transcription initiation regions derived from a gene source, and translation initiation regions derived from A different gene source, there are numerous regions of transcription initiation that provide a wide variety of constitutive or regulatable, eg, inducible, transcription of structural gene functions. The regions of initiation of transcription / translation that correspond to said structural genes, are immediately towards the 5 'end of the respective I start codons. Among the transcription initiation regions used for plants, said regions are associated with the T-DNA structural genes such as for nopaline and mannopine synthases, the 19S and 35S promoters of CaMV, and the regions toward the 5 'end of other genes. of plants such as napin, ACP, SSU, PG, zein, phaseolin E, and the like. Enhanced promoters, such as the double 35S, are also available for the expression of FtsZ sequences. For those applications where non-coding regions are obtained towards the 5 'end of other genes regulated during seed maturation, those preferentially expressed in plant embryonic tissues, such as control regions of the beginning of transcription derived, are desired. of ACP and napin. Said "seed-specific promoters" can be obtained and used in accordance with the teachings of the US patents. Issued Nos. 5,608,152 and 5,530,194, the references of which are incorporated herein by reference. Regions of transcription initiation that are preferably expressed in seed tissues, ie, which are not detectable in other parts of the plant, are considered desirable for TAG modifications to minimize any adverse or disruptive effects of the product. gene I Regulatory regulatory regions of transcription may also be provided in the DNA constructs of this invention. The transcription termination regions can be provided by the DNA sequence encoding FtsZ, or a convenient transcription termination region derived from a different gene source, eg, the transcription terminator region that is naturally associated with the region of the beginning of transcription. When the terminus region of the transcript is from a different gene source, it will contain at least about 0.25 kb, preferably about 1 to 3 kb of the 3 'sequence towards the structural gene from which the termination region is derived. Expression or transcription constructions of plants having an FtsZ protein as the DNA sequence of interest for increased or decreased expression thereof, can be used with a wide variety of plant life, particularly, plant life involved in the production of oils vegetables for edible and industrial uses. More particularly preferred are temperate oilseed crops. Plants of interest include, but are not limited to, rapeseed (cañola and varieties with high erucic acid content), sunflower, safflower, cotton, soybean, peanut, coconut, oil palm and corn. Depending on the method for introducing the recombinant constructs into the host cell, other DNA sequences may be required. Most important, this invention is applicable to dicotyledonous species and i! monocotyledons, and will be readily applicable to new and / or improved transformation and regulation techniques. The transformation method is not critical to the present invention; Several methods of plant transformation are currently available. As new methods emerge to transform crops, they can be applied directly. For example, many plant species naturally susceptible to infection by Agrobacterium can be successfully transformed by Agrobacterium-mediated transformation methods with binary or tripartite vectors. In addition, techniques of microinjection, bombardment of DNA particles and electroporation have been developed, which allow the transformation of several species of monocotyledonous and dicotyledonous plants. For the development of the DNA construct, the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector which is capable of replication in a host bacterium, for example, E. coli. There are numerous vectors that have been described in the literature. After each cloning, the plasmid can be isolated and subjected to further manipulation, such as restriction, insertion of new fragments, ligation, deletion, insertion, reservoir, etc., in order to adapt the components of the desired sequence. Once the construction has been completed, it can then be transferred to a suitable vector for further manipulation in accordance with the form of transformation of the host cell.

! Normally, included with the construction of DNA, there will be a structural gene that has the regulatory regions necessary for expression in a host and that provides the selection of transforming cells. The gene can provide resistance to a cytotoxic agent, for example, antibiotic, heavy metal, toxin, etc., complementation by providing prototrophy to an auxotrophic host, viral immunity, or the like. Depending on the number of different host species in which the expression construct or the components thereof is introduced, one or more markers may be used, where different conditions are used for the selection of different hosts. A number of markers have been developed for use in the selection of transformed plant cells, such as those that provide resistance to various antibiotics, herbicides, and the like. The particular marker used is not essential for this invention, with one or the other marker being preferred, depending on the particular host and the form of construction. As mentioned above, the manner in which the construction of DNA is introduced into the host cell is not critical to this invention. Any method that provides efficient transformation can be used. Various methods for the transformation of plant cells include the use of Ti or Ri plasmids, microinjection, electroporation, bombardment of DNA particles, fusion of liposomes, or the like. In many cases, it will be desirable for the construction to be limited on one or both sides by T-DNA, particularly the left and right edges, more particularly the right edge i i I. This is particularly useful when the construction uses A. tumefaciens or A. rhizogenes as a mode of transformation, although the edges of T DNA can find use with other modes of transformation. Once a transgenic plant containing cells with altered numbers and / or sizes of chloroplasts is obtained, a tissue containing said cells can then be used in plastid transformation experiments. For example, the use of tissue containing cells with larger plastids, provides a larger objective in plastid transformation methods, thereby allowing a probability of increased introduction of DNA introduced into the plant cell's pythastids. The DNA sequences, or polynucleotides, for use in the transformation of plastids of this invention, will contain a plastid expression construct that generally comprises a functional promoter in the plastids of a plant cell, and a DNA sequence of interest that will be expressed in cells with transformed plastids. Constructions and methods for their use in the transformation of plastids of higher plants are described in Zoubenko et al. . { Nuc Acid Res (1994) 22 (19): 3819-3824), Svab et al. . { Proc. Nati Acad. Sci. ^ 1990) 87: 8526-8530, Proc. Nati Acad. Sci. (1993) 90: 913-917) and Staub et al. . { EMBO J. (1993) 12: 601-606). Constructs and methods for their use in the transformation of plastids of higher plants to express DNA sequences under the control of a T7 polymerase directed to plastids and nuclearly encoded, are described in the patent of E.U.A. 5,576,198. The complete DNA sequences of the tobacco plastid genome are reported by Shinozaki et al. . { EMBO J. (986) 5: 2043-2049). The stable transformation of genomes of tobacco I plastids by bombardment of particles has been reported (Svab et al (1990), cited above) and Svab et al. (1993), cited above. The methods described herein can be used to obtain homoplasmic plants for plastid expression constructs using the methods described herein. In summary, said methods involve bombarding DNA from an objective host explant, preferably from a tissue which is rich in metabolically active plastids, such as green plant tissues including leaves, and cotyledons. The bombarded tissue is then cultured for about 2 days in media] that promotes cell division. The plant tissue is then transferred to selective media containing an inhibitory amount of the particular selective agent, as well as the particular hormones and other substances necessary to achieve regeneration of that particular plant species. For example, in the above publications and the examples provided herein, the selective marker is the aadA gene, and the selective agent is spectinomycin. The aadA gene product allows the continuous growth and greening of cells whose chloroplasts comprise the product of the marker gene. Cells that do not contain the marker gene product are discolored. The bombed explants will form green shoots in I approximately 3-8 weeks. The leaves of these shoots are then subcultured in the same selective media to ensure the production and selection of homoplasmic shoots. As an alternative to a second cycle of shoot formation, the initial selected shoots can be developed to mature plants, and depend on segregation to provide transformed homoplasmic plants for the inserted gene construct. The transformed plants selected in this way can then be analyzed to determine if the total plastid content of the plant has been transformed (homoplasmic transformants).

Typically, after two cycles of shoot formation and spectinomycin selection, approximately 50% of the transgenic plants tested are homoplasmic, as determined by Southern blot analysis of the plastid DNA. These approaches are selected for subsequent culture, for phenotype analysis of the transgenic plastids (where the expression construct of the nuclear viral polymerase is also present in the plastid transformant), or in methods for transforming the viral polymerase construct into the nucleus of transplastomic plants. The methods of the present invention provide a more efficient method for obtaining homoplasmic plants. Cells from wild type plants typically contain from 50 to 100 plastids per cell. However, once a transplastomic plant is obtained, the DNA sequence contained in the nucleus of the plant cell can be crossed out of the transplastomic cells. The DNA sequence transformed in the nucleus encoding the alteration can be crossed outside the plant containing the transformed plastids. Once the DNA sequence has been crossed, the plastids in the host plant cell can divide and revert to the normal size and number of plastids (ie, the wild type). By applying the selective agent for which plastid expression constructs provide resistance, cells containing a pure population of the plastids containing the introduced DNA can be obtained. The vectors that are used in the plastid transformation preferably include means for providing a stable transfer of the plastid expression construct and selectable marker construction in the plastid genome. This is most conveniently provided by regions of homology to the target plastid genome. The regions of homology flank the construction to be transferred, and provide the transfer to the plastid genome by homologous recombination, by double crossing in the genome. The complete DNA sequence of the tobacco plastid genome has been reported (Shinozaki et al., EMBO J. (1986) 5: 2043-2049). The first complete DNA sequences of the hepatic plastid I genomes (Ohyama et al., Nature (1986) 322: 572-574) and rice (Hiratsuka et al., Mol. Gen. Genet. 1989) 217: 185-194).

When the regions of homology are present in the regions of inverted repetition of the plastid genome (known IRA and IRB ran), two copies of the transgene are expected by transformed plastid. When the regions of homology are present outside the inverted repeat regions of the plastid genome, only one copy of the transformed plastid transgene is expected. The regions of homology within the plastid genome are approximately 1 kb in size. Even smaller homology regions can be used, and as little as 100 bp can provide homologous recombination in the plastid genome. However, the frequency of recombination, and thus the frequency to obtain plants that have transformed plastids, decreases as the size of the regions of homology decreases. Examples of constructions comprising said regions of homology for the transformation of plastids in tobacco, are described in Svab et.al. (1990, cited above) and Svab and Maliga (1993, cited above). Useful regions for recombination in tobacco and Brassica plastid genomes are also described in the following examples. Similar homologous selection and recombination constructs can be prepared using the DNA of the plastids of the target plant species. Other means of transfer to the plastid genome are also considered here, as is the case with methods involving the use of transposable elements. For example, the constructs to be transferred in the plastid genome can be flanked by the inverted repeat regions of a transposable marker that functions in the plastids of the plants. A DNA construct that continues the transient expression of the transposable marker that is required to transfer the target DNA into the plastids is also introduced into the chloroplasts. In this way, a variety of phenotypes can be obtained in plants I transformed with the same expression construct, depending on the position effects that can result from the insertion of the expression constructs at various positions in the plastid genome. Suitable transplants in use in such plastid transformation methods include bacterial Tn10, Mu of bacteriophages, and various other known bacterial transplants. The DNA sequence of interest in the plastid promoter expression constructs can be a coding sequence that is targeted for the expression of a particular structural gene, such that the protein encoded by the structural gene sequence is produced in the plastid transformed. In addition, the DNA sequence of interest may include a number of regions coding for an individual structural gene, so that an operon is produced for the expression of a number of genes from a single region of plastid promoter. In this way, it is possible to enter and express multiple genes from a designed or synthetic operon, or from a group of pre-existing prokaryotic genes. This method would allow the large-scale and economical production of valuable proteins and fine chemical compounds in aThe desired tissue tissue in particular or a particular developmental stage, depending on the promoter used to direct the nuclear expression of the specific viral polymerase. Such a procedure is not practical through the use of standard methods of nuclear transformation, since each gene must be designed in a monocistron that includes a transit peptide. encoded for plastid uptake, and appropriate promoter and terminator signals. As a result, it would be expected that gene expression levels vary widely among cistrons, and would require the generation of an I number of transgenic plant lines. Finally, crosses would be required to introduce all these cistrons in a plant to bring the expression towards the objective biochemical pathway. Alternatively, the DNA sequence of interest in the plastid construct may be a fragment of an endogenous oriented plastid gene, such that an RNA complementary to the messenger RNA of the endogenous gene is produced in the transformed plastid, pichas antisense constructions. they can be used to decrease the expression of the target plastid gene. In order to provide means for selecting the desired plant cells after the transformation of the plastids, the polynucleotides for the transformation of plastids will also contain a construction that provide the expression of a marker gene. The expression of the gene product marker allows the selection of plant cells comprising plastids expressing the marker protein. In the examples provided in the present invention, a bacterial aadA gene is expressed under the regulatory control of the 3 'transcript and the 5' chloroplast promoter regions. The use of said expression construct for the transformation of plant cell plastids has been described by Svab and Maliga (1993, cited above). The expression of the aadA gene confers resistance to spectinomycin and streptomycin, and in this way allows the identification of plant cells that express this marker gene. The selection for the aadA marker gene is based on the identification of plant cells that are not bleached by the presence of streptomycin, or more preferably spectinomycin, in the growth medium of plants. Other genes that code for a product that is involved in chloroplast metabolism can also be used as selectable markers. For example, genes that provide resistance to herbicides such as glyphosate, bromoxynil or imidazolinone may find particular use. These genes have been reported by Staiker et al. . { J. Biol. Chem. (1985) 260: 4724-4728, glyphosate-resistant EPSP), Staiker et al. . { J. Biol. Chem. (1985) 263: 6310-631 *; Nitrilase gene resistant to bromoxynil), and Sathasivan ef al. . { Nucí Acids [Res. (1990) 18: 2188; AHAS resistance gene imidazolinone). The present invention also provides methods for obtaining a plant with transformed plastids in medium containing glyphosate. In the initial stage of transformation, only a few of the many plastids present in a plant cell are transformed, and are therefore capable of expressing the product of the glyphosate-resistant marker gene. The rest of the plastids not transformed inside the cell remain vulnerable to the effect of glyphosate. Therefore, although the cell contains transformed plastids, it is unable to divide and select the transformed plastid, resulting in lack of recovery of the transformed callus tissue, which would result in the transformed regenerants. Thus, any method I that reduces the number of plastids to one to a few within the cell has the potential to survive the effect of glyphosate, and be useful as a selectable marker for the transformation of plastids. The following examples are provided by way of illustration and not by way of limitation.

EXAMPLES EXAMPLE 1 Identification of plant ftsZ sequences To obtain a source of plant tissue with an altered number and / or size of plastids using antisense and / or sense expression of the bacterial FtsZ homologs, public and proprietary sequence databases for homologous sequences in soybean, rice, Arabidopsis are ascertained , corn and Brassica. Two types of FtsZ proteins from plants have been previously identified in the gene bank, FtsZ type I proteins exemplified by access gilí 079731 (SEQ ID NO: 32), seem to be included in the plastid, while FtsZ type II proteins , exemplified by the access I gil3608494 (SEQ ID NO: 33) and gil683524 (SEQ ID NO: 34), appear to remain in the cytoplasm. Homologs of ia are described below FtsZ sequence type I, as well as homologs of the FtsZ genes type II. The sequences used for search against the database are: search of FtsZ type I homologs was (SEQ ID NO: 32), and for the search for FtsZ type II, (SEQ ID NO: 33).

