MXPA00006067A

MXPA00006067A - Human proteins responsible for nedd8 activation and conjugation

Info

Publication number: MXPA00006067A
Application number: MXPA/A/2000/006067A
Authority: MX
Inventors: Vincent Chau
Original assignee: Proscript Inc
Priority date: 1997-12-19
Filing date: 2000-06-19
Publication date: 2002-03-05

Abstract

The invention relates to covalent modification of proteins through their conjugation with other proteins. More particularly, the invention relates to the modulation of such conjugation involving the protein NEDD8. The invention provides compositions and methods for detecting and/or modulating the activation and/or conjugation of NEDD8, as well as compositions and methods for discovering molecules which are useful in detecting and/or modulating the activation and/or conjugation of NEDD8. The present invention arises from the purification and characterization of novel NEDD8 activating and conjugating enzymes.

Description

HUMAN PROTEINS THAT RESPOND TO THE ACTIVATION AND CONJUGATION OF NEDD8 BACKGROUND OF THE INVENTION FIELD OF THE INVENTION The invention relates to the covalent modification of proteins through their conjugation with other proteins. More particularly, the invention relates to the modulation of such conjugation involving the NEDD8 protein.

BRIEF DESCRIPTION OF THE RELATED ART The covalent modification of proteins through their conjugation with other proteins is an important biological mechanism for the regulation of protein metabolism and biological activity. Hershko and Ciechanover, Annu. Rev. Biochem. 6 ^: 761-807 (1992) describes the conjugation of ubiquitin, one of the most conserved eukaryotic proteins, to other proteins through an enzymatic mechanism, as well as its role in the degradation of proteins. Rock et al., Cell 7_8: 761- FEF.121220 771 (1994) discloses that the ubiquitination of protein antigens is required for the processing of such antigens. Murray, Cell 81: 149-152 (1995), teaches that the ubiquitination of cyclin is involved in the regulation of the cell cycle. Scheffner et al., Cell 7_5: 495-505 (1993) discloses that the ubiquitination of p53 is involved in the degradation of this tumor suppressor. The enzymatic pathway for ubiquitination has been reasonably well defined. Jentsch, Annu. Rev. Genet. 2_6: 179-207 (1992) discloses that ubiquitination requires the initial activation of a conserved C-terminal glycine residue, by the enzyme of activation of ubiquitin, El, through the formation of the adenylate of ubiquitin in a process dependent on the ATP releasing PPi, followed by the formation of the thiol ester at a thiol site in El with AMP release. The ubiquitin is then transferred to a thiol site in the conjugation enzyme of ubiquitin, E2, through the formation of a thiol ester linkage. The ubiquitin is then transferred to an epsilon-amino group of a lysine residue in the target protein, via an amide bond, usually with the involvement of the isopeptide ligase of the ubiquitin protein, E3. Hopkin, J. Nati. Inst. Health Res. 97 36-42 (1997), teaches that the specificity of the target is regulated by the particular combination of protein E2 and E3, with more than 30 E2 proteins and 10 E3 proteins that are known to date. Ubiquitin is not the only protein that is used to modify other proteins through the covalent bond. Kamitani et al., J. Biol. Chem. 272: 14001-14004 (1997), describes that sentrin, a protein similar to ubiquitin, appears to be processed similarly to ubiquitin, but has a smaller target protein repertoire than the ubiquitin. Okura et al., J. Immunol. 272: 4277-4281 (1996) teaches that sentrine protects cells against anti-FAS and cell death mediated by tumor necrosis factor. Loeb and Haas, J. Biol. Chem. 267: 7806-7813 (1992), discloses that the ubiquitin-cross-reactive protein (UCRP), which contains two ubiquitin domains, is conjugated to a large number of intracellular proteins. Ku ar et al., Biochem. Biophys. Res. Commun. 185: 1155-1161 (1992), describes another protein similar to ubiquitin, called NEDD8, for neuronal precursor sub-regulated by development, expressed by cells. Kamitani et al., J. Biol. Chem. 272: 28557-28562 (1997), teaches that NEDD8 is predominantly expressed in the nucleus and is conjugated to target proteins through a mechanism analogous to ubiquitination. These proteins, which covalently modify other cellular proteins, are important components of the biological regulatory process. The pattern of nuclear expression and the regulation of the development of NEDD8 make it a particularly competent candidate as an important regulatory molecule. There is a need, therefore, to understand the role of NEDD8 in biological regulation. Unfortunately, the lack of understanding regarding the specific proteins involved in the conjugation of NEDD8 has resulted in a lack of effective tools to probe the role of NEDD8. Therefore, there is a need for better tools to be used in the elucidation of the role of NEDD8 in biological regulation. Ideally, such tools could allow modulation of the activation and / or conjugation of NEDD8.

