MXPA01004242A - Use of dna identification techniques for the determination of genetic material of cocoa in fermented or roasted beans and chocolate - Google Patents

Abstract

The present invention pertains to the use of DNA detection techniques for the determination of cacao in fermented and/or roasted beans and chocolate varieties and/or cacao varieties that have been modified by common breeding techniques or that have been modified by genetic engineering. In particular the DNA detection techniques are selected from the group consisting of PCR, RAPD, RFLP or microsatellite identification.

Description

USE OF DNA IDENTIFICATION TECHNIQUES FOR THE DETERMINATION OF COCOA GENETIC MATERIAL IN GRAINS FERMENTED OR ROASTED AND IN CHOCOLATE DESCRIPTION OF THE INVENTION The present invention relates to the use of DNA identification techniques for the determination of genetic material of cocoa in fermented and / or roasted grains and in chocolate. In particular, the present invention relates to the use of techniques selected from the group consisting of PCR, RAPD, RFLP or microsatellite identification and subsequent determination of the DNA sequence respectively, for the determination of cocoa varieties and / or varieties of cocoa that have been modified by common reproductive techniques, or that have been modified by genetic engineering in processed grains and chocolate. Due to the globalization of the world a huge variety of products from all over the world have become available in local markets. This also applies to the raw materials or intermediate products used in the various stages of food production.

Apart from the new foreign food products that enter the local markets, new modified products can be obtained, which show a variety of different characteristic qualities. For this purpose, for example tomato paste derived from genetically modified tomatoes has been sold in the United Kingdom since 1996, after having been imported from the United States of America. Due to national regulations some food products and raw materials therefore have to be labeled in order to determine their origin and / or quality level. One of the disadvantages of such labeling procedures is that labels accidentally or intentionally be exchanged, so that the buyer can not always rely on this type of identification. In addition, the imposition of exclusive rights of the owner over the raw materials may require identification at various stages of the process, including the final food product on the shelf. Therefore, there is a need in the art for a reliable method for determining particular raw materials in food products of interest, or their origin. With the progress of DNA analysis techniques, efficient methods for identifying the genetic origin of raw materials / food products have become accessible. However, these techniques can only be applied to products / raw materials in which the genetic material has not been degraded to a substantial degree. In this regard, R. Greiner and colleagues in "There is some possibility of detecting the use of genetic engineering in processed foods" ("There is some possibility of detecting the use of genetic engineering in invented foods"), Z. Ernáhrungswissenschaft 36 (1977 ), pages 155-160, of the option that some food products, such as pizza tomatoes, French fries etc. They allow the detection of their genetic material through PCR (Polymerase Chain Reaction, Ehrlich et al., Science 253 (1991), pages 1643-1651). In the same article (Greiner et al., Supra) it is also mentioned, however, that some processed food products, such as tomato soup, tomato starch, mashed potatoes, etc., do not allow such identification, because the DNA of them obviously is degraded to an extensive degree. For the cocoa it was generally accepted that the stages of the process involved in the preparation of the cocoa, such as grain fermentation, drying and roasting, which is usually carried out at temperatures from 105 ° C to 150 ° C 2 to 50 minutes, are stages of the process that destroy the DNA, so that the DNA of the cocoa can not be used to identify and control the genetic origin of fermented grains, roasted beans and chocolate. Consequently, an object of the present invention is to provide methods for the identification of the genetic material of cocoa in processed cocoa beans and in chocolate. In the studies that give rise to the present invention, it has now surprisingly been found that contrary to the common belief of the current state of the art, DNA identification techniques are currently suitable for detecting genetic material in processed cocoa beans and in chocolate , and that these techniques can be used efficiently to identify the genetic origin of cocoa. The above object has therefore been achieved using DNA identification techniques, in particular PCR, RAPD, FPLP or microsatellite techniques and subsequent determination of DNA sequences, respectively, for the determination of the genetic material of cocoa, in where the material to be determined is fermented grains, roasted beans or chocolate. Using the techniques mentioned above the identification of cocoa (varieties) is now feasible, for example of what particular variety the cocoa beans contained in a final product, such as chocolate, have been derived. This option will also represent an attractive future to determine if any particular cocoa, such as cocoa that has been modified or improved by common techniques, or that has been subjected to genetic engineering, or has been used in the preparation of the chocolate of interest. On the other hand, the present invention allows an efficient control of the variety of origin of dry fermented grains in the stage of export to / import from a particular country, for an efficient control of the origin of the roasted beans in the factory during its processing, and for efficient control of chocolate on the shelf. PCR techniques (Ehrlich et al., Supra) RAPD (Random Amplified Polymorphic DNA); Welsh et al., "Fingerprint determination of genomes using PCR with arbitrary primers (Fingerprinting genomes using PCR with arbitrary primers"), Nucleic Acid Res. 18 (1990), pages 7213-7218), RFLP (fragment length polymorphism). restriction, Botstein D. Y collaborators, "Construction of a genetic map in man using restriction fragment length polymorphism" ("Construction of a genetic map in man using restriction fragment length polymorphism"), Am. J. Hum. Genet 32 (1980), pages 314-331) and microsatellite identification (Tautz, D. and collaborators "Hypervariability of simple sequences as a general source for polymorphic DNA markers" ("Hypervariability of simple sequences as a general source for polymorphic ADM ar ers "), Nucí Acid Res., 17, (1989), pages 6463-6471; Weber J. Y collaborators," Abundant classes of human DNA polymorphisms that can be represented using the chain reaction. polymerase "(" abundant class of human DNA polymorphisms which can be typed using the polymerase Cain reaction "), Am. J. Hum. Genet., 44 (1989), 388-396) are known and described in the art. The documents mentioned above are incorporated herein by reference. In a preferred embodiment the DNA to be detected according to the techniques above is a DNA derived from the 5S gene of the cocoa or the SSP gene (Seed Storage Protein gene; Spencer E. and Hodge, P., Plant 186 ( 1992, 567-576) or the chitinase gene In a further preferred embodiment, the DNA to be detected is derived from ADM of mitochondria and / or chloroplast.This DNA shows the advantage that it propagates stably from mother grains to daughter, thus allowing to assign the fruits of descendant trees to a particular original tree / variety.This option also applies when descendants are derived from a female tree and different male trees.Applying DNA identification techniques, preferably PCR techniques, RAPD , RFLP or microsatellite identification and 'subsequent determination of DNA sequences, respectively, with fermented and / or roasted cocoa beans and / or chocolate will also be possible to identify the A raw material derived from a variety, which has been modified or improved by common breeding techniques, or that has been genetically modified, in the final product. In the Figures: Figure IA shows a photograph of an agarose gel stained with ethidium bromide, on which cocoa SADN has been applied from different sources. Figure IB shows an autoradiograph of a hybridization experiment, wherein the DNA of the agarose gel of Figure IA has been transferred to a nylon membrane and hybridized with radiolabelled cocoa DNA using 32 P as the radioactive isotope. Figure 2 shows a photograph of an agarose gel stained with ethidium bromide, in which the 5S intergenic spacer on different samples of cocoa has been amplified via PCR. Figure 3 shows a photograph of an agarose gel stained with ethidium bromide, where intron 1 and exon 2 of the SSP gene have been amplified via PCR on different samples.