The searches carried out in our own databases containing sequences obtained from Arabidopsis, identified sequences of DNA that are related to the sequence of FtsZ1. The sequence of SEQ ID NO: 1 is identified as AtFtsZL The sequence deduced from amino acid encoded by SEQ ID NO: 1 is provided in SEQ ID NO: 2. In addition, it was identified that a sequence (SEQ ID NO: 3) is related to the sequence of FtsZ2. The deduced amino acid sequence encoded by SEQ ID NO: 3 is provided in SEQ ID NO: 4. Sequences were also identified in databases containing sequences obtained from Brassica. A sequence was identified related to the FtsZ1 sequence of Arabidopsis. Based on the sequence alignments between the two sequences, it was predicted that approximately 170 amino acids were missing in the Brassica sequence in the N-terminal. To obtain a full length coding sequence for the FtsZ1 gene from Brassica (BnFtsZI), PCR RACE was carried out using DNA obtained from Brassica leaves using primers SC258 (SEQ ID I NO: 35) and SC259 (SEQ ID NO: 36). A reaction product was found to contain most of the 5 'sequence (SEQ ID NO: 70), and was used to produce a full length sequence referred to as BnFtsZI (SEQ ID NO: 5). The deduced amino acid sequence encoded by BnFtsZI is expressed in SEQ ID NO: 6. A FtsZ1 homologue was also identified in the tobacco by PCR using primers designed for the conserved amino acid domains of the FtsZ1 sequence of Arabidopsis. The PCR primers used are identified as SC252 (SEQ ID NO: 37), SC253 (SEQ ID NO: 38), SC254 (SEQ ID NO: 39) and SC255 (SEQ ID NO: 40). The reaction products were cloned into TOPO TA (Invitrogen), and a single clone, referred to as xanthil-26-contig (SEQ ID NO: 7), contained most of the sequence. Other primers were designed to be used in RACE PCR to obtain a full-length coding sequence for the tobacco FtsZ1 homolog. For amplification of the 5 'region, primers SC291 (SEQ ID NO: 41) and SC292 (SEQ ID NO: 42) were used, and for amplification of the 3' sequence, primers SC293 (SEQ ID NO: 43) and SC294 (SEQ ID NO: 44). The PCR products were cloned in TOPO TA, and sequenced. The clone xanftsZ1-5'-15 (SEQ ID NO: 71) was chosen as the best for the 5 'FtsZ1 sequence of the tobacco, since it contained the greatest amount of 5' sequences, and overlapped with xanthil-26-contig. . This sequence was combined with xanthil-26-contig to produce xanFtsZI (SEQ ID NO: 8). The deduced amino acid sequence is provided in SEQ ID NO: 9). FtsZ homologous sequences were identified in databases containing DNA sequences obtained from maize by BLAST searches, using the amino acid sequences of FtsZ1 and FtsZ2 of Arabidopsis. It was identified that ten sequences were related to the FtsZ sequences, provided in SEQ ID NOS: 10-19. The clones, when aligned, revealed six contigs, and the best representative clone was selected for further analysis. Sequence analysis of SEQ ID NO: 10 revealed high homology with AtFtsZI, and it was estimated that 158 amino acids were missing at the N-terminus, when compared to FtsZ1 of Arabidopsis. The clone SEQ ID NO: 13 was found to overlap perfectly with SEQ ID NO: 10 by 153 nucleotides at the 5 'end, and furthermore had 167 nucleotides at the 5' end that had amino acid homology with FtsZ1 of Arabidopsis. However, it was also not predicted that this clone codes for full-length FtsZ, and still lacked 113 amino acids at the N-terminus when compared to FtsZ1 of Arabidppsis. What is interesting, for the clone SEQ ID NO: 13, its homology with SÉQ ID NO: 10 ends at the position of 167 nucleotides, and diverges. This could be indicative of the presence of intron sequences or a new class of FtsZ protein. The primer SC321 (SEQ ID NO: 45) was designed to remove the missing FtsZ sequence from the maize by PCR RACE.

Sequence analysis of SEQ ID NO: 18 revealed its high homology with FtsZ2, and it was also predicted that it was not full length, and that lacked approximately 286 amino acids at the N-terminus when compared to FtsZ2 from Arabidopsis. The SC322 initiator was designed (SEQ ID NO: 46) to remove the missing FtsZ2 sequence from the maize by PCR RACE However, it was identified that SEQ ID NO: 14 and SEQ ID NO: 15 have the highest BLAST scores with FtsZ2.

Homologous sequences of soy FtsZ were identified in databases through BLAST searches with the sequences of amino acids of FtsZ1 and FtsZ2 of Arabidopsis. Twelve were obtained sequences, and are provided in SEQ ID NOS: 20-31. Sequence analysis of SEQ ID NO: 20, SEQ ID NO: 24 and SEQ ID NO: 25 revealed high homology with FtsZ1, and none was of full length when compared to FtsZ1 of Arabidopsis SEQ ID NO: 25 had the longest sequence at the N-terminus, and was predicted to lack 64 amino acids at the N-terminus, when compared to the FtsZ1 sequence of Arabidopsis. The sequences of SEQ ID NO: 20, SEQ ID NO: 24 and SEQ ID NO: 25 to correct the overlapping region. The RACE PCR primers can now be designed to amplify the ends to obtain a full-length DNA sequence. An alignment of sequences between the sequences of the FtsZ1 protein from Arabidopsis, Brassica, tobacco, soybean and corn, is provided in the Figure 1.

EXAMPLE 2 Preparation of expression constructs in plants 2A. Nuclear expression constructions Constructions are prepared for transformation in the nucleus of a plant cell for alteration of the size and / or the number of plastids in the transformed plant cell. Constructs can be prepared to alter the plastids constitutively, or in a specific form of tissues, for example, in leaf tissue or in seed tissue. A plasmid containing the napin cassette derived from pCGN3223 (described in USPN 5,639,790, the contents of which are hereby incorporated by reference in their entirety), was modified to make it more useful for cloning large DNA fragments containing multiple restriction sites , and to allow the cloning of multiple napin fusion genes into binary transformation vectors in plantais. An adapter formed from the sequence self-linked oligonucleotide CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCC ATTTAAAT (SEQ ID NO: 47), was ligated into the cloning vector pBG SK + (Stratagene) after digestion with the restriction endonuclease BssHIl to construct the vector pCGN7765. Plasmids pCGN3223 and pCGN7765 I were digested with Notl and ligated together. The resulting vector, pCGN7770, contains the base structure of pCGN7765 with the seed-specific pCGN3223 napin expression cassette. 1 The cloning cassette pCGN7787, which essentially has the same regulatory elements as pCGN7770, except for the napin regulatory regions of pCGN7770, has been replaced with the double 35S promoter of CAMV, the polyadenylation of tml and the terminator region of the transcription. A binary vector for transformation into pl, pCGN5139, was constructed from pCGN1558 (McBride and Summerfelt (1990), Plant Molecular Biology, 14: 269-276). The polylinker of pCGN1558i was replaced as a Hindlll / Asp718 fragment with a polylinker containing unique sites of restriction endonuclease, Ascl, Pac, Xbal, Swal, BamHI and Notl. The restriction endonuclease sites Asp718 and Hindlll are retained in pCGN5139. A series of turbo binary vectors is constructed to allow rapid cloning of DNA sequences into binary vectors containing regions of transcription initiation (promoters) and transcription termination regions. The plasmid pCGN8618 ligand ios oligonucleotides 5 -TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3 '(SEQ ID NO: 8) and 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 49) was constructed in pCGN7770 digested with Sall / Xhol. A fragment containing the napin promoter, polylinker and 3 'napin region was separated from pCGN8618 by digestion with Asp718l; the fragment was shaved at its ends by filling in the 5 'overhangs with Klenow fragment and ligated then in pCGN5139 which had been digested with Asp718l and Hindlll and shaved at its ends by filling in the 5 'overhangs with Klenow fragment. A plasmid containing the insertion oriented so that the napin promoter was closer to the Asp718l site of pCGN5139 shaved at its ends and the 3 'end of napin was closer to the Hlindlll site shaved at its ends, was subjected to sequence analysis for confirm the orientation of the insertion and the integrity of the cloning junctions. The resulting plasmid was designated pCGN8622. The plasmid pCGN8619 was constructed by ligating the oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3 '(SEQ ID NO: 50) and 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 1) in pCGN7770 digested with Sall / Xhol. A fragment containing the napin promoter, polylinker and 3 'napin region was separated from pCGÑ8619 by digestion with Asp718l; the fragment was shaved at its ends by filling in the 5 'overhangs with Klenow fragment and then ligated into pCGN5139 which had been digested with Asp718l and Hindlll and shaved at its ends by filling in the 5' overhangs with Klenow fragment. A plasmid containing the oriented insertion so that the napin promoter was closer to the Asp718l site of pCGN5139 shaved at its ends and the 3 'end of napin was closer to the indilll site shaved at its ends, was subjected to sequence analysis ! to confirm the orientation of the insertion and the integrity of the cloning junctions. The resulting plasmid was designated pCGN8623.

I i The plasmid pCGN8620 was constructed by ligating the oligonucleptides S'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT-S '(SEQ ID NO: 52) and d'-CCTGCAGGAAGCTTGCGGCCCCCGGATCC-S' (SEQ ID NO: 53) in pCGN7787 digested with Sall / Sacl. A fragment containing the d35S promoter, polylinker and 3 'region of tml was separated from pCGN8620 by complete digestion with Asp718l and partial digestion with Notl. The fragment was shaved at its ends by filling in the 5 'overhangs with Klenow fragment and then ligated into pCGN5139 which had been digested with Asp718l and Hindlll and shaved at its ends by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the d35S promoter was closer to the Asp718l site of pCGN5139 shaved at its ends and the 3 'end of tml was closer to the Hindlll site shaved at its ends, was submitted to sequence analysis for confirm the orientation of the insertion and the integrity of the cloning junctions. The resulting plasmid was designated pCGN8624. The plasmid pCGN8621 was constructed by ligating the oligonucleotides d'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT-S '(SEQ ID NO: 54) and 5'-GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 55) in pCGN7787 digested with Sall / Sacl. A fragment containing the d35S promoter, polylinker and 3 'region of tml was separated from pCGN8621 by complete digestion with Asp718l and partial digestion with Notl. The fragment was shaved at its ends by filling in the 5 'overhangs with Klenow fragment i and then ligated into pCGN5139 which had been digested with Asp718l and Hindlll and shaved at its ends by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the d35S promoter was closer to the Asp718l site of pCGN5139 shaved at its ends and the 3 'end of tml was closer to the Hindlll site shaved at its ends, was submitted to sequence analysis for confirm the orientation of the insertion and the integrity of the cloning junctions. The resulting plasmid was designated pCGN8625. The construction of plasmid pCGN8640 is a modification of pCGN8624 described above. A 938 bp Pstl fragment isolated from transposon Tn7, which codes for bacterial resistance to spectinomycin and streptomycin (Fling et al. (1985), Nucleic Acids Research 13 (19): 7095-7106), a determinant for selection of E. coli and Agrobacterium, was shaved at its ends with Pfu polymerase. The shaved fragment at its ends was ligated into pCGN8624 which had been digested with S | pel and shaved at its ends with Pfu polymerase. The region containing the PstI fragment was sequenced to confirm the orientation of the insertion and the integrity of the cloning linkages. The spectinomycin resistance marker was introduced into pCGN8622 and pCGN8323 in the following manner: an AvrlI-SnaBI fragment of 7.7 Kpb from pCGN8640 was ligated to an AvrlI-SnaBI fragment of 10.9 Kpb from pCGN8623 and pCGN8622, described above. The resulting plasmids were pCGN8641 and pCGN8643, respecti. The nucleotide sequence of FtsZ1 of Arabidopsis was used to construct the sense expression vector pCGN6495 for use in the transformation of Arabidopsis, Brassica and tobacco. For this construct, the ftsZ1 sequence of Arabidopsis was amplified by PCR. To monitor the expression of FtsZ1 proteins in transformed lines, a c-myc tag (EQKLISEEDL (SEQ ID NO: 56)) was fused by translation to FtsZ1 at the C-terminus. Amplification by PCR was carried out by a first cycle of amplification with the primers SC247 (SEQ ID NO: 57) and SC260 (SEQ ID NO: 58), followed by amplification with SC247 (SEQ ID NO: 59) and SC261 ( SEQ ID NO: 60) using the product of the first amplification as the template DNA, using standard amplification parameters. The final product of the amplification, the FtsZ1 / c-myc fusion, was cloned into the nuclear transformation vector pCGN8624 to create pCGN6495, which was used for the nuclear transformation of Arabidopsis, canola and tobacco using standard protocols. The turbo vector pCGN8624 was used for the antisense constructs, so that the antisense sequence is directed from the d35S promoter. For Arabidopsis, the coding sequence (from ATG to TAG) was amplified with primers SC248 (SEQ ID NO: 61) and SC250 (SEQ ID NO: 62) using AtFtsZI as a template. For Brassica, the primers SC276 (SEQ ID NO: 63) and SC268 (SEQ ID NO: 64) were used with the M ^ HMMM ^ HM ^ HM ^ HMMii ^^^ MH ^ HHI ^ MMa PCR fragment SC3-1-1 (SEQ ID NO: 70) as template DNA to generate a Hind \\\ Pst fragment, and cloned into pBSKS (Stratagene) to generate pCGN6528. The SC276 primer was designed to be located 140 bases towards the 3 'end of ATG due to the presence of a non-homologous stretch of the sequence compared to FtsZ1 of Arabidopsis contained in the first 140-base sequence fragment. The 3 'half of the coding sequence was amplified by PCR using the primers SC269 (SEQ ID NO: 65) and SC270 (SEQ ID NO: 66) to produce a PstI / NotI fragment, and subsequently cloned into pCGN6528 to generate pCGN6529. The Hind \\\ IPst fragment containing the BnFtsZI sequence (from 140 bases to the 3 'end of ATG to TAG) was cloned into the turbo vector pCGN8624 to generate the final transformation vectors pCGN6530 and pCGN6611. The Hind \\\ INot fragment containing the sequence of BnFtsZI was also cloned into the vector pCGN8643 for the expression of seed-specific antisense FtsZ1. For tobacco, primers SC305 and SC306 were designed to PCR amplify the FtsZ1 sequence to produce a Ssel /? / OfI fragment using 5 'DNA from the library obtained by PCR RACE obtained from leaf RNA, and cloned in TOPO TA2 .1 to produce pCGN6565. The Ssel /? / OfI fragment from pCGN6565 was cloned into the turbo vector pCGN8624 to generate the final transformation vector pCGN6566. ^^ taM ^ MÉWÉ-ÉUlM 2A. Plastid expression constructions Constructs and methods for their use in the transformation of plastids from higher plants are described in Zoubenko et al. . { Nuc Acid Res (1994) 22 (19): 3819-3824), Svab et al. . { Proc. Nati Acad. Sci (1990) 87: 8526-8530 and Proc. Nati Acad. Sci. (1993) 90: 913-917) and Staub et al.