BRIEF DESCRIPTION OF THE INVENTION The invention provides compositions and methods for detecting and / or modulating the conjugation of NEDD8 and / or its transfer to a target protein, as well as compositions and methods for discovering molecules that are useful in the detection and / or modulation of NEDD8 conjugation. and / or its transfer to an objective protein. The present invention arises from the purification and characterization of novel activating and conjugating enzymes of NEDD8. In a first aspect, the invention provides the beta sub-unit of the purified NEDD8 activation protein (NAEl-beta). The primary amino acid sequence of a preferred embodiment of such NAEl-beta protein is shown in Figure 1. In a second aspect, the invention provides the NAEl-beta expression elements. Such elements include, without limitation, the isolated or recombinant nucleic acid sequences encoding NAEl-beta or the nucleic acid sequences specifically homologous or specifically complementary to it, the vectors comprising any such nucleic acid sequences and the expression units recombinants expressing NAEl-beta or, the antisense transcripts or the dominant negative mutants thereof. The purified protein and its structural information provided herein make it possible to prepare NAEL-beta binding molecules (NAElBBMs). Thus, in a third aspect, the invention provides methods for the identification of NAElBBMs. A preferred method according to this aspect of the invention comprises the selection of NAElBBMs by contacting purified NAEl-beta according to the invention and populations of molecules or mixed populations of molecules and determination of the presence of molecules that specifically bind to NAEl-beta. Another preferred method according to this aspect of the invention comprises rationally designing molecules to bind to NAEl-beta based on the structural information of the purified NAEl-beta protein provided by the invention, and determining whether such rationally designed molecules are specifically linked to NAEl-beta. This aspect of the invention includes NAElBBMs identified by the methods according to the invention. NA ELBBMs can be used in conventional assays to detect the presence or absence, and / or the amount of NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample. Thus, in a fourth aspect, the invention provides methods for determining the presence or absence and / or the amount of NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample. Such methods comprise providing a detectable NAE1BBM for a biological sample, allowing detectable NAE1BBM to bind to NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8, if any is present in the biological sample, and detecting the presence or absence and / or the amount of a detectable NAE1BBM complex and NAEl-beta, heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NAEl-beta can also be used in conventional assays to detect the presence or absence of the NAEl-beta nucleic acid in a biological sample. Thus, in a fifth aspect, the invention provides methods for determining the presence or absence and / or amount of the NAEl-beta nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and / or amplification assays, such assays comprising the provision to the biological sample of a nucleic acid sequence that is specifically complementary to the NAEl-beta nucleic acid. In a sixth aspect, the invention provides methods for identifying the modulating ligands of NAEl-beta. Some NAElBBMs are able to act as NAEl-beta antagonists or agonists. In this way, the method according to this aspect of the invention comprises the provision of NAElBBMs to a test system for the participation of NAEl-beta in the activation / conjugation pathway of NEDD8, and determining whether such NAElBBMs interfere with or improve the ability of NAEl-beta to participate in the activation / conjugation route of NEDD8. The NAElBBMs are preferably provided as a population of molecules (more preferably rationally designed molecules), or as a mixed population of molecules, as for example in a selection procedure. This aspect of the invention includes the modulation of the NAEl-beta ligands identified by this method according to the invention. In a seventh aspect, the invention provides for the modulation of NAEl-beta ligands. The preferred modulating ligands are NAElBBMs that act as antagonists, interfering with the ability of NAEl-beta to participate in the activation / conjugation pathway of NEDD8. Other preferred modulating ligands are NAElBBMs that act as agonists, improving the ability of NAEl-beta to participate in the activation / conjugation pathway of NEDD8. In certain embodiments, such NAElBBMs preferentially interact with NAEl-beta to inhibit or increase the formation of the NAEl heterodimer, the formation of the NEDD8 adenylate, the formation of a thiol ester linkage between NEDD8 and NAEl, and / or the transfer of NEDD8 to the conjugation enzyme of NEDD8. In an eighth aspect, the invention provides methods for modulating activation and / or conjugation of NEDD8. A preferred embodiment of the method according to this aspect of the invention comprises the provision of an NAEl-beta modulating ligand or a recombinant expression unit that expresses NAEl-beta or an antagonist thereof to a biological system in which NEDD8 is conjugated to another protein. In a ninth aspect, the invention provides oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 1. Preferred embodiments include hybridization probes and antisense oligonucleotides. In a tenth aspect, the invention provides methods for identifying NAEL-alpha binding molecules (NAElABMs). The present inventors have identified the alpha subunit of the heterodimer NAEl (NAEl-alpha). Surprisingly, it has an amino acid sequence that is substantially identical to a protein previously identified as the protein 1 of binding to the amyloid precursor protein (APP-BPl).; see Chow et al., J. Biol. Chem. 271: 11339-11346 (nineteen ninety six)). A preferred method according to this aspect of the invention comprises the selection of NAElABMs by contacting purified NAEl-alpha and populations of molecules or mixed populations of molecules and determining the presence of molecules that specifically bind to NAEl-alpha. Another preferred method according to this aspect of the invention comprises rationally designing molecules to bind to NAEl-alpha based on the structural information from the NAEl-alpha protein identified by the present inventors and determining whether such rationally designed molecules are specifically linked to NAEl-alpha. This aspect of the invention includes NAElABMs identified by the methods according to the invention. The NAElABMs can be used in conventional assays to detect the presence or absence, and / or the amount of NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample. Thus, in a decipher aspect, the invention provides methods for determining the presence or absence and / or the amount of NAEl-alpha, heterodimer of NAEl, or the complex of the heterodimer of NAE1 / NEDD8 in a biological sample. Such methods comprise the provision of a detectable NAE1ABM to a biological sample, allowing the detectable NAE1ABM to bind to NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8, if any is present in a biological sample, and detecting the presence or absence and / or the amount of a complex of the detectable NAE1ABM and NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8. In preferred embodiments, the method according to this aspect of the invention is used to detect the presence or absence and / or the amount of the heterodimer of NAEl, or the complex of the heterodimer of NAE1 / NEDD8 in a biological sample. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NAEl-alpha can also be used in conventional assays to detect the presence or absence of the NAEl-alpha nucleic acid in a biological sample in which the conjugation of NEDD8 is suspected. Thus, in a twelfth aspect, the invention provides methods for determining the presence or absence and / or amount of the NAEl-alpha nucleic acid in such a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and / or amplification assays, such assays comprise the provision to the biological sample of a nucleic acid sequence that is specifically complementary to the NAEl-alpha nucleic acid. In a thirteenth aspect, the invention provides methods for identifying the modulating ligands of NAEl-alpha. Some NAElABMs are able to act as NAEl-alpha antagonists or agonists. Thus, the method according to this aspect of the invention comprises the provision of NAElABMs to a test system for the participation of NAEl-alpha in the activation / conjugation pathway of NEDD8, and determining whether such NAElABMs interfere with or improve the ability of NAEl-alpha to participate in the activation / conjugation path of NEDD8. The NAElABMs are preferably provided as a population of molecules (more preferably rationally engineered molecules), or as a mixed population of molecules, as for example in a selection procedure. This aspect of the invention includes the NAEl-alpha antagonists or agonists identified by this method according to the invention. In a fourteenth aspect the invention provides a purified complex of NAEl-beta and NAEl-alpha, or of NAEl-beta, NAEl-alpha and NEDD8, or a purified complex of portions thereof. In a fifteenth aspect, the invention provides the modulating ligands of NAEl-alpha. Certain preferred modulating ligands are NAElABMs that act as antagonists that interfere with the ability of NAEl-alpha to participate in the activation / conjugation pathway of NEDD8. Other preferred modulating ligands are NAElABMs that act as agonists that enhance the ability of NAEl-alpha to participate in the activation / conjugation pathway of NEDD8. Preferably, such inhibition or improvement is specific, as described above. In certain embodiments, such modulating ligands preferentially interact with NAEl-alpha to inhibit or enhance the formation of the NAEl heterodimer, the formation of NEDD8 adenylate, the formation of a thiol ester linkage between NEDD8 and NAEl, and / or the transfer from NEDD8 to the conjugation enzyme to NEDD8. In a sixteenth aspect, the invention provides methods for modulating the activation and / or conjugation of NEDD8. A preferred embodiment of the method according to this aspect of the invention comprises the provision of an NAEl-alpha modulating ligand or a recombinant expression unit expressing NAEl-alpha or an antagonist thereof, to a biological system in which NEDD8 is conjugated to another protein. In a seventeenth aspect, the invention provides the allelic variants of NAEl-alpha. This aspect of the invention also includes the expression elements of the allelic variant of NAEl-alpha. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding NAEl-alpha, or nucleic acid sequences specifically homologous or specifically complementary thereto, vectors comprising any such nucleic acid sequences, and recombinant expression units that express NAEl-beta or the antisense transcripts or the dominant negative mutants thereof. In an eighteenth aspect, the invention provides methods for modulating the auxin response in plants. The present inventors have discovered that NAEl-alpha shares 39% identity and 61% conserved residues with Auxl in A. th ali ana, which is involved in the transduction of the signal in the response to auxin in plants. This suggests that antagonists of NAEl-beta and / or NAEl-alpha should downregulate the response to auxin, and that the expression of NAEl-beta and / or NAEl-alpha should upregulate the response to auxin. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit that expresses NAE1-beta or NAEl or an antagonist thereof to a plant that is under treatment with auxiña. In a nineteenth aspect, the invention provides methods for modulating the biological role of APP and / or the accumulation of the beta peptide in a biological system. The present inventors have discovered that NAEl-alpha is substantially the same protein as the amyloid precursor protein that binds to protein 1 (APP-BP1). This suggests that antagonists or agonists of NAEl-beta and / or NAEl-alpha should modulate the function of APP, including its role in the accumulation of beta peptide. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit that expresses NAEl-beta or NAEl or an antagonist thereof to a biological system In a twentieth aspect, the invention provides two new, purified, conjugated enzymes to NEDD8, and allelic variants thereof. The primary amino acid sequence of a preferred embodiment of a first conjugation enzyme to NEDD8 (NCE1) is shown in Figure 2. The primary amino acid sequence of a preferred embodiment of a second conjugation enzyme to NEDD8 (NCE2) is shown in Figure 5. In a twenty-first aspect, the invention provides the expression elements of the conjugation enzyme to NEDD8. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding NCE1 or NCE2 or dominant negative mutants thereof, or capable of expressing antisense transcripts thereof or specifically homologous nucleic acid sequences or specifically complementary to these, and the vectors comprising any such recombinant expression elements, preferably the expression vectors.

The purified protein and its structural information provided therein makes possible the preparation of NCEl and NCE2 binding molecules, respectively NCElBMs and NCE2BMs. Thus, in a twenty-second aspect, the invention provides methods for identifying NCElBMs and NCE2BMs. A preferred method according to this aspect of the invention comprises the selection for NCElBMs or NCE2BMS by contacting purified NCEl or NCE2, according to the invention, and the populations of molecules or mixed populations of molecules and determining the presence of molecules that they bind specifically to NCEl or NCE2. Another preferred method according to this aspect of the invention comprises rationally designing the molecules to bind to NCEl or NCE2 based on the structural information from purified NCEl or NCE2, provided by the invention, and determining whether such rationally designed molecules are bind specifically to NCEl or NCE2. This aspect of the invention includes NCElBMs and NCE2BMs identified by the methods according to the invention. NCElBMs and NCE2BMS can be used in conventional assays to detect the presence or absence, and / or the amount of NCEl or NCE2, or NCEl or the NCE2 / NEDD8 complex in a biological se. Thus, in a twenty-third aspect, the invention provides methods for determining the presence or absence and / or the amount of NCEl or NCE2, or NCEl or the complex of NCE2 / NEDD8 in a biological se. Such methods comprise the provision of a detectable NCE1BM or NCE2BM to a biological se, allowing detectable NCE1BM or NCE2BM to bind to, respectively NCE1 or NCE2, or respectively NCE1 or the NCE2 / NEDD8 complex, if any is present in a biological se , and detecting the presence or absence and / or the amount of a complex of NCE1BM or NCE2BM and NCE1 or detectable NCE2, and NCE1 or NCE1 or the complex of NCE2 / NEDD8. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NCE1 or NCE2 can also be used in conventional assays to detect the presence or absence of the nucleic acid of NCE1 or NCE2 in a biological se. Thus, in a twenty-fourth aspect, the invention provides methods for determining the presence or absence and / or amount of nucleic acid of NCEl or NCE2 in a biological se. In preferred embodiments, such assays are nucleic acid hybridization and / or ification assays, such assays comprising the provision to the biological se of a nucleic acid sequence that is specifically complementary to the nucleic acid of NCE1 or NCE2. In a twenty-fifth aspect, the invention provides methods for identifying the modulating ligands of NCE1 or NCE2. Some NCElBMs or NCE2BMs are capable of acting as antagonists or agonists, respectively of NCEl or NCE2. Thus, the method according to this aspect of the invention comprises the provision of NCElBMs or NCE2BMs to a test system for the participation of NCEl or NCE2 in the activation / conjugation path to NEDD8, and determining whether such NCElBMs or NCE2BMS interfere with or improve the ability of NCEl or NCE2 to participate in the activation / conjugation pathway to NEDD8. The NCElBMs or NCE2BMS are preferably provided as a population of molecules (more preferably rationally engineered molecules), or as a mixed population of molecules, as for exe in a selection procedure. This aspect of the invention includes the modulating ligands of NCEl or NCE2 identified by this method according to the invention. In a twenty-sixth aspect, the invention provides the modulating ligands of NCEl or NCE2. the preferred modulating ligands are NCElBMs or NCE2BMs that act as antagonists, interfering with the ability of NCEl or NCE2 to participate in the activation / conjugation pathway of NEDD8. Other preferred modulating ligands are NCElBMs or NCE2BMs that act as agonists, improving the ability, respectively, of NCEl or NCE2 to participate in the activation / conjugation route of NEDD8. In certain embodiments, such NCElBMs or NCE2BMs preferably interact with NCEl or NCE2 to inhibit or enhance the formation of a thiol ester linkage between NEDD8 and NCEl or NCE2 and / or the transfer of NEDD8 to their target protein. In a twenty-seventh aspect, the invention provides methods for modulating the conjugation of NEDD8 or its transfer to a target protein. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NCEl or NCE2 or a recombinant expression unit expressing NCE1 or NCE2 or an antagonist thereof to a biological system in which NEDD8 is conjugated to another protein. In a twenty-eighth aspect, the invention provides the oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 2 or Figure 5. Preferred embodiments include hybridization probes and antisense oligonucleotides.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the nucleotide [SEQ ID NO .: 1] and the predicted amino acid sequence [SEQ ID NO .: 2] for NAEl-beta, with the two triptic peptide sequences revealed by underlining. Figure 2 shows the nucleotide [SEQ ID NO .: 3] and the predicted amino acid sequence [SEQ ID NO .: 4] for conjugation enzyme 1 to NEDD8 (NCEl), with the active Cys residue indicated. Figure 3 shows the alignment of NCEl with Ubcl2 of yeast.

