MXPA01001090A - Chlamydia. - Google Patents
Chlamydia.Info
- Publication number
- MXPA01001090A MXPA01001090A MXPA01001090A MXPA01001090A MXPA01001090A MX PA01001090 A MXPA01001090 A MX PA01001090A MX PA01001090 A MXPA01001090 A MX PA01001090A MX PA01001090 A MXPA01001090 A MX PA01001090A MX PA01001090 A MXPA01001090 A MX PA01001090A
- Authority
- MX
- Mexico
- Prior art keywords
- polypeptide
- polynucleotide
- chlamydia
- antibody
- sequence
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56927—Chlamydia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/295—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Chlamydiales (O)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
Abstract
In summary of this disclosure, the present invention provides a method of nucleic acid, including DNA, immunization of a host, including humans, against disease caused by infection by a strain of Chlamydia, specifically C. pneumoniae, employing a vector containing a nucleotide sequence encoding an omp protein of a strain of Chlamydia pneumoniae and a promoter to effect expression of the omp gene in the host. Modifications are possible within the scope of this invention.
Description
ANTIGENS OF CHLAMYDIA AND THE CORRESPONDING DNA FRAGMENTS AND USES OF THEM
RELATED APPLICATION OF THE UNITED STATES The present patent application claims the priority for the provisional application of United States patent No. 60 / 094,203 filed on July 27, 1998 and No. 60 / 122,045 filed on March 1, 1999.
FIELD OF THE INVENTION The present invention relates to Chlamydia antigens and to the corresponding DNA molecules that can be used in methods to prevent and treat diseases caused by infection with Chlamydia in mammals, such as, for example, in humans.
BACKGROUND OF THE INVENTION The Chlamydiae family is prokaryotic. They exhibit formological and structural similarities with gram-negative bacteria, which include a trilaminar outer membrane, which contains lipopolysaccharide and several membrane proteins. The Chlamydiae family differs from other bacteria thanks to its morphology and a unique development cycle. They are obligate intracellular parasites with a single biphasic life cycle consisting of an extracellular metabolically inactive but infectious stage and a replicating intracellular stage, although not an infectious one. The replicative stage of the life cycle occurs within an inclusion bound to the membrane that sequesters the bacteria away from the cytoplasm of the host cell infected. Because the Chlamydiae family is small in size and multiplies only within susceptible cells, they were long thought to be viruses. However, they have many common characteristics with other bacteria: (1) they contain both DNA and RNA, (2) they are divided by binary fission, (3) their cell envelopes resemble those of other gram-negative bacteria, (4) they contain ribosomes similar to those of other bacteria and (5) are susceptible to several antibiotics. The Chlamydiae family can be observed under the optical microscope and the genome is about 1 third the size of the genome of Escherichia coli. From birds, man and other mammals many different strains of Chlamydiae have been isolated and these strains can be distinguished on the basis of host range, virulence, pathogenesis and antigenic composition. There is a strong DNA homology within each species, although surprisingly, little homology between species, suggesting an age-old evolutionary separation.
C. trachomatis has a high degree of specificity for the host, is almost totally limited to man; causes eye and genitourinary infections of very variable severity. In contrast, C. psi ttaci strains are rare in humans, although they are found in a wide range of birds and also in wild, domestic and laboratory mammals where they multiply in the cells of many organs. C. pneumoniae is a common human pathogen, originally described as the T AR strain of C. psi ttaci, although later recognized as a new species. C. pneumoniae is antigenic, genetic and morphologically distinct from other species of Chlamydia (C. trachomatis, C. pecorum and C. psi ttaci). Shows 10% or less of homology in the. DNA sequence with either C. trachomatis or C. pei ttaci and to date it seems to consist of only one strain, TWAR. C. pneumoniae is a common cause of community-acquired pneumonia, only less frequent than Streptococcus pneumoniae and Mycoplasma pneumoniae. Grayston et al. , J. Infect. Dis. 168: 1231 (1995); Campos et al. , Invest. Ophtalmol. Vis. Sci. 36: 1477 (1995), each incorporated herein by reference. It can also cause symptoms in the upper respiratory tract and diseases that include bronchitis and sinusitis. See, for example, Grayston et al. , J. Infect. Dis. 168: 1231 (1995); Campos et al. , Invest. Ophtalmol. Vis. Sci. 36: 1477 (1995), Grayston et al. , J. Infect. Dis. 161: 618 (1990); Marrie, Clin. Infect. Dis. 18: 501 (1993). The vast majority of the adult population (more than 60%) has antibodies against C. pneumoniae (Wang et al., Chamidial Infections, Cambridge University Press, Cambridge, p. 329 (1986)), which indicate a past infection that was not recognized or that was asymptomatic. C. pneumoniae infection usually occurs as an acute respiratory disease (ie, cough, sore throat, hoarseness, and fever - abnormal sounds of the chest heard on auscultation). For most patients, cough persists for 2 to 6 weeks and recovery is slow. Approximately in 10% of these cases, the upper respiratory tract infection is followed by bronchitis or pneumonia. In addition, during an epidemic of C. pneumoniae, in about half of these pneumonia patients, subsequent co-infection with pneumococci has been observed, particularly in the weak and elderly population. As indicated above, there is more and more evidence that infection with C. pneumoniae is also linked to diseases other than respiratory infections.
The receptor of the organism is, presumably, the human being. In contrast to C. psi ttaci infections, there is no known bird or animal that is a receptor. The transmission has not been clearly defined. It can result from direct contact with ant secretions, or from airborne propagation. There is a long incubation period, which can last for many months. Based on the analysis of the epidemics, C. pneumoniae seems to spread slowly through a population (averaging a case-to-case interval of 30 days), because the infected persons are ineffective transmitters of the organism. Susceptibility to C. pneumoniae is universal. The reinfections occur during adult life, after the primary infection that occurs during childhood. C. pneumoniae appears to be an endemic disease throughout the world, notable for overlapping intervals of increased incidence
(epidemics) that persist for 2 or 3 years. C. trachomatis infection does not confer cross immunity against C. pneumoniae. Infections are easily treated with oral antibiotics, tetracycline or erythromycin (2 g / day, for at least 10 to 14 days). A recently developed drug, azithromycin, is very effective as a single-dose therapy against chlamydial infections.
In most cases, C. pneumoniae infection is moderate and uncomplicated and up to 90% of infections are subacute or not recognized. Among children in industrialized countries, it has been thought that infections are rare until the age of 5 years, although a recent study has reported that many children in this age group show evidence of PCR infection, despite being seronegative. and they estimate a prevalence of 17 to 19% from 2 to 4 years of age. See, Normann et al. , Acedia Paediatrica, 87: 23-27 (1998). In developing countries, the seroprevalence of C. pneumoniae antibodies among young children is high and there is a suspicion that C. pneumoniae may be an important cause of acute lower respiratory disease and mortality of infants and children in the tropical regions of the world. Based on seroprevalence studies and studies of local epidemics, the initial C. pneumoniae infection usually occurs between the ages of 5 and 20 years. For example, in the United States, it is estimated that there are 30,000 cases of pneumonia in children annually, caused by C. pneumoniae. Infections can be grouped between groups of children or young adults (for example, students in a school or military conscripts).
C. pneumoniae causes 10 to 25% of lower respiratory tract infections acquired in the community (according to reports from Sweden, Italy, Finland and the United States). During an epidemic, C. pneumoniae infection can amount to 50% to 60% of cases of pneumonia. During these periods, more episodes of infections combined with S. pneumoniae have also been reported. Reinfection during adult life is common; the clinical presentation tends to be more moderate. Based on seroprevalence studies in the population, there is a tendency for an increase in exposure with age, which is particularly evident among men. Some researchers have speculated that a persistent infection status with asymptomatic C. pneumoniae is common. In adults of middle age or older, infection with C. pneumoniae may progress to chronic bronchitis and sinusitis. A study in the United States revealed that the incidence of pneumonia, caused by C. pneumoniae in people under 60 years of age, is 1 case per I., 000 people per year; although in the elderly, the incidence of the disease tripled. Infection with C. pneumoniae rarely leads to hospitalization, with the exception of patients with an underlying disease. Of considerable importance is the association of atherosclerosis and infection with C. pneumoniae. There are several epidemiological studies that show a correlation of previous infections with C. pneumoniae and heart attacks, coronary artery disease and carotid artery disease. See, Saikku et al., Lancet 2: 983 (1988); Thom et al., JAMA 268: 68 (1992); Linnanmaki et al., Circulation 87: 1030 (1993); Saikku et al., Annals Int. Med. 116: 273 (1992); Melnick et al., Am. J. Med. 95: 499 (1993). In addition, organisms have been detected in atheromas and fatty streaks of the coronary, carotid, peripheral and aortic arteries. See, Shor et al., South African Med. J. 82: 158 (1992); Kuo et al., J. Infect. Dis. 167: 841 (1993); Kuo et al., Arteriesclerosis and Thrombosis 13: 1500 (1993); Campbell et al., J. Infect. Dis. 172: 585 (1995); Chiu, et al., Circulation 96: 2144-2148 (1997). Viable C. pneumoniae has been recovered from the coronary and carotid arteries. Ramírez et al., Annals Int. Med. 125: 979 (1996); Jackson et al., Abst. K121, p272, 36th ICAAC, New Orleans (1996). In addition, it has been shown that C. pneumoniae can induce atherosclerosis changes in a rabbit model. See, Fong et al., (1997) Journal of Clinical Microbiology 35: 48. Taken together, these results indicate that it is very likely that C. pneumoniae may cause atherosclerosis in humans, although the epidemiological importance of chlamydial atherosclerosis continues to be expected. demonstrated Several recent studies have also indicated an association between C. pneumoniae infection and asthma. The infection has been linked to wheezing, asthmatic bronchitis, adult-onset asthma and acute exacerbation of asthma in adults and small-scale studies have shown that prolonged treatment with antibiotics was effective in greatly reducing the severity of the disease in some individuals. Hahn et al. , Ann Allergy Asth to Immunol. 80: 45-49 (1998); Hahn et al. , Epidemiol Infect. 117: 513-517 (1996); Bjornson et al. , Scand J Infect Dis. 28: 63-69 (1996); Hahn, J. Fam. Pract 41: 345-351-11995); Allegra et al. , Eur. Respir. J. 7: 2165-2168 (1994); Hahn, et al. , JAMA 266: 225-230 (1991). In light of these results, a protective vaccine against the disease caused by infection with C. pneumoniae would be of considerable importance. There is not yet an effective vaccine for human C. pneumoniae infection. However; Studies with C. trachomatis and C. psi ttaci indicate that this is an achievable goal. For example, mice that have recovered from a lung infection with C. trachomatis were protected against infertility induced by subsequent vaginal inoculation. Pal et al. , Infection and Immuni ty 64: 5341 (1996). Similarly, sheep immunized with inactivated C. psi ttaci were protected against subsequent miscarriages and calving with chlamydia induced dead products. Jones et al. , Vaccine 13: 715 (1995). Protection against chlamydial infections has already been associated with immune responses with Thl, particularly the induction of CD4 + T cells that produce INF ?. Igietsemes et al. , Immunology 5: 317 (1993). Adoptive transfer of CD4 + cell lines or clones to nude mice or SCID conferred protection against inoculation or clear chronic disease (Igietseme et al., Regional I munology 5: 317
(1993); Magee et al. , Regional I munology 5: 305 (1993)), and in in vivo depletion of CD4 + T cells exacerbated the disease post-inoculation (Landers et al., Infection &Immuni ty 59: 3774 (1991); Magee et al., Infection &Immuni ty 63: 516 (1995)). However, the presence of sufficiently high titers of neutralizing antibodies on the mucosal surfaces can also exert a protective effect. Cotter et al. , Infection and Immuni ty 63: 4704 (1995). The degree of antigenic variation within C. pneumoniae species is not well characterized. The C. trachomatis serovars are defined on the basis of antigenic variation in the major outer membrane proteins (MOMP), although the published sequences of the C. pneumoniae MOMP genes do not show variation among different isolates. of the organism. See, Campbell et al., Infection and Immunity 58: 93 (1990); McCafferty et al., Infection and Immunity 63: 2387-9 (1995); Knudsen et al., Third Meeting of the European Society for Chlamydia Research, Vienna (1996). The regions of the protein known to be conserved in other chlamydial MOMPs are conserved in C. pneumoniae. See, Campbell et al., Infection and Immunity 58: 93
(1990); McCafferty et al., Infection and I munity 63: 2387-9 (1995). One study has described a strain of C. pneumoniae with FOMP of higher molecular weight than normal, although the gene has not been sequenced. Grayston et al., J. Infect. Dis. 168: 1231 (1995). It was also found that the partial sequences of outer membrane protein 2 from nine different isolates did not vary. Ramírez et al., Annals Int. Med. 125: 979 (1996). The genes of HSP60 and HSP70 show little variation of other clamiial species, as would be expected. The gene coding for a 76 kDa antigen has been cloned from a single strain of C. pneumoniae. It has no significant similarity with other known chlamydial genes. Marrie, Clin. Infect. Dis. 18: 501 (1993). Many antigens recognized by sera immune to C. pneumoniae were conserved throughout the Chlamydiae family, although the 98 kDa, 76 kDa and 54 kDa proteins may be specific for C. pneumoniae. Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477 (1995); Marrie, Clin. Infect. Dis. 18: 501 (1993); Wiedman-Al-Ahmad et al., Clin. Diagn. Lab Immunol. 4: 700-704 (1997). Immunoblotting of isolates with patient sera shows variation in transfer patterns between isolates, indicating that serotypes of C. pneumoniae may exist. Grayston et al., J. Infect. Dis. 168: 1231
(nineteen ninety five); Ramírez et al., Annals Int. Med. 125: 979 (1996).