. { EMBO J. (1993) 12: 601-606). Constructs and methods for their use in the transformation of plastids of higher plants to express DNA sequences under the control of a T7 polymerase directed to plastids and nuclearly encoded, are described in the patent of E.U.A. No. 5,576,198. The complete DNA sequences of the tobacco plastid genome are reported by Shinozaki et al. . { EMBO J. (1986) 5: 2043-2049). A plastid expression construct, pMON49218, was constructed which expresses the synthetic CP4 sequence with the GFP fusion of 14 amino acids from the promoter region of the 16Sr DNA operon having the RNA polymerase region encoded by the nucleus ( PrrnPEP + NEP), and the terminator region of the plastid rps16 gene. The DNA sequence of the Prrn / NEP / G10L :: 14aaGFP fusion is SEQ ID NO: 67.

EXAMPLE 3 Transformation and analysis of plants Constructs for the expression of sense or antisense sequences are transformed into tobacco cells using the methods described by Ursin et al. (1991) Plant Cell 3: 583-591. i Transgenic tobacco plants containing the first nuclear FtsZ constructs were analyzed for alterations in the plastid morphology, including the size and number of plastids present in the plant cell. We selected 58 initial transformants (generation T1) obtained from the transformation with the expression construct of FtsZ1 pCGN6495, for the phenotype of large plastids, and were divided into three categories. Thirty-four (34) lines contained less than 5 large plastids, 8 lines contained between 5 and 20 plastids, and 16 lines more than 20 plastids (number of wild type and more than wild type number). One line, Nt6495-61, contained a single large plastid. The selection method consisted in examining isolated mesophilic protoplasts at a magnification of 100X under an optical microscope. Transgenic plants containing large plastids appear to be phenotypically indistinguishable from the wild type under growing and greenhouse conditions. The calculation of the number of plastid DNA copies of several large plastid lines, did not reveal any difference when compared with the wild type. Southern analysis was used to calculate the number of copies of the transgene in the large plasmid lines,] and several lines with individual integration events were identified. Western analysis of the large plastid lines with c-myc antibody confirmed the expression of the introduced transgene (labeled by c-myc). T2 seeds were collected from selected plants from each of the three categories: EXAMPLE 4 Transformation and plastid analysis Foliar material was obtained from three transgenic lines, Nt64j95-30 (with less than 5 plastids per cell), Nt6495-16 (with 5 to 20 plastids per cell) and Nt6495-69 (with 5 to 20 plastids per cell), to evaluate the transformation efficiency of the plastids and direct the selection by glyphosate. The Plastid Transformation Rector pMON49218, which contains the aacW gene for spectinomycin selection and GFP as a marker, was used to bombard 15 leaf explants from each of three transgenic lines. For each series of bombardment of the transgenic line, 15 wild-type control leaves were used. The order of bombardment of the wild type leaves and the transgenic line was randomized to eliminate any prejudice. The frequency of Nt6495-30 transformation of the first eyento was almost twice that of the wild-type control that produces 7 against 3 transformants, respectively. Nt6495-16 and Nt6495-69 showed almost the same transformation frequency (3 transformers) as the control. In this way, the authors' preliminary analysis reveals that the plastid transformation efficiency could have been increased by reducing the number of wild-type plastids to less than 5 plastids per cell. Interestingly, all the plastid-transforming regenerants of the Nt6495 lines showed much smaller growth and size compared to the wild-type ones. It seems that the presence of the selectable antibiotic spectinomycin dihydrochloride at a concentration of 500 mg / ml could have affected the regeneration capacity of the cells in the Nt6495 lines. In this way, it is possible that there could be more cells with transformed plastids in the transgenic Nt6495 lines that were susceptible to the antibiotic and could not regenerate. To verify if this was the case, mortality curves can be used with lower concentrations of spectinomycin dihydrochloride (50, 100, 200, 300, 400 and 500 mg / ml) with each of the lines Nt6495-30, Nt6495-16 and Nt6495-69 to establish the concentration at which the regeneration of the shoots is as good as in the wild type. This concentration of spectinomycin dihydrochloride will then be used to repeat the transformation frequency tests with the three Nt6495 lines. To analyze the direct selection by glyphosate, mortality curves with variable glyphosate levels will be established with the Nt6495 lines, in order to find the best level of selection. The plastid transformation vector pMON49218 will be used to bombard the Nt6495 lines, ^ MtoM ^ tf and will be tested for direct selection using the optimized glyphosate level. In Arabidopsis, the nuclear expression construct of FtsZ1 pCGN6495 was used to transform the Columbia ecotype. T1 seeds were collected, and approximately 100 seedlings resistant to kanamycin were analyzed to determine the alteration in the size and number of plastids following the same protocols described for the section of this report on tobacco. The transgenic plants were divided into three groups based on the number of plastids (I) 20 independent lines containing few large plastids (1-5), (II) 23 lines containing 5 to 20 plastids, and (lll) 50 lines containing a number of wild-type plastids. T2 plants selected from each category were analyzed to determine the number of integration loci of the transgene, and sent to the growth chamber for collection of T3 seeds to identify homozygous plants. Said plants can be used in plastid transformations as described by Sikdar, et al. (1998) Plant Cell Reports, 18: 20-24. Transformed plants selected for the expression of the aadA marker gene or glyphosate resistance were analyzed to determine if the total plastid content of the plant had been transformed (homoplasmic transformants). Typically, after two cycles of shoot formation and selection for spectinomycin, almost 50% of the transgenic plants that are analyzed are homoplasmic, as , -. - ^. i..j ..- »- j, .. J ^ .. .. -y-. .- .. J .. . . ^ m > *. ! i determines by Southern blot analysis of plasmid DNA. Homoplasmic approaches are selected for subsequent culture. Southern blot analysis is used to confirm the integration of the chimeric expression cassettes into the plastid genome. The steps of preparation, electrophoresis and DNA transfer to filters are described by Svab et al. 1993, cited above. Total cellular DNA from plants can be prepared as described by Dellaporta et al. (1983) Plant Mol. Biol. Rep.: 19-21. To visually observe the expression of marker genes such as GFP from the chloroplasts of transformed plants, various tissues are visualized using a dissection microscope. The protoplasts and chloroplasts are isolated as described in Sidorov, ef al. (1994) Theor. Appl. Genet 88,525-529. The above results demonstrate that the sequences of the present invention provide efficient means for the production of plants with transformed plastids. In addition, said methods find use in plastid transformation methods that involve the selection of transplastomic plants by the use of herbicides, for example, glyphosate. All publications and patent applications mentioned in this specification are indicative of the level of knowledge of those skilled in the art to which this invention pertains. All publications and patent applications are incorporated herein by reference, at the same > IHE grade as if it were indicated that each publication or individual patent application specifically and individually is incorporated as a reference. Although the above invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