Figure 4 shows the results of an assay for the formation of the thioester bond between NEDD8 and NCEl. Figure 5 shows the nucleotide [SEQ ID NO .: 5] and the predicted amino acid sequence [SEQ ID NO .: 6] for conjugation enzyme 2 to NEDD8 (NCE2), with the active Cys residue indicated. Figure 6 shows the homology between NCE2 and a C gene. the egans of unknown function. Figure 7 shows the sequential alignment of NCEl and NCE2 with the known Ubc proteins. Figure 8 shows the results of an assay for the formation of the thioester bond between NEDD8 and NCE2.

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES The invention relates to the covalent modification of proteins through their conjugation with other proteins. More particularly, the invention relates to the formulation of such conjugation involving the NEDD8 protein. The invention provides compositions and methods for detecting and / or modulating the conjugation of NEDD8 and / or its transfer to a target protein, as well as compositions and methods for discovering molecules that are useful in the detection and / or modulation of conjugation. of NEDD8 and / or its transfer to a target protein. The present invention arises from the purification and characterization of the novel activation and conjugation enzymes of NEDD8. The patents and publications cited herein reflect knowledge of the art and are incorporated herein by reference in their entirety. Any inconsistency between these patents and publications and the present description will be resolved in favor of the present disclosure. In a first aspect, the invention provides the beta subunit of the purified, NEDD8 activation protein (NAEl-beta). The primary amino acid sequence of a preferred embodiment of such NAEl-beta protein is shown in Figure 1. However, the term "beta subunit of the NEDD8 activating protein" or "NAEl-beta" is intended to include the variants allelic of them. An "allelic variant", as used herein, is a protein having at least about 75% amino acid sequence, preferably at least about 85%, more preferably at least about 95%, and more preferably at least about 99%. % identity to the amino acid sequence described in SEQ ID NO: 1, or to a portion or conjugate of protein thereof that retains the biological activity of NAEl-beta (as part of the heterodimer of NAEl) to form a thioester linkage with NEDD8 at a faster rate than that achieved by human ubiquitin activation enzyme 1, preferably at least 2 times faster, more preferably at least 5 times and more preferably at least 10 times faster. Alternatively, an allelic variant may retain such biological activity and comprise a peptide sequence having at least 70% amino acid identity to the peptide sequence corresponding to residues 46-118 in Figure 1, or at least 45% amino acid identity to the peptide sequence corresponding to residues 119-166, at least 65% amino acid identity to the peptide sequence corresponding to residues 175-239, or at least 35% amino acid identity to the peptide sequence corresponding to residues 276 -375. Preferably, such a biologically active portion comprises at least the PXCT portion, wherein X can be any amino acid, preferably a hydrophobic amino acid, more preferably methionine, leucine, or isoleucine, and most preferably methionine. More preferably, such a biologically active portion comprises the amino acid sequence of residues 214-217, more preferably comprises at least about 25 additional amino acids of NAEl-beta, even more preferably at least about 50 additional amino acids of NAEl-beta, still more preferably at least about 75 additional amino acids of NAEl-beta, still more preferably at least about 100 additional amino acids of NAEl-beta, and most preferably at least about 150 additional amino acids from NAEl-beta. Such allelic variants have the biological activity of NAEl-beta, as discussed above, which is the catalytic monomer of the NAEl heterodimer. In alternative preferred embodiments, such allelic variants are either rationally engineered or allelic variants of natural origin, for example, they are expressed in effective individual mammals, more preferably from individual humans or individual mice. Rationally designed allelic variants can be produced according to standard procedures recognized in the art (see for example international publication 095/18974). "Purified" as used herein means that it has less than about 25% by weight, and preferably less than about 10% by weight of contamination with other proteins. Such purified proteins can be obtained from natural sources, from recombinant expression, or by chemical synthesis. "Protein", as used throughout, is intended to encompass any polypeptide having at least 10 amino acid residues. In a second aspect, the invention provides the expression elements of NAEl-beta. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding NAEl-beta or dominant negative mutants thereof, or capable of expressing antisense transcripts thereof or specifically homologous nucleic acid sequences or specifically complementary to these, and the vectors comprising any of such recombinant expression elements, preferably the expression vectors. For purposes of the invention, the identity and homology of the amino acid sequence are determined using the Clustal program, Version 1.6 to perform the sequential alignment (Thompson et al., Nucleic Acids Res 2_2: 4673-4680 (1994)). To see the aligned sequences, we used the GeneDoc program, Version 2.2. A sequence is "specifically homologous" to another sequence if it is sufficiently homologous to hybridize specifically to the exact complement of the sequence. A sequence is "specifically complementary" to another sequence if it is sufficiently homologous to hybridize specifically to the sequence. A sequence is "specifically hybridized" to another sequence if it hybridizes to form Watson-Crick or Hoogsteen-like base pairs either in the body, or by conditions that approximate conditions that approximate physiological conditions with respect to to the ionic strength, for example, 140 mM NaCl, 5 mM MgCl 2. Preferably, such specific hybridization is maintained under stringent conditions, for example 0.2 X SSC at 68 ° C. A "recombinant expression element" is a nucleic acid sequence encoding NAEl-beta, or a portion that encodes at least 15 contiguous amino acids thereof, or a dominant negative mutant thereof, or is capable of expressing a molecule antisense specifically complementary to it, or a molecule in the sense specifically homologous thereto, wherein the recombinant expression unit may be in the form of a linear DNA or RNA, RNA or circular DNA covalently closed, or as part of a chromosome, however, with the proviso that it can not be the native chromosomal locus for NAEl-beta. Preferred recombinant expression elements are vectors, which may include an origin of replication and are thus replicable in one or more cell types. Certain preferred recombinant expression elements are expression vectors, and further comprise at least one promoter and a passive terminator, whereby transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell is allowed. Preferred recombinant expression elements have at least 75% nucleic acid sequence identity with the nucleic acid sequence described in SEQ ID NO: 1, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 99%, and they code for a protein or peptide having either biological activity of NAEl-beta, as described above, or activity as a dominant negative mutant thereof, as described below. "Dominant negative mutants" are proteins derived from NAEl-beta or NAEl-alpha that inhibit the biological activity of NAEl. Preferred dominant negative mutants include allelic variants in which the carbon at position 216 is substituted, preferably by S. The preferred, additional dominant negative mutants interfere with the association of native NAEl-beta with native NAEl-alpha and can be derived either NAEl-beta and NAEl-alpha. Such dominant negative mutants can be prepared by methods recognized in the art. (see for example Townsley et al., Proc. Nati. Acad.

Sci. USA 94_: 2362-2367 (1997)). Preferably, such a dominant negative mutant is a protein or peptide having from 50% amino acid sequence identity to about 99% identity to the amino acid sequence described in SEQ ID NO: 2, or to a protein portion or conjugate. thereof which inhibits the biological activity of NAEl to form a thioester linkage with NEDD8 or transfer NEDD8 to a conjugation enzyme to NEDD8, under conditions as described in the following examples by at least 50%, preferably by at least 75%, more preferably by at least 90%, and most preferably by at least 99%. Preferably, such an inhibitory portion comprises a nucleic acid sequence spanning residue 216, more preferably comprising at least about 25 additional amino acids of NAEl-beta, or at least about 50 additional amino acids of NAEl-beta, or at least about 75 amino acids additional NAEl-beta, or at least about 100 additional amino acids of NAEl-beta, or even at least about 150 additional amino acids of NAEl-beta. For purposes of this aspect of the invention, the term "encompassing residue 216" means that it comprises the amino acid residues in the N-terminal and C-terminal directions from residue 216, and that residue is shown in Figure 1. Preferably, residue 216 itself may be substituted with one or more amino acids, more preferably from about 1 to about 50 amino acids, or residue 216 may be absent. Preferably, the amino acids in the N-terminal and C-terminal directions from residue 216 are each independently within 20 amino acids of residue 216, as shown in Figure 1, more preferably within 10, even more preferably within 5. , and most preferably are immediately adjacent to residue 216 as shown in Figure 1. The purified protein and its structural information provided herein make it possible to prepare NAE1-beta binding molecules (NAElBBMs). Thus, in a third aspect, the invention provides methods for identifying NAElBBMs. A preferred method according to this aspect of the invention comprises the selection for NAElBBMs by contacting purified NAEl-beta according to the invention and populations of molecules or mixed populations of molecules, and determining the presence of molecules that specifically bind to NAEl-beta. Another preferred method according to this aspect of the invention comprises rationally designing the molecules to bind to NAEl-beta based on the structural information from the purified NAEl-beta protein, and the amino acid sequence described herein, provided by the invention and which determines whether such rationally designed molecules bind specifically to NAEl-beta. Molecules that specifically bind to NAEl-beta are molecules that bind to NAEl-beta with higher affinity than other unrelated proteins. Preferably, the binding affinity of the molecule is at least 5 times greater than the affinity for the unrelated proteins, more preferably at least 10 times higher, still more preferably at least 50 times higher, and more preferably at least 100 times higher. This aspect of the invention includes NAElBBMs identified by the methods according to the invention. As used herein a "NAEl-beta binding molecule" or "NAE1BBM" is a molecule or macromolecule that binds under physiological conditions to NAEl-beta. "Binds under physiological conditions" means the formation of a covalent or non-covalent association with an affinity of at least 106 M "1, more preferably at least 109 M" 1, either in the body, or under conditions approaching the physiological conditions with respect to ionic strength, for example, 140 mM NaCl, 5 mM MgCl2. A "population of molecules," as used herein, refers to a plurality of identical molecules. A "mixed population of molecules" refers to a plurality of molecules wherein more than one type of molecule is present. In certain preferred embodiments, an NAE1BBM according to the invention is a peptide or a mimetic peptide. For purposes of the invention, a "peptide" is a molecule comprised of a linear array of amino acid residues connected to each other in the linear array by peptide bonds. Such peptides according to the invention may include from about three to about 500 amino acids, and may further include secondary, tertiary or quaternary structures, as well as intermolecular associations with other peptides or other non-peptidic molecules. Such intermolecular associations can be through, without limitation, covalent bonding (for example, through disulfide bonds, or through chelation, electrostatic interactions, hydrophobic interactions, hydrogen bonds, dipole ion interactions, dipole-dipole interactions, or any In certain preferred embodiments, such NAE1BBM comprises a region for determining the complementarity of an antibody that binds under physiological conditions to an epitope containing NAEl-beta peptide, or a mimetic peptide from such a region for determination of complementarity For purposes of the invention, a "region for determining the complementarity of an antibody" is that portion of an antibody that binds under physiological conditions to an epitope, including any structural regions necessary for such an attachment, and that is preferably comprised of a subgroup of waste from amino acids encoded by the V, D and J regions of the human heavy chain, the V and J regions of the human light chain, and / or combinations thereof. Examples of such preferred embodiments include an antibody, or an antibody derivative, which may more preferably be a monoclonal antibody, a human antibody, a humanized antibody, a single chain antibody, a chimeric antibody, or a binding antibody fragment. to the antigen.