However, the results are potentially confused by the state of infection of the patients, since the immunoblot profiles of a patient's serum change with time after infection. An evaluation of the number and relative frequency of any serotypes and definition antigens is not yet possible. Thus, there continues to be a need for effective compositions for preventing, treating and diagnosing Chlamydia infections.
SUMMARY OF THE INVENTION In one aspect, the present invention provides isolated and purified DNA molecules that encode Chlamydia polypeptides designated as outer membrane protein (omp) or alternatively CPN100314 (SEQ ID NO: 1 - full length sequence and SEQ ID NO: 3 - coding sequence for the mature polypeptide). The terms omp and CPN100314 are used interchangeably in the present application. The encoded polypeptides can be used in methods to prevent, treat and diagnose Chlamydia infection and include polypeptides having the amino acid sequence shown in SEQ ID NO: 2 and 4. Those skilled in the art will appreciate that the invention also includes DNA that code for mutants, variants and derivatives of these polypeptides, which result from the addition, deletion or substitution of non-essential amino acids, as described herein. The invention also includes RNA molecules that correspond to the DNA molecules of the invention. In addition to the DNA and RNA molecules, the invention includes the corresponding monospecific polypeptides and antibodies that specifically bind to these polypeptides. The present invention has wide application and includes cassettes, vectors and cells transformed or transfected with the polynucleotides of the invention. In accordance with the foregoing, the present invention provides: (i) a method for producing a polypeptide of the invention in a recombinant host system and related transformed or transfected expression cassettes, vectors and cells; (ii) live vaccine vectors, such as viral or bacterial live vaccine vectors, which include, smallpox virus, alphavirus, Salmonella typhimurium vector or Vibrio cholerae, which contain a polynucleotide of the invention, these vaccine vectors are useful for, for example, preventing and treating Chlamydia infection, in combination with a diluent or carrier and the related pharmaceutical compositions and the associated therapeutic and / or prophylactic methods; (iii) a therapeutic and / or prophylactic method that includes the administration of an RNA or DNA molecule of the invention, either directly or formulated with a delivery vehicle, a polypeptide or combination of polypeptides or a monospecific antibody of the invention and the related pharmaceutical compositions; (iv) a method for diagnosing the presence of Chlamydia in a biological sample, which may include the use of an AE molecule > No. of RNA, of a monospecific antibody or of a polypeptide of the invention; and (v) a method for purifying a polypeptide of the invention by affinity chromatography based on antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS The present invention will be further understood from the following description with reference to the drawings, in which: Figure 1 shows the nucleotide sequence of the omp gene (upper sequences) and the deduced amino acid sequence of the protein omp from Chlamydia pneumoniae (intermediate sequences of full-length protein, lower sequences of the truncated protein). Figure 2 shows the analysis of the restriction enzyme of the gene encoding the omp gene of C. pneurcioniae. Figure 3 shows the construction and elements of plasmid pCAI314. Figure 4 illustrates protection against C. pneumoniae infection by pCAI314 after DNA immunization, where the individual data points (empty diamonds) are shown for each animal, as well as the average (filled squares) and the standard deviation for each one of the groups.
DETAILED DESCRIPTION OF THE INVENTION In the genome of C. pneumoniae, open reading frames (ORFs) have been identified that encode chlamydial polypeptides. These polypeptides include polypeptides that are permanently found in the structure of the bacterial membrane, polypeptides that are present in the outer vicinity of the bacterial membrane, include polypeptides that are permanently found in the structure of the inclusion membrane, polypeptides that they are present in the outer vicinity of the inclusion membrane and polypeptides that are released into the cytoplasm of the infected schedule. These polypeptides can be used in vaccination methods to prevent and treat Chlamydia infection. In accordance with a first aspect of the invention, isolated polynucleotides encoding the precursor and mature forms of Chlamydia polypeptides are provided. An isolated polynucleotide of the invention codes for a polypeptide having an amino acid sequence that is homologous with a Chlamydia amino acid sequence, the Chlamydia amino acid sequences will be selected from the group consisting of the amino acid sequences as shown in SEQ ID. US: 2 or 4. The term "isolated polynucleotide" is defined as a polynucleotide removed from the environment in which it is naturally present. For example, a molecule of
DNA that occurs in nature, present in the genome of the bacterium, is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, for example, a cloning event
(amplification), if it is isolated. Normally, an isolated DNA molecule is free from the DNA regions
(for example, coding regions) of which it is immediately contiguous at the 5 'or 3' end in the natural genome. These isolated polynucleotides could be part of ur. vector or a composition and still be isolated since the vector or composition is not part of its natural environment. A polynucleotide of the invention may be in the form of RNA or DNA (e.g., cDNA, genomic DNA or synthetic DNA) or modifications or combinations thereof. The DNA can be double-stranded or single-stranded and, if it is from a single strand, it can be the coding strand or the strand that is not coding (antisense). The sequence encoding a polypeptide of the invention, as shown in SEQ ID NOS: 2 and 4, can be: (a) the coding sequence, as shown in SEQ ID NOS: 1 or 3; (b) a ribonucleotide sequence, derived by transcription of (a); or (c) a different coding sequence; the latter, as a result of the redundancy or degeneracy of the genetic code, which codes for the same polypeptides as the DNA molecules of which in SEQ ID NOS: 1 and 3 the nucleotide sequences are illustrated. By "homologous amino acid sequence" reference is made to an amino acid sequence that differs from the amino acid sequence shown in SEQ ID NOS: 2 or 4, only in one or more conservative amino acid substitutions or in one or more non-conservative amino acid substitutions, deletions or additions located at positions where these do not destroy the specific antigenicity of the polypeptide. Preferably, this sequence is at least 75%, more preferably 80% and most preferably 90% identical to the amino acid sequences shown in SEQ ID NOS: 2 or 4. The homologous amino acid sequences include sequences that are identical or practically identical to an amino acid sequence, as shown in SEQ ID NOS: 2 and 4. By "virtually identical amino acid sequence" reference is made to a sequence that is at least 90%, preferably 95%, with more preferably 97% and most preferably 99% identical to a reference amino acid sequence and which preferably differs from the reference sequence, if at all, in a majority of conservative amino acid substitutions. Conservative amino acid substitutions usually include substitutions between amino acids of the same class. These classes include, for example: (a) amino acids having uncharged polar side chains, such as asparagine, glutamine, serine, threonine and tyrosine; (b) amino acids having basic side chains, such as lysine, arginine and histidine; (c) amino acids having acid side chains, such as aspartic acid and glutamic acid; and (d) amino acids having non-polar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan and cysteine. Homology is usually measured using sequence analysis software (for example, the Sequence Analysis Software Package from Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wl 53705). Similar amino acid sequences are aligned to obtain the highest degree of homology (ie, identity). For this purpose, it may be necessary to introduce separations in the sequence. Once the optimal alignment has been established, the degree of homology (ie, identity) is established by recording all the positions in which the amino acids of both sequences are identical, with respect to the total number of positions. Alternatively, the homology can be determined by aligning the candidate sequence and the reference sequence, using an alignment tool, such as the dynamic programming algorithm, described in Needleman et al. , J. Mol. Biol. 48: 443 (1970), and the Align Program, a commercial software package produced by DNAstar, Inc., the teachings of these are incorporated herein by reference. After the initial alignment is performed, it can be refined by comparison with multiple sequence alignments of a family of related proteins. Once the alignment between the candidate and reference sequences was effected and refined, a percent homology figure is calculated. The individual amino acids of each sequence are compared sequentially, in accordance with similarity to each other. Similarity factors include size, shape and similar electrical charge. A particularly preferred method for determining amino acid similarities is the PAM250 matrix, described in Dayhoff et al. , 5 ATLAS OF PROTEIN SEQUENZ? AND STRUCTRURE 345-352 (1978 &Supp.), Incorporated herein by reference. First, a similarity number is calculated as the sum of amino acid similarity figures aligned by pairs. Insertions and deletions are ignored for the purposes of percent homology and identity. In accordance with the above, in this calculation the faults or punishments for separation are not used. The gross figure is then normalized by dividing it by the geometric mean of the figures of the candidate compound and the reference sequence. The geometric mean is the square root of the product of these figures. The normalized gross figure is the percentage of homology. Preferably, a homologous sequence is one that is at least 45%, more preferably 60% and most preferably 85% identical to (i) a coding sequence of SEQ ID NO: I (ii) a coding sequence of SEQ ID NO: 3. Polypeptides having a homologous sequence with one of the sequences shown in SEQ ID NOS: 2 and 4, include natural allelic variants, such as mutants and variants or any other variants that do not occur naturally, which are analogous in terms of antigenicity, with a polypeptide having a sequence, as shown in SEQ ID NOS: 2 or 4. An allelic variant is an alternating form of a polypeptide that is characterized as having a substitution, deletion or addition of one or more amino acids that practically do not alter the biological function of the polypeptide. By "biological function" reference is made to the function of the polypeptide in the cells in which it occurs naturally, even if the function is not necessary for the growth or survival of the cells. For example, the biological function of a porin is to allow the cells present in the extracellular medium to enter the cells. The biological function is different from the antigenic function. A polypeptide can have more than one biological function. Allelic variants are very common in nature. For example, a species of bacteria, for example, C. pneumoniae, is usually represented by a variety of strains that differ from each other in minor allelic variations. Of course, a polypeptide that fulfills the same biological function in different strains can have an amino acid sequence that is not identical in each of the strains. This allelic variation can also be reflected at the polynucleotide level. Support for the use of these allelic variants of polypeptide antigens comes from, for example, chlamydial MOMP antigen studies. The amino acid sequence of MOMP varies from strain to strain, even cross-linked antibody binding plus neutralization of infectivity occurs, indicating that MOMP, when used as an immunogen, has tolerance to amino acid variations.