LIST OF SEQUENCES < 110 > CalgeneLLC < 120 > Methods for the transformation of plastids < 130 > 15595/00 / WO < 140 > PCT / US99 / 28103 < 141 > 1999-11-24 < 150 > 60 / 109,892 < 151 > 1998-11-25 < 160 > 73 < 170 > FastSEQ for Windows, Version 4.0 < 210 > 1 < 211 > 1495 < 212 > DNA < 213 > Arabidopsis sp • *** t > * > - < 400 > 1 atggcgataa ttccgttagc acagcttaat gagctaacga tttcttcatc ttcttcttcg 60 tttcttacca aatcgatatc ttctcattcg ttgcatagta gctgcatttg cgcaagttct 120 agaatcagtc aattccgtgg cggcttctct aaacgaagaa gcgattcaac aaggtctaag 180 tcgatgcgat tgaggtgttc cttctctccg atggaatctg cgagaattaa ggtgattggt 240 gtcggtggtg gtggtaacaa tgccgttaac cggatgattt caagcggttt acagagtgtt 300 gatttctatg cgataaacac ggattcgcaa gctctgttac agtcttctgc tgagaaccca 360 cttcaaattg gagaactttt aactcgtggg cttggcactg gtggaaaccc gcttcttgga 420 gaacaagctg cagaagaatc aaaagatgca attgctaatg ctcttaaagg atcagacctt 480 gttttcataa ctgctggtat gggtggtgga acagggtctg gtgctgcacc tgtggtagct 540 cagatttcga aggatgctgg ttatttgact gttggtgttg ttacctatcc gtttagcttt 600 gaaggacgta aaagatcttt gcaggcactg gaagctattg aaaagctcca aaagaatgtt 660 gataccctta tcgtgattcc aaatgatcgt ttgctgatga ctgctagata acagacgcca 720 cttcaggacg cgtttcttct tgcagatgat gttttacgcc aggaatctca aaggagtaca 780 gatattatta ctatacctgg actagtcaat gtagattttg cagatgtgaa ggcagtcatg 840 aaagattctg gaactgc aat gctcggggta ggtgtttctt ccagcaaaaa ccgggcagaa 900 gaagcagctg aacaagcaac tttggctcca ttgatcggat catccataca atcagctact 960 ggtgtcgtct acaacatcac tggtggaaaa gacataactt tgcaggaagt gaaccgagta 1020 tcacaggtcg tgacaagttt ggcagaccca tcggccaaca tcatatttgg agctgttgtg 1080 acaccggaga gatgatcgct gattcatgta acgataatcg ccacaggctt ctctcagtca 1140 cacttctgac ttccagaaga gcagctaaac tgatccaaga aatgggatca tccttgacaa 1200 tcaggtcaac aagagaacaa aggaatgtct ctgcctcacc agaagcagtc tccatcaact 1260 atctctacca aatcgtcttc tccccgtaga cttttcttct agttttcttt ttttcctttt 1320 cggtttcaag catcaaaaat gtaacgatct tcaggctcaa atatcaatta catttgattt 1380 tcaaaaaaaa aaaaaaaagg cggccgctct agaggatcca agcttacgta cgcgtgcatg 1440 cgacgtcata gctcttctat agtgtcacct aaattcaatt cactggccgt cgttt 1495 < 210 > 2 < 211 > 433 < 212 > PRT < 213 > Arabidopsis sp < 400 > 2 Met Wing He He Pro Leu Le Wing Gln Leu Asn Glu Leu Thr He Being Ser 1 5 10 15 Being Being Being Phe Leu Thr Lys Being Ser Being His Being Leu His 20 25 30 Being Being Cys He Cys Being Wing Being Arg Being Being Gln Phe Arg Gly Gly 35 40 45 Phe Being Lys Arg Arg Being Asp Being Thr Arg Ser Lys Ser Met Arg Leu 50 55 60 Arg Cys Ser Phe Ser Pro Met Glu Ser Wing Arg He Lys Val He Gly 65 70 75 80 Val Gly Gly Gly Gly Asn Asn Wing Val Asn Arg Met He Ser Ser Gly 85 90 95 Wl ^^ itetU ^ Leu Gln Ser Val Asp Phe Tyr Wing He Asn Thr Asp Ser Gln Wing Leu 100 105 110 Leu Gln Phe Ser Wing Glu Asn Pro Leu Gln He Gly Glu Leu Leu Thr 115 120 125 Arg Gly Leu Gly Thr Gly Gly Asn Pro Leu Leu Gly Glu Gln Ala Wing 130 135 140 Glu Glu Ser Lys Asp Wing He Wing Asn Wing Leu Lys Gly Ser Asp Leu 145 150 155 160 Val Phe He Thr Wing Gly Met Gly Gly Gly Gly Thr Gly Wing Ala 165 170 175 Pro Val Val Ala Gln He Ser Lys Asp Wing Gly Tyr Leu Thr Val Gly 180 185 190 Val Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser Leu Gln 195 200 205 Wing Leu Glu Wing He Glu Lys Leu Gln Lys Asn Val Asp Thr Leu He 210 215 220 Val He Pro Asn Asp Arg Leu Leu Asp He Wing Asp Glu Gln Thr Pro 225 230 235 240 Leu Gln Asp Wing Phe Leu Leu Wing Asp Asp Val Leu Arg Gln Gly Val 245 250 255 Gln Gly He Being Asp He He Thr He Pro Gly Leu Val Asn Val Asp 260 265 270 Phe Wing Asp Val Lys Wing Val Met Lys Asp Ser Gly Thr Wing Met Leu 275 280 285 Gly Val Gly Val Ser Ser Ser Lys Asn Arg Wing Glu Glu Wing A the Glu 290 295 300 Gln Wing Thr Leu Wing Pro Leu He Gly Be Ser He Gln Ser Wing Thr 305 310 315 320 Gly Val Val Tyr Asn He Thr Gly Gly Lys Asp He Thr Leu Gln Glu 325 330 335 Val Asn Arg Val Ser Gln Val Val Thr Ser Leu Wing Asp Pro Be Wing 340 345 350 Asn He He Phe Gly Wing Val Val Asp Asp Arg Tyr Thr Gly Glu He1 355 360 365 His Val Thr He He Wing Thr Gly Phe Ser Gln Ser Phe Gln Lys Thr 370 375 380 Leu Leu Thr Asp Pro Arg Wing Wing Lys Leu Leu Asp Lys Met Gly Ser 385 390 395 400 Ser Gly Gln Gln Glu Asn Lys Gly Met Ser Leu Pro His Gln Lys Gln 405 410 415 Ser Pro Ser Thr He Ser Thr Lys Ser Ser Ser Pro Arg Arg Leu Phe 420 425 430 Phe < 210 > 3 < 211 > 1611 < 212 > DNA < 213 > Arabidopsis sp «MßaiA < 400 > 3 tgttgttgcc gctcagaaat ctgaatcttc tccaatcaga aactctccac ggcattacca 60 aagccaagct caagatcctt tcttgaacct tcacccggaa atatctatgc ttagaggtga 120 acaatagtca agggactagt atccaagaaa ggaaacgtct tctggacctg ttgtcgagga 180 ttttgaagag ccatctgctc cgagtaacta caatgaggcg aggattaagg ttattggtgt 240 gggaggtggt ggatcaaatg ctgtgaatcg tatgatagag agtgaaatgt caggtgtgga 300 gttctggatt gtcaacactg atatccaggc tatgagaatg tctcctgttt tgcctgataa 360 taggttacaa attggtaagg agttgactag gggtttaggt gctggaggaa atccagaaat 420 cggtatgaat gctgctagag agttattgaa agagcaaaga gaagctcttt atggctcaga 480 tatggtcttt gtcacagctg gaatgggcgg tggaactggc actggtgcag cccctgtaat 540 tgcaggaatt gccaaggcga tgggtatatt gacagttggt attgccacaa cgcctttctc 600 gtttgagggt cgaagaagaa ctgttcaggc tcaagaaggg cttgcatctc tcagagacaa 660 ctcatcgtca tgttgacact ttccaaatga caagttgctt acagctgtct ctcagtctac 720 gaagcattta tccggtaaca atctagctga tgatatactc cgtcaggggg ttcgtgggat [780 atctgatatc attacgattc ctggtttggt gaatgtggat tttgctgatg tgagagctat 840 aatggc AAAT gcggggtctt cattgatggg aataggaact gcgacaggaa agagtcgggc 900 aagagatgct gcgctaaatg caatccaatc ccctttgtta gatattggga ttgagagagc 960 gtttggaaca cactggaatt ttactggcgg aagtgacttg acattgtttg aggtaaatgc 1020 tgctgcggaa gtaatatatg atcttgtcga tccaactgcc aatcttatat tcggtgctgt 1080 tgtagatcca gccctcagcg gtcaagtaag cataaccctg atagctacgg gtttcaaacg 1140 acaagaagag ggagaaggac gaacagttca gatggtacaa gcagatgctg cgtcagttgg 1200 agctacaaga agaccctctt cttcctttag agaaagcggt tcagtggaga tcccagagtt 1260 cttgaagaag aaaggcagct ctcgttatcc ccgagtctaa agcccaatct aatcactacc 1320 ctgcacactg cagcaataac aaacgtgtgt gtactggtag tctggtactg ccttctggga 1380 tacagcaaga tgtgttgatg tatgatcaag aatctgtgtg tgttctgtca ggtgtgtata 14 | 40 ctgcctctgg tcgtgttctt gaataggttg ttttagaaat ctctatgtca cggagtttct 1500 cttccaaaac aaaaaaggag aagaagaatc acacttctcg aaccataaac atacttataa 1560 gattatgaga gttttagcag aaattattgt aaaaaaaaaa caaaaaaaaa to 1611 < 210 > 4 < 211 > 397 < 212 > PRT < 213 > Arabidopsis sp < 400 > 4 Met Leu Arg Gly Glu Gly Thr Ser Thr He Val Asn Pro Arg Lys Glu 1 5 10 15 Tnr Ser Ser Gly Pro Val Val Glu Asp Phe Glu Glu Pro Ser Ala Pro 20 25 30 Ser Asn Tyr Asn Glu Wing Arg He Lys Val He Gly Val Gly Gly Gly 35 40 45 Gly Ser Asn Ala Val Asn Arg Met He Glu Ser Glu Met Ser Gly Val 50 55 60 Glu Phe Trp He Val Asn Thr Asp He Gln Wing Met Arg Met Ser Pro 65 70 75 80 Val Leu Pro Asp Asn Arg Leu Gln He Gly Lys Glu Leu Thr Arg Gly 85 90 95 - ^ ¡¡^^^ ¿Leu Gly Ala Gly Gly Asn Pro Glu He Gly Met Asn Ala Ala Arg Glu 100 105 110 Ser Lys Glu Val He Glu Glu Ala Leu Tyr Gly Ser Asp Met Val Phe1 115 120 125 Val Thr Wing Gly Met Gly Gly Gly Thr Gly Thr Gly Ala Wing Pro Val 130 135 140 He Wing Gly He Wing Lys Wing Met Gly He Leu Thr Val Gly He Wing 145 150 155 160 Thr Thr Pro Phe Ser Phe Glu Gly Arg Arg Arg Thr Val Gln Wing Gln1 165 170 175 i Glu Gly Leu Wing Ser Leu Arg Asp Asn Val Asp Thr Leu He Val He 180 185 190 Pro Asn Asp Lys Leu Leu Thr Wing Val Ser Gln Ser Thr Pro Val Thr; 195 200 205 Glu Ala Phe Asn Leu Ala Asp Asp He Leu Arg Gln Gly Val Arg Gly 210 215 220 He Be Asp He He Thr He Pro Gly Leu Val Asn Val Asp Phe Wing 225 230 235 240 Asp Val Arg Ala He Met Ala Asn Ala Gly Ser Ser Leu Met Gly He 245 250 255 Gly Thr Ala Thr Gly Lys Ser Arg Ala Arg Asp Ala Ala Leu Asn Ala 260 265 270 He Gln Ser Pro Leu Leu Asp He Gly He Glu Arg Ala Thr Gly He 275 280 285 Val Trp Asn He Thr Gly Gly Ser Asp Leu Thr Leu Phe Glu Val Asn 290 295 300 Wing Wing Wing Glu Val He Tyr Asp Leu Val Asp Pro Thr Wing Asn Leu 305 310 315 320 He Phe Gly Ala Val Val Asp Pro Ala Leu Ser Gly Gln Val Ser He 325 330 335 Thr Leu He Wing Thr Gly Phe Lys Arg Gln Glu Glu Gly Glu Gly Arg 340 345 350 Thr Val Gln Met Val Gln Ala Asp Ala Ala Ser Val Gly Ala Thr Arg 355 360 365 Arg Pro Ser Ser Phe Arg Glu Ser Gly Ser Val Glu He Pro Glu 370 375 380 Phe Leu Lys Lys Lys Gly Ser Ser Arg Tyr Pro Arg Val 385 390 395 < 210 > 5 < 211 > 1450 < 212 > DNA < 213 > Brassica sp < 400 > 5 atggcgatta gtccgttggc acagcttaac gagctaccag tctcttcctc gtttcttgcg 60 acatcccact cgctgcacag taccagaatc agtggcggct tctcaaaaca aaggtttaag 120 caaacacggt tgagatgctc cttctctccg atggagtctg cgaggattaa ggtggttggt 180 gtcggcggtg gtggtaacaa tgccgtcaat cgcatgattt ccagcggctt acagagtgtt 240 gatttctatg cgataaacac ggactctcaa gctctcttgc agtcttctgc gcagaaccct 300 cttcaaattg gagagctcct aactcgtggc cttgggactg gtgggaaccc gcttctagga 360 gaacaagctg ctgaggaatc taaagacgcg attgctaatg ctcttaaagg atctgacctt 420 gytttcatta ctgctggtat gggtggtggc actggctccg gtgctgctcc tgttgttgct 480 cagatctcga aagacgctgg ttatttgacc gttggtgttg ttacctatcc cttcagcttc 540 gaaggtcgta aaagatcttt gcaggcactt gaagccattg aaaagctgca gaagaacgtg 600 gataccctca tcgtgatacc aaatgatcgt ctcctagata ttgctgatga acagacgcct 660 cttcaagacg cttttcttct cgcggatgat gttttgcggc aaggagttca aggaatctct 720 gatattatta ctatacctgg actggtcaat gtagattttg cggatgtgaa gtcggttatg 780 aaagattccg gaactgcgat gctcggggtg ggtgtttctt ccgagcagaa caagcaagaa 840 gaagcagctg agcaagccac tttggctcca ttgatcggat catccattca atcagctact 900 ggtgtcgtct acaacatcac cggtggaaaa gacattactt tgcaggaagt gaaccgagta 960 tctcaggtgg tgacaagttt ggcagaccca tcggccaaca tcatatttgg agctgttgtg 1020 acactggaga gatgatcgat gattcatgta acgataatag ccacggggtt ctcacagtct 1080 cacttctcag ttccagaaga gcagctaaac tgatccaaga aacgggatca tactcgacaa 1140 tcaggtcaac aacaagagaa caaaggcagt caccagaggc agtctcctgc aactatcaac 1200 accaaatcat cttctccccg tagattgttc ttctagtatc ttttgttttt taagcatatt 1260 cctttatcaa aaatgtaacg atcttcaggc tcaaatatca attacttttc tccagattat 1320 ctcaaaagaa gtaatttgtt aaaccaaaaa aaaaaaaaaa gggcggccgc tctagaggat 1380 ccaagcttac gtacgcgtgc atgcgacgtc atagctcttc tatagtgtca cctaaattca 1440 attcactggc 1450 < 210 > 6 < 211 > 411 < 212 > PRT < 213 > Brassica sp < 220 > < 221 > VARIANT < 222 > (1) ... (411) < 223 > Xaa = Any amino acid < 400 > 6 Met Ala He Ser Pro Leu Ala Gln Leu Asn Glu Leu Pro Val Ser Ser 1 5 10 15 Be Phe Leu Ala Thr Ser His Being Leu His Being Thr Arg He Ser Gly 20 25 30 i Gly Phe Ser Lys Gln Arg Phe Lys Gln Thr Arg Leu Arg Cys Ser Phe 40 45 Ser Pro Met Glu Ser Wing Arg He Lys Val Val Gly Val Gly Gly Gly 50 55 60! Gly Asn Asn Wing Val Asn Arg Met He Be Ser Gly Leu Gln Ser Val 65 70 75 80! Asp Phe Tyr Ala He Asn Thr Asp Ser Gln Ala Leu Leu Gln Ser Ser 85 90 95 Wing Gln Asn Pro Leu Gln He Gly Glu Leu Leu Thr Arg Gly Leu Giy 100 105 110 Thr Gly Gly Asn Pro Leu Leu Gly Glu Gln Ala Wing Glu Glu Ser Lys1 115 120 125! Asp Ala He Ala Asn Ala Leu Lys Gly Ser Asp Leu Xaa Phe He Thr 130 135 140! Wing Gly Met Gly Gly Gly Thr Gly Wing Gly Wing Pro Val Val Wing! 145 150 155 160 Gln He Ser Lys Asp Wing Gly Tyr Leu Thr Val Gly Val Val Thr Tyr 165 170 175! Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser Leu Gln Ala Leu Glu Ala1 180 185 190 He Glu Lys Leu Gln Lys Asn Val Asp Thr Leu He Val He Pro Asn 195 200 205 Asp Arg Leu Leu Asp He Wing Asp Glu Gln Thr Pro Leu Gln Asp Wing 210 215 220 Phe Leu Leu Wing Asp Asp Val Leu Arg Gln Gly Val Gln Gly He Ser 225 230 235 240.