Those skilled in the art are qualified to make any such antibody derivatives, using standard techniques recognized in the art. For example, Jones et al., Nature 321: 522-525 (1986) describes the replacement of the CDRs of a human antibody with those of a mouse antibody. Marx, Science 229: 455-456 (1985) describes chimeric antibodies that have mouse variable regions and human constant regions. Rodwell, Nature 342: 99-100 (1989) describes the lower molecular weight recognition elements derived from the CDR information of the antibody. Clackson, Br. J. Rheumatol. 3052: 36-39 (1991) discusses genetically engineered monoclonal antibodies, including derivatives of the Fv fragment, single chain antibodies, chimeric antibodies to fusion proteins and humanized rodent antibodies. Reichman et al., Nature 332: 323-327 (1988) describes a human antibody on which hypervariable regions of rat have been grafted. Verhoeyen et al., Science 239: 1534-1536 (1988) teaches the grafting of a mouse antigen binding site on a human antibody.

In addition, those skilled in the art are skilled in designing and producing mimetic peptides that have similar or superior binding characteristics to such a region of complementarity determination (see, for example, Horwell et al., Bioorg. Med. Chem. 4_: 1573 ( 1996), Liskamp et al., Recl. Trav. Chim. Pays-Bas 1_: 113 (1994), Gante et al., Angew. Chem. Int. Ed. Engl. 33_: 1699 (1994); Seebach et al. , Helv. Chim. Acta 29_: 913 (1996)). Accordingly, all such antibody derivatives and the mimetic peptides thereof are contemplated within the scope of the present invention. The compositions according to the invention may further include physiologically acceptable diluents, stabilizing agents, locating agents or buffers. Additional preferred NELBBMs according to the invention include small molecules, which can be identified using selection or rational design procedures as discussed hereinafter. The NAElBBMs can be used in conventional assays to detect the presence or absence and / or amount of NAEl-beta, heterodimer of NAEl, or complex of NAE1 / NEDD8 in a biological sample. Thus, in a fourth aspect, the invention provides methods for determining the presence or absence and / or amount of NAEl-beta, heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample. Such methods comprise the provision of a detectable NAE1BBM to a biological sample, allowing the detectable NAE1BBM to bind to NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8, if any is present in the biological sample, and detecting the presence or absence and / or amount of a complex of the detectable NAE1BBM or NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8. A detectable NAE1BBM is an NAE1BBM that can be detected in a test. Such detection is preferably through the direct or indirect linkage of a label or tag on the NAE1BBM. "Direct or indirect link" means that the label or marker can be directly connected to the NAE1BBM by intermolecular association, and can be connected via the intermediary molecules to the NAE1BBM by intermolecular association. Such intermolecular associations may be through, without limitation, covalent bonding (eg, through disulfide bonds), or through chelation, electrostatic interactions, hydrophobic interactions, hydrogen bonds, ion-dipole interactions, dipole-dipole interactions , or any combination of the above. Preferred labels and tags include, without limitation, radioisotopes, heavy metals, fluorescent markers, chemiluminescent markers, enzymes and enzyme substrates. Preferred biological samples include blood, serum, plasma, cells, tissue portions, and cell or tissue extracts. In certain preferred embodiments, the method according to this aspect of the invention takes the form of a conventional ELISA or RIA. In another preferred embodiment, the method employs either direct or indirect immunofluorescence. Additional preferred embodiments utilize the imaging of cells expressing NAEl-beta using conventional imaging agents directly or indirectly linked to an NAE1BBM according to the invention. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NAEl-beta can also be used in conventional assays to detect the presence or absence of the NAEl-beta nucleic acid in a biological sample. Thus, in a fifth aspect, the invention provides methods for determining the presence or absence and / or amount of the NAEl-beta nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and / or amplification assays, such assays comprising the provision to the biological sample of a nucleic acid sequence that is specifically complementary to the NAEl-beta nucleic acid. Particularly preferred embodiments include Northern blotting, spotting or dot blotting, and polymerase chain reaction. In a sixth aspect, the invention provides methods for identifying the modulating ligands of NAEl-beta. Some NAElBBMs with the ability to act as NAEl-beta antagonists or agonists. Thus, the method according to this aspect of the invention comprises the provision of NAElBBMs to a test system for the participation of NAEl-beta in the activation / conjugation pathway to NEDD8, and determining whether such NAElBBMs interfere with or improve the ability of NAEl-beta to participate in the activation / conjugation route to NEDD8. The NAElBBMs are preferably provided as a population of molecules (more preferably rationally designed molecules), or as a mixed population of molecules, as for example in a selection procedure. This aspect of the invention includes the NAEl-beta antagonists or agonists identified by this method according to the invention. The evaluation of the ability to "interfere with or improve the ability to participate in the activation / conjugation path to NEDD8" can be carried out conventionally using an in vi tro activity system as described hereinafter. Preferably, such interference or enhancement results in a reduction of activation / conjugation of NEDD8 of at least 50%, more preferably of at least 90% and most preferably, at least 99%, or an increase of activation / conjugation of NEDD8 of at least 50%, preferably at least 2 times, more preferably at least 5 times.

In a seventh aspect, the invention provides the modulating ligands of NAEl-beta. The preferred modulation ligands are NAElBBMs that act as antagonists interfering with the ability of NAEl-beta to participate in the activation / conjugation pathway to NEDD8. Other preferred modulating ligands are the NAElBBMs that act as agonists, improving the ability of NAEl-beta to participate in the activation / conjugation pathway to NEDD8. Preferably, such inhibition or enhancement is specific, for example, the modulating ligand interferes with or improves the ability of NAEl-beta to participate in the activation / conjugation pathway to NEDD8 at a concentration that is less than the concentration of the ligand required. to produce another biological effect not related. Preferably, the concentration of the ligand required for the activation / conjugation modulation activity of NEDD8 is at least 2 times lower, more preferably at least 5 times lower, even more preferably at least 10 times lower, and most preferably at least 20 times less than the concentration required to produce an unrelated biological effect. In certain embodiments, such NAElBBMs preferentially interact with NAEl-beta to inhibit or increase the formation of the NAEl heterodimer, the formation of the NEDD8 adenylate, the formation of a thiol ester linkage between NEDD8 and NAEl, and / or the transfer of NEDD8 to the conjugation enzyme to NEDD8. In an eighth aspect, the invention provides methods for modulating the conjugation of NEDD8 to NAEl or its transfer to a conjugation enzyme to NEDD8 or to a target protein. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NAEl-beta or a recombinant expression unit that expresses NAEl-beta or an antagonist thereof to a biological system in which NEDD8 is conjugates to a conjugation enzyme to NEDD8 or to an objective protein. The term "biological system", as used herein, includes cellular or tissue extracts in vi tro, cell cultures, tissue cultures, organ cultures, living plants and animals, including mammals, including without limitation humans and mice . An "antagonist" is a molecule that inhibits the biological activity of NAEl.