Figure 4 shows RAPD profiles of different cocoa samples. In the following examples the techniques for the determination of cocoa DNA in fermented and / or roasted grains and in chocolate will be described. It is understood, however, that the present invention is not limited to the examples, but rather is comprised by the scope of the appended claims. Unless indicated otherwise, the techniques applied are as described in Sambrook, J., Fritsch, E. F., Maniatis, T .; Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, E.U.A., 1989.

Example 1: Extraction of DNA from fermented cocoa beans 400 mg of cocoa embryo shafts were collected, ground in liquid nitrogen and homogenized in 10 ml of extraction buffer (Sorbitol 0.35 M, Tris-HCl 0.1 M pH 8, 5 mM EDTA, sodium bisulfite 5 g / 1) using an IKA-Ultra-Turrax T25 (Janke &Kunkel). The resulting homogenate was filtered through Miracloth (Calbiochem) and subjected to centrifugation (15 minutes, 1000 g, 4 ° C). The pellet was resuspended in 5 ml of extraction buffer and subjected to centrifugation (15 minutes, 1000 g, 4 ° C). The pellet was resuspended in 0.5 ml of extraction buffer with 0.5 ml of lysis buffer (0.2 M Tris-HCl pH 8, 50 M EDTA, 2 M NaCl, 2% C ) and 0.1 ml of 5% Sarkosyl. % and incubated for 60 minutes at 65 ° C. The lysed material was then extracted with 1 ml of chloroform / isoamyl alcohol (24/1, v / v). After centrifugation (15 minutes at 10,000 g, 4 ° C), the DNA in the aqueous phase was precipitated by adding a volume of isopropanol and resting overnight at -20 ° C. The DNA was collected by centrifugation, only to suspend again in 1 ml of TE buffer (10 mM Tris-HCl pH 8, 0.1 mM EDTA) and purified with RNAse A (Sigma) in a final concentration of 200 μg / ml at 37 ° C for 30 minutes, and Proteinase K ( Boehringer Mannheí) in a final concentration of 400 μg / ml at 56 ° C for 1 hour. Proteins were eliminated with a phenol / chloroform / isoamyl alcohol treatment (25/24/1: v / v / v). After centrifugation (15 minutes, 1000 g, 4 ° C) the DNA of the aqueous phase was precipitated overnight with a mixture of 3 M sodium acetate, pH 5.2, and cold ethanol (0.1 / 2: v / v). -20 ° - ii C). The DNA was trapped on a glass rod, washed in 70% ethanol solution and resuspended in 50 μl of TE buffer.