Asp He He Thr He Pro Gly Leu Val Asn Val Asp Phe Wing Asp Val 245 250 255 Lys Ser Val Met Lys Asp Ser Gly Thr Wing Met Leu Gly Val Gly Val 260 265 270 Ser Ser Lys Asn Arg Wing Glu Glu Wing Wing Glu Gln Wing Thr Leu 275 280 285 Wing Pro Leu He Gly Being Ser Gln Ser Wing Thr Gly Val Val Tyr 290 295 300 Asn He Thr Gly Gly Lys Asp He Thr Leu Gln Glu Val Asn Arg Val 305 310 315 320 Ser Gln Val Val Thr Ser Leu Ala Asp Pro Ser Ala Asn He He Phe 325 330 335 Gly Ala Val Val Asp Asp Arg Tyr Thr Gly Glu He His Val Thr He 340 345 350 He Wing Thr Gly Phe Ser Gln Ser Phe Gln Lys Thr Leu Leu Ser Asp 355 360 365 Pro Arg Wing Wing Lys Leu Leu Asp Lys Thr Gly Ser Ser Gly Gln Gln 370 375 380 Gln Glu Asn Lys Gly Ser His Gln Arg Gln Ser Pro Ala Thr He Asn 385 390 395 400 Thr Lys Being Ser Pro Arg Arg Leu Phe Phe 405 410 < 210 > 7 < 211 > 1295 < 212 > DNA < 213 > Nicotiana sp < 400 > 7 tgccgttaac cggatgattt caagcggttt acagggtgtt gacttctatg ctataaacac 60 ggatgctcaa gcactgctac agtctgctgc tgaaaacccg cttcaaattg gagaacttct 120 gactcgtggg cttggtactg gtggtaatcc tcttttaggg gaacaggcag tggaggagtc 180 gaaggaagcc attgcaaatt ctctaaaagg ttcagatatg gtgttcataa cagcaggaat 240 gggtggaggt acaggatctg gtgctgctcc tgttgtggct caaatagcaa aagaagcagg 300 ctatttgact gttggtgttg tcacataccc attcagcttt gaaggacgta aaagatccgt 360 gcaggctctg gaagcaattg aaaaacttca gataccctta gaaaaatgta tagtaattcc 420 aatgaccgtc tgctagatat tgctgatgag cagacaccac ttcaagatgc ttttcttctt 480 gctgatgatg tattacgcca aggtgtccaa ggaatttccg atataattac tatacctggg 540 cttgtaaatg tggattttgc cgatgtaaag gtagtgatga aagattctgg aactgctatg 600 cttggagttg gggtttcatc aagcaagaac cgtgctgaag aagcagccga acaagcaact 660 cttgcccctc ttaattggat cgtccattca atcgccactg gggtagtatc caccattcca 720 ggaggaaaag accataactt tgcagaaagt gaatagggtg tctcaggttg ttacagtctg 780 gctgatccct cccgctaaca tcatatttgg tgctgttgtg gatgagcgct acaatggcga 840 aatacacgtg accataattg caactggttt tacccagtct tttcagaaga ctcttctctc 900 ggtgcaaagc tgacccacga ttgttgataa atccaagaaa aggcccagta gcatggcatc 960 acctgttacc ctgaggtcat caacctcacc ttcgacaaca tcacgaacac ctactcggag 1020 gctgttcttt tagctccttt atatagtttg ttacggcttc atttttctct tttcttactt 1080 ttttcttttt tactttcttt gtatttacat gttttgctga ttggtgtttg catttggctg 1140 tagacatagt gatgattctt atcaagtgca tcacattcat actcgaaaaa aaaaaaaaaa 1200 aaaaaaagta ctctgcgttg ttacccactg ttaagggcga tatcccatca attctgcaga 1260 cgctcgagca cactggcggc tgcatctaga gggcc 12 ^ 5 < 210 > 8 < 211 > 1255 < 212 > DNA < 213 > Nicotiana sp < 400 > 8 atggccacca tctcaaaccc agcagagata gcagcttctt ctccttcctt tgctttttac '60 cactcttcct ttattcctaa acaatgctgc ttcaccaaag ctcgccggaa aagcttatgt 120 aaacctcaac gtttcagcat ttcaagttca tttactcctt ttgattctgc taagattaag 180 gttatcggcg tcggtggcgg tggtaacaat gccgttaacc ggatgatttc aagcggttta 2 * 40 cagggtgttg acttctatgc tataaacacg gatgctcaag cactgctgca gtctgctgct 300 gaaaacccgc ttcaaattgg agaacttctg actcgtgggc ttggtactgg tggtaatcct 360 cttttagggg aacaggcagc ggaggagtcg aaggaagcca ttgcaaattc tctaaaaggt 420 tcagatatgg tgttcataac agcaggaatg ggtggaggta caggatctgg tgctgctcct 480 gttgtggctc aaatagcaaa agaagcaggc tatttgactg ttggtgttgt cacataccca 540 ttcagctttg aaggacgtaa aagatccgtg caggctctgg aagcaattga aaaacttcag 600 aaaaatgtag atacccttat agtaattccc aatgaccgtc tgctagatat tgctgatgag 660 cagacaccac ttcaagatgc ttttcttctt gctgatgatg tattacgcca aggtgtccaa 720 ggaatttccg atataattac tatacctggg cttgtaaatg tggattttgc cgatgtaaag 780 gtagtgatga aagattctgg aactgctatg cttggagttg gggtttcatc aagcaagaac 840 cgtgctgaag aagcagccga acaagcaact cttgcccctc ttattggatc gtccattcaa 900 tcagccactg gggtagtatc caccattcca ggaggaaaag acataacttt gcagaaagtg 960 aatagggtgt ctcaggttgt tacagtctgg ctgatccctc ccgctaacat catatttggt 1020 atgagcgcta gctgttgtgg caatggcgaa atacacgtga ccataattgc aactggtttt 1080 acccagtctt ttcagaagac tcttctctct gacccacgag gtgcaaagct tgttgataaa 1140 ggcccagtaa tccaagaaag catggc atca cctgttaccc tgaggtcatc aacctcacct 1200 tcgacaacat cacgaacacc tactcggagg ctgttctttt agctccttta tatag 1255 < 210 > 9 < 211 > 413 < 212 > PRT < 213 > Nicotiana sp < 400 > 9 Met Ala Thr He Ser Asn Pro Ala Glu He Ala Ala Be Ser Pro Pro 1 5 10 15 Phe Wing Phe Tyr His Ser Being Phe He Pro Lys Gln Cys Cys Phe Thr 20 25 30 Lys Wing Arg Arg Lys Ser Leu Cys Lys Pro Gln Arg Phe Ser Be Ser 40 40 45 Ser Ser Phe Thr Pro Phe Asp Ser Ala Lys He Lys Val He Gly Val 50 55 60 Gly Gly Gly Gly Asn Asn Wing Val Asn Arg Met He Ser Ser Gly Leu 65 70 75 80 Gln Gly Val Asp Phe Tyr Ala He Asn Thr Asp Ala Gln Ala Leu Leu 85 90 95 Gln Ser Ala Ala Glu Asn Pro Leu Gln He Gly Glu Leu Leu Thr Arg 100 105 110 Gly Leu Gly Thr Gly Gly Asn Pro Leu Leu Gly Glu Gln Ala Ala Glu 115 120 125 Glu Ser Lys Glu Ala He Ala Asn Ser Leu Lys Gly As Asp Met Val 130 135 140 Phe He Thr Ala Gly Met Gly Gly Gly Gly Thr Gly Ser Ala Ala Pro 145 150 155 160 Val Val Ala Gln He Ala Lys Glu Ala Gly Tyr Leu Thr Val Gly Val 165 170 175 Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser Val Gln Wing 180 185 190 Leu Glu Wing He Glu Lys Leu Gln Lys Asn Val Asp Thr Leu He Val 195 200 205 He Pro Asn Asp Arg Leu Leu Asp He Wing Asp Glu Gln Thr Pro Leu 210 215 220 Gln Asp Wing Phe Leu Leu Wing Asp Asp Val Leu Arg Gln Gly Val Gln 225 230 235 240 Gly He Ser Asp He He Thr He Pro Gly Leu Val Asn Val Asp Phe 245 250 255 Wing Asp Val Lys Val Val Met Lys Asp Ser Gly Thr Wing Met Leu Gly 260 265 270 Val Gly Val Being Ser Lys Asn Arg Wing Glu Glu Wing Wing Gl Gln 275 280 285 Wing Thr Leu Wing Pro Leu He Gly Be Ser He Gln Be Wing Thr Gly 290 295 300 Val Val Ser Thr He Pro Gly Gly Lys Asp He Thr Leu Gln Lys Val 305 310 315 320 Asn Arg Val Ser Gln Val Val Thr Val Trp Leu He Pro Pro Wing Asn 325 330 335 He He Phe Gly Wing Val Val Asp Glu Arg Tyr Asn Gly Glu He His 340 345 350 Val Thr He He Wing Thr Gly Phe Thr Gln Ser Phe Gln Lys Thr Leu 355 360 365 Leu Ser Asp Pro Arg Gly Ala Lys Leu Val Asp Lys Gly Pro Val He 370 375 380 Gln Glu Ser Met Ala Ser Pro Val Thr Leu Arg Ser Ser Thr Ser Pro 385 390 395 400 Ser Thr Thr Ser Arg Thr Pro Thr Arg Arg Leu Phe Phe 405 410 < 210 > 10 < 211 > 1278 < 212 > DNA < 213 > Zea mays < 220 > * • * - "'* <221> miscellaneous feature <222> (1) ... (1278) <223> n = A, T, C or G < 400 > 10 gatcttgtct tcataacagc tgggatggga gggggtactg gatctggtgc tgctccagtt 60 gttgcccaga tatcaaagga agctggttat cttactgttg gtgttgtcac ctatccattc 120 agtttcgagg gccgtaagcg ctctgtacag gcattggaag cactagagaa gctggaaaag 180 agtgtagaca cacttattgt gattccaaat gataagttat tagatgttgc ggatgaaaac 240 atgcccttgc aagatgcatt tctccttgca gatgatgtcc ttcgtcaggg tgttcaagga 300 atatcagaca tcatcacaat accgggactt gtcaatgttg attttgctga tgtaaaagct 360 gtcatgaaaa actctggaac tgccatgctc ggtgttggtg tttcttccag caaaaatcgg 420 gcccaagaag ctgctgaaca ggcaacactt gctcctttga ttggatcatc catcgaggca 480 gctactggcg ttgtgtataa tattactggt gggaaggaca tcactttgca agaagtgaac 540 aaggtgtccc agattgtgac aagcctagct gacccatctg cgaacataat tttcggtgct 600 gtcgttgatg accgttacac tggtgagata catgtgacaa tcattgcgac aggatttcca 660 cagtccttcc agaaatccct tttggcggat ccaaagggag cacgtatagt ggaatccaaa 720 gagaaagcag caaccctcgc ccataaagca gcagcagctg cagttcaacc ggtccctgct 780 tctgcttggt ctcgaagact cttctcctga gaagctcatt tggtgaaccg tgactcgtag 840 tgcattagat ttgcat TTAG cgtgttgagg gcagtcccta aggtgatctt cggatatctg 900 gcttgggcta gagatttata gtgttcggta gtggtagaat aagtttcagt gtatgtatcg 960 ttgctttgct ttatgttttt gaggatcagg cggtgaggct gagagaagtg ctcagcaact 1020 ctgttgtaga caacattgaa agatctttga ttgcttttat tgctgcaaca tgccaacaac 1080 attcamcmna cctctgttgg aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1J40 aaaaaaaaaa aaaaaaaaaa aaaanncaaa aaaaaaaaaa aaaaaaaagg gcggccgccg 1200 actagtgagc tcgtcgaccc gggaattaat tccggaccgg tacctgcagg cgtaccagct 1260 ttccctatag tgagtcgt 1278 < 21O > 11 < 211 > 283 < 212 > DNA < 213 > Zea mays < 400 > eleven gctccagttg ttgcccagat atcaaaggaa gctggttatc ttactgttgg tgttgtcacc 60 tatccattca gtttcgaggg ccgtaagcgc tctgtacagg cattggaagc actagagaag 120 ctggaaaaga gtgtagacac acttattgtg attccaaatg ataagttatt agatgttgcg 180 gatgaaaaca tgcccttgca agatgcattt ctccttgcag atgatgtcct tcgtcagggt 240 gttcaaggaa tatcagacat catcacaata ccgggacttg tca 283 < 21 O > 12 < 211 > 287 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (287) < 223 > n = A, T, C or G < 400 > 12 gggccgtaag cgctctgtac aggcattgga agcactagag aagctggaaa agagtgtaga 60 cacacttatt gtgattccan atnatnngtt attagatgtt gcggatgaaa acatgccctt 120 gcaagatgca tttctccttg cagatgatgt ccttcgtcag ggtgttcaag gaatatcaga 180 catcatcaca ataccgggac ttgtcaatgt tgattttgct gatgtaaaag ctgtcatgaa 240 aaactctgga actgccatgc tcggtgttgg tgtttcttcc agcaaaa 287 < 210 > 13 < 211 > 1122 < 212 > DNA < 213 > Zea mays < 400 > 13 ccgattccca gctataaaca agcccttatt aattcacaag cgcaatatcc tctgcaaatt 60 ggagagcagt tgacccgcgg cttaggtgcc ggtggaaatc cgaatttggg agagcaggct 120 gctgaggaat caagagaaac catagccact gccctgaggg attcagatct tgtcttcata; i80 acagctggga tgggaggggg tactggatct ggtgctgctc cagttgttgc ccagatatca 0.240 aaggaagctg gttatcttac tgttggtgtt gtcacctatc cattcagttt cgagggccgt 0.300 aagcgctctg tacaggcaaa gtatctgagc cccccttcac tcctgaattt taattcaaac 360 tgtcatatct cgttctgcga ctttcttttg ctcgatggaa gcattagttt gtagtcataa 420 caatgacatc cagccacatt tattgctgat gatgtataca atggtaggtc aaagaaatgt 480 agcatcatgc catcacctgt agttcatctc atcattttgt tcctactttt ctgcgtggtt 540 acaatataca gatgcccaaa actatgtggt tgtactgttg cattgccttg tggagggatg 600 tttatgttgt gaaatatttc aaaacacatg tcattatgaa tattccctcc tgtggttgtg '660 gggacttgtt tcaaatgcta tgaattaaga acaaggcaac ataaagtgtt aaatgttaac 720 ccatgaaaca cgtctttcgt ttattccctt gaggataatg ggccttggac aaaggctgat 780 gagagtataa ttaccaagct taaatcttcg taataaaatt tcaatagata ttgtaagata? 840 acataaaa ta aagggtataa aaaggggtaa ataaatcata attatattta gacgaattat 900 cttaatatat tgaatcattg aatacaataa tacctctgcc ttggcaaagg ttggattccg '960 ttgcaagtta aaaaatgtga ccagaatgcg tgaacagtaa aggaatactg ttcactattt 1.020 ataggcacag gacacagcct gtggaggaat tcaattatac ccgtcataag agtttacaca 1080 cctttatgga ttgacttaga ctaaaagatc attgctatct tt lll22 < 210 > 14 < 211 > 291 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (291) < 223 > n = A, T, C or G < 400 > 14 aaaatagtgt ggacacccta atcgtcatcc caaatgataa gttgctgtct gctgtttctc 60 caaatacacc tgtaactgaa gcatttaatc tggctgatga tattcttcgt caaggcattc 120 gtggcatatc tgatataatt acggttcctg ggnaggttaa tgttgatttt gctgacgtac 180 gtgctatcat gcaaaatgca gggtcatcct tgatgggtat agggactgct acaggaaagt 240 caagagcaag ggatgctgct cttaacgcca tccagtcgcc gctgcttgat 291 ^^^ HtftÜMMUfeta < 21O > 15 I < 211 > 415 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (415) < 223 > n = A, T, C or G < 400 > 15 gagcaaggga tgctgctctt aacgccatcc agtcgccgct gcttgatatt ggaattgaaa 60 gagccacagg cattgtgtgg aatatcactg ggggaactga cctgactttg tttgaggtga 120 atgctgcggc cgaaattatc tacgaccttg tcgatccaaa cgctaatctg atatttggcg 180 ccgtcataga cccgtcactg agtgggcagg tgagcataac cttgatagct actggcttca 240 tgaaccagaa aacggcagga ggccgcgtgt cgaagggtgg gcaacaaggt gagaatggcc 300 gacgcccatc cccagcanag ggcaacaaca cggtggaaat tccaaaattc ccgccaacaa 360 aaagggccct tccnncttcc cacnattttg actggtcctg tctgcacctg tatga 415 < 210 > 16 < 211 > 744 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (744) • ---- • - - - - • '- - * - * < 223 > n = A, T, C or G < 400 > 16 AATTCCCGGG tcgacccacg cgtcccgcgg acgcgtgggt ggaatatcac tggagggaac 60 gatctaacct tgacagaggt gaatgctgca gctgaagtaa tctatgatct tgttgaccct 120 ggtgcaaatc tgatttttgg ctctgttata gatccgtcat acactggtca agtgagcata 180 actctaattg caactggttt caaacgccag gaggaaagtg agagccggtc ttcacaggct 240 ggaggagaca agcaaccgcg gtcgctcggc tggttttctc ccacttccca ggaggaaggt 300 aaatcccana catgcattgc gttcctacag aggaaagggc gtccagggtt tcacgagtct 360 gaacacactt tggatcaatg tttttcttgt catagtttgg tacgatgcag gtttggtttc 420 tgggtctctt aggtagcaag tgttcctgaa gtagaacaga cccgcacata ctaatctgtg 480 tgcaaacttc ngccgctgag taccattggc ttgggctgct ngaacctgca ttgcttctca 540 gtgaggtctc aatttgctag ttagtatgat taaaagtnaa gcgctgagac caaattatac 600 gttccgtgtg aatgattact tgctcnctgc cattttcttt tcaaaaaaaa aaaaaaaaaa 660 aaaaaggcgg cgctntanag gatccaagct tacttcccct gcatncgacn canagctntt 720 ntatagngtn acctaaattc AATC 744 < 210 > 17 < 211 > 230 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (230) < 223 > n = A, T, C or G < 400 > 17 ggctgctgag gaatcaagag aaaccatagc cactgccctg agggatr g atcttgtttt 60 cataacagct gggatgnnag ggggtgctgc tccaattgtt gcccagacat caaaggaagc 120 tggttatctt actgttggtg ttgtcaccta tccattcaat ttcgagggcc gtaagcgctc 180 tttacaggca agtatctgag ccccccttca ctcctgaatt agaattcaaa 230 < 21 O > 18 < 211 > 318 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (318) < 223 > n = A, T, C or G < 400 > 18 caggcattgt gtggaatatc actgggggaa ctgacctaac tttgtttgag gtgaatgctg 60 cggccgaaat tatctacgac cttgtcgatc caaatgctaa tctgatattt ggtgccgtca 120 tagacccgtc actgagtggg taacctgata caggtgagca tcaaacggca gctactggct 180 ggatgaacca gaaggccgcg tgtcgaaggg tgggcaacaa agtgagaatg gccgacgccc 240 gagggcagca gtcccccgca gcacggtgga gttccagagt cctgcgacgt agagganctt 300 ctcgcttccc agagttga 318 < 210 > 19 < 211 > 471 < 212 > DNA < 213 > Zea mays < 220 > < 221 > diverse feature < 222 > (1) ... (471) < 223 > n = A.T.C or G < 400 > 19 cgacgcccaa ggtgacgaat gctgtcagcc acgctgtgct acacggggga aacaatgcaa 60 anacattacc tgcctcactc ntgcttgctc ctgtaaatat aatgatngtc gctgctacat 120 natatttact cctgctgctg ttattctgta cttgaggcca gccactacta cgtaaatgaa 180 ctctcacaca gcatgcgccg gccgacgacg tacgtacgtg tattatatac gctctacccc 240 gtgagctttt gttcgagtga tacgtgatcc atccatgcat ggatgcttat gtatgtatat 300 gtgttagtcg tctcagggaa ccgggcanca naagggggtg ttgtattana tttacgtctt '360 ctggtgatta aataanaaag gggtatgttg gatgtgtgca aaaaaaaaaa aaaaanaaaa , 420 aaaaaaaaaa aaaaaaaaag ggcggccgcc gactagtgag ctcgtcgacc c 471 < 210 > 20 < 211 > 1085 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (1085) < 223 > n = A.T.C or G < 400 > 20 aaccctatta cggctcgagg aaattggaga agttctgact cgtggattag gtacgggcgg 60 gaatccactt ttgggggaac aagctgcaga ggaatcaaga gatgctattg ctgatgctct 120 taaaggatca gatttggtgt ttataacggc tgggatgggt gggggaaccg ggtctggtgc 180 tgccccagtt gtagcccaaa tatcaaaaga ggcaggttac ttgactgtag gtgttgttac 240 ctatcccttc agttttgaag gacgtaagag atccttgcag gcctttgaag ccatcgaaag 300 aatgttgaca gctgcagaaa cmmttatagt gawtccmaat gmccgtctgc ttgacawagy 360 tratragcar atgcctcttc aaggatgctt tccgytttgc agatgacgtt ytmsggcaag 420 gagt caggg aatatcagac attatamctg tacctggact tkkcaaatgt ggattttgca 480 gctgtgatga agatgtaaaa aagactctgg gactgcaatg cttggagtag gtgtttccty 540 ccgagcagaa cggtaaaaaa gaagcagccg aacaggctac tttggctcct ttaattggat 600 cctctattca gtcaagctac tggggtagtg tataatatta ctggagggaa aggacataac 660 cctgcaggaa gtgracaggg tttytmaggt g gacyar ttggctgatc cttctgctaa 720 tattatattt ggggctgtcg ttgatgatcg ctacacgggg gagattcacg tgactatcat 780 tgcaactggc ttctcacagt cttttcagaa gaagttgcta gggcttgcaa acagatccaa 840 agctgcttga caaggtgg ct gagggccaag aaagcaaggc agtccctcct cccctcaagt 900 cctcaaacaa ggttgaatct agaccatccc cgcgaaagct ctttttttag ttgcatggtt 960 ctttttaccc tttttcattt ttccaattat tattattata ttatatnggc cgatcaaaaa 1020 aaaaaaaaaa ggcggccgcc gactagtgag ctcgtcgacc cgggaattaa ttccggaccg 1080 gtacc 1085 - ** - »* -. & • > * -.