In a ninth aspect, the invention provides oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 1. Preferred embodiments include hybridization probes and antisense oligonucleotides. For purposes of the invention, the term "oligonucleotide" includes polymers of two or more deoxyribonucleotides, or any modified nucleoside, including the 2 '-halo-nucleosides, 2'-O-substituted ribonucleosides, deozanucleosides or any combination thereof. Preferably, such oligonucleotides have from about 10 to about 100 nucleotides, more preferably from about 15 to 50, and more preferably from about 15 to 35. Such monomers can be coupled to one another by any of the numerous known internucleoside linkages. In certain preferred embodiments, these internucleoside linkages may be the phosphodiester, phosphotriester, phosphorothioate, or combinations thereof. The term "oligonucleotide" also encompasses polymers such that they have chemically modified bases or sugars, and / or have additional substituents, including without limitation lipophilic groups, intercalating agents, diamines and adamantane. For purposes of the invention the term "2'-O-substituted" means the substitution of the 2 'position of the pentose portion with a halogen (preferably chlorine, bromine, or fluorine) or an O-lower alkyl group containing 1 to 6 saturated or unsaturated carbon atoms, or with an O-aryl or allyl group having 2 to 6 carbon atoms, wherein such an alkyl, aryl or allyl group may be unsubstituted or may be substituted, for example with halo, hydroxyl, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl, or amino groups; or such 2 'substitution can be with a hydroxyl group (to produce a ribonucleoside), an amino group or a halo group, but not with a 2'-H group. Certain embodiments of such oligonucleotides are useful in hybridization assays. Other embodiments are useful as antisense oligonucleotides for use in human therapeutic equipment or animal models. In a tenth aspect, the invention provides methods for identifying NAEL-alpha binding molecules (NAElABMs). The present inventors have identified the alpha subunit of the heterodimer NAEl (NAEl-alpha). Surprisingly, it has an amino acid sequence that is substantially identical to a protein previously identified as the binding protein 1 to the amyloid precursor protein (APP-BP1; see Chow et al., J. Biol. Chem. 271: 11339-11346 (nineteen ninety six) ) . A preferred method according to this aspect of the invention comprises the selection for NAElABMs by contacting purified NAEl-alpha and populations of molecules or mixed populations of molecules and determining the presence of molecules that specifically bind to NAEl-alpha, or preferably the heterodymer of NAEl. Another preferred method according to this aspect of the invention comprises the rational design of molecules to bind to NAEl-alpha based on the structural information from the NAEl-alpha protein identified by the present inventors and determining whether such rationally designed molecules are linked specifically to NAEl-alpha. This aspect of the invention includes NAElABMs identified by the methods according to the invention. The terms "specifically linked", "population of molecules" and "mixed population of molecules" are as previously described. The structural aspects of the NAElABMs are as discussed above for NAElABMs, except that the NAElABMs bind under physiological conditions to NAEl-alpha. Preferably, the binding affinity of the molecule for NAEl-alpha is at least 5 times greater than the affinity for the unrelated proteins, more preferably at least 10 times higher, still more preferably at least 50 times higher, and most preferably at less than 100 times This aspect of the invention includes NAElABMs identified by the methods according to the invention. As used herein, a "NAEl-alpha binding molecule" or "NAE1ABM" is a molecule or macromolecule that binds under physiological conditions to NAEl-alpha. The terms "bind under physiological conditions", "population of molecules" and "mixed population of molecules" are as previously used. In certain preferred embodiments, an NAE1ABM according to the invention is a pee or a mimetic pee. For purposes of the invention, the term "pee" is as previously used.

In certain preferred embodiments, such NAE1ABM comprises a region of the complementarity determination of an antibody, which binds under physiological conditions to an epitope containing NAEl-alpha peptide, or to a mimetic peptide from such a region of complementarity determination. For purposes of the invention, the term "region for determining the complementarity of an antibody" is as previously used. The compositions according to the invention can further include physiologically acceptable diluents, stabilizing agents, locating agents or buffers. The additional, preferred, NAELABMs according to the invention include small molecules, which can be identified using rational design or selection procedures as discussed hereinafter. The NAElABMs can be used in conventional assays to detect the presence or absence, and / or the amount of NAEl-alpha, heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample. Thus, in a eleventh aspect, the invention provides methods for determining the presence or absence and / or the amount of NAEl-alpha, the heterodimer of NAEl, or the complex of the heterodimer of NAE1 / NEDD8 in a biological sample. Such methods comprise the provision of a detectable NAE1ABM to a biological sample, allowing the detectable NAE1ABM to bind to NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8, if any is present in the biological sample, and detecting the presence or absence and / or the amount of a complex of the detectable NAE1ABM and the NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8. A detectable NAE1ABM is an NAE1ABM that can be detected in an assay. Such detection is preferably through the direct or indirect linkage of a label or tag on NAE1ABM. The term "direct or indirect link" is as previously used. Preferred labels or labels include, without limitation, radioisotopes, heavy metals, fluorescent labels, chemiluminescent labels, enzymes, and enzyme substrates. Preferred biological samples include blood, serum, plasma, cells, tissue portions, and cell or tissue extracts. In certain preferred embodiments, the method according to this aspect of the invention takes the form of a conventional ELISA or RIA. In another preferred embodiment, the method employs either direct or indirect immunofluorescence. Additional preferred embodiments utilize the imaging of cells expressing NAEl-alpha, using conventional imaging agents directly or indirectly linked to an NAE1ABM according to the invention. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NAEl-alpha can also be used in conventional assays to detect the presence or absence of the NAEl-alpha nucleic acid in a biological sample. Thus, in a twelfth aspect, the invention provides methods for the determination of the presence or absence and / or amount of NAE1-alpha nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and / or amplification assays, such assays comprising the provision to the biological sample of a nucleic acid sequence that is specifically complementary to the NAEl-alpha nucleic acid. Particularly preferred embodiments include Northern staining or blotting, dot or spot staining, and polymerase chain reaction. In a thirteenth aspect, the invention provides methods for identifying the modulating ligands of NAEl-alpha. Some NAElABMs are able to act as NAEl-alpha antagonists or agonists. In this way, the method according to this aspect of the invention comprises the provision of NAElABMs to a test system for the participation of NAEl-alpha in the activation / conjugation pathway of NEDD8, and the determination of whether such NAElABMs interfere with or improve the ability of NAEl-alpha to participate in the activation / conjugation pathway of NEDD8. The NAElABMs are preferably provided as a population of molecules (more preferably rationally engineered molecules), or as a mixed population of molecules, as for example in a selection procedure. This aspect of the invention includes the NAEl-alpha antagonists or agonists identified by this method according to the invention. The evaluation of the ability to "interfere with or improve the ability to participate in the activation / conjugation path to NEDD8" can be conveniently carried out using an activity system as described below. Preferably, such interference or improvement results in a reduction of activation / conjugation of NEDD8 of at least 50%, more preferably at least 90%, and most preferably, at least 99%, or an increase in activation / conjugation to NEDD8 of at least 50%, preferably at least 2 times, more preferably at least 5 times. In a fourteenth aspect the invention provides a purified complex of NAEl-beta and NAEl-alpha, or of NAEl-beta, NAEl-alpha and NEDD8, or a purified complex of portions thereof. The term "complex" means in covalent or non-covalent association, preferably with an affinity greater than 106 / mol. The term "purified" is as previously used. In a fifteenth aspect, the invention provides the modulating ligands of NAEl-alpha. The preferred modulating ligands are NAElABMs that act as antagonists, interfering with the ability of NAEl-alpha to participate in the activation / conjugation pathway to NEDD8. Other preferred modulating ligands are NAElABMs that act as agonists, improving the ability of NAEl-alpha to participate in the activation / conjugation pathway of NEDD8. Preferably, such inhibition or enhancement is specific, for example, the modulating ligand interferes with or improves the ability of NAEl-alpha to participate in the activation / conjugation pathway of NEDD8 at a concentration that is less than the concentration of the ligand required. to produce another biological effect not related. Preferably, the concentration of the ligand required for the activation / conjugation modulation activity of NEDD8 is at least 2 times lower, more preferably at least 5 times lower, even more preferably at least 10 times lower, and most preferably at least 20 times less than the concentration required to produce an unrelated biological effect. In certain embodiments, such NAElABMs preferentially interact with NAEl-alpha to inhibit or enhance the formation of the NAEl heterodimer, the formation of the NEDD8 adenylate, the formation of a thiol ester linkage between NEDD8 and NAEl, and / or the transfer of NEDD8 to the conjugation enzyme to NEDD8.

In a sixteenth aspect, the invention provides methods for modulating the conjugation of NEDD8 to NAEl or its transfer to a conjugation enzyme to NEDD8 or to an objective protein. A preferred embodiment of the method according to this aspect of the invention comprises the provision of an NAEl-alpha modulating ligand or a recombinant expression unit that expresses NAEl-alpha or an antagonist thereof to a biological system in which NEDD8 is conjugated to a conjugation enzyme to NEDD8 or to a target protein. The term "biological system" as used herein, includes cellular or tissue extracts in vi tro, cell cultures, tissue cultures, organ cultures, living plants and animals, including mammals, including without limitation human and mice. An "antagonist" is a molecule that inhibits the biological activity of NAEl. In a seventeenth aspect, the invention provides the allelic variants of NAEl-alpha. An "allelic variant" as used herein, is a protein having at least about 75% amino acid sequence, preferably at least about 85%, more preferably, at least about 95%, and most preferably at least about 99% identity to the amino acid sequence of the NAEl-alpha, or to a portion or conjugate of protein thereof that preserves the biological activity of NAEl-alpha to form a heterodimer or NAEl-beta that is active in the pathway of the activation / conjugation of NEDD8. This aspect of the invention also includes the allelic variant expression elements of NAEl-alpha. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding NAEl-alpha, or nucleic acid sequences specifically homologous or specifically complementary thereto, vectors comprising any sequences of such nucleic acid, and expression units Recombinant expressing NAEl-beta or antisense transcripts or dominant negative mutants thereof. Each of these terms is as previously used. In an eighteenth aspect, the invention provides methods for modulating the auxin response in plants. The present inventors have discovered that NAEl-alpha shares 39% identity and 61% conserved residues with Auxl in A. Tal i ana, which is involved in the transduction of the signal in the response to auxin in plants. This suggests that antagonists of NAEl-beta and / or NAEl-alpha should down-regulate the response to auxin, and that the expression of NAEl-beta and / or NAEl-alpha should upregulate the response to auxin (see Leyser et al. Nature 354: 161-164 (1993)). A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit that expresses NAEl-beta or NAEl or an antagonist thereof to a plant that is suffering from auxin treatment. In a nineteenth aspect, the invention provides methods for modulating the biological function of APP and / or the accumulation of beta peptide in a biological system. The present inventors have discovered that NAEl-alpha is substantially the same protein as protein 1 that binds to the amyloid precursor protein (APP-BP1). This suggests that antagonists or agonists of NAEl-beta and / or NAEl-alpha should modulate the function of APP, including its role in beta-peptide accumulation. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit that expresses NAEl-beta or NAEl or an antagonist thereof, a a biological system. In a twentieth aspect, the invention provides two new purified NEDD8 conjugation enzymes. The primary amino acid sequence of a preferred embodiment of a first conjugation enzyme to NEDD8 (NCEl) is shown in Figure 2. The primary amino acid sequence of a preferred embodiment of a second NEDD8 conjugation enzyme of this type (NCE2) is shown in Figure 5. However, the terms "conjugation enzyme 1 to NEDD8", "NCEl", "conjugation enzyme 1 to NEDD8", and "NCE2", are intended to include the allelic variants thereof. An "allelic variant" as used herein, is a protein having at least about 50% identity of amino acid sequences, more preferably at least about 75%, even more preferably at least about 85%, still more preferably at less about 95%, and most preferably at least about 99% identity to the amino acid sequence described in SEQ ID NO. : 4 or SEQ ID NO. : 6, or a portion or conjugate of protein thereof which preserves the biological activity of NCEl or NCE2 to form the thioester linkage with NEDD8 under conditions as described in the following examples at a ratio of at least 10% of that of NCEl or NCE2, preferably at least 25% faster, more preferably at least 50% as fast, and more preferably at least 75% as fast. Preferably, such a biologically active portion comprises an amino acid sequence spanning residue 111 in Figure 2 or residue 116 in Figure 5, more preferably comprising at least about 25 additional amino acids respectively of NCEl or NCE2, still more preferably at least about 50 additional amino acids respectively of NCEl or NCE2, still more preferably at least about 75 additional amino acids respectively of NCE1 or NCE2, even more preferably, at least about 100 additional amino acids respectively of NCE1 or NCE2, more preferably at least about 150 additional amino acids respectively of NCEl or NCE2. Such allelic variants have the biological activity of NCE1 or NCE2, as discussed above. In alternative preferred embodiments, such allelic variants are either rationally designed or are allelic variants of natural origin, for example, they are expressed in effective individual mammals, more preferably from humans or effective individual mice. The rationally designed allelic variants can be produced according to standard procedures recognized in the art (see, for example, the international publication W095 / 18974). The terms "purified" and "protein" are as previously used. In a twenty-first aspect, the invention provides the expression elements of the conjugation enzyme to NEDD8. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding NCE1 or NCE2 or dominant negative mutants thereof, capable of expressing antisense transcripts thereof or nucleic acid sequences specifically homologous or specifically complementary to these, and the vectors comprising any such recombinant expression elements, preferably expression vectors.