EXAMPLE 2 DNA extraction from roasted cocoa beans or non-embryo grains, and from chocolate 60 g of dark chocolate were ground (Nestlé, Grands chocolats, Noir (74% cocoa), Auchan, Vendóme Noir (52% cocoa), freely available in the market or 25 g of embryo-free grains (from Nestlé St. Menet, France) in liquid nitrogen, and subsequently homogenized in 200 ml of extraction buffer as previously described. The homogenized material was filtered through Miracloth, and was subjected to centrifugation for 15 minutes at 1000 g at 4 ° C. The pellet was resuspended in 50 ml of extraction buffer, and subjected to centrifugation (15 minutes, 1000 g, 4 ° C). pellet was resuspended in 5 ml of extraction buffer, with 7 ml of lysis buffer and 2.4 ml of 5% Sarkosyl, and was incubated for 60 minutes at 65 ° C. The resulting lysate material was then extracted with 10 ml of chloroform / isoamyl alcohol (24/1: v / v). After centrifugation (15 minutes, 1000 g, 4 ° C) the DNA in the aqueous phase was precipitated by adding a volume of isopropanol, and allowing to stand overnight at -20 ° C. after two successive centrifugation (15 minutes, 10,000 g, 4 ° C) the resulting pellets were pooled and resuspended in 5 ml of TE buffer. Two additional purification steps were carried out with phenol / chloroform / isoamyl alcohol (25/24/1: v / v / v), and the DNA of the finally obtained aqueous phase was precipitated overnight adding 3 M sodium acetate, pH 5.2 and cold ethanol (0.1 / 2; v / v) and allowing to stand at -20 ° C. After centrifugation (15 minutes, 1000 g, 4 ° C) the DNA was resuspended in 30 μl of TE buffer. The DNA was purified with RNase A (final concentration: 200 μg / ml) at 37 ° C for 10 minutes.

Example 3 Amplification of DNA by PCR Two types of amplification were tested by PCR, first on repeated DNA sequences of the "rDNA 5S gene (1000 to 50,000 copies per haploid genome) and second on a single gene encoding a cocoa seed storage protein (SSP) with 3 to 5 copies per haploid genome.

DNA amplification for the intergenic spacer of the 5S ribosomal gene: Purified DNA obtained from cocoa beans, non-embryo or chocolate grains was diluted as illustrated above in TE buffer, at a ratio of 1/500. DNA amplification was performed with 5 μl of each diluted DNA sample and 45 μl of the PCR buffer containing 200 μM of each dNTP, 25 ng of each primer and 2 U of Taq Polymerase (Stratagene) with a final concentration of 1.5 mM in magnesium chloride. The DNA sequences of the two primers used are: 5'-TTTAGTGCTGGTATGATCGC-3 '(SEQ ID NO: I) 5'-TGGGAAGTCCTCGTGTTGCA-3' (SEQ ID NO: II) These two primers were designated according to Kolchinsky et al. "Representation of plant genomes using amplification by polymerase chain reaction of 5S ribosomal genes" ("Portraying of plant genomes using polymerase Cain reaction amplification of ribosomal 5S genes") Genome 34 (1991) pages 1028-1031. The amplifications were performed on a Bio-Med Thermocycler 60/2 (B. Braun) programmed for a preliminary denaturation of 2 minutes at 94 ° C and 30 cycles including 1 minute at 94 ° C, 1 minute at 55 ° C and ° C. minute at 72 ° C. A final DNA extension cycle was performed at 72 ° C for 7 minutes.

DNA amplification for the seed storage protein (SSP) gene: The DNA amplification procedure was the same as previously described, with the proviso that the two DNA primers designed to detect the presence of the SSP gene are like follows: 5 '-GGCAATTTACTTCGTGACAAACG-3' (SEQ ID NO: III) 5'-CTCATATTTGCCAGGAGAATTAAC-3 '(SEQ ID NO: IV) EXAMPLE 4 Random Amplified Polymorphic DNA (RAPD) DNA amplification was performed as already described above, with the proviso that the primers used are randomly designed decamers from Oeron 'Technologies, Almeda, California.