- < 21O > 21 < 211 > 797 < 212 > DNA < 213 > Glycine sp < 400 > 21 ccagctggcg aaaggggatg tgctgcaagg cgattaagtt gggtacgcag ggttttccca '60 gtcacgacgt tgtaaaacga cggcagtgaa ttgaatttag gtgacactat agaagagcta 120 tgcacgcgta tgacgtcgca cgtaagctcg gaattcggct cgagaggcta ctttggctcc 180 tttaattgga tcctctattc agtcagctac tggggtagtg tataatatta ctggaggaaa 240 ggacataacc ctgcaggaag tgaacagggt ttctcaggtt gtgactagtt tggctgatcc 300 ttctgctaat attatatttg gggctgtcgt tgatgatcgc tacactgggg agattcacgt 360 gactatcatt gcaactggct tctcacagtc ttttcagaag aagttgctaa cagatccaag 420 ctgcttgaca ggctgcaaag aggtggctga gggccaagaa agcaaggtag tccctcctcc 480 cctcaagtcc tcaaacaagg ttgaatctag accatccccg cgaaagctct tttttttagt 540 tgcatggttc tttttaccct ttttcatttt tccaattatt attattatat tatattggcc 600 aaaattatta gatcaaaaaa tattatattg taggacacaa tgatcttgat gcttaattaa 660 attctcttga gtgagatatc tgttaaaaaa aaaaaaaaag ggcggccgcc gactagtgag J720 ctcgtcgacc cgggaattaa ttccggaccg gtacctgcag gcgtaccagc tttccctata 780 797 gtgagtcgta ttagagg < 210 > 22 < 211 > 714 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (714) < 223 > n = A.T.C or G < 400 > 22 .a ^^ uau? faith. aattcggctc gagacggctg cgagaagacg acagaagggg gttaccgtta tcatgcaagc 60 tgataatggg gcctctgaag ttcttgttcc gttattataa aactgagtcc ttcactctct 120 ctcgaaccag ctcacagaaa caatgatctc ctacgccgac atgctcaagg gatcacatgg 180 atgtcaacaa cttcaactat cctccattgt cagagatgta aactacagct gtggctcgtg 240 tggttatgag ctgaacttga actccagcaa tgttctctca ccgcaacact ttgactcaaa 300 gtccataaag agaggcatca tctccttctt ctccgtggat gagagcaggt tcactcagat 360 ccagcaactt cactggcctt cttggatgcc ctttttcaac tccaagcgcc aaagaaccaa 420 gcttttttgc cgcagctgtg ggaaccacct tggctatgct tacactttgc ctctcaatct 480 caatcccggg atggcatctc tgatgattca tatcaaacta gaatctatga accgctttgt 540 taccttcttt ctgcgaggaa ccaagtcaaa agttaganga tatgggcaag gtttgagact 600 gcatcttcct ccactcttgg tggtctaatt cttgaaaggg acagaaacat attcatcagt 660 tcttggttgg ttggaatgng aattaatgna ttctaccttt tgacattatg AAGG 714 < 210 > 23 < 211 > 525 < 212 > DNA < 213 > Glycine sp < 400 > 2. 3 cgggctcgag attactggag gaaaggacat aaccctgcag gggtttctca gaagtgaaca 60 ggttgtgact agtttggctg atccttctgc taatattata tttggggctg tcgttgatga 120 tcgctacact ggggagattc acgtgactat cattgcaact ggcttctcac agtcttttca 180 gaagaagttg ctaacagatc caagggctgc aaagctgctt gacaaggtgg ctgagggcca 240 agaaagcaag gtagtccctc ctcccctcaa gtcctcaaac aaggttgaat ctagaccatc 300 cccgcgaaag ctcttttttt agttgcatgg ttctttttac cctttttcat ttttccaatt 360 attattatta tattatattg aaaaaaatta gccgatcaaa ttatattata ttgtaggaca 420 caatgatctt gatgcttaat taagtgagat atcattctct tgatgttctt tcccctccaa 480 aaaaaaaaaa aaagggcggc cgccgactag tgagctcgtc gaccc 525 < 210 > 24 < 211 > 1083 < 212 > DNA < 213 > Glycine sp < 400 > 24 aaccctatta cggctcgagg aaattggaga agttctgact cgtggattag gtacgggcgg 60 gaatccactt ttgggggaac aagctgcaga ggaatcaaga gatgctattg ctgatgctct 120 taaaggatca gatttggtgt ttataacggc tgggatgggt gggggaaccg ggtctggtgc 180 tgccccagtt gtagcccaaa tatcaaaaga ggcaggttac ttgactgtag gtgttgttac 240 ctatcccttc agttttgaag gacgtaagag atccttgcag gcctttgaag ccatcgaaag 300 aatgttgaca gctgcagaaa cacttatagt gattccaaat gaccgtctgc ttgacatagc 360 tgatgagcag atgcctcttc aggatgcttt tccgtcttgc agatgacgtt ctacggcaag 420 gagtacaggg aatatcagac attatamctg wcctggactt gtcaatgtgg atttttgcag 480 tgtgatgaaa atgtaaaagc gactctggga ctgcaatgct tggagtaggt gtttcctccg 540 gtaaaaaccg agcagaagaa gcagccsaac aggctacttt ggctycttta attggatcct 600 ctatttcagt cagctactgg gggtagtgta taatattact ggaggaaagg acataaccct 660 scaggaagtg aacagggktt ctcaggttgt gactaagttt ggctgatcct tctgctaata 720 ttatatttgg ggctgtcgtt gatgatcgct acacggggga gattcacgtg actatcattg 780 caactggctt ctcacagtct tttcagaaga agttgctaac agatccaagg gctgcaaagc 840 tgcttgacaa ggtggc tgag ggccaagaaa gcaaggcagt ccctcctccc ctcaagtcct 900 caaacaaggt tgaatctaga ccatccccgc gaaagctctt tttttagttg catggttctt 960 tttacccttt ttcatttttc caattattat tattatatta tattggccga tcaaaaaaaa í020 aaaaaaaggg cggccgccga ctagtgagct cgtcgacccg ggaattaatt ccggaccggt 1080 acc 1083 < 210 > 25 < 211 > 1335 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (1335) < 223 > n = A, T, C or G < 400 > 25 cggctcgagg cccagaacaa caaaaattgc tcctcaacgc ctaagtcgtc gtttcggttc 60 ggtgagatgc tcctacgctt acgtagataa cgccaaaatt aaggttgtcg gcatcggcgg 120 tggcggcaac aatgccgtta atcgcatgat cggaagtggt ttgcagggtg tagacttcta 180 tgcgataaat accgatgctc aggcactatt aaattctgct gctgagaacc ctattaaaat 240 tggagaagtt ctgactcgtg gattaggtac aggtgggaat ccacttttgg gggaacaagc 300 tgcggaggaa tccagagatg ctattgctga tgctcttaaa ggatcagatt tggtatttat 360 aacggctggg atgggtgggg gaaccgggtc ttggtgctgc cccagttgta gnccaaatat 420 caaaagaggc aggntacttt gactgtaggt gttggtacct atcccttcag ttttgaagga 480 cgtaagagat gcttgcaggc ctttgaagcc atcgaaaggc tgcagaaaaa tgttgcacac 540 ttatagttat tccaaatgat cgtctgcttg acatancttg tgcctattca atgaaccaga '600 aggatgcttt ycgytytkca rawkatgtty tamcgsaarg sgkacaggga atatcaagac 0.660 attwtaacag gtacctggac ttgtmaatgt agattttgct gatgtaaaam ctgkgataaa 1720 gacttctggg actgcaatgc ttggtgtagg tgtttcatcc ggtaaaaccg accagaagaa 780 gcagcagaac agggctactt tggctccttt aattggatca tctattcagt cagctactgg840 ggtagtgtat aatattactg gaggaaagga cataaccctg caggaagtga acagggtttc 900 tcaggtggtg actagtttgg ctgatccttc tgctaatatt atatttggag cttgttgttg 960 atgatcgctt acactgggga gattcacgtg actataattg caactggctt ctcacagtct 1020 tttcagaaga agttgctaac agatccaagg gctgcaaagc tgcttgacaa agtggctgag 1 | 080 ggccaagaaa gcaaggcagt ccctcctccc cccaagtcct caatcaaggt tgaatctaga 1 | 140 ccatccccgc gaaagctctt tttgtagttg catggttctt ttaccctttt cttttttcca 11200 attattatat tgtaagtcat tctgtagtac aatgatcttg atgcttaatt tagtgagata l'260 tcattctctt gatgttaaaa aaaaaaaaaa aaaaaaaaaa aaagggcggc cgccgactag 1320 tgagctcgtc gaccc 1335 < 210 > 26 < 211 > 902 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (902) < 223 > n = A, T, C or G < 400 > 26 II aattcggctc gagtaccagg gttggtgaat gtagattttg ctgatgttcg ggctataatg, 60 gccaatgcag gttcttcact ggaactgcaa aatggggata ctggaaaatc aagggcaaga 120 gatgctgcat taaatgccat ccagtcacct ttactggata ttggtatara gagggctact 180 kgaattgttt ggaacawaac tggtgggact gatctgrcct tgtttgaggt aaacacggca 240 gcagaggtta tttatgacct cgtggaccct actgctaatt taatatttgg agcagtaata 300 gatccatcac tcagtggtca agtgagcata acattaattg cttactgrat tcaaagcgyc 360 aagaggagag tgaagggagg cctctgcagg ccagtcaact cactcaagca gacacaacct 420 tcggcaccaa ttggcggtct tcctctttca ctgatggtgg tttgtttgag ataccagaat 480 tcctaaagaa garaggaggt tcacgctatc atctttttca cgagggcgta tcctaatttc 540 ttttgatccc ttgcatttct tcacccttgg atatacatag caattggtct agttcttarg 600 tccctgtctt gscctttttc ggatttwrkc aaragttgkg katacagttk gttcatgaaa 660 ^^^^ gtttattact tyccactgkc cagacttatg ggkctaaacc gganggtatt ksarcatgga i 720 tgcttttctt ggcatatttg aattagttta ttagcttgta cagagatttc agtaatgctg 780 agagcttgtt atagttcttt ggcatgttat agaaaattca ttattattaa aaaaaaaaaa 840 aaaggcggcc gccgactagt gagctcgtcg acccgggaat tnattccgga ccggtacctg ca 900 902 < 210 > 27 < 211 > 856 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (856) < 223 > n = A, T, C or G < 400 > 27 aattcggctc gagattggtg aaccgtagac tttgctgatg ttcgagctat aatggccaat 60 gcagggtctt cacttatggg gataggaact gcaactggga aaacaagggc marggawgct 120 gcattaaatg ctatccagtc mccctttact ggatatttgg tataraaagg gctactggaa 180 ttgtatggaa cataacyggk ggaagtgatt tgaccttgtt tgaaggtaaa tgttgcasca 240 raagttatat atgmccttgt ggmccccact gstaatttaa tatttgggsc agwaatagat 300 ccatcactcc agtgggcaag taagcatamm wtaatcgcaa ctggattcaa gcgtcaagag 360 gaaaagtgaa gggagaccct atgcaggcca gtcaactcac acaaggagat nccgttggta 420 tcaatcggcg atyttctact ttcactgatg gtagcttttg ttggagatcc ctggaattct 480 ggggcgctca taaagaagaa gagtttaata cgttatccaa caactcctta ctcttttccc 540 atccctcctt gcatctcttt mccaascaat ttttagggat acaaatctca tcagtctaag 600 gtattagatc acggtttttg cccctttttt catttttagg ttcgcattgt gcantamagt 660 tgttcattga aagcgaagtt actttccaaa accgttgttt tctgarttga aggcttggtt 720 wataagttta ggcatgtttt ttagcttgta tttttgtnca gagaataata tatcagtaat 780 ggtcagtgct tgttataaan aaaaaaaaaa ccncnaaaaa ccgccgacta aaaagggcgg 840 ' gtgagctcgt cgaccc, 856 < 211 > 1060 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (1060) < 223 > n = A, T, C or G < 400 > 28 ( aattcggctc gaggtcacaa cccctttttc atttgaaggg cgaagaaggg cagttcaagc 60 attgctgcat acaagaagga tgttgataca taagagataa ttccaaatga ctgatagtta 120 caaactgctg actgcagttt ctcaatctac ccctgtaact atctggctga gaagcattca 180 tgatattctt agacaaggtg ttcgtggtat atctgatatt attacgatac caggattggt 240 gaatgtagac tttgcagatg ttcgagctat aatggccaat gcaggttctt cacttatggg 3?) 0 gataggaact gcaactggca aaacaagggc aagagacgct gcattaaatg ctatccagtc 360 gatattggta acctttacta tagaaagggc taccggaatt gtatggaaca taactggtgg 420 aaagwgattt gaccttgttt gaggtaaatg ctgcagcaga agttatatat gaccttgtgg 4? 0 accccactgy taatttaata tttggagcag taatagatcc atcactcagt ggtcaagtaa 540 gcatcacatt aattgcaact ggattcaagc cgtcaagagg aaaagtgaag ggagacctat 600 acaggccarc caatttacac aaggagatac ggttggtatc aaccsgcgat cttcctcttt 660 cactgatggk agctttgttg agayccctga attcttaaag aaraaggggc gctcaygtta 720 tccgagagct taatactctt ctccccaatt tcttaatccc ttgatttctt tacaaagtaa 780 tttttaggga tacaaatctc atcagtctag gtattagatc ccgttttgcc cctttttttt 840 ttcatt ttta ggttcgcatt gggcatactg ttgttcaaga aagcaaagta ctttcaaaac 900 cgttgtttac tgagtcgagg cttgttggca ggttttaata agtttattag cttgtatttt 96 | 0 ttgtacagag aatatatcag taatggtcag ggcttgttat nnnanncccn nnnannaaan 1020 aaaaaaaaag gcggccgccg actagtgagc tcgtcgaccc 1060 < 210 > 29 < 211 > 727 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (727) < 223 > n = A, T, C or G HHÉÑ-ÉIÍ MÜ- < 400 > 29 atctcncaaa atgcatgncn ctgtgtgtgg catatattca aaatgacttg gcccagggtg 60 gggttttant ttgctcttag aaaatgtgtt gagcctgcac atanaagatt ggagttgttg 120 attctcagtg gattgttcac caaggtattc cctcactagg gaatcagggt gantctcaaa 180 caggaaagcn ccatggcagg ggntgaggga ncggtgtana aaggagtggc catgttccag 240 agtcggtggc aaatgctgaa tacgcgtatc acaactccat tggaattgat acatctaatt 300 ccactgctca ttaggtgact tcggcctaag ttgacttgta aacatattgt tactaccctt '360 agccttacgc gtagaatttt cccttaaaaa ttcctatgta aaaaaatata acgttacgta 420 aatcacaata catgcaatgc tagagtccta gctagggacc aaacatcatt tcgatgtaga '480 cttaacagtg aattgctgta agtaaatcta gtgaagagaa tgctaacgaa ttattattgc, 540 ggaaatggaa ggtgcttata atgctagtga atccttaaat tggaggctga caacgaagtt 600 tttgggatta ctttagggtt aagaaaacga aatgtcataa ttatcatacc cttgggatga 660 ggagacagga ctattactat aaaaaaaaaa aaaaagggcg gccgccgact agtgagctcg tcgaccc 720, 727 < 210 > 30 < 211 > 1185 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (1185) < 223 > n = A.T.C or G < 400 > 30 cggctcgagc tggaatgggt gggggaactg gcacaggtgg agctccaatt attgctagta, 60 aatgggtata ttgcaaagtc ttgacggttg gtattgtcac cacccctttc tcgtttgaag 120 ggagaaagag atctattcaa gcccaagaag gaattacagc cttaagagat aatgttgaca 180 cgcttatagt tattccaaat gacaagctac taacggcagt ttctcaatct acccctgtaa 240 ctgaagcatt caatctggct gatgatattc ttcgacaggg tgttcgtggc atatctgata 300 ttattacaat accagggttg gtgaatgtag attttgctga tgttcgggct ataatggcca 360 atgcaggttc ttcactaatg gggataggaa ctgcaactgg aaaatcaagg gcaagagatg 420 ctgcattaaa tgccatccag tcaccwttmc tggatattgg tatagararg gctactggaa 480 ttgtttggaa cawaactggk gggactgatc ttgaccttgt ttgaggtaaa cacggcarca 540 rraggttatt tatgacctcg tggaccctac tgctaattta atatttggag cagtaataga 600 tccatcactc agtggkcaag tgagcataac attaattgct actggattca agcgtcaaga 660 • - ' "- *' - 'ggarartgaa rggaggcctn tgcaggccag tcaactcact caagcagaca caaccttcgg 720 caccaattgg cggtcttcct ctttcactga tggtggtttg tttgagatac cagaattcct 780 aaagaagaga ggaggttcac gctatccgag ggcgtaatct ttttcatcct aatttctttg 840 atcccttgca tttcttcacc cttggatata catagcattg gtctagttct taggtccctg T00 tcttgccctt tttcggattt tagtcagagt tgtgtataca gtttgttcat gaaagtttat' 960 tacttcccac tgtccagact tatgggtcta accggaggta ttgcagcatg gatgcttttc 1I020 ttggcatatt tgaattagtt tattagcttg tacagagatt tcagtaatgc tgagagcttg 1 080 ttatagttct ttggcatgtt atagaaaatt cattattatt attcatcccn ccaaaaaaaa 1,140 aaaaaaaaaa aaagggcggc cgccgactag tgagctcgtc gaccc 1185 < 210 > 31 < 211 > 700 < 212 > DNA < 213 > Glycine sp < 220 > < 221 > diverse feature < 222 > (1) ... (700) < 223 > n = A, T, C or G < 400 > 31 gagattgtca aattcggctc ctcgtttgaa ccaccccttt gatctattca gggagaaaga 60 agcccaagaa ggaattacag ccttaagaga taatgttgac acgcttatag ttattccaaa 120 tgacaagcta ctaacggcag tttctcaatc tacccctgta actgaagcat tcaatctggc 180 tgatgatatt cttcgacagg gtggtccgtg gcatatctga tattattaca ataccagggt 240 tggtgaatgt agattttgct gatgttcggg ctataatggc caatgcaggt tcttcactaa 300 tggggatagg aactgcaact ggaaaatcaa gggcaagaga tgctgcatta aatgccatcc 360 agtcaccttt actggatatt ggtatagaga gggctactgg aattgtttgg aacataactg 420 gtgggactga ttgaggtaaa tctgccttgt cacngcagca ganggtattt atgacctcgn 480 ggccctactg ctaattaata tttggagcag aatagatcca tcctcatggc aagtgacata 540 tctggattca cattnantgc agcgtcaaga ngagaagtga ttgcaggcca agggangcct 600 agcagacaca gcactcactc accttngnac caattggcgg cttcctcttt cactgatggg 660 nggttggttg agatncnana attcctaaag aaaaanagag 700 < 210 > 32 < 211 > 1425 < 212 > DNA: 213 > Arabidopsis sp < 400 > 32 ccacgcgtcc ggaggaagta