Polynucleotides, for example, DNA molecules, which code for allelic variants can be easily recovered by polymerase chain reaction (PCR) amplification of genomic bacterial DNA extracted by conventional methods. This includes the use of synthetic oligonucleotide primers that match the 5 'end and the 3' end of the coding domain. Suitable primers can be designed, in accordance with the nucleotide sequence information provided in SEQ ID NOS: 1 and 3. Typically, a primer can consist of 10 to 40, preferably 15 to 25 nucleotides. It may also be advantageous to select primers containing C and G nucleotides in a sufficient proportion to ensure efficient hybridization; for example, an amount of nucleotides C and G of at least 40%, preferably 50% of the total number of nucleotides. Useful homologs can be designed that do not occur naturally, using known methods to identify regions of an antigen that are likely to be tolerant to changes in amino acid sequence and / or deletions. For example, antigen sequences from different species can be compared to identify conserved sequences. Polypeptide derivatives that are encoded by the polynucleotides of the invention include, for example, fragments, polypeptides having large internal deletions derived from full-length polypeptides and fusion proteins. The polypeptide fragments of the invention can be derived from a polypeptide having a homologous sequence with any of the sequences shown in SEQ ID NOS: 1 and 3, insofar as the fragments retain the desired substantial antigenicity of the precursor polypeptide ( specific antigenicity). The polypeptide derivatives can also be constructed by large internal deletions that remove a significant portion of the precursor polypeptide, while retaining the desired specific antigenicity. In general, polypeptide derivatives must have a length of at least 12 amino acids to maintain antigenicity. Advantageously, they may be at least 20 amino acids, preferably at least 50 amino acids, more preferably at least 75 amino acids and most preferably at least 100 amino acids long. Useful polypeptide derivatives, e.g., polypeptide fragments, can be designed using computer-assisted analysis of the amino acid sequences, to identify sites on protein antigens that have potential as antigenic regions of surface exposed. Hughes et al. , Infect. Immun. 60: 3497 (1992). Polypeptide fragments and polypeptides having large internal deletions can be used to reveal epitopes that are otherwise masked in the precursor polypeptide and which can be of importance in inducing, for example, a protective T cell-dependent immune response. Deletions can also eliminate immunodominant regions of high variability between strains. In the field of immunology, an accepted practice is to use fragments and variants of protein immunogens such as vaccines and immunogens, as all that is required to induce an immune response in a protein can be a small region (for example, 8 a 10 amino acids) of the protein. This has been done for several vaccines against other pathogens other than Chlamydia. For example, short synthetic peptides corresponding to antigens exposed on the surface of pathogens, such as mammary tumor virus in murine, peptide containing 11 amino acids (Dion, et al., Virology 179: 1-11 (1990)); Semliki Forest virus, peptide containing 16 amino acids (Snijders et al., J. Gen. Virol. 72: 557-565 (1991)); and canine parvovirus, two overlapping peptides, each containing 15 amino acids (Langeveld et al., Vaccine 12: 1473-1480 (1994)) have been shown to be effective vaccine antigens against their respective pathogens. Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions can be constructed using standard methods (see, for example, Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley &Sons Inc., (1994)); for example, by PCR, including reverse PCR by restriction enzyme treatment of the cloned DNA molecules or by the method of Kunkel et al. . { Proc. Nati Acad. Sci. USA 82: 448 (1985)); biological material that can be obtained Strategene. A polypeptide derivative can also be produced as a fusion polypeptide containing a polypeptide or a polypeptide derivative of the invention fused, for example, at the N or C terminus, with any other polypeptide. For the construction of DNA encoding the amino acid sequence corresponding to the hybrid fusion proteins, a first DNA encoding the amino acid sequence corresponding to the portions of the nucleotide sequence CPN100202 (SEQ ID NOS: 1 or 3) ) is linked to a second DNA using the methods described, for example, in U.S. Patent 5,844,095, incorporated herein by reference. Then, a product can easily be obtained by translating the gene fusion. Vectors for expressing fusion polypeptides are available in commercial form, such as the pMal-c2 or pMal-p2 systems from New England Biolabs, where the fusion peptide is a maltose binding protein, the glutathione-S-system transferase from Pharmacia or the His-Tag system, which can be obtained from Novagen. These and other expression systems provide convenient means for further purification of the polypeptides and derivatives of the invention. Another particular example of the fusion polypeptides included in the invention includes a polypeptide or polypeptide derivative of the invention, fused to a polypeptide having adjuvant activity, such as for example the subunit of either the cholera toxin or the toxin thermolabile of E. coli. Various possibilities can be used to achieve fusion. First, the polypeptide of the invention can be fused to the N-terminus or preferably to the C-terminus of the polypeptide having adjuvant activity. Second, a polypeptide fragment of the invention can be fused within the amino acid sequence of the polypeptide having adjuvant activity.mR.
As mentioned above, the polynucleotides of the invention code for Chlamydia polypeptides in precursor or mature form. They can also code for hybrid precursors containing heterologous signal peptides, which can mature into polypeptides of the invention. By "heterologous signal peptide" reference is made to a signal peptide that is not found in the precursor that occurs in the nature of a polypeptide of the invention. A polynucleotide of the invention, having a homologous coding sequence, hybridizes, preferably under stringent conditions, with a polynucleotide having a sequence as shown in SEQ ID NOS: 1 and 3. Hybridization methods are described, example, in Ausubel et al. , CURRENT PROTOCOLS IN MOLECULAR BIOLOGÍG, John Wiley & Sons Inc., (1994)); Silhavy et al. , EXPERIMENTS WITH GENE FUSIONS, Cold Spring Harbor Laboratory Press (1984); Davis et al. , A MANUAL FOR GENETIC ENGINEERING: ADVANCSD BACTERIAL GENETICS, Cold Spring Harbor Laboratory Press (1980), incorporated here as a reference. The important parameters that can be considered to optimize the hybridization conditions are reflected in a formula that allows the calculation of a critical value, the fusion temperature above which two complementary DNA strands separate. Cascy and Davidson, Nucí.
Acid Res. 4: 1539 (1977). This formula is the following:
Tm = 81.5 + 0.5x (% G + C) + 1.6 log (positive ion concentration) - 0.6x (% formamide).