The terms "specifically homologous", "specifically complementary" and "are specifically hybridized" are as previously used. A "recombinant expression element" is a nucleic acid sequence that encodes NCE1 or NCE2, or a portion encoding at least 20 contiguous amino acids thereof, or a dominant negative mutant thereof, or that is capable of expressing a antisense molecule specifically complementary thereto, or a molecule in a specifically homologous sense thereof, wherein the recombinant expression unit may be in the form of linear DNA or RNA, circular DNA or RNA, covalently closed or as part of a chromosome, nevertheless , with the proviso that it can not be the native chromosomal locus for NCEl or NCE2. Preferred recombinant expression elements are vectors, which may include an origin of replication and are thus replicable in one or more cell types. Certain preferred recombinant expression elements are expression vectors, and in addition they comprise at least one promoter and the passive terminator, thereby allowing the transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell. Preferred recombinant expression elements have at least 75% identity of the nucleic acid sequence, with the nucleic acid sequence described in SEQ ID No. 2 or SEQ ID No. 4, more preferably at least 90%, still more preferably at least 95%, and most preferably at least 99%, and codes for a protein or peptide having either biological activity of NCEl or NCE2 or activity as a dominant negative mutant thereof, as described below. "Dominant negative mutants" are proteins or peptides derived from NCEl or NCE2 that inhibit the biological activity respectively of NCEl or NCE2. Preferred dominant negative mutants include variants in which the carbon in position 111 of NCEl or in position 116 of NCE2 is substituted, preferably by sulfur. Preferred dominant negative mutants interfere with the association of NEDD8 and NCE1 or NCE2 and can be derived from, respectively NCE1 or NCE2. Other preferred dominant negative mutants interfere with the conjugation of NEDD8 to an objective protein and can be derived from either NCEl or NCE2. Such dominant negative mutants can be prepared by methods recognized in the art (see, for example, Townsley et al., Proc. Nati, Acad. Sci. USA 94: 2362-2367 (1997)). Preferably, such a dominant negative mutant is a protein or peptide having from 50% amino acid sequence identity to about 99% identity to the amino acid sequence described in SEQ ID No. 3 or SEQ ID No. 5, or a portion or conjugate of protein thereof which inhibits the biological activity of NCEl or NCE2 to form a thioester linkage with NEDD8 under conditions as described in the following examples by at least 50%, preferably by at least 75%, more preferably by at least 90%, and most preferably at least 99%. Preferably, such inhibitory portion comprises an amino acid sequence spanning residue 111 in Figure 2 or residue 116 in Figure 5, more preferably comprises at least about 25 additional amino acids respectively of NCEl or NCE2, still more preferably, at least about 50 additional amino acids respectively of NCEl or NCE2, still more preferably, at least about 75 additional amino acids respectively of NCEl or NCE2, still more preferably, at least about 100 additional amino acids respectively of NCE1 or NCE2, most preferably, at least about 150 additional amino acids respectively of NCE1 or NCE2. The purified protein and its structural information provided herein make possible the preparation of NCEl and NCE2 binding molecules, respectively NCElBMs and NCE2BMs. Thus, in a twenty-second aspect, the invention provides methods for identifying NCElBMs and NCE2BMs. A preferred method according to this aspect of the invention comprises selecting NCElBMs or NCE2BMs by contacting purified NCE1 or NCE2 according to the invention, and populations of molecules or mixed populations of molecules and determining the presence of molecules that specifically bind to NCEl or NCE2. Another preferred method according to this aspect of the invention comprises rationally designing the molecules that bind to NCE1 or NCE2, based on structural information from purified NCE1 or NCE2, provided by the invention, and determining whether such molecules are rationally designed specifically link to NCEl or NCE2. Molecules that specifically bind to NCE1 or NCE2 are molecules that bind to NCE1 or NCE2 with higher affinity than other unrelated proteins. Preferably, the binding affinity of the molecule is at least 5 times greater than the affinity for the unrelated proteins, more preferably, at least 10 times higher, still more preferably, at least 50 times higher, and most preferably, at least 100 times greater This aspect of the invention includes NCElBMs or NCE2BMS identified by the methods according to the invention. As used herein, a "NCEl or NCE2 binding molecule", or "NCElBMs or NCE2BMs", is a molecule or macromolecule that binds under physiological conditions respectively to NCE1 or NCE2. The terms "bind under physiological conditions", "population of molecules" and "mixed population of molecules" are as previously used. In certain preferred embodiments, an NCE1BM or NCE2BM according to the invention is a peptide or a mimetic peptide. For purposes of the invention, the term "peptide" is as previously used.

In certain preferred embodiments, such NCE1BM or NCE2BM comprises a region for determining the complementarity of an antibody, which binds under physiological conditions to an epitope containing peptide of, respectively NCE1 or NCE2, or a peptide mimetic of such a region for determination of complementarity. For purposes of the invention, the term "region of complementarity determination of an antibody" is as previously used. Accordingly, all such antibody derivatives and the mimetic peptides thereof are contemplated within the scope of the present invention. The compositions according to the present invention may further include physiologically acceptable diluents, stabilizing agents, locating agents or buffers. Additional preferred NCElBMs and NCE2BMs according to the invention include small molecules, which can be identified using rational design or selection procedures as described hereinafter. The NCElBMs and NCE2BMs can be used in conventional assays to detect the presence or absence, and / or the amount of NCEl or NCE2, or NCEl, or NCEl or the complex of NCE2 / NEDD8 in a biological sample. Thus, in a twenty-third aspect, the invention provides methods for determining the presence or absence and / or the amount of NCEl or NCE2, or NCEl or the complex of NCE2 / NEDD8 in a biological sample. Such methods comprise the provision of a detectable NCE1BM or NCE2BM, to a biological sample, allowing the detectable NCE1BM or NCE2BM to bind to NCE1 or the NCE2 / NEDD8 complex, if any is present in the biological sample, and detecting the presence or absence and / or the amount of a complex of the detectable NCE1BM or detectable NCE2BM and, respectively NCE1 or NCE2, or NCE1 or the NCE2 / NEDD8 complex. A detectable NCE1BM or NCE2BM is an NCE1BM or NCE2BM that can be detected in an assay. Such detection is preferably through the direct or indirect linkage of a label or tag on NCE1BM or NCE2BM. The term "direct or indirect link" is as previously used. Preferred labels and markers include, without limitation, radioisotopes, heavy metals, fluorescent labels, chemiluminescent labels, enzymes, and enzyme substrates.