aacaatggcg ataattccgt tagcacagct taatgagcta '60 acgatttctt catcttcttc ttcgtttctt accaaatcga tatcttctca ttcgttgcat 0.20 agtagctgca tttgcgcaag ttctagaatc agtcaattcc gtggcggctt ctctaaacga 180 agaagcgatt caacaaggtc taagtcgatg cgattgaggt gttccttctc tccgatggaa 240 tctgcgagaa ttaaggtgat tggtgtcggt ggtggtggta acaatgccgt taaccggatg 300 atttcaagcg gtttacagag tgttgatttc tatgcgataa acacggattc gcaagctctg 360 ttacagtttt ctgctgagaa cccacttcaa attggagaac ttttaactcg tgggcttggc ^ 20 actggtggaa acccgcttct tggagaacaa gctgcagaag aatcaaaaga tgcaattgct 480 aaggatcaga aatgctctta ccttgttttc ataactgctg gtatgggtgg tggaacaggg 540 tctggtgctg cacctgtggt agctcagatt tcgaaggatg ctggttattt gactgttggt | S00 gttgttacct atccgtttag ctttgaagga cgtaaaagat ctttgcaggc actggaagct 660 attgaaaagc tccaaaagaa tgttgatacc cttatcgtga ttccaaatga tcgtctgcta 720 gatattgctg atgaacagac gccacttcag gacgcgtttc ttcttgcaga tgatgtttta 780 cgccaaggag tacaaggaat ctcagatatt attactatac ctggactagt caatgtggat 840 tttgcagatg tgaaggcagt catgaaagat tctggaactg caatgctcgg ggtaggtgtt 9 | 00 tcttccagca aaaaccgggc agaagaagca gctgaacaag caactttggc tccattgatc 960 ggatcatcca tacaatcagc tactggtgtc gtctacaaca tcactggtgg aaaagacata 1020 actttgcagg aagtgaaccg agtatcacag gtcgtgacaa gtttggcaga cccatcggcc 1080 aacatcatat ttggagctgt tgtggatgat cgctacaccg gagagattca tgtaacgata 1140 atcgccacag gcttctctca gtcattccag aagacacttc tgactgatcc aagagcagct 1200 aaactccttg acaaaatggg atcatcaggt caacaagaga acaaaggaat gtctctgcct 1260 caccagaagc agtctccatc aactatctct accaaatcgt cttctccccg tagacttttc 1320 ttctagtttt ctttttttcc ttttcggttt caagcatcaa aaatgtaacg atcttcaggc 1380 tcaaatatca attacatttg attttcctcc aaaaaaaaaa aaaaa 1425 1 < 210 > 33 < 211 > 1611 1 < 212 > DNA < 213 > Arabidopsis sp < 400 > 33 tgttgttgcc gctcagaaat ctgaatcttc tccaatcaga aactctccac ggcattacca 60 aagccaagct caagatcctt tcttgaacct tcacccggaa atatctatgc ttagaggtga 120 acaatagtca agggactagt atccaagaaa ggaaacgtct tctggacctg ttgtcgagga 180 ttttgaagag ccatctgctc cgagtaacta caatgaggcg aggattaagg ttattggtgt 240 gggaggtggt ggatcaaatg ctgtgaatcg tatgatagag agtgaaatgt caggtgtgga 300 gttctggatt gtcaacactg atatccaggc tatgagaatg tctcctgttt tgcctgataa 360 taggttacaa attggtaagg agttgactag gggtttaggt gctggaggaa atccagaaat, 420 cggtatgaat gctgctagag agagcaaaga agttattgaa gaagctcttt atggctcaga 480 tatggtcttt gtcacagctg gaatgggcgg tggaactggc actggtgcag cccctgtaat 540 tgcaggaatt gccaaggcga tgggtatatt gacagttggt attgccacaa cgcctttctc 600 gtttgagggt cgaagaagaa ctgttcaggc tcaagaaggg cttgcatctc tcagagacaa 660 ctcatcgtca tgttgacact ttccaaatga caagttgctt acagctgtct ctcagtctac 720 gaagcattta tccggtaaca atctagctga tgatatactc cgtcaggggg ttcgtgggat neo atctgatatc attacgattc ctggtttggt gaatgtggat tttgctgatg tgagagctat 840 aatggcaaat gc ggggtctt cattgatggg aataggaact gcgacaggaa agagtcgggc 900 aagagatgct gcgctaaatg caatccaatc ccctttgtta gatattggga ttgagagagc .960 cactggaatt gtttggaaca ttactggcgg aagtgacttg acattgtttg aggtaaatgc 1¡020 tgctgcggaa gtaatatatg atcttgtcga tccaactgcc aatcttatat tcgtgctgtt 1080 gtagatccag ccctcagcgg tcaagtaagc ataaccctga tagctacggg tttcaaacga 1140 caagaagagg gagaaggacg aacagttcag atggtacaag cagatgctgc gtcagttgga 1200 gaccctcttc gctacaagaa ttcctttaga gaaagcggtt cagtggagat cccagagttc 1.260 ttgaagaaga aaggcagctc tcgttatccc cgagtctaaa gcccaatcta atcactaccc l '| 320 tgcacactgc agcaataaca aacgtgtgtg tactggtagt ctggtactgc cttctgggat 1380 acagc ^ * at gtgttgatgt atgatcaaga atctgtgtgg gtgtgtatat gttctgtcac 1440 tgcct ^. ggt cgtgttcttg aataggttgt tttagaaatc ggagtttctc tctatgtcac 1500 ttccaaaaca aaaaaggaga agaagaatca cacttctcga accataaaca tacttataag 1560 attatgagag ttttagcaga aattattgtc aaaaaaaaaa aaaaaaaaaa to 1611 < 210 > 34 < 211 > 299 < 212 > DNA < 213 > Arabidopsis sp < 220 > < 221 > diverse feature < 222 > (1) ... (299) < 223 > n = A, T, C or G < 400 > 3. 4 agtaattgaa aaatgacaca tacctctttt aagtttataa nctacaatca ctaagaagaa 60 agtaataata caaatgcaat aagatttgag gacatactgt gacaaagacc atatctgagc 120 cataaagagc ttctncaata actgctttgc tctctctagc agcattcata ccgatttcng 180 gatttcctcc agcacctaaa cccctagtca actccttacc aatttgtaac ctattatcag 240 gcaaaacagg agacattctc atagcctgga tatcagtgtt gacaatccag aactccaca 2199 < 210 > 35 < 211 > 25 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 35 cttgccgcaa aacatcatcc gcgag 25 < 210 > 36 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 36 cacccacccc gagcatcgca gttccgga i 28 < 210 > 37 < 211 > 41 < 212 > DNA _É-i-i-jÉ (i-i-? Fc_ -jj ^^ i <213> Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 37 ttggtgtcgg tggtggtggt aacaatgccg ttaaccggat g 41 < 210 > 38 < 211 > 41 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 38 ggtaacaatg ccgttaaccg gatgatttca agcggtttac a 41 < 210 > 39 < 211 > 41 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 39 gctgctcttg gatcagtcag aagtgtcttc tggaatgact g 41 < 210 > 40 < 211 > 39 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 40 tttgtcaagg agtttagctg ctcttggatc agtcagaag 39 < 210 > 41 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 41 cagcaccaga tcctgtacct ccacccat '28 < 210 > 42 < 211 > 30 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 42 ctgaatgggt atgtgacaac accaacagtc 30 < 210 > 43 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 43 gctgatgatg tattacgcca aggtgtcc 28 < 210 > 44 < 211 > 28 ^ -. «M», ^ < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 44 ctggaactgc tatgcttgga gttggggt 28 < 210 > 45 < 211 > 34 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 45 tcgaaactga atggataggt gacaacacca acag 34 < 210 > 46 < 211 > 36 < 212 > DNA < 213 > Artificial sequence < 220 > ! < 223 > Synthetic oligonucleotide < 400 > 46 tggatcgaca aggtcgtaga taatttcggc cgcagc 36 < 210 > 47 < 211 > 56 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 47 cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaaat 56 < 210 > 48 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 48 tcgaggatcc gcggccgcaa gcttcctgca gg 32 < 210 > 49 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 49 tcgacctgca ggaagcttgc ggccgcggat ce 32 < 210 > 50 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 50 tcgacctgca ggaagcttgc ggccgcggat ce 32 < 210 > 51 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 51 tcgaggatcc gcggccgcaa gcttcctgca gg 32 < 210 > 52 < 211 > 36 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 52 tcgaggatcc gcggccgcaa gcttcctgca ggagct 36 < 210 > 53 i < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 53 cctgcaggaa gcttgcggcc gcggatcc 28 < 210 > 54 < 211 > 36 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 54 tcgacctgca ggaagcttgc ggccgcggat ccagct 36 < 210 > 55 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 55 ggatccgcgg ccgcaagctt cctgcagg 28 < 210 > 56 < 211 > 10 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > brand c-myc < 400 > 56 Glu Gln Lys Leu He Ser Glu Glu Asp Leu 1 5 10 < 210 > 57 < 211 > 37 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 57 acgtgcggcc gcatggcgat aattccgtta gcacagc 37 < 210 > 58 < 211 > 37 < 212 > DNA I ^^ MÉI < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 58 actgataagc ttttgctcga agaaaagtct acgggga 37 < 210 > 59 < 211 > 37 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 59 acgtgcggcc gcatggcgat aattccgtta gcacagc 37 < 210 > 60 < 211 > 44 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide • ÉatattiM j < 400 > 60 cgtcctgcag gctacaagtc ttcctcactg ataagctttt gctc 44 < 210 > 61 < 211 > 37 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 61 acgtcctgca ggatggcgat aattccgtta gcacagc 37 < 210 > 62 < 211 > 38 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 62 acgtgcggcc gcctagaaga aaagtctacg gggagaag 38 < 210 > 63 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 63 acgtaagctt tccttctctc cgatggagtc tg 32 < 210 > 64 < 211 > 33 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 64 acgtctgcag cttttcaatg gcttcaagtg cct 33 < 210 > 65 < 211 > 34 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 65 acgtctgcag aagaacgtgg ataccctcat cgtg 34 < 210 > 66 < 211 > 38 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 66 acgtgcggcc gcctagaaga acaatctacg gggagaag 38 < 210 > 67 < 211 > 244 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Prrn / NEP / Geni O / Amino Acid 14 Guiding Sequence of the GFP < 400 > 67 gaattcggta cccccgtcgt tcaatgagaa tggataagag gctcgtggga ttgacgtgag 60 ggggcaggga tggctatatt tctgggagcg aactccgggc gaatactgaa gcgcttggat 120 cttggaagga acaagttatc aagacaattc cggatcctct agaaataatt ttgtttaact 180 ttaagaagga gatataccca tgggtaaagg agaagaactt ttcactggag ttgtcccaag tasting 240 244 < 210 > 68 < 211 > 32 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 68 gtcctgcagg atggccacca tctcaaaccc ag 32 < 210 > 69 < 211 > 37 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synthetic oligonucleotide < 400 > 69 tagcggccgc ctatataaag gagctaaaag aacagcc 37 < 210 > 70 < 211 > 669 < 212 > DNA < 213 > Arabidopsis sp < 400 > 70 atggcgatta gtccgttggc acagcttaac gagctaccag tctcttcctc gtttsttgcg 60 acatcccact cgctgcacag taccagaatc agtggcgggc ttctcaaaac aaaggtttaa 120 gcaaacacgg ttgagatgct ccttctctcc gatggagtct gcgaggatta aggtggttgg 180 tgtcggcggt ggtggtaaca atgccgtcaa tcgcatgatt tccagcggct tacagagtgt 240 gcgataaaca tgatttctat cggactctca agctctcttg cagtcttctg cgcagaaccc 300 tcttcaaatt ggagagctcc taactcgtgg ccttgggact ggtgggaacc cgcttctagg 360 agaacaagct gctgaggaat ctaaagacgc gattgctaat gctcttaaag gatctgacct 420 tgytttcatt actgctggta tgggtggtgg cactggctcc ggtgctgctc ctgttgttgc 480 tcagatctcc aaagacgctg gttatttgac cgttggtgtt gttacctatc ccttcagctt 540 cgaaggtcgt aaaagatctt tgcaggcact tgaagccatt gaaaagctgc agaakaacgt 600 ggataccctc atcgtgatac caaatgatcg tctcctagat attgctgatg aacagacgcc tcttcaaga 660 669 < 21O > 71 < 211 > 646 < 212 > DNA < 213 > Nicotiana sp < 400 > 71 ggccctctag atgcatgctc gagcggccgc cagtgtgatg gatatctgca gaattcgccc 60 ttaagcagtg gtaacaacgc agagtacgcg ggggtaaacc aaacagacag agagagcaga 120 aacagcaatg gccaccatct caaacccagc agagatagca gcttcttctc cttcctttgc 180 tttttaccac tcttccttta ttcctaaaca atgctgcttc accaaagctc gccggaaaag 240 cttatgtaaa cctcaacgtt tcagcatttc aagttcattt actccttttg attctgctaa 300 gattaaggtt atcggcgtcg gtggcggtgg taacaatgcc gttaaccgta tgattggcag 360 tggcttacag ggtgttgact tctatgctat aaacacggat gctcaagcac tgctgcagtc 420 tgctgctgaa aatcatcttc aaattggaga gcttctgact cgtgggcttg gtactggtgg 480 caatcctctt ttaggggaac aggcagcaga ggagtcgaag gaagccattg caaattctct 540 aaaaggttca gatatggtgt tcataacagc aggaatgggt ggaggtacag gatctggtgc 600 tgaagggcga attccagcac actggcggcc gttactagtg gatccg 646 < 210 > 72 • - '"* ° * • íi -" l < 211 > 325 < 212 > PRT < 213 > Glycine sp < 400 > 72 Gly Ser Arg Pro Arg Thr Thr Lys He Wing Pro Gln Arg Leu Ser Arg 1 5 10 15 Arg Phe Gly Ser Val Arg Cys Ser Tyr Ala Tyr Val Asp Asn Ala Lys1 25 30; He Lys Val Val Gly He Gly Gly Gly Gly Asn Asn Wing Val Asn Arg 35 40 45 Met He Gly Ser Gly Leu Gln Gly Val Asp Phe Tyr Wing He Asn Thr 50 55 60 Asp Ala Gln Ala Leu Leu Asn Ser Ala Ala Glu Asn Pro He Lys He, 65 70 75 80 'Gly Glu Val Leu Thr Arg Gly Leu Gly Thr Gly Gly Asn Pro Leu Leu 85 90 95 Gly Glu Gln Ala Wing Glu Glu Ser Arg Asp Wing He Wing Asp Ala Leu 100 105 110 Lys Gly Ser Asp Leu Val Phe He Thr Wing Gly Met Gly Gly Gly Thr 115 120 125 Gly Ser Gly Wing Wing Pro Val Val Wing Gln He Ser Lys Glu Wing Gly 130 135 140 Tyr Leu Thr Val Gly Val Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg 145 150 155 160 (Lys Arg Ser Leu Gln Wing Phe Glu Wing He Glu Arg Leu Gln Lys Asn 165 170 175 Val Asp Thr Leu He Val He Pro As Asp Arg Leu Leu Asp He Ala 180 185 190 Asp Glu Gln Met Pro Leu Gln Asp Wing Phe Pro Phe Wing Asp Asp Val 195 200 205 Leu Arg Gln Gly Val Gln Gly He Ser Asp He He Thr Val Pro Gly 210 215 220 Leu Val Asn Val Asp Phe Wing Asp Val Lys Ala Val Met Lys Asp Ser 225 230 235 240 Gly Thr Ala Met Leu Gly Val Gly Val Ser Ser Gly Lys Asn Arg Ala 245 250 255 Glu Glu Wing Wing Glu Gln Wing Thr Leu Wing Pro Leu He Gly Being 260 265 270 He Gln Ser Wing Thr Gly Val Val Tyr Asn He Thr Gly Gly Lys Asp 275 280 285 He Thr Leu Gln Glu Val Asn Arg Val Ser Gln Val Val Thr Ser Leu '290 295 300 Wing Asp Pro Ser Wing Asn He He Phe Gly Ala Val Val Asp Asp Arg 305 310 315 320 Tyr Thr Gly Glu He 325 < 210 > 73 < 211 > 357 < 212 > PRT < 213 > Zea mays < 220 > < 221 > VARIANT < 222 > (1) ... (357) < 223 > Xaa = Any amino acid < 400 > 73 Asp Leu Val Phe He Thr Wing Gly Met Gly Gly Gly Thr Gly Ser Gly 1 5 10 15 Ala Ala Pro Val Val Ala Gln He Ser Lys Glu Ala Gly Tyr Leu Thr 25 30 Val Gly Val Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser 40 45 Val Gln Ala Leu Glu Ala Leu Glu Lys Leu Glu Lys Ser Val Asp Thr 50 55 60 Leu He Val He Pro Asn Asp Lys Leu Leu Asp Val Wing Asp Glu Asn 65 70 75 80 Met Pro Leu Gln Asp Wing Phe Leu Leu Wing Asp Asp Val Leu Arg Gln 85 90 95 Gly Val Gln Gly He Ser Asp He He Thr He Pro Gly Leu Val Asn 100 105 110 Val Asp Phe Wing Asp Val Lys Wing Val Met Lys Asn Ser Gly Thr Wing 115 120 125 Met Leu Gly Val Gly Val Being Ser Lys Asn Arg Wing Gln Glu Wing 130 135 140 Wing Glu Gln Wing Thr Leu Wing Pro Leu He Gly Being Ser He Glu Wing 145 150 155 160 Wing Thr Gly Val Val Tyr Asn He Thr Gly Gly Lys Asp He Thr Leu '165 170 175 Gln Glu Val Asn Lys Val Ser Gln He Val Thr Ser Leu Ala Asp Pro; 180 185 190 Be Wing Asn He He Phe Gly Wing Val Val Asp Asp Arg Tyr Thr Gly '195 200 205 Glu He His Val Thr He He Wing Thr Gly Phe Pro Gln Ser Phe Gln 210 215 220 Lys Ser Leu Leu Wing Asp Pro Lys Gly Ala Arg He Val Glu Ser Lys 225 230 235 240 Glu Lys Ala Ala Thr Leu Ala His Lys Ala Ala Ala Ala Ala Ala Gln 245 250 255 Pro Val Pro Wing Ser Wing Trp Ser Arg Arg Leu Phe Ser Xaa Glu Wing 260 265 270 His Leu Val Asn Arg Asp Ser Xaa Cys He Arg Phe Wing Phe Ser Val 275 280 285 Leu Arg Wing Val Pro Lys Val He Phe Gly Tyr Leu Glu He Tyr Sen 290 295 300 Leu Gly Xaa Cys Ser Val Val Val Glu Xaa Val Ser Val Tyr Val Ser 305 310 315 320 Leu Leu Cys Phe Met Phe Leu Arg He Xaa Arg Xaa Gly Xaa Glu Lys 325 330 335 Cys Ser Ala Thr Gln His Xaa Thr Val Xaa Lys He Phe Asp Cys Phe 340 345 350 He Ala Ala Thr Cys 355