The Codes for the corresponding primers are as follows: AG15 5 '-CCCACACGCA-3 (SEQ ID NO: V) AM10 5'-CAGACCGACC-3' (SEQ ID NO: VI) Z06 (to be found in the PCR kit of Operon) Amplifications were programmed for 45 cycles that included 1 minute at 94 ° C, 1 minute at 37 ° C and 2 minutes at 72 ° C. A final cycle of DNA extension was performed at 72 ° C for 7 minutes according to to Williams et al., "DNA polymorphisms amplified by arbitrary primers are useful as genetic markers" ("DNA polymorphisms amplified by arbitrary primers are useful as genetic markers"). Acids Res. 18 (1990), pages 6531-6535.

Electrophoresis and DNA Hybridization The different DNA fragments were separated on a 1.4% agarose gel, followed by staining with ethidium bromide. Southern blots were performed according to Southern (Sambrook, supra) using alkaline capillary transfer to nylon membranes (Appligene). The DNA probes were labeled using 32P dCTP with the Megaprime kit (Amersham) and hybridized on the membranes overnight at 65 ° C in hybridization buffer (5% w / v SDS, 5 x SSC, 5 x solution of Denhart, 40 μg / ml heterologous DNA). The post-hybridization treatments consisted of three high stringency washes (2 x SSC, 0.1% SDS, 1 x SSC, 0.1% SDS, 0.2 x SSC, 0.1% SDS) each at 65 ° C for 30 minutes.

Example 5 Detection of cocoa bean DNA to chocolate The protocol used allowed the detection of High molecular weight DNA in fermented cocoa beans and chocolate. Co and brown DNA and hazelnut DNA were used as negative control. To ensure that the DNA extracted from the non-embryo bean and chocolate was derived from cocoa, the DNA transferred to the nylon membrane was hybridized with radioactively labeled total cocoa DNA, purified from cacao tree leaves. Autoradiography (Figure IB) indicates positive homology for cocoa samples from leaves to chocolate, demonstrating that the SDN purified from these samples originated from cocoa.

Amplification of DNA by PCR of cocoa samples: To test the possibility of detecting specific DNA sequences from the different samples, specific DNA primers were used to first amplify the intergenic spacer of the cascade-repeated 5S ribosomal gene, and secondly a part of the Seed protein storage gene (SSP). Amplifications of the 5S intergenic spacer were successful over all DNA samples tested from leaves to chocolate (Figure 2). These DNA amplifications by PCR were detected as a faint DNA stain indicating substantial degradation of the DNA during the processing steps of the cocoa beans with discrete bands to be detected from about 160 bp to more than 1000 bp for the samples of leaf and fresh grain. This amplification of multiple bands of DNA was the result of the cascade repetition organization of the target 5S ribosomal gene. The part of the amplified 5S gene corresponds to intron 1 and exon 2 thereof, and provides a PCR product of 312 bp in length, which can be detected in all the samples tested (Figure 3).

This result allows to consider that it is possible to detect a single copy of the leaf-to-chocolate DNA gene, since the SSP gene represents a low number of copies of the gene in the haploid genome of Theobroma cocoa (3 to 5 copies). DNA polymorphism was detected for DNA amplification by PCR from part of the SSP gene.

RAPD tests on cocoa samples: The purpose of this experiment was to demonstrate that it could be possible to obtain RAPD fingerprints from processed samples of cocoa to determine the genetic origin (s) of the raw materials used for a sample. chocolate. Three initiators of Operon kits were selected, and the results are illustrated by Figure 4. DNA amplifications were obtained in two different chocolate samples (Nestlé, Grands chocolats, Noir (74% cocoa), Auchan, Vendóme Noir (52 Cocoa%) showing that it is really possible to relate the final product to particular raw materials.

Example 6 Determination of DNA sequences from cocoa beans to chocolate To genetically characterize different samples of cocoa from grains to chocolate a PCR amplification of two cocoa genes (seed storage protein gene (SSP) and chitinase gene) was followed by a sequence determination, to detect DNA polymorphism. Two cocoa trees (Laranja and EET 95) were used to obtain the different samples of cocoa beans and chocolate. The results indicate that the two genotypes used can be assessed by specific DNA sequence of SSP and chitinase genes.