Under appropriate extreme conditions, the hybridization temperature (Th) is approximately 20-40 ° C, 20-25 ° C or, preferably, 30-40 ° C below the calculated Tm. Those skilled in the art will understand that optimum salt and temperature conditions can easily be determined empirically in preliminary experiments, using conventional methods. For example, stringent conditions can be obtained for both prehybridization and hybridization incubations, (i) from 4 to 16 hours at 42 ° C in 6xSSC containing 50% formamide or (ii) from 4 to 16 hours at 65 ° C in an aqueous solution of 6xSSC (1 M NaCl, 0.1 M sodium citrate (pH 7.0)). For polynucleotides containing 30 to
600 nucleotides, the above formula is used and then corrected by subtracting (600 / size of the polynucleotide in base pairs). The extreme conditions are defined by a Th that is 5 to 10 ° C below Tm. Hybridization conditions with oligonucleotides shorter than 20 to 30 bases do not exactly follow the rules discussed above. In these cases, the formula for calculating the Tm is as follows: Tm = 4x (G + C) +2 (A + T). For example, a fragment of 18 nucleotides of 50% G + C would have an approximate Tm of 54 ° C. A polynucleotide molecule of the invention, which contains RNA, DNA or modifications or combinations thereof, can have several applications. For example, a DNA molecule can be used in: (i) a process for producing the encoded polypeptide in a recombinant host system, (2) the construction of vaccine vectors, such as the smallpox viruses, which are also used in methods and compositions to prevent and / or treat Chlamydia infection, (iii) as a vaccine agent (as well as an RNA molecule), in naked or direct (naked) form or in formulated form with a carrier vehicle. delivery and, (iv) the construction of attenuated Chlamydia strains, which can overexpress a polynucleotide of the invention or express it in a modified and mutated form, as a non-toxic form, if appropriate. For vaccine compositions and uses of the proteins and peptides and coding nucleotides of the present invention for protection against diseases caused by Chlamydia, it is not preferred to use naked DNA that codes for the protein or peptides and the administration of these nucleotides intranasally or intramuscularly. For these proteins, it is preferred to administer the coding nucleic acids by other routes, such as intradermal and / or by encoding nucleic acid formulation to improve (or help) the immune response. It is also preferred to include the coding nucleic acid as part of a recombinant living vector, such as a viral or bacterial vector to be used as the immunization agent. It is also preferred to immunize with vaccine formulations comprising the same proteins or polypeptides of the invention. These vaccine formulations may include the use of adjuvants. According to a second aspect of the invention, there is thus provided: (i) an expression cassette containing a DNA molecule of the invention, placed under the control of the elements required for expression, in particular, under the control of an appropriate promoter; (ii) an expression vector containing an expression cassette of the invention; (iii) a prokaryotic or eukaryotic cell transformed or transfected with an expression cassette and / or a vector of the invention, as well as (iv) a process for producing a polypeptide or polypeptide derivative encoded by a polynucleotide of the invention, including culturing a prokaryotic or eukaryotic cell transformed or transfected with an expression cassette and / or vector of the invention, under conditions that allow the expression of the DNA molecule of the invention and the recovery of the encoded polypeptide or polypeptide derivative of the cell culture. From prokaryotic and eukaryotic hosts a recombinant expression system can be selected. Eukaryotic hosts include yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris), mammalian cells (e.g., COSI cells, NIH3T3 or JEG3), arthropod cells (e.g., Spodoptera frugiperda (SF9)) and plant cells. Preferably, a prokaryotic host, such as E. coli, is used. Bacterial and eukaryotic cells are available to those skilled in the art from several different sources, for example, the American Type Culture Collectioin (ATCC, Rockville, Maryland). The choice of the expression system depends on the desired characteristics of the expressed polypeptide. For example, it may be useful to produce a polypeptide of the invention in a particular lipidated form or in any other form. The choice of the expression cassette will depend on the selected host system, as well as on the desired characteristics for the expressed polypeptide. Typically, an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; an initiation codon (ATG) if necessary, a region encoding a signal peptide, eg, a lipidation signal peptide; a DNA molecule of the invention; a stop codon and, optionally, a 3 'terminal region (translation and / or transcription terminator). The signal peptide coding for the region is adjacent to the polynucleotide of the invention and placed in the appropriate reading frame. The region encoding the signal peptide can be homologous or heterologous to the DNA molecule encoding the mature peptide and can be specific to the host secretion apparatus used for expression. The open reading frame constituted by the DNA molecule of the invention, alone or together with the signal peptide, is placed under the control of the promoter, so that transcription and translation occur in the host system. Promoters, the regions encoding the signal peptide are widely known and available to those skilled in the art and include, for example, the Salmonella Typhi murium promoter (and derivatives) that is inducible by arabinose (araB promoter) and it is functional in Gram-negative bacteria, such as E. coli (as described in U.S. Patent No. 5,028,530 and in Cagnon et al., (Cagnon et al., Protein Engineering 4: 843 (1991)); the promoter of the bacteriophage T7 gene encoding the RNA polymerase, which is functional in several strains of E. coli expressing T7 polymerase (described in U.S. Patent No. 4,952,496), OspA lipidation signal peptide and lipidation signal peptide RlpB (Takase et al., J. Bact., 169: 5692 (1987).) The expression cassette is usually part of an expression vector, which is selected for its ability to replicate in the system. chosen expression. Expression vectors (eg, plasmid or viral vectors) can be chosen from those described in Pouwels et al. , (CLONING VECTORS: LABORATORY MANUAL, 85, Supp. 1987). These can be acquired in different commercial sources. Methods for transforming / transfecting host cells with expression vectors will depend on the host system selected, as described in Ausubel et al. , CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & amp;; Sons Inc., (1994). After expression, a recombinant polypeptide of the invention (or a polypeptide derivative) is produced and remains in the intracellular compartment, secreted / excreted into the extracellular medium or in the periplasmic space or embedded in the cell membrane. The polypeptide can then be recovered in a substantially purified form of the cell extract or the supernatant after centrifugation of the recombinant cell culture. Typically, the recombinant polypeptide can be purified by affinity purification based on antibodies or by any other method that can be readily adapted by one skilled in the art, such as by gene fusion in a small affinity binding domain. Affinity-based purification methods are also available to purify a polypeptide of the invention, extracted from a strain of Chlamydia. Antibodies useful for immunoaffinity purification of the polypeptides of the invention can be obtained as described below. A polynucleotide of the invention may also be useful in the field of vaccines, for example, to effect vaccination with DNA. There are two main possibilities, using either a viral or bacterial host as a gene delivery vehicle (live vaccine vector) or administering the gene in free form, for example, inserted in a plasmid. The therapeutic or prophylactic efficacy of a polynucleotide of the invention can be evaluated, as described below. In accordance with the foregoing, in a third aspect of the invention, there is provided: (i) a vaccine vector such as a pox virus, which contains a DNA molecule of the invention, placed under the control of the elements required for The expression; (ii) a composition of material containing a vaccine vector of the invention, together with a diluent or carrier; particularly (iii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a vaccine vector of the invention; (iv) a method for inducing an immune response against Chlamydia in a mammal (e.g., a human; alternatively, the method can be used in veterinary applications to treat or prevent Chlamydia infection of animals, e.g. , of cats or birds), which includes administering to the mammal an immunogenically effective amount of a vaccine vector of the invention to produce an immune response, eg, a protective or therapeutic immune response against Chlamydia; and, in particular, (v) a method to prevent and / or treat a Chlamydia infection
(for example, C. trachomatis, C. psi ttaci, C. pneumoniae, C. pecorum), which includes administering a prophylactic or therapeutic amount of a vaccine vector of the invention to the individual in need thereof. Additionally, the third aspect of the invention encompasses the use of a vaccine vector of the invention in the preparation of a medicament for preventing and / or treating Chlamydia infection. A vaccine vector of the invention may express one or more polypeptides or derivatives of the invention, as well as at least one additional Chlamydia antigen, fragment, homologue, mutant or derivative thereof. In addition, it can express a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), which increases the immune response (adjuvant effect). Thus, a vaccine vector can include an additional DNA sequence encoding, for example, a chlamydial antigen or a cytokine, placed under the control of the elements required for expression in a mammalian cell. Alternatively, a composition of the invention may include several vaccine vectors, each of which is capable of expressing a polypeptide or derivative of the invention. A composition may also contain a vaccine vector capable of expressing an additional Chlamydia antigen or a subunit, fragment, homologous, mutant or derivative thereof; or a cytokine such as IL-2 or IL-12.
In vaccination methods for treating or preventing infection in a mammal, a vaccine vector of the invention can be administered by any conventional route in use in the field of vaccines, particularly, to a mucosal surface (eg, ocular, intranasal). , oral, gastric, pulmonary, intestinal, rectal, vaginal or urinary tract) or through the parenteral route (eg, subcutaneous, intradermal, intramuscular, intravenous or intraperitoneal). Preferred routes depend on the choice of vaccine vector. The administration can be carried out in a single dose or repeated at intervals. The appropriate dose depends on several parameters which are understood by those skilled in the art, such as the same vaccine vector, the route of administration or the condition of the mammal to be vaccinated (weight, age and the like). The live vaccine vectors available in the art include viral vectors, such as adenovirus, alphavirus and smallpox virus, as well as bacterial vectors, for example, Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacillus Calmette-Guérin (BCG) and Streptococcus. . In U.S. Patent No. 4,920,209, an example of an adenovirus vector is described, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention. The vectors of the smallpox virus that may be used include, for example, vaccinia virus and canarypox virus, described in U.S. Patent No. 4,722,848 and U.S. Patent No. 5,364,773, respectively (see also, Tartaglia et al., Virology 188: 217 (1992)) for a description of the vaccinia virus vector; and Taylor et al. , Vaccine 13: 539 (1995) for a reference of canarypox). Smallpox virus vectors capable of expressing a polynucleotide of the invention can be obtained by homologous recombination, as described in Kieny et al. , Nature 312: 163 (1984), so that the polynucleotide of the invention is inserted into the viral genome under conditions suitable for expression in mammalian cells. In general, the dose of the viral vaccine vector, for therapeutic or prophylactic use, may be from about lxlO4 to lxlO11, advantageously from about lxlO7 to lxlO10, preferably from about lxlO7 to lxlO9 plaque forming units per kilogram. . Of preference, the viral vectors are administered parenterally; for example, in three doses, with four weeks of separation. Those skilled in the art recognize that it is preferable to avoid the addition of a chemical adjuvant to a composition containing a viral vector of the invention and, in this way, minimize the immune response to the viral vector itself. Nontoxicgenic Vibrio cholerae strains that are useful as a live oral vaccine are described in Mekalanos et al. , 306: 551 (1983) and in U.S. Patent No. 4,882,278 (strain in which a significant amount of the coding sequence of each of the two ctxA alleles has been deleted so that the toxin is not produced functional cholerae); WO 92/11354
(strain in which the irgA site is inactivated by mutation, this mutation can be combined into a single strain with ctxA mutations); and WO 94/1533 (mutant deletion lacking the functional DNA sequences ctxA and attRSI). These strains can be genetically engineered to express heterologous antigens, as described in WO 94/19482. A dose of effective vaccine of a strain of Vibrio cholerae capable of expressing a polypeptide or polypeptide derivative encoded by a DNA molecule of the invention may contain, for example, between about 1 × 10 5 and 1 × 10 9, preferably about 1 × 10 6 and lx108 of viable bacteria in an appropriate volume for the selected administration route. Preferred routes of administration include all mucosal pathways; most preferably, these vectors are administered intranasally or orally. The attenuated Salmonella typhmurium strains, genetically designed or not for the recombinant expression of heterologous antigens and their use as oral vaccines, are described in Nakayama et al. , Bio / Technology 6: 693 (1988) and WO 92/11361. Preferred routes of administration include all mucosal pathways; most preferably, these vectors are administered intranasally or orally. Other bacterial strains useful as vaccine vectors are described in High et al. , EMBO 11: 1991 (1992); Size ore et al. , Science 270: 299 (1995) (Shigella flexneri); Medaglini et al. , Proc. Nati Acad. Sci. USA 92: 6868 (1995). { Streptococcus gordonii); and Flynn, Cell. Mol. Biol. 40: 1 (1994), WO 88/6626, WO / 90/0594, WO 91/13157, WO 92/1796 and WO 92/21376 (Bacille Calmette Guerin). In bacterial vectors, the polynucleotide of the invention can be inserted into the bacterial genome or can remain in the free state, transported in a plasmid. An adjuvant may also be added to the composition containing a bacterial vaccine vector. Those skilled in the art are aware of various adjuvants. Preferred adjuvants can be selected from the list given below.
According to a fourth aspect of the invention, there is also provided: (i) a composition of material containing a polynucleotide of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention; (iii) a method for inducing an immune response against Chlamydia, in a mammal, by administering to the mammal an immunogenically effective amount of a polynucleotide of the invention to produce an immune response, eg, a protective immune response against Chlamydia; and, particularly (iv) a method for preventing and / or treating a Chlamydia infection (eg, C. trachomatis, C. psi ttaci, C. pneumoniae or C. pecorum), by administering a prophylactic or therapeutic amount of a polynucleotide of the invention to an individual who needs it. Additionally, the fourth aspect of the invention encompasses the use of a polynucleotide of the invention in the preparation of a medicament for preventing and / or treating Chlamydia infection. The fourth aspect of the invention preferably includes the use of a DNA molecule placed under conditions for expression in a mammalian cell, for example, in a plasmid that is unable to replicate in mammalian cells and to be integrated into virtually any genome. mammal. The polynucleotides (DNA or RNA) of the invention can also be administered to a mammal for vaccine purposes, for example, therapeutic or prophylactic. When a DNA molecule of the invention is used, it can be in the form of a plasmid that is incapable of replicating in a mammalian cell and incapable of integrating into the mammalian genome. Normally, a DNA molecule is placed under the control of a promoter suitable for expression in a mammalian cell, the promoter can function in a ubiquitous or tissue-specific manner. Example of promoters that are not tissue-specific include the above cytomegalovirus (CMV) promoter (described in U.S. Patent No. 4,168,062) and the Rous Sarcoma virus promoter (described in Norton &Coffin,
Molec. Cell Biol. 5: 281 (1985)). The desmin promoter (Li et al., Gene 78: 243 (1989), Li &Paulin, J. "Biol. Chem.