Claims (30)

NOVELTY OF THE INVENTION CLAIMS

1. - A method for the transformation of plastids of a plant cell, characterized in that it comprises the steps of introducing into the cells of a plant, a construct comprising a funpional promoter in plastids of a plant cell operably associated with a DNA sequence of interest, and transforming said plastids from the plant cell with said construction, wherein the improvement comprises introducing said construction into a plant cell having an altered morphology in its plastids selected from the group consisting of altered size of plastids and altered number of plastids in said cell vegetable.

2. The method according to claim 1, further characterized in that said plastid size is increased from a plastid morphology of wild-type plants.

3. The method according to claim 2, further characterized in that said number of plastids is decreased from a plastid morphology of wild-type plants.

4. The method according to claim 1, further characterized in that said plastid size is decreased from a plastid morphology of wild type plants.

5. - The method according to claim 4, further characterized in that said number of plastids is increased from a plastid morphology of wild-type plants.

6. The method according to claim 2, further characterized in that said plant cell is obtained from a source of plant tissue in which the division of the plastids is inhibited.

7- The method according to claim 6, further characterized in that said division of the plastids is inhibited by the introduction, in the cells of the plant tissue source, of a second DNA construct comprising in the direction of transcription 5 '. at 3 ', a functional promoter in a plant cell, a DNA sequence coding for a gene involved in the cell division of the plastids and a functional transcription termination sequence in a plant cell.

8. The method according to claim 7, further characterized in that said DNA sequence is in an antisense orientation.

9. The method according to claim 8, further characterized in that said construct contains a DNA sequence encoding an FtsZ protein.

10. The method according to claim 7, further characterized in that said DNA sequence is in a sense orientation. í fOrtil r-i: tf.

11. - The method according to claim 10, further characterized in that said DNA sequence provides sense suppression.

12. The method according to claim 6, further characterized in that said division of the plastids is inhibited by developing a plant under culture conditions that inhibit the division of the plastids of the plant cell.

13. The method according to claim 12, further characterized in that said culture conditions comprise developing the source of plant tissue under exposure to an inhibitor of bacterial cell division.

14. The method according to claim 13, further characterized in that said inhibitor is 5,5'-bis- (8-anilino-1-naphthalenesulfonate).

15. The method according to claim 6, further characterized in that said division of the plastids is inhibited by genetic mutagenesis.

16.- An isolated DNA sequence that codes for an FtsZ protein from Arabidopsis thaliana plants.

17. The DNA sequence according to claim 16, further characterized in that said FtsZ protein is encoded by a sequence that includes a sequence selected from the group consisting of SEQ ID NOS: 1 and 3. .-JJg-O. *

18. - An isolated DNA sequence that codes for a FtsZ protein from Brassica plants.

19. The DNA sequence according to claim 18, further characterized in that said FtsZ protein is encoded by a sequence of SEQ ID NO: 5.

20. An isolated DNA sequence encoding an FtsZ protein from soybean plants.

21. The DNA sequence according to claim 20, further characterized in that said FtsZ protein is encoded by a sequence that includes a sequence selected from the group consisting of SEQ ID NOS: 20-31.

22. An isolated DNA sequence that codes for an FtsZ protein from corn plants.

23. The DNA coding sequence according to claim 22, further characterized in that said FtsZ protein is encoded by a sequence that includes a sequence selected from the group consisting of SEQ ID NOS: 10-19.

24. A recombinant DNA construct comprising any of the DNA coding sequences according to claims 16 to 23.

25.- A plant cell comprising the DNA construct according to claim 24.

26. - A plant comprising a cell according to claim 25.

27.- A method for improving the selectivity of a plant, characterized in that it comprises transforming a plant cell source having an altered plastid morphology, with a construction comprising a functional promoter in the plastids of a plant cell operably associated with a nucleic acid sequence encoding a selectable marker.

28. The method according to claim 27, further characterized in that said nucleic acid sequence codes for a herbicide tolerance gene.

29. The method according to claim 27, further characterized in that said nucleic acid sequence codes for a glyphosate tolerance gene.

30. A method for preparing a plant cell source with increased plastid transformation efficiency, characterized in that it comprises transforming a plant cell with a construction! which comprises a functional promoter in a plant cell operably associated with a nucleic acid sequence encoding an FtsZ protein. 31.- A method for the transformation of plastids of a plant cell, characterized in that it comprises introducing into a plant cell that has altered plastid morphology, a first acid construction • - ^ - ^ nucleic comprising a functional promoter in plastids of a plant cell operably associated with a nucleic acid sequence of interest. . »... -