PCR Amplification of DNA from Cocoa Samples: Specific DNA primers were used to specifically amplify the two gene fragments of the different cocoa samples. The amplified SSP gene part corresponding to introns 1, 2, 3 and exons 2, 3 and provides a PCR product of 584 bp in length. The purified 'DNA obtained from grains' of cocoa, non-embryo grains or chocolate as shown in Example 2 was diluted in TE buffer at a ratio of 1/500. DNA amplification was performed with 5 μl of diluted DNA samples and 45 μl of the PCR buffer containing 200 μM of each dNTP, 25 ng of each primer and 2 U of Taq Polymerase (Stratagene) with a final concentration of 1.5 mM in magnesium chloride. The DNA sequences of the two primers used are: 5 '-GGCAATTTACTTCGTGACAAACG-3r (SEQ ID NO: III) 5'-CCTCCAGCTTCTCTCTTTGTGT-3' (SEQ ID NO: VII) The amplifications were performed in a programmed Thermocycler Braun 60/2 for 30 cycles, which included 1 minute at 94 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C. A final extension stage was performed at 72 ° C for 7 minutes. A fragment of the chitinase gene was amplified using genomic access code clone sequence U30324 from GCG (Genetics Computer Group, USA). The DNA amplification protocol is the same as described above, except that 50 ng of the two DNA primers were used. The length of the PCR amplification is 1064 bp. The DNA sequences of the two primers used are: 5 '-GCTGAGCAGTGTGGACGGC-3' (SEQ ID NO: VIII) 5'-CCTCTGGTTGTAGCAGTCGA-3 '(SEQ ID NO: IX) Sequence determination of fragments of amplified SSP and chitinase genes from fermented grains or chocolate: Two independent PCR amplifications were carried out for each gene (SSP and chitinase) and for each variety (Laranja and EET 95). 10 ng of DNA from each amplification was cloned into single vector pGEM T according to the Promega instructions. Competent E. coli JM109 cells were transformed by recombinant plasmid DNA, and cultured on LB plates containing ampicillin (100 mg / 1), X GAL (40 mg / 1) and IPTG (20 mg / 1). The sequence was determined on five randomly selected clones containing fragments of the SSP or chitinase genes.