Preferred biological samples include blood, serum, plasma, cells, tissue portions, and cell or tissue extracts. In certain preferred embodiments, the method according to this aspect of the invention takes the form of a conventional ELISA or RIA. In another preferred embodiment the method employs either direct or indirect immunofluorescence. Additional preferred embodiments utilize the imaging of cells expressing NCEl or NCE2 using conventional imaging agents directly or indirectly linked to an NCE1BM or NCE2BM according to the invention. Nucleic acid sequences specifically complementary to and / or specifically homologous to the nucleic acid sequences encoding NCE1 or NCE2 can also be used in conventional assays to detect the presence or absence of the nucleic acid of NCE1 or NCE2 in a biological sample. Thus, in a twenty-fourth aspect, the invention provides methods for the determination of the presence or absence and / or amount of nucleic acid of NCEl or NCE2 in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and / or amplification assays, such assays comprising the provision to the biological sample of a nucleic acid sequence, which is specifically complementary to the nucleic acid of NCE1 or NCE2. Particularly preferred embodiments include spotting or Northern blotting, spotting or spotting, and polymerase chain reaction. In a twenty-fifth aspect, the invention provides methods for the identification of modulating ligands of NCEl or NCE2. Some NCElBMs and NCE2BMs are capable of acting as antagonists or agonists, respectively of NCEl and NCE2. Thus, the method according to this aspect of the invention comprises the provision of NCElBMs or NCE2BMS to a test system respectively for the participation of NCEl or NCE2 in the activation / conjugation pathway of NEDD8, and the determination of if such NCElBMs or NCE2BMs interfere with or improve the ability of NCEl or NCE2 to participate in the NEDD8 activation / conjugation pathway. The NCElBMs or NCE2BMs are preferably provided as a population of molecules (more preferably rationally engineered molecules), or as a mixed population of molecules, as for example in a selection procedure. This aspect of the invention includes the antagonists or agonists of NCEl or NCE2 identified by this method according to the invention. The evaluation of the ability to "interfere with or improve the ability to participate in the activation / conjugation pathway of NEDD8" can be conventionally carried out using a system of vi nite activity, as described hereinafter. Preferably, such interference or improvement results in a reduction of activation / conjugation of NEDD8 of at least 50%, more preferably at least 90%, and most preferably at least 99%, or an increase in activation / conjugation of NEDD8 of at least 50%, preferably at least 2 times, more preferably at least 5 times, most preferably at least 10 times. In a twenty-sixth aspect, the invention provides the modulating ligands of NCEl or NCE2. Preferred modulation ligands are NCElBMs or NCE2BMS which act as antagonists, interfering as the ability respectively of NCEl or NCE2 to participate in the activation / conjugation pathway of NEDD8. Other preferred modulating ligands are NCElBMs or NCE2BMs which act as agonists, improving the ability, respectively, of NCEl or NCE2 to participate in the activation / conjugation pathway of NEDD8. Preferably, such inhibition or augmentation is specific, for example, the modulating ligand interferes with or improves the ability of NCEl or NCE2 to participate in the activation / conjugation pathway of NEDD8 at a concentration that is less than the concentration of the ligand required for produce another biological effect not related. Preferably, the concentration of the ligand required for the activation / conjugation modulating activity of NEDD8 is at least 2 times lower, more preferably at least 5 times lower, even more preferably at least 10 times lower, and most preferably at least 20 times less than the concentration required to produce an unrelated biological effect. In certain embodiments, such NCElBMs or NCE2BMs preferably interact with, respectively, NCEl or NCE2 to inhibit or enhance the formation of a thiol ester linkage between NEDD8 and NCEl or NCE2, and / or the transfer of NEDD8 to a target protein.

In a twenty-seventh aspect, the invention provides methods for modulating the formation of a thiol ester linkage between NEDD8 and NCEl or NCE2, or the transfer of NEDD8 to an objective protein. A preferred embodiment of the method according to this aspect of the invention comprises the provision of a modulating ligand in NCEl or NCE2 or a recombinant expression unit expressing NCE1 or NCE2 or an antagonist thereof to a biological system in which NEDD8 is conjugated to another protein. The term "biological system" as used herein, includes extracts of cells or tissues in vi tro, cell cultures, tissue cultures, organ cultures, living plants and animals, including mammals, including limitation of humans and mice. In a twenty-eighth aspect, the invention provides the oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 2 or Figure 5. For purposes of the invention, the term "oligonucleotide" is as previously used. Certain embodiments of such oligonucleotides are useful as antisense probes. Other embodiments are useful as antisense oligonucleotides for use in human therapeutic programs or animal models. In a twenty-ninth aspect, the invention provides a purified complex of NCEl and NEDD8, or of NCE2 and NEDD8. The terms "complex" and "purified" are as previously used. The following examples are intended to further illustrate certain particularly preferred embodiments of the invention and are not intended to limit the scope of the invention. Searches of EST databases in humans used the BLAST program (Altschul et al., Nucleic Acids Res 25: 2389: 3402 (1997)). Searches for transmembrane helices used the program Antheprot V.3.0 Gilbert Deleague, Institute of Biology and Chemistry of Proteins 69 367 Lyon cdex 07, France.

Example 1 Preparation of human NEDD8 The nucleotide sequence coding for the 76 N-terminal residues of human Neddd was obtained from a human leukocyte cDNA library (Life Technologies Tech-LineSM, Inc.) by nested polymerase chain reaction, using 5'- ccg tgt gca gcc cea aac tgg and 5'-aca ggg taa aga ggt aaa atg as the front and reverse primer of the first round, respectively. In the second round, 5 '-ggg aat tcc ata tgc taa tta aga tga aga cgc and 5' -ccc aag ctt tcc tcc tet cag age caa was used as the forward and inverse primer, respectively. The second PCR product was digested with Ndel and HindIII and ligated to the large fragment of a similarly digested PT7-7 vector. The construct was transformed into E. coli strain BL21 (DE3) / pLysS (Novagen). The expression of Neddd was induced by the addition of 0.5 mM IPTG. The S100 fraction of the bacterial extracts was applied to a Q-Sepharose column in 50 mM HEPES, pH 7.5 and the side-to-side flow containing Neddd was collected, concentrated by ultrafiltration and fractionated by size exclusion chromatography on Superdex G75 .

Example 2 Identification of the NEDD8 Activation Enzyme To identify the activation enzyme of Human Neddd, the presence of this enzymatic activity was first tested by checking the incorporation of Neddd in the form of a thioester bond within the proteins derived from Hela cells. Based on the chromatographic behavior of the recombinant human Neddd, two protein fractions (Fl and FII) were generated from the extracts of the Hela cells, which are expected to be devoid of endogenous Neddd as follows. To eliminate Neddd, 400 mg of protein from the S100 fraction of Hela cells was applied to a 70 ml column of Q-Sepharose, equilibrated with 50 mM HEPES, pH 8.0 with 1 mM DTT. Proteins in the side-by-side flow fraction were precipitated in 90% ammonium sulfate, dialysed and fractionated by size exclusion chromatography on Superdex G75. Fractions that eluted earlier than Neddd were combined and concentrated by ultrafiltration to 15 mg / ml and are designated herein as Fl. The proteins retained by Q-Sepharose were eluted by inclusion of 0.6 M NaCl in the equilibrium buffer. The collected proteins were precipitated with 90% ammonium sulfate and dialyzed against 25 mM Hepes, pH 7.5, and 1 mM DTT and concentrated to 15 mg / ml of protein. This fraction is designated herein as FII. Fraction II was generated by harvesting the proteins that were retained by an anion exchange gel (Q-Sepharose) while Fl was obtained by further fractionation of the non-retained proteins by gel filtration. Incubation of 125I-Nedd8 with FII, but not with Fl, produced a radiolabeled band on SDS-gel that migrated at 59 kDa. The formation of this radiolabeled species required the presence of ATP, and this species could not be detected when DTT was included in the SDS-gel sample buffer. Thus, FII contains an activity that binds Neddd to a protein via a link sensitive to DTT. Incubation of 125Nedd8 with Fl and FII together resulted in the formation of two additional radiolabeled bands on SDS-gel, migrating at 30 and 97 kDa. Only the 30 kDa species showed sensitivity to DTT. One interpretation of this result is the presence of a Neddd conjugation enzyme in Fl, which serves to accept Neddd from its activation enzyme in FII to form a 30 kDa thioester.

Example 3 Purification of NEDDd Activation Enzyme To purify the protein in FII that forms the DTT-sensitive link to Neddd, Neddd was immobilized to the CH-Sepharose 4B gels and DTT was used to elute the proteins that were initially retained by the gel matrix, as follows. Affinity gel by Neddd was prepared by coupling Neddd purified to activated CH Sepharose 4B (Pharmacia) according to the manufacturer's instructions and led to the coupling of 5 mg of Neddd / ml of gel spheres. 100 mg of the FII protein in a 9 ml reaction buffer containing MgATP and an ATP regeneration system was applied to 1 ml of gel spheres immobilized with Neddd at room temperature. The column was washed sequentially with 5 volumes of buffer bed A (50 mM Tris-HCl buffer, pH 7.5), buffer A with 0.5 M NaCl, and buffer A. A buffer containing 50 mM Tris-HCl, pH 9.0 and 10 mM DTT was used to elute bound proteins. Analysis of the proteins by SDS-PAGE and silver staining revealed the presence of two major proteins that migrated at 60 and 49 kDa. A third major protein, which migrated at 43 kDa, eluted as a broad peak. When the eluted proteins were analyzed by gel filtration chromatography, the 43 kDa protein eluted as a large aggregate in the empty volume, whereas p60 and p49 were found to co-elute with a retention time similar to that of the enzyme of ubiquitin activation of 110 kDa, suggesting that these two proteins form a heterodimer. To determine which of these two proteins forms the DTT-sensitive link with Neddd, proteins modified from the affinity chromatography step by Needd were tested. The result is consistent with p49 which is the Neddd acceptor. This protein is quantitatively absent only when ATP or AMPPNP was included in the reaction and only if the electrophoresis was carried out in the absence of DTT. The fact that a new discrete protein band was not detected under conditions in which p49 was absent is probably due to the presence of p60 which excludes the detection of proteins that could migrate with similar mobility. In a separate experiment, the use of 12 Nedd8 in the reaction led to the detection of a 59 kDa band sensitive to DTT, confirming the presence of a thioester containing Nedd8. The ability of AMPPNP to substitute ATP suggests that the activation of NEDDd, similar to ubiquitin and SUMO-1, involves the intermediate formation of a Neddd adenylate bound in the enzyme, before the binding of the thiomers.