266: 6562 (1991), and Li & Paulin, J. Biol. Chem. 268: 10403
(1993)) is tissue-specific and promotes expression in muscle cells. More generally, useful vectors are described inter alia WO 94/21797 and Hartikka et al. , Human Gene Therapy 7: 1205 (1996). For DNA / RNA vaccination, the polynucleotide of the invention can encode a precursor or mature form. When coding for a precursor form, the precursor form can be homologous or heterologous. In the latter case, a eukaryotic leader sequence, such as the leader sequence of tissue-type plasminogen factor (tPA), can be used. A composition of the invention may contain one or more polynucleotides of the invention. It may also contain at least one additional polynucleotide that codes for another Chlamydia antigen or for a fragment, derivative, mutant or analogue thereof. A polynucleotide that codes for cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), can also be added to the composition, so that the immune response is increased. These additional polynucleotides are placed under the appropriate control for expression. Advantageously, the DNA molecules of the invention and / or the additional DNA molecules that are to be included in the same composition can be transported in the same plasmid. Standard techniques of molecular biology can be used in the preparation of the therapeutic polynucleotide of the present invention to prepare and purify polynucleotides. For use as a vaccine, a polynucleotide of the invention can be formulated in accordance with various methods. First, a polynucleotide can be used in a direct form, free of any delivery vehicles, such as anionic liposomes, cationic lipids, microparticles, for example, gold microparticles, precipitation agents, for example, calcium phosphate or any other agent that facilitates transfection. In this case, the polynucleotide can simply be diluted in a physiologically acceptable solution, such as a sterile saline solution or sterile buffered saline, with or without a carrier. When present, the carrier is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as is provided by a sucrose solution, for example, a solution containing 20% sucrose. Alternatively, a polynucleotide may be associated with agents that aid cell absorption. Among others, these may be: (i) supplemented with a chemical agent that modifies cellular permeability, such as bupivacaine (see, for example, WO 94/16737), (ii) encapsulated in liposomes or (iii) associated with cationic lipids or silica, gold or tungsten microparticles. Anionic and neutral liposomes are well known in the art (see, for example, LIPOSOMES: A PRACTICAL APPROACH, RPC New Ed, IRL press (1990)), for a detailed description of methods for preparing liposomes) and are useful for delivery a wide range of products, including polynucleotides. Cationic lipids are also known in the art and are commonly used for gene delivery. These lipids include Lipofectin ™ also known as DOTMA (N- [1- (2-3-dioleyloxy) propyl] -N, N, N-trimethylammonium chloride), DOTAP (1,2-bis (oleoyloxy) -3- (trimethylammonium propane), DDAB (dimethyldioctadecylammonium bromide), DOGS (dioctadecylamidologlyl spermine) and cholesterol derivatives, such as DC-Chol
(3 beta- (N- (N ', N' -cimethyl-aminomethane) -carbamoyl) cholesterol). A description of these cationic lipids can be found in EP 187,702, WO 90/11092,
U.S. Patent No. 5,283,185, WO 91/15501, WO 95/26356 and U.S. Patent No. 5527,928. Cationic lipids for gene delivery are preferably used in association with a neutral lipid, such as DOPE (dioleyl phosphatidylethanolamine), as described, for example, in WO 90/11092. Other compounds that facilitate transfection can be added to a formulation containing cationic liposomes. Some of them are described, for example, in WO 93/18759, WO 93/19768, WO 94/25608 and WO 95/2397. These include, among others, spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO 93/18759) and membrane permeabilization compounds, such as GALA, Gramicidin S and cationic bile salts. (see, for example, WO 93/19768). Gold or tungsten microparticles can also be used for gene delivery, as described in WO 91/359, WO 93/17706 and Tang et al. , (Nature 356: 152 (1992)). In this case, the polynucleotides coated with microparticles can be injected through the intradermal or intraepidermal routes, using a needleless injection device ("gene gun"), such as those described in U.S. Patent No. 4,945,050, in U.S. Patent 5,015,580 and WO 94/24263. The amount of DNA that will be used in the recipient of the vaccine depends on, for example, the concentration of the promoter used in the construction of the DNA, the immunogenicity of the expressed gene product, the condition of the mammal that will be the target of the administration (by example, its weight, age and general state of general of the mammal), the mode of administration and the type of formulation. In general, a therapeutic or prophylactically effective dose of about 1 μg to 1 mg, preferably about 10 μg to 800 μg, and more preferably about 25 μg to 250 μg, can be administered to human adults. The administration can be carried out in a single dose or repeated at intervals. The route of administration can be any conventional route used in the field of vaccines. As a general guide, a polynucleotide of the invention can be administered through a mucosal surface, for example, an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal and urinary tract surface.; or through a parenteral route, for example, by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal or intramuscular route. The choice of route of administration will depend on, for example, the formulation selected. A polynucleotide formulated in association with bupivacaine is advantageously administered to the muscles. When a neutral or anionic liposome or a cationic lipid, such as DOTMA or DC-Chol, is used, the formulation can be injected advantageously through the intravenous, intranasal (aerosol), intramuscular, intradermal and subcutaneous routes. Via the intramuscular, intradermal or subcutaneous routes, a polynucleotide can be administered directly in a direct manner. Although not fully required, this composition may also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferred, such as, for example, PS21, which is described in U.S. Patent No. 5,057,546. The sequence information provided in the present application allows the design of specific nucleotide primers and probes, which can be used for diagnosis. Accordingly, in a fifth aspect of the invention, there is provided a nucleotide probe or primer having a sequence that is found or derived by degeneracy of the genetic code from a sequence shown in SEQ ID NOS: 1 and 3 The term "probe", as used in the present application, refers to DNA molecules (preferably single-stranded) or RNA (or modifications or combinations thereof) that hybridize under stringent conditions, as defined above. , in nucleic acid molecules having sequences homologous to those shown in SEQ ID NOS: 1 and 3 or to a complementary or antisense sequence. In general, the probes are significantly shorter than the full length sequences shown in SEQ ID NOS: 1 and 3; for example, they may contain from about 5 to 100, preferably from about 10 to 80 nucleotides. In particular, the probes have sequences that are at least 75%, preferably at least 85%, more preferably 95% homologous to a portion of a sequence as shown in SEQ ID NOS: 1 and 3 or that are complementary of these sequences. The probes may contain modified bases, such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine or diamino-2,6-purine. Sugar or phosphate residues can also be modified or replaced. For example, a deoxyribose residue can be replaced by a polyamide (Nielsen et al., Science 254: 1497 (1991)) and the phosphate residues can be replaced by ester groups, such as diphosphate ester, alkyl, arylphthalate and phosphorothionate. In addition, the 2'-hydroxyl group in the ribonucleotides can be modified by the inclusion of, for example, alkyl groups. The probes of the invention can be used in diagnostic tests, such as capture or detection probes. These capture probes can be conveniently immobilized on a solid support, directly or indirectly, by covalent means or by passive adsorption. A detection probe can be labeled by a detection marker selected from radioactive isotopes; enzymes such as peroxidase, alkaline phosphatase and enzymes capable of hydrolyzing a chromogenic, fluorogenic or luminescent substrate; compounds that are chromogenic, fluorogenic or luminescent; analogs of the nucleotide base and biotin. The probes of the invention can be used in any conventional hybridization technique, such as dotted tference (Maniatis et al., MOLECULAR CLONING: A LABORATORY MANUAL (1982) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) , the southern transfer (Southern, J. Mol. Biol. 98: 503 (1975)), the northern blot (identical to the southern blot with the exception that RNA is used as the blank) or the sandwich technique (Dunn et al., Cell 12: 23 (1977)). This latter technique includes the use of a specific capture probe and / or a specific detection probe with nucleotide sequences that at least partially differ from each other. A primer is usually a probe of approximately 10 to 40 nucleotides that is used to initiate the enzymatic polymerization of DNA in an amplification process (eg, PCR), in an elongation process or in a reverse transcription method. In a diagnostic method that includes PCR, the primers can: be labeled. Thus, the invention also encompasses: (i) a reagent containing a probe of the invention to detect and / or identify the presence of Chlamydia in a biological material; (ii) a method to detect and / or identify the presence of Chlamydia in a biological material, in which: (a) of the biological material a sample is recovered or derived, (b) the DNA or RNA is extracted from the material and denatured and (c) are exposed to the probe of the invention, eg, a capture, detection or both probe, under stringent hybridization conditions, such that hybridization is detected; and (iii) a method for detecting and / or identifying the presence of Chlamydia in a biological material, in which: (a) of the biological material a sample is recovered or derived, (b) of the sample is extracted DNA, (c) ) the extracted DNA is primed with at least one primer, and preferably with two primers of the invention and amplified by the polymerase chain reaction and (d) the amplified DNA fragment is produced. As mentioned previously, polypeptides that can be produced with the expression of the newly identified open reading frames are useful vaccine agents. Therefore, a sixth aspect of the invention features a polypeptide or substantially purified polypeptide derivative having an amino acid sequence encoding a polynucleotide of the invention. A "substantially purified polypeptide" is defined as a polypeptide that is separated from the environment in which it is naturally present and / or that is free from most polypeptides that are present in the environment in which it was synthesized. For example, a practically purified polypeptide is free of cytoplasmic polypeptides. Those skilled in the art will understand that the polypeptides of the invention can be purified from a natural source, i.e., a Chlamydia strain, or they can be produced by recombinant means. Homologous polypeptides or polypeptide derivatives encoded by the polynucleotides of the invention can be classified according to specific antigenicity, by cross-reactivity tests with an antiserum grown against the reference polypeptide, having an amino acid sequence shown in SEQ. ID NOS: 2 and 4. In summary, a monospecific hyperimmune antiserum can be obtained against a reference purified polypeptide, either as a fusion polypeptide, for example, an expression product of MBP, GST, or tagging systems. His or a synthetic peptide that is predicted as antigenic. The homologous polypeptide or the derivative classified according to the specific antigenicity can be produced as it is or as a fusion polypeptide. In this latter case and if the antiserum is also obtained against a fusion polypeptide, the two different fusion systems will be employed. The specific antigenicity can be determined according to several methods, including Western blotting (Towbin et al., Proc. Nati, Acad. Sci. USA 76: 4350 (1979)), dot blotting and ELISA, as outlined below. In a Western blot assay, the product to be classified, either as a purified preparation or as a total extract of E. coli, is subjected to SDS-Page electrophoresis as described in Laemmli, Nature 227: 680 (1970). ). After transfer to a nitrocellulose membrane, the material is further incubated with the monospecific hyperimmune antiserum diluted in a range of dilutions ranging from about 1: 5 to about 1: 5000, preferably between about 1: 100 and 1 : 500 The specific antigenicity is mastered once a corresponding band of the product exhibits reactivity to any of the dilutions in the above range. In an ELISA assay, the product to be classified as preferred is used as the coating antigen. A purified preparation is preferred, although whole cell extract can also be used. In summary, approximately 100 μl of a preparation at about 10 μg protein / ml are distributed in the cavities of a 96-well polycarbonate ELISA plate. The plate is incubated for 2 hours at 37 ° C and then overnight at 4 ° C. The plate is washed with phosphate buffered saline solution (PBS) containing 0.05% Tween 20 (PBS / Tween buffer). The cavities are saturated with 250 μl of PBS containing 1% bovine serum albumin (BSA) to prevent non-specific binding of the antibody. After 1 hour of incubation at 37 ° C, the plate is washed with PBS / Tween buffer. The antiserum is serially diluted in the PBS / Tween buffer containing 0.5% BSA. 100 μl of the dilutions are added per cavity. The plate is incubated for 90 minutes at 37 ° C, washed and evaluated according to standard procedures. For example, an anti-rabbit goat peroxidase conjugate is added to the cavities when specific antibodies are cultured in rabbits. Incubation is carried out for 90 minutes at 37 ° C and the plate is washed. The reaction proceeds with the appropriate substrate and the reaction is measured by colorimetry (absorbance measured spectrophotometrically). Under the above experimental conditions, a positive reaction is shown with values of optical density (O.D.) greater than those of the non-immune control serum. In a dot transfer assay, a purified product is preferred, although a complete cell extract can also be used. In summary, a solution of the product at approximately 100 μg / ml is diluted twice in series in 50 mM Tris-HCl (pH 7.5). 