Identification of DNA of genetic material of sequences with the SSP gene: The DNA sequences obtained from the SSP gene allow the genetic differentiation of the different samples of cocoa tested originated from cocoas of Laranja and EET '95 due to two mutations' in position 67 (G / A) and 475 (C / G) as described below: SSP DNA sequence (583 bp) from samples of Laranja cocoa: 5'CC CCAGCTtCTCT.CTTTGTGTCtAACAAACAAGATAAAAATGAATAAATAAAT AAATAAGtAAAAGACAAGAGAAAGTAAAAACAAAAAATTGATTCATAGCtAGTC AAAGAACCATAtACATtGAAGACGGTCtCAAGAACTTCATAGCTGAAGGCTCCGT AATATGATTCAGGtTTATtATTTCCAGCGGGGAAGAAtAACtGCAGCAATTATAA GTACAGGGTCAATAGACTAACCAAGACATCAAGGTTATGTAGAAACTTCTAATAA ATAAATGpAAAGTAGAAAACCTCATAtpGCCAGGAGAATTAACAGGCAGGGCG, AGCACAGCTATGGTTAGCTTCtCTTGGTTGTCTTGGCTAACCACGtAAACAGtGCT TCCTGCAGGAACGCTGACTAC GTTCCACGCrGtACATTATAGGACTCTTTGtTTT CATGAGTCACAAACGTAATTGTCCCCTTTCCTGACACAGAAATAATtTACTATGTT TTCAATCAATGGTGATTTGGtGATAAAAGCCGCAAAATTTTGTTCGAAAGGGAAG AGAATTTACCGTTTGTCACGAAGTAAATTGCC-3 • (SEQ ID No. X) SSP DNA sequence (583 bp) of EET 95 cocoa samples: CTCCAGCtTCTCTCTTTGTGTCtAACAAACAAGATAAAAATsAATAAATAAAT AAATAAGtAAAAAACAAGAGAAAGTAAAAACAAAAAATTGATTCATAGCTAGTCA AAGAACCATATACATTGAAGACGGTCTCAAGAACTTCATAGCTGAAGGCTCCGTA ATATGATTCAGGTTTATTATTTCCAGCGsGGAAGAATAACTGCAGCAATTATAAGt ACAGGGTCAATAGACTAACCAAGACATCAAGGTTATGTAGAAACTTCtAAtAAAt -4-AATGTTAAAGTAGAAAACCTCATATTTGCCAGGAGAATTAACAGGCAGGGCGAG CACAGCTATGGTTAGCTTC C-rrTGGTTGtCTTGGCTAACCACsTAAACAGTGCTTC CtGCAGGAACGCTGACTACTGTTCCACGCTGtACATTATAGGACTCTTTGTTTTCA TGAGtCACAAACGTAATTGtCCCCtTrCCTGAGACAGAAATAATTTACtAtGTTTT C-ATCAATGGtGATtTGGTGATAAAAGCCGCAAAATTTTGTTCGAAAGGGAAGAG -AATTrACCsTTTGTCACGAAGtAAATTGCCTr (SEQ ID No. XI) DNA identification of genetic material from sequences with chitinase gene: The DNA sequences of the chitinase gene also discriminate the different tested cocoa samples originating from Laranja cocoas and TSE 95 due to four mutations at position 266 (G / A), 425 (One addition / deletion of nucleotide), 615 ( A / G), and 865 (A / G) as described below: Chitinase DNA sequence (1062 bp) of Laranja cocoa samples: 'GCTGAGCAGTGTGGACGGCAAGCTGGTGGTGCCCTGTGCCCTGGAGGCCTATGT TGTAGCCAATTTGGTGGGTGTGGCAACACTGATGACTACTGCAAAAGGGAAAATG GTTGCCAGAGTCAGTGCAGCGGAAGCGGAGGTGATACTGGtGGACTTGATAGTCT GATAACAAGAGAAAGGTtTGATCAGATGCtTTTGCAtAGAAATGA7GGTGG7TGT C rGCTCGTGGCrrcrATACCTATGAtGCTTTCATAGCTGCTGCGAGGTCTTTCCC TGCCTTCGCtACAACCGGTGATGATGCCACTCGCAAGAGGGAAGTTGCTGCtTTC TTGGCCCAAACTTCTCACGAAACTACTGGttAGTCCACTTCGAAAGTTAATCACA AAGTtCACCATGTTTTGAACATGACTTCATCGGtTTGAGATTAATTTGATGATGCC GTAGGTGGAGCAGGATGGGCTGCACCCGATGGTCCATATACGTGGGGATACTGCT ACAATAGGGAATTAAACCCCGCTGATTACTGCCAGTGGGATCCAAACtACCCTTG CGCTCCtGGTAAGCAATATTTTGGCCGGGGTCCAATGCAACTtACTTGGtAAGCC TTTCACCATTTGCT.AATTtCtTTTCTTGAAATstATTTATGGTAAGGCAAAATTGTT TTGTtGACATGGGAATAATCACTTAACTTTTGATATATCAGGAAC7ACAAC7ATsG GCAGTGTGGAAGAGCCATTGGGGTGGACCTATTAAACAACCCAGACCTGC7AGCA ACtGATCCTACAATTrcpTCAAGTCAGCGTTCTGGTTCTGGATGACTCCACAATC ACCAAAGCCTTCTTGCCACGATG7GATCATTGGAGCGTGGTCACCCTCCGG7AGC GACCAGGCGGCAGGCCGGGTTCCAGGGTT7ssTTTGATCACAAA7ATTA7CAATG GCGGCCtTGAATGTGGTCAAGGTTGGAATGCAAAGGTAGAGGACCGCATTGGGTT C-TATAAGAGGXAT7GTGACACACTTGGAG7TGGC7ATGG7AACAA7CTCGAC7GCG-3 '(SEQ ID No. XII) SSP DNA sequence (1063 bp) of SSP cocoa samples: 5 * GCTGAGCAGTGTGGACGGCAAGCTGGTGGTGCCCTGTGCCCTSGAGGCCTATGT TGTAGCCAATTTGGTTGGTGTGGCAACACTSATGACTACTGCAAAAAGGAAAATG GTTGCCAGAGTCAG7GCAGCGGAAGCGGAGG7GA7ACTGSTGG? CTTGATAG_7_CT GATA? CAAGAGAAAGGTTTGATCAGATGCTTTTGCATAGAAATGAXGGTGGTTG? CC? GCTCGTGGCTTCTATACC? ATGATGCTTTCATAGCRGCTGCGAAGTCTTTCCC