Example 4 Determining the Sequence of the NEDDd Activation Enzyme To obtain the identity of p-49, this protein was excised from an SDS gel, digested with trypsin and the peptides were eluted and purified by HPLC as follows. The peak fractions from the affinity chromatography step of Neddd were concentrated and separated by SDS-PAGE, stained with Coomassie Brilliant Blue, and the bands corresponding to p49 and p60 were excised. The gel slices were digested with trypsin, the peptides were extracted and purified by reverse-phase micro-orifice HPLC (PE-Applied Biosystems model 140A / system 1000S) on silica columns Zorbax SF-C1S (1 x 150 mm), using linear gradients of acetonitrile in 0.06% aqueous trifluoroacetic acid (TFA), essentially as described (J. Pohl et al., FEBS Lett 272, 200 1990). The masses of the peptides were determined by matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF) using a Bruker Instrument model ProFlex MALDI-TOF operated in the reflectron mode; 2, 5-dihydroxybenzoic acid was used as the sample matrix. The sequences of the peptides were determined by automated Edman degradation on a Procise-HT PE-Applied Biosystems sequencing system operated in the pulsed liquid mode using the sequencing cycles provided by the manufacturer. Two tryptic peptide sequences were determined (shown underlined in Figure 1), and these sequences were used to investigate the protein as well as the databases of the sequential marker expressed (EST). Although these sequences did not resemble the proteins known in the database, two groups of EST clones could be identified, whose translated amino acid sequence produced perfect couplings to either of the two tryptic peptides. Further investigation of the homology with these EST sequences identified additional EST clones with overlapped sequences. Analysis of these EST clones made it possible to obtain a contiguous open reading frame (ORF) that codes for a 442 residue protein that contains the two tryptic peptide sequences. The nucleotide sequence of this ORF was confirmed by direct nucleotide sequencing of two EST clones (AA40d62 and R57021). The analysis of this protein sequence revealed three regions of homology with human Ubal. Region I contains the putative ATP binding site found in Ubal which is also present in the yeast Uba2, and region II contains the portion of the PXCT sequence found in Ubal in which the cysteine residue was identified by mutational analysis to form the thioester bond with ubiquitin. These similarities are expected if the activation of Neddd uses a mechanism similar to that of ubiquitin and Smt3. Since p49 forms a heterodimer with p60 and functions as a protein component of Neddd activation, it was designated Nae_beta and p60 as Nae-aifa. Investigations of the data banks with the protein sequence identified an open reading structure in S. pombe, and one in C. the egan which code for proteins of similar size. In addition, a protein of 299 S. cerevisiae residues, despite its smaller size, also shows extensive homology with this human protein. These are probably homologs of Nae-beta in different species, since identical residues certainly conserved between these four proteins are interspersed throughout the greater part of the protein, while their homology to Ubal and Uba2 is limited to defined regions only .

Example 5 Identification of Nae-alpha The similarity between the activation enzyme of Neddd and Smt3 in its subunit structure suggested that p60 or Nae-a? Fa could also contain a sequential stretch that shares homology to the N-62 portion. terminal of Ubal. Using procedures similar to those with p49, three tryptic peptide sequences were obtained for p60. These sequences FTVVATQLPEXTXL, EHFQSYDLDHME, and QTPSF ILA produced perfect couplings to residues 123-136, 194-205 and 300-308 at residue 534 of APP-BPl. In addition, mass spectroscopy of 15 of the triptych peptides revealed equivalences or couplings within 1 Da of the expected mass of the tryptic peptides of APP-BP1. These adjustments or couplings covered 37% of the APP-BPl sequence. In this way, it was concluded that Nae-aifa is of course APP-BPl.

E p e 6 Identification and cloning of NCEl The putative human homolog of Ubcl2 from yeast was identified by searching the human EST database for clones that have coding sequences that are homologous to the yeast protein. An initial investigation using the yeast protein sequence identified several clones. Clone AA261636, which contains a coding sequence very similar to a region of the yeast protein was used for d3 look for additional clones of EST. The search led to the construction of a contiguous consensus sequence from the overlapping clones, which predicts that a gene encodes a protein having ld3 amino acids, with a predicted molecular mass of 20899 Da. The contiguous nucleotide sequence was obtained using nested PCR on a human leukocyte cDNA library. The first PCR used primers that have the sequence GCAGGATGATCAAGCTGTTCTCGC (forward) and CGTGGCGGGGGTGGGTATGCGCCA (inverse). The second PCR used the primers CGGGAATTCCATATGATCAAGCTGTTCTCGCTG (front) and CGCCCAAGCTTCTATTTCAGGCAGCGCTCAAAG (inverse). The PCR product was digested with Ndel and HindIII and ligated with the similarly digested plasmid pT7-7. The resulting clone, pt7-7-UbcH12, was sequenced to determine the nucleotide sequence (SEQ ID NO 3) and the deduced amino acid sequence (SEQ ID NO 4) shown in Figure 1. Figure 2 shows the alignment of NCEl with the Ubcl2 of yeast. NEC1 shows 41% identity and 63% homology with the Ubcl2 of yeast.

Example 7 Expression and purification of NEC1 Bacterial cells BL21 (EE3) (Novagen, Madison, Wl; catalog No. 69450-1) were transformed with the plasmid pT7-7UbcH12 using standard procedures. Transformed bacteria were induced to express the NCEl protein by adding, up to a final concentration of 1 mM, isopropyl-b-D-thiogalactopyranoside (IPTG) to an exponentially growing culture. The culture was allowed to develop for an additional 3 hours at 37 ° C. The NCEl protein was purified from the Used cells by sequential anion exchange and size exclusion chromatography. For anion exchange chromatography, the bacterial extract was loaded at a protein / gel ratio of 15 mg protein / ml gel on Q-Sepharose (Pharmacia, Piscataway, NJ) equilibrated with 50 mM HEPES (pH 7.8) and DTT 1 mM. The NCEl protein was retained by the gel and eluted using a linear gradient of NaCl in the gel equilibration buffer. The fractions containing the NCEl protein were determined by the thioester formation assay of NEDD8. NCEl was found to elute at 0.08 M NaCl. The active fractions were combined and concentrated by microfiltration and then subjected to size exclusion chromatography on Superdex-75 (Pharmacia) using a 50 mM HEPES column buffer (pH 7.8), DTT lmM and 50 mM NaCl. The fractions were tested for the formation of NEDDd-thioester. NCEl eluted at an expected volume for a 19 kDa protein, suggesting that it exists as a monomer. SDS-PAGE analysis with Commassie staining indicated that the preparation was predominantly the NCEl protein (>90%). The purified NCEl protein migrated on an 8% TRICINA gel at a molecular weight of 21 kDa (data not shown). Extending the N-terminus of NCEl with the amino acid sequence MHHHHHH resulted in a variant protein of NCEl that retained activity in the formation of NEDDd-thioester. The six histidine residues provide a nickel binding site and allowed this variant to be purified by Ni-NTA or other metal affinity chromatography methods.

Example 8 Thioester formation between NCEl and NEDDd The proteins (as indicated below) were incubated in a reaction buffer containing 25 mM Hepes (pH 7.0), 10 mM Mg2 + and 1 mM ATP for 5 minutes at 30 ° C. The reaction was stopped by the addition of SDS sample charge buffer. Each sample was divided into two aliquots, one of which DTT was added to a final concentration of 10 mM. The sample containing DTT was heated in a bath at 95 ° C for two minutes. Samples were separated on PAGE of 10% SDS-tricine, followed by silver staining. The results are shown in Figure 4. Lanes 1-4 are reaction mixtures 1-4. Lanes 5-6 are reaction mixtures 1-4 which were incubated with 10 mM DTT and heated at 90 ° C for two minutes before electrophoresis. These results show that NCEl migrates at a slower rate in the presence of NEDDd and Nae, and that this is reversible by DTT. The enzyme of activation of ubiquitina, El, can not replace NAE when providing this result. These data support the view that NCEl is a conjugation enzyme to NEDD8 that d7 forms a thioester with NEDDd in the presence of the activation enzyme NAE.

Reaction No. Protein 1 NAE + NEDDd 2 NCEl + NEDD6 3 NCEl + NEDDd + NAE 4 NCEl + NEDDd + ubiquitin activation enzyme, El Example 9 Identification and cloning of NCE2 The human EST database was investigated using as a search sequence HPNITETICLSLLREHSIDGTGWA. This is the sequence of clone AA306113 and it has similarity to the active site of the proteins in the UBC protein family. Clones having sequences that overlapped to the sequence of clone AA306113 were identified. The identified sequences of the overlapped EST clones were aligned by the CLUSTALW program (See Thompson et al. Nucleic Acids Res. 22: 4673-46d0 (1994), or by SeqMan program (DNASTAR, Inc., Madison, Wl) to produce a consensus sequence, C0N1. CON1 was used to perform searches for additional clones with overlapping sequences. The overlapping sequences produced an open reading structure which codes for a protein of 185 amino acids (predicted molecular mass = 21076 Da). Based on the homology to the known human Ubc proteins, this gene is a member of the human Ubc gene family. The contiguous nucleotide sequence of NCE2 was obtained using nested PCR on a human leukocyte cDNA library. The first PCR used the primers AGCCCAGGGTAAAGGCAGCA (forward) and CATGTTAGAGACAAACTGTA (inverse). The second PCR used the primers GGGAATTCCATATGCTAACGCTAGCAAGTAA (front) and CCATCGATTCATCTGGCATAACGTTTGA. The PCR product was then cloned into the sites Ndel / HindIII of pT7-7 to generate the plasmid pT7-7- HSUBC17. The NCE2 gene sequence and its deduced amino acid sequence are shown in Figure 4. There is no close homologue in the yeast genome. The protein has 46% identity and 64% homology with a C gene. the egans (Genebank Access # CE 275650) of unknown function (see figure 5). 69 Example 10 Expression and purification of NCE2 BL21 bacterial cells (DE3) were transformed with the pT7-7-UbcH17 plasmid using conventional procedures. The transformed bacteria were induced to express the NCE2 protein by the addition, to a final concentration of 1 mM, of isopropyl-b-D-thiogalactopyranoside (IPTG) to an exponentially growing culture. The culture was allowed to develop for an additional 3 hours at 