100 μl of each dilution is applied to a 0.45 μm nitrocellulose membrane placed in a 96-well dot transfer apparatus (Biorad). The shock absorber is removed by applying vacuum to the system. The cavities are washed by the addition of 50 mM Tris-HCl (pH 7.5) and the membrane is air dried. The membrane is saturated with blocking buffer (50 mM Tris-HCl (pH 7.5) 0.15 M NaCl, 10 g / L skim milk) and incubated with an antiserum dilution of between about 1:50 and 1: 5000, preferably approximately 1: 500. The reaction is revealed according to standard procedures. For example, goat anti-rabbit peroxidase conjugate is added to the cavities when rabbit antibodies are used. The incubation is carried out 90 minutes at 37 ° C and then the spot or spot is washed. The reaction proceeds with the proper substrate and stops. The reaction is measured visually by the appearance of a colored spot, for example, by colorimetry. According to the above experimental conditions, a positive reaction is shown when a colored dot is associated with a dilution of at least or about 1: 5, preferably at least about 1: 500. The therapeutic or prophylactic efficacy of a polypeptide or derivative of the invention can be evaluated as described below. According to a seventh aspect of the invention, there is provided: (i) a composition of matter having a polypeptide of the invention together with a diluent or carrier, in particular, (ii) a pharmaceutical composition containing an effective amount in therapy or prophylaxis, of a polypeptide of the invention; (iii) a method for inducing an immune response against Chlamydia in a mammal, by administering to the mammal an effective amount in the immunogenic area, of a polypeptide of the infection in order to produce an immune response, for example a protective anti-Chlamydia immune response , and, particularly, (iv) a method for preventing and / or treating a Chlamydia infection, for example: C. trachomatis, C. psi ttaci, C. pneumoniae or C. pecorum), by administering a prophylactic or therapeutic amount of a polypeptide of the invention to an individual in need thereof. Additionally, the seventh aspect of the invention encompasses the use of a polypeptide of the invention in the preparation of a medicament for preventing and / or treating Chlamydia infection. The immunogenic compositions of the invention can be administered by any conventional route used in the field of vaccines, in particular towards a mucosal surface (eg, ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal or in the urinary tract) or parenterally (for example, subcutaneous, intradermal, intramuscular, intravenous or intraperitoneal). The choice of route administration depends on several parameters. For example, the adjuvant associated with the polypeptide. For example, if a mucosal adjuvant is used, the orally or intranasally it will be preferred if a lipid formulation or an aluminum compound is used, the parenteral route is preferred. In the latter case, the subcutaneous or intramuscular routes are the most preferred. The choice may depend on the nature of the vaccine agent. For example, a polypeptide of the invention fused to CTB or LTB will be best administered to a mucosal surface. A composition of the invention may contain one or more polypeptides or derivatives of the invention. It may also contain at least one additional Chlamydia antigen, or a subunit, fragment, homologue, mutant or derivative thereof. For use in the composition of the invention, a polypeptide or derivative thereof can be formulated within liposome or with liposomes, preferably in neutral or anionic liposomes, microspheres, ISCOMS or virus-like particles (VLPs). facilitate the administration and / or reinforcement of the immune response. These compounds are readily available to experts in this area, for example see: LIPOSOMES: A PRACTICAL APPROACH (supra). Adjuvants other than liposomes and the like can also be used and are known in the art. A suitable selection can be made conventionally by the experts, for example, from the list provided below. Administration can be achieved in a single dose or repeatedly, as necessary, at intervals to be determined by experts. For example, a priming dose may be followed by three booster doses at weekly or monthly intervals. A suitable dose depends on several parameters, including the recipient (for example, adult or child), particular antigen of the vaccine, route and frequency of administration, presence / absence or type of adjuvant and the desired effect (for example , protection and / or treatment), as determined by the expert in this area. In general, a vaccine antigen of the invention can be administered by a mucosal route in an amount ranging from about 10 μg to 500 mg, preferably between about 1 mg and 200 mg. For the parenteral administration route, the dose should normally not exceed 1 mg, and preferably should be approximately 10 μg. When used as vaccine agents, the polynucleotides and polypeptides of the invention may be used sequentially as part of a multi-step immunization process. For example, a mammal can be primed initially with a vaccine vector of the invention, for example a smallpox virus, for example, parenterally, and then reinforced twice with the polypeptide encoded by the vaccine vector, for example, mucosally. In another example, liposomes associated with a polypeptide or derivative of the invention can also be used for priming, and the reinforcement is carried out mucosally using a soluble polypeptide or derivative of the invention, in combination with a mucosal adjuvant ( example, LT). A polypeptide derivative of the invention is also useful as a diagnostic reagent for detecting the presence of anti-Chlamydia antibodies, for example, a blood sample. These polypeptides are about 5 to 80 amino acids in length, preferably between about 10 and 50, and may be labeled or untagged, depending on the diagnostic method. The diagnostic methods involve the reagents described below. During the expression of a DNA molecule of the invention, a polypeptide or polypeptide derivative is produced and can be purified using known laboratory techniques. For example, the polypeptide or polypeptide derivative can be produced as a fusion protein containing a fused tail that facilitates purification. The fusion product can be used to immunize a small mammal, for example a mouse or rabbit, in order to produce antibodies against the polypeptide or polypeptide derivative (monospecific antibodies). The eighth aspect of the invention then provides a monospecific antibody that binds to a polypeptide or polypeptide derivative of the invention. By "monospecific antibody" is meant an antibody that is capable of reacting with a single Chlamydia polypeptide, which occurs naturally. An antibody of the invention can be polyclonal or monoclonal. The monospecific antibodies can be recombinant, for example chimeric (for example, consisting of a variable region of murine origin associated with a human constant region), humanized (a constant structure of human immunoglobulin together with a hypervariable region of animal, for example of origin murine), and / or from a single chain. The polyclonal and monospecific antibodies may also be in the form of immunoglobulin fragments, for example F (ab) '2 or Fab fragments. The antibodies of the invention can be of any isotype, for example, IgG or IgA and the polyclonal antibodies can be of a single isotype or can contain a mixture of isotypes. Antibodies of the invention that are cultured against a polypeptide or polypeptide derivative of the invention can be produced and identified using standard immunological assays, eg, Western blot analysis, dot blot analysis or ELISA (see, for example, example, Coligan et al., CURRENT PROTOCOLS IN IMMUNOLOGY (1994) John Wiley & amp;; Sons, Inc., New York, NY). The antibodies can be used in diagnostic methods to detect the presence of a Chlamydia antigen in a sample, for example a biological sample. The antibodies can also be used in affinity chromatography methods to purify a polypeptide or polypeptide derivative of the invention. As mentioned below, these antibodies can be used in passive therapeutic and prophylactic immunization methods. Accordingly, a ninth aspect of the invention provides: (i) a reagent for detecting the presence of Chlamydia in a biological sample containing an antibody, polypeptide or polypeptide derivative of the invention; and (ii) a diagnostic method for detecting the presence of Chlamydia in a biological sample, by contacting the biological sample with an antibody, a polypeptide or a pclipeptide derivative of the invention, so that an immune complex is formed, and detecting this complex to indicate the presence of Chlamydia in the sample or the organism from which the sample was derived. Those skilled in the art will understand that the immune complex is formed between a component of the sample and the antibody, polypeptide or polypeptide derivative, according to which it is used, and that any material that has not been bound can be removed before the complex is detected. . As will be readily understood, a polypeptide reagent is useful for detecting the presence of anti-i Chlamydia antibodies in a sample, for example a blood sample, while an antibody of the invention can be used to classify a sample, for example gastric extract or biopsy, to determine the presence of Chlamydia polypeptides. For use in diagnostic applications, the reagent (for example the antibody, polypeptide or polypeptide derivative of the invention) can be in a free state or immobilized on a solid support, for example a tube, a bead or any other conventional support used in this field. Immobilization can be achieved using a direct or indirect means. The direct medium includes passive adsorption (non-covalent binding) or covalent binding between the support and the reagent. By "indirect means" is meant that an anti-reactive compound that interacts with a reagent is first attached to the solid support. For example, if a polypeptide reagent is used, an antibody that binds to it can serve as an anti-reagent, provided that binds to an epitope that is not involved in the recognition of antibodies in biological samples. Indirect means such as a ligand system and a receptor, for example, a molecule such as a vitamin, can also be employed, can be grafted onto the polypeptide reagent and the corresponding receptor can be immobilized on the solid phase. This is illustrated with the biotin-streptavidin system. Alternatively, an indirect means may be used, for example, the addition to the reagent of a peptide tail, chemically or genetically engineered, and the immobilization of the fused or grafted product by passive adsorption or covalent attachment of the peptide tail. According to a tenth aspect of the invention, there is provided a process for purifying, from a biological sample, a polypeptide or derivative of the polypeptide of the invention, which involves carrying out an affinity chromatography based on an antibody, in the biological sample, wherein the antibody is a monospecific antibody of the invention. For use in a purification process of the invention, the antibody can be of the polyclonal or monospecific type and preferably is of the IgG type. Purified IgG can be prepared from an antiserum using standard methods (see, for example, Coligan et al., Supra). The support material for conventional chromatography and standard methods for grafting antibodies is shown in ANTIBODIES: A LABORATORY MANUAL, D. Lane, E. Harlow, Eds. (1988). In summary, a biological sample, for example an extract of C. pneumoniae, preferably in a buffer solution, is applied to a chromatography material and preferably equilibrated with the buffer used in order to dilute the biological sample to be allowed to the polypeptide or polypeptide derivative of the invention (ie, the antigen) that is adsorbed on the material. The chromatography material, for example a gel or resin coupled to an antibody of the invention, can be in a column or in batch form. Unbound components are removed by washing and the antigen is eluted with a suitable elution buffer, for example glycine buffer or a buffer containing a chaotropic agent, for example, guanidine HCl or high salt concentration (e.g., 3 M MgCl2). The blunt fractions are coated and the presence of the antigen is detected, for example, by measuring the absorbance at 280 nm. An antibody of the invention can be classified according to its therapeutic efficacy as described below. According to the eleventh aspect of the invention there is provided: (i) a material composition containing a monospecific antibody of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing an effective therapeutic or prophylactic amount of a monospecific antibody of the invention, and (iii) a method of treating or preventing a Chlamydia infection (eg, C. trachomatis, C. psi ttaci, C. pneumoniae or C. pecorum), by administering a therapeutic or prophylactic amount of a. monospecific antibody of the invention, to an individual in need thereof. Additionally, the eleventh aspect of the invention abate the use of a monospecific antibody of the invention for the preparation of a medicament for treating or preventing Chlamydia infections.