TGCCTTCGCTACAACCGG7GATGATGCCACTCGCAAGAGGGAAGTTGCTGC777C ? TGGCCCAAACTTC7CACGAAACTACTGGTTAG_7_CCACTTCGAAAGTTAATCACA AAGTTCACCATG7T7TSAACATGACTTCATCGGTT? GAGAATTAA7TTGATGATGC CGTAGG7GGAGCAGGATGGGCTGCACCCGATGGTCCATATACGTGGGGATACTGC TACAATAGGGAATTAAACCCCGC7GATTAC7GCCAGTGGGA7CCAAACTACCC7T GCGCTCCTGGTAAGCAATATTTGGGCCGGGGTCCAATGCAACTTACTTGGTAAGC CT TCACCGTTTGCTAAT? TCTTTTCTTGAAATCTATTTATGGTAAGGCAAAATTS TTTTGTTGACATGGGAATAATCACTTAACTTTTGATATATCAGGAAC7ACAAC7A7 GGGCAGTGTGGAAGAGCCATTGGGGTGGACCTATTAAACAACCCAGACCTGCTAG CAACTGA7CCTACAAT7TCTTTCAAGTCAGCGTTC7SS77CTGGATGACTCCACAA TCACCAAAGCCTTCTTGCCACGA7G7GA7CATTGGGGCG7GGTCACCC7CCGG7A GCGACCAGGCGGCAGGCCGSGTTCCAGGGTTTGG7TTGATCACAAA7A7TA7CAA TSGCGGCCTRGAATG7GG7CAAGGTTGGAATGCAAAGGTAGAGGACCGCATTGGG TTCTATAAGAGGTAT7GTGACACACTTGGAGTTGGCTATGGTAACAATCTCCAC7 GCTACAACCAGAGG-3 '(SEQ ID NO XIII) LIST OF SEQUENCES < 110 > SOCIETÉ DES PRODUITS NEST E < 120 > IDENTIFICATION OF COCOA < 130 > cocoa identification < 140 > < 141 > < 150 > 98121043.8 < 151 > 1998-11-05 < 160 > 13 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 20 < 212 > DNA < 213 > cocoa < 400 > 1 tttagtgctg gtatgatcgc 20 < 210 > 2 < 211 > 20 < 212 > DNA < 213 > cocoa < 400 > 2 tgggaagtcc tcgtgttgca 20 < 210 > 3 < 211 > 23 < 212 > DNA < 213 > cocoa < 400 > 3 ggcaatttac ttcgtgacaa acg 23 < 210 > 4 < 211 > 24 < 212 > DNA < 213 > cocoa < 400 > 4 ctcatatttg ccaggagaat taac 24 < 210 > 5 < 211 > 10 < 212 > DNA < 213 > cocoa < 400 > 5 cccacacgca 10 < 210 > 6 < 211 > 10 < 212 > DNA < 213 > cocoa < 400 > 6 cagaccgacc 10 < 210 > 7 < 211 > 22 < 212 > DNA < 213 > cocoa < 400 > 7 cctccagctt ctctctttgt gt 22 < 210 > 8 < 211 > 19 < 212 > DNA < 213 > cocoa < 400 > 8 gctgagcagt gtggacggc 19 < 210 > 9 < 211 > 20 < 212 > DNA < 213 > cocoa < 400 > 9 cctctggttg tagcagtcga 20 < 210 > 10 < 211 > 583 < 212 > DNA < 213 > cocoa < 400 > 10 cctccagctt ctctctttgt gtctaacaaa caagataaaa atgaataaat aaataaataa 60 agagaaagta gtaaaagaca aaaacaaaaa attgattcat agctagtcaa agaaccatat 120 acattgaaga cggtctcaag aacttcatag ctgaaggctc ttcaggttta cgtaatatga 180 ttatttccag cggggaagaa taactgcagc aattataagt acagggtcaa tagactaacc 240 aagacatcaa ggttatgtag aaacttctaa taaataaatg ttaaagtaga aaacctcata 300 tttgccagga gaattaacag gcagggcgag cacagctatg gttagcttct cttggttgtc 360 ttggctaacc acgtaaacag tgcttcctgc aggaacgctg actactgttc cacgctgtac 420 attataggac tctttgtttt catgagtcac aaacgtaatt gtcccctttc ctgacacaga 480 aataatttac tatgttttca atcaatggtg atttggtgat aaaagccgca aaattttgtt 540 cgaaagggaa gagaatttac cgtttgtcac gaagtaaatt gcc 583 < 210 > 11 < 211 > 583 < 212 > DNA < 213 > cocoa < 400 > 11 cctccagctt ctctctttgt gtctaacaaa caagataaaa atgaataaat aaataaataa 60 agagaaagta gtaaaaaaca aaaacaaaaa attgattcat agctagtcaa agaaccatat 120 acattgaaga cggtctcaag aacttcatag ctgaaggctc ttcaggttta cgtaatatga 180 ttatttccag cggggaagaa taactgcagc aattataagt acagggtcaa tagactaacc 240 aagacatcaa ggttatgtag aaacttctaa taaataaatg ttaaagtaga aaacctcata 300 tttgccagga gaattaacag gcagggcgag cacagctatg gttagcttct cttggttgtc 360 ttggctaacc acgtaaacag tgcttcctgc aggaacgctg actactgttc cacgctgtac 420 attataggac tctttgtttt catgagtcac aaacgtaatt gtcccctttc ctgagacaga 480 aataatttac tatgttttca atcaatggtg atttggtgat aaaagccgca aaattttgtt 540 cgaaagggaa gagaatttac cgtttgtcac gaagtaaatt gcc 583 < 210 > 12 < 211 > 1062 < 212 > DNA < 21"3 &cocoa < 400 > 12 gctgagcagt gtggacggca agctggtggt gccctgtgcc ctggaggcct atgttgtagc 60 caatttggftg ggtgtggcaa cactgatgac tactgcaaaa gggaaaatgg ttgccagagt 120 cagtgcagcg gaagcggagg tgatactggt ggacttgata gtctgataac aagagaaagg 180 tttgatcaga