For this purpose, the monospecific antibody can be of polyclonal or monoclonal type, preferably of the IgA isotype (predominantly). In passive immunization, the antibody can be administered to a mucosal surface of a mammal, for example, the gastric mucosa, for example orally or intragastrically, advantageously in the presence of a bicarbonate buffer. Alternatively, systemic administration, which does not require a bicarbonate buffer, can be performed. A monospecific antibody of the invention can be administered as a single active component or as a mixture with at least one monospecific antibody, specific for a different Chlamydia polypeptide. The amount of antibody and the particular regimen that is used can be easily determined by the experts. For example, for most purposes, effective regimens may be: daily administration of between about 100 and 1,000 mg of antibodies for one week, or three doses per day of about 100 to 1,000 mg of antibodies for two to three days. The therapeutic or prophylactic efficacy can be evaluated using standard methods in this field, for example, by measuring induction of a mucosal immune response or induction of therapeutic and / or protective immunity, using for example the mouse model with C. pneumoniae. Experts in this field will recognize that the strain of C. pneumoniae in the model can be replaced by another strain of Chlamydia. For example, the efficiency of DNA molecules and polypeptides from C. pneumoniae is preferably evaluated in a mouse model using a C. pneumoniae strain. Protection can be determined by comparing the degree of infection with Chlamydia to the control group. Protection is demonstrated when the infection is reduced compared to the control group. This evaluation can be done by polynucleotides, vaccine vectors, polypeptides and derivatives thereof, as well as with the antibodies of the invention. Adjuvants useful in any of the vaccine compositions described above are the following: Adjuvants for parenteral administration including aluminum compounds, for example aluminum hydroxide, aluminum phosphate and aluminum hydroxyphosphate. The antigen can be precipitated with the aluminum compound or adsorbed thereon, according to standard protocols. Other adjuvants, for example RIBI (ImmunoChem, Hamilton, MT), may be used in parenteral administration. Adjuvants for mucosal administration include bacterial toxins, for example cholera toxin (CT), E. coli thermolabile toxin (LT), Clostridium difficile toxin A and pertussis toxin (PT) or combinations, subunits, toxoids or mutants of the same. For example, a purified preparation of subunit B of the native cholera toxin (CTB) may be used. Fragments, homologs, derivatives and fusions of any of these toxins are also suitable, as long as they retain the adjuvant activity. Preferably, the mutant having reduced toxicity is used. Suitable mutants are described, as for example in WO 95/17211 (mutant Arg-7-Lys CT), WO 96/6627 (mutant Arg-192-Gly LT) and WO 95/34323 (mutant Arg-9-Lys and Glu-129-Gly PT). Additional LT mutants that can be used in the methods and compositions of the invention include, for example: Ser-63-Lys, Ala-69-Gly, Glu-110-Asp and Glu-112-Asp mutants. Other adjuvants such as bacterial monophosphoryl lipid A (MPLA) of for example, E. coli, Salmonella minnesota, Salmonella typhi urium or Shigella flexneri; Saponins or polylactide glycolide (PLGA) microspheres may be used in mucosal administration. Adjuvants useful for mucosal and parenteral administration include polyphosphazene (WO 95/2415), DC-chol (3 b- (N- (N 1, N '-dimethyl aminomethane) -carbamoyl) cholesterol (U.S. Pat., 283.185 and WO 96/14831) and QS-21 (WO 88/9336). Any pharmaceutical composition of the invention which contains a polynucleotide, a polypeptide, a polypeptide derivative or an antibody of the invention may be manufactured in a conventional manner. In particular, it can be formulated with a pharmaceutically acceptable carrier or diluent, for example, water or saline, as phosphate buffered saline. In general, a diluent or carrier may be selected based on the mode or route of administration, and with standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical needs for use in pharmaceutical formulations, are described in Remington's Pharmaceutical Sciences, a standard reference text in this field and in the USP / NF. The invention also includes methods wherein Chlamydia infection is treated by oral administration of a Chlamydia pclipeptide of the invention and a mucosal adjuvant, in combination with an antibiotic, an antacid, sucralfate or a combination thereof. Examples of the compounds that can be administered with the vaccine antigen and the adjuvants are antibiotics, including, for example, macrolides, tetracyclines and derivatives thereof (specific examples of antibiotics that may be used include azithromycin or dixycycline). or immunomodulators such as cytokines or steroids). In addition, compounds containing more than one of the aforementioned components coupled together can also be used. The invention also includes compositions for carrying out these methods, ie, compositions containing a Chlamydia antigen (or several antigens) of the invention, an adjuvant and one or more of the aforementioned compounds, in a pharmaceutically acceptable diluent or carrier. . The amounts of the aforementioned compounds which are used in the methods and compositions of the invention can be easily determined by the skilled person. In addition, an expert in this area can easily design treatment / immunization programs. For example, non-vaccine components can be administered on days 1 to 14, and the vaccine antigen + adjuvant can be administered on days 7, 14, 21 and 28. The above discussion generally describes the present invention. A more complete understanding may be obtained in relation to the following specific examples. These examples are described solely as a form of exemplification and are not intended to limit the scope of the invention. Changes in the form and substitution of equivalents are considered as circumstances that may be suggested or made easier by the invention. Although specific terms have been used herein, these terms are not intended to be descriptive or limiting in any way.
Example 1 Preparation of the plasmid vector pCAI314 containing the omp gene This example illustrates the preparation of a plasmid vector pCAI314 which contains the omp gene. The omp gene was amplified from Chlamydia pneumoniae genomic DNA by polymerase chain reaction (PCR) using a 5 ': 5' primer ATAAGAATGCGGCCGCCACCATGAAAAAAAAATTATCATTACTTGTAGGTT 3 '(SEQ ID NO: 5), which contains a Not I restriction site, a ribosome binding site, an initiation codon and the sequence encoding the N terminal sequence of omp and a 3 ': 5' primer GCGCCGGATCCGAAATATTCCCATGATATTTTG 3 '(SEQ ID NO: 6) including the sequence encoding the C terminal sequence of omp and a Bam Hl restriction site. The termination codon was excluded and an additional nucleotide was inserted to obtain a C-terminal fusion in frame with the Histidine tag. After amplification, the PCR fragment was purified by means of a QIAquick ™ PCR purification system (Qiagen), then digested with Not I and Barn Hl and cloned into the eukaryotic expression vector pCA-Myc-His described in Example 2 (Figure 3) with transcription under control of the human CMV promoter.
Example 2 Preparation of the eukaryotic expression vector pCA / Myc-His This example illustrates the preparation of the eukaryotic expression vector pCA / Myc-His. The plasmid peDNA3.1 (-) Myc-His C (Invitrogen) was restricted with Spe I and Bam Hl to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A of plasmid VR-1012 (Vical) was isolated on a Spe I / Bam Hl fragment. The fragments were ligated to produce pCA / Myc-His plasmid. The PCR fragment restricted with Not I / Bam Hl containing the omp gene was ligated to plasmid pCA / Myc-His restricted with Bam Hl and Not 1 to produce the plasmid pCAI314 (Figure 3). The resulting plasmid pCAI314 was transferred by electroporation to E. coli XL-1 blue (Stratagene) which was cultured in LB broth containing 50 μg / mL of carbenicillin. The plasmid was isolated by the large-scale DNA purification system Endo Free Plasmid Giga Kit ™ (Qiagen). The DNA concentration was determined by absorbance at 260 nm and then the plasmid was verified by gel electrophoresis and staining with ethidium bromide and compared with molecular weight standards. The 5 'and 3' ends of the gene were verified by sequencing, using a LiCor model 4000 DNA sequencer and primers labeled IRD-800.
Example 3 Protection against intranasal C. pneumoniae This example illustrates the immunization of mice to generate protection against intranasal stimulation with C. pneumoniae. Previously it has been shown that mice are suscepe to intranasal infection by different isolates of C. pneumoniae, Yang et al. , Infect. Immun. 61: 2037-2040 (1993). Strain AR-39 (Grayston, 1989) was used in Balb / c mice as a model of infection by stimulation, to examine the ability of chlamydia gene products supplied as naked DNA to elicit a response against a lung infection by C. pneumoniae subletal. Protective immunity is defined as an accelerated clearance of the lung infection. Groups of 7 to 9 adult male Balb / c mice were immunized intramuscularly (im) and intranasally (in) with plasmid DNA containing the coding sequence for C. pneumoniae omp as described in Examples 1 and 2 The groups of control animals were given saline or the plasmid vector lacking the insertion of a chlamydia gene. For immunization i.m. The left and right quadriceps were alternately injected with 100 μg of DNA in 50 μl of PBS (buffered phosphate saline) three times at 0, 3 and 6 weeks. For immunization i.n. the anesthetized animals aspirated 50 μl of PBS containing 50 μg of DNA, three times at 0, 3 and 6 weeks. At week 8, immunized mice were inoculated i.n. with 5 x 105 UFI of C. pneumoniae strain AR39 in 100 μl of SPG buffer in order to verify its ability to limit growth in stimulation with C. pneumoniae sublethal. On day 9 post-stimulation, the lungs were excised and immediately homogenized in SPG buffer (7.5% sucrose, 5 mM glutamate, 12.5 mM phosphate pH 7.5). The homogenate was stored frozen at -70 ° C until the time of the test. Dilutions of the homogenate were analyzed to verify the presence of infectious chlamydia, by inoculation in monolayers of susceptible cells. The inoculum was centrifuged in the cells at 3000 rpm for 1 hour, then the cells were incubated for three days at 35 ° C in the presence of 1 μg / mL of cycloheximide. After incubation, the monolayers were fixed with formalin and methanol and then immunoperoxidase staining was performed to detect the presence of Chlamydia inclusions using convalescent serum from rabbits infected with C. pneumoniae and metal-reinforced DAB as the peroxidase substrate. Figure 4 illustrates that mice immunized i.m. and i.n. with pCAI314 had pulmonary chlamydia titers lower than 4600 in 3 of 5 cases, while the value of values for control mice was 1800 to 23100 UFl / lung (mean 11811) and 16600 to 26100 UFl / lung (mean 22100) for controls immunized with saline or immunized with the unmodified vector, respectively (Table 1). The absence of protection with the unmodified vector confirms that the DNA itself was not responsible for the observed protective effect. This is further supported by the results obtained for an additional plasmid DNA construct, pdagA, which did not provide protection and for which the mean lung titers were similar to those obtained in the control mice immunized with saline. The pdagA construct is identical to pCAI314, with the exception that the nucleotide sequence coding for omp is substituted with a nucleotide sequence of C. pneumoniae that codes for the dagA protein.
Table 1 Bacterial Load (Inclusion Training Units by
Lung) in the Lungs of Balb / C Mice Immunized with
Several DNA Constructions of Immunization
EQUIVALENTS From the above description of the specific embodiments of the invention, it will be apparent that a unique Chlamydia antigen has been described. Although particular embodiments have been set forth in detail, this has been done only by way of example and for purposes of illustration, and no limitation is intended with respect to the scope of the appended claims. In particular, the inventor contemplates that various substitutions, alterations and modifications to the invention can be made without departing from the spirit and scope thereof, which is defined in the claims.
Claims (37)
- CLAIMS: 1. An isolated polynucleotide selected from the group consisting of: (a) a polynucleotide having a sequence comprising the nucleotide sequence SEQ ID NO: 1 and the functional fragments thereof; (b) a polynucleotide encoding a polypeptide having a sequence that is at least 75% homologous to SEQ ID NO: 2; and to the functional fragments thereof; and (c) a polynucleotide capable of hybridizing under extreme conditions to a polynucleotide having a sequence comprising the nucleotide sequence SEQ ID NO: 1 and the functional fragments thereof.
- 2. The polynucleotide of claim 1, linked to a second nucleotide sequence encoding a fusion polypeptide.
- 3. The nucleotide of claim 2, wherein the fusion polypeptide is a heterologous signal peptide.
- 4. The nucleotide of claim 2, wherein the polynucleotide encodes a functional fragment of the polypeptide having SEQ ID NO: 2.
- 5. An isolated polypeptide having a sequence that is at least 75% homologous to SEQ ID NO: 4 and functional fragments thereof.
- 6. The polypeptide according to claim 5, wherein the polypeptide has the sequence of SEQ ID NO: 2 or functional fragments thereof.
- 7. A polypeptide comprising the polypeptide of claim 5, linked to a fusion polypeptide.
- 8. The polypeptide according to claim 7, wherein the fusion polypeptide is a signal peptide.
- The polypeptide according to claim 7, wherein the fusion polypeptide comprises a heterologous polypeptide having adjuvant activity.
- 10. An expression cassette, comprising the polypeptide of claim 1 operably linked to a promoter.
- 11. An expression vector comprising the expression cassette of claim 10.
- 12. A host cell comprising the expression cassette of claim 10.
- 13. The host cell of claim 10, wherein the host cell is a prokaryotic cell.
- 14. The host cell of claim 13, wherein the host cell is a eukaryotic cell.
- 15. A method for producing a recombinant polypeptide CPN100314, comprising: (a) culturing a host cell of claim 12, under conditions that allow expression of the polypeptide; and (b) recovering the recombinant polypeptide.
- 16. A vaccine vector comprising the expression cassette of claim 10.
- 17. The vaccine vector of claim 16, wherein the mammalian host is a human.
- 18. The vaccine vector of claim 16, in a pharmaceutically acceptable excipient.
- 19. A pharmaceutical composition comprising an immunologically effective amount of the vaccine vector of claim 14.
- 20. A method for inducing an immune response in a mammal, wherein the method comprises: administering to the mammal an immunologically effective amount of the vaccine vector. of claim 16, wherein the administration induces an immune response.
- 21. A pharmaceutical composition comprising an immunologically effective amount of the polypeptide of claim 5 and a pharmaceutically acceptable diluent.
- 22. The pharmaceutical composition of claim 21, further comprising an adjuvant.
- 23. The pharmaceutical composition of claim 21, further comprising one or more of the Chlamydia antigens.
- 24. A method for inducing an immune response in a mammal, comprising: administering to the mammal an immunologically effective amount of the pharmaceutical composition of claim 21, wherein the administration induces an immune response.
- 25. A polynucleotide probe reagent capable of detecting the presence of Chlamydia in biological material, comprising a polynucleotide that hybridizes with the polynucleotide of claim 1, under extreme conditions.
- 26. The polynucleotide probe reagent of claim 25, wherein the reagent is a DNA primer.
- 27. A method of hybridization for detecting the presence of Chlamydia in a sample, comprising the steps of: (a) obtaining a polynucleotide from the sample; (b) hybridizing the polynucleotide obtained with a polynucleotide probe reagent of claim 21, under conditions that allow hybridization of the probe and the sample; and (c) detecting the hybridization of the detection reagent with a polynucleotide in the sample.
- 28. An amplification method for detecting the presence of Chlamydia in a sample, comprising the steps of: (a) obtaining the polynucleotide from the sample; (c) amplifying the polynucleotide obtained using one or more polynucleotide probe reagents of claim 25; and (c) detecting the amplified polypeptide.
- 29. A method to detect the presence of Chlamydia in a sample, comprising the steps of: (a) contacting the sample with a detection reagent that binds to the polypeptide CPN100314 to form a complex; and (b) detecting the complex formed.
- 30. The method according to claim 29, wherein the detection reagent is an antibody.
- 31. The method according to claim 30, wherein the antibody is a monoclonal antibody.
- 32. The method according to claim 30, wherein the antibody is a polyclonal antibody.
- 33. An affinity chromatography method for substantially purifying a CPN100314 polypeptide, comprising the steps of: (a) contacting a sample comprising a peptide CPN100314 with a detection reagent that binds to the polypeptide CPN100314 to form a complex; (b) isolating the complex formed; (c) dissociating the formed complex; and (d) isolating the dissociated polypeptide CPN100314.
- 34. The method according to claim 33, wherein the detection reagent is an antibody.
- 35. The method according to claim 34, wherein the antibody is a monoclonal antibody.
- 36. The method according to claim 34, wherein the antibody is a polyclonal antibody.
- 37. An antibody that immunospecifically binds to a polypeptide of claim 5, or a fragment derived from the antibody that contains the binding domain thereof.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US9420398P | 1998-07-27 | 1998-07-27 | |
US12204599P | 1999-03-01 | 1999-03-01 | |
US36043499A | 1999-07-26 | 1999-07-26 | |
PCT/IB1999/001333 WO2000006743A2 (en) | 1998-07-27 | 1999-07-27 | Chlamydia antigens and corresponding dna fragments and uses thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
MXPA01001090A true MXPA01001090A (en) | 2002-06-04 |
Family
ID=27377706
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
MXPA01001090A MXPA01001090A (en) | 1998-07-27 | 1999-07-27 | Chlamydia. |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1108033A2 (en) |
JP (1) | JP2002524035A (en) |
AU (1) | AU4793499A (en) |
CA (1) | CA2336534A1 (en) |
MX (1) | MXPA01001090A (en) |
WO (1) | WO2000006743A2 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000034498A1 (en) * | 1998-12-04 | 2000-06-15 | University Of Manitoba | Two-step immunization procedure against chlamydia infection |
US7807802B2 (en) | 2002-11-12 | 2010-10-05 | Abbott Lab | Polynucleotides for the amplification and detection of Chlamydia trachomatis and Neisseria gonorrhoeae |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU701247B2 (en) * | 1993-11-03 | 1999-01-21 | Pfizer Inc. | Vaccine and method for treatment of chlamydial infections |
ATE312920T1 (en) * | 1996-07-12 | 2005-12-15 | DNA IMMUNIZATION AGAINST CHLAMYDIA INFECTION | |
JP2001504329A (en) * | 1996-10-28 | 2001-04-03 | アストラ・アクチエボラーグ | Nucleic acid and amino acid sequences related to Helicobacter pylori and vaccine compositions thereof |
WO1999027105A2 (en) * | 1997-11-21 | 1999-06-03 | Genset | Chlamydia pneumoniae genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection |
-
1999
- 1999-07-27 AU AU47934/99A patent/AU4793499A/en not_active Abandoned
- 1999-07-27 WO PCT/IB1999/001333 patent/WO2000006743A2/en not_active Application Discontinuation
- 1999-07-27 EP EP99931399A patent/EP1108033A2/en not_active Withdrawn
- 1999-07-27 MX MXPA01001090A patent/MXPA01001090A/en unknown
- 1999-07-27 JP JP2000562525A patent/JP2002524035A/en active Pending
- 1999-07-27 CA CA002336534A patent/CA2336534A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
AU4793499A (en) | 2000-02-21 |
WO2000006743A2 (en) | 2000-02-10 |
JP2002524035A (en) | 2002-08-06 |
WO2000006743A3 (en) | 2000-05-04 |
EP1108033A2 (en) | 2001-06-20 |
CA2336534A1 (en) | 2000-02-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6403101B1 (en) | Chlamydia antigens and corresponding DNA fragments and uses thereof | |
US6403102B1 (en) | Chlamydia antigens and corresponding DNA fragments and uses thereof | |
AU753984B2 (en) | Chlamydia antigens and corresponding DNA fragments and uses thereof | |
US20020102270A1 (en) | Chlamydia antigens and corresponding DNA fragments and uses thereof | |
MXPA01001092A (en) | Chlamydia. | |
AU5297399A (en) | (chlamydia) antigens and corresponding dna fragments and uses thereof | |
US20030170259A1 (en) | Chlamydia antigens and corresponding dna fragments and uses thereof | |
MXPA01001088A (en) | Chlamydia. | |
MXPA01001090A (en) | Chlamydia. | |
MXPA01001091A (en) | Chlamydia. | |
WO2000006739A2 (en) | Chlamydia antigens and corresponding dna fragments and uses thereof | |
MXPA01001089A (en) | Chlamydia. | |
MXPA01004396A (en) | Chlamydia | |
EP1144638A2 (en) | Chlamydia antigens and corresponding dna fragments and uses thereof | |
AU4793299A (en) | (chlamydia) antigens and corresponding dna fragments and uses thereof |