tgcttttgca tagaaatgat ggtggttgtc ctgctcgtgg cttctatacc 240 tatgatgctt tcatagctgc tgcgaggtct ttccctgcct tcgctacaac cggtgatgat 300 gccactcgca agagggaagt tgctgctttc ttggcccaaa cttctcacga aactactggt 360 tagtccactt cgaaagttaa tcacaaagtt caccatgttt tgaacatgac ttcatcggtt 420 tgagattaat ttgatgatgc cgtaggtgga gcaggatggg ctgcacccga tggtccatat 480 acgtggggat actgctacaa tagggaatta aaccccgctg attactgcca gtgggatcca 540 aactaccctt gcgctcctgg taagcaatat tttggccggg gtccaatgca acttacttgg 600 taagcctttc accatttgct aatttctttt cttgaaatgt atttatggta aggcaaaatt 660 catgggaata gttttgttga ttttgatata atcacttaac tcaggaacta caactatggg 720 cagtgtggaa gagccattgg ggtggaccta ttaaacaacc cagacctgct agcaactgat 780 cctacaattt ctttcaagtc agcgttctgg ttctggatga ctccacaatc accaaagcct 840 tcttgccacg atgtga tcat tggagcgtgg tcaccctccg gtagcgacca ggcggcaggc 900 cgggttccag ggtttggttt gatcacaaat attatcaatg gcggccttga atgtggtcaa 960 ggttggaatg caaaggtaga ggaccgcatt gggttctata agaggtattg tgacacactt 1020 ggagttggct atggtaacaa tctcgactgc tacaaccaga gg 1062 < 210 > 13 < 211 > 1063 < 212 > DNA < 213 > cocoa < 400 > 13 gctgagcagt gtggacggca agctggtggt gccctgtgcc ctggaggcct atgttgtagc 60 caatttggtt ggtgtggcaa cactgatgac tactgcaaaa aggaaaatgg ttgccagagt 120 cagtgcagcg gaagcggagg tgatactggt ggacttgata gtctgataac aagagaaagg 180 tttgatcaga tgcttttgca tagaaatgat ggtggttgtc ctgctcgtgg cttctatacc 240 tatgatgctt tcatagctgc tgcgaagtct ttccctgcct tcgctacaac cggtgatgat 300 gccactcgca agagggaagt tgctgctttc ttggcccaaa cttctcacga aactactggt 360 tagtccactt cgaaagttaa tcacaaagtt caccatgttt tgaacatgac ttcatcggtt 420 tgagaattaa tttgatgatg ccgtaggtgg agcaggatgg gctgcacccg atggtccata 480 tactgctaca tacgtgggga atagggaatt aaaccccgct gattactgcc agtgggatcc 540 aaactaccct tgcgctcctg gtaagcaata ttttggccgg ggtccaatgc aacttacttg 600 gtaagccttt caccgtttgc taatttcttt tcttgaaatg tatttatggt aaggcaaaat 660 tgttttgttg acatgggaat aatcacttaa cttttgatat atcaggaact acaactatgg 720 gcagtgtgga agagccattg gggtggacct attaaacaac ccagacctgc tagcaactga 780 tcctacaatt tctttcaagt cagcgttctg gttctggatg actccacaat caccaaagcc 840 ttcttgccac gatgtga tca ttggggcgtg gtcaccctcc ggtagcgacc aggcggcagg 900 ccgggttcca gggtttggtt tgatcacaaa tattatcaat ggcggccttg aatgtggtca 960 aggttggaat gcaaaggtag aggaccgcat tgggttctat aagaggtatt gtgacacact 1020 tggagttggc tatggtaaca atctcgactg ctacaaccag ag3 1063

Claims (8)

1. CLAIMS 1. Use of a DNA detection technique for the determination of genetic material of cocoa in fermented and / or roasted grains and / or chocolate.
2. 2. The use according to claim 1, wherein the DNA detection technique is selected from the group consisting of PCR, RAPD, RFLP or microsatellite identification.
3. 3. The use according to claim 1, wherein the technique of DNA analysis is the sequence determination of genes amplified by PCR.
4. 4. The use according to any of claims 1 or 2, wherein the DNA to be detected is derived from the cacao 5S gene.
5. 5. The use according to claim 1, wherein the DNA to be detected is derived from the cocoa SSP gene.
6. 6. The use according to claim 1, wherein the DNA to be detected is derived from the cocoa chitinase gene.
7. 7. The use according to claim 1, wherein the DNA to be detected is derived from mitochondrial DNA and / or cocoa chloroplast.
8. 8. The use according to any of the preceding claims, wherein the cocoa from which the fermented and / or roasted beans are derived and the chocolate, is a variety, which has been modified by common breeding techniques, or which has been modified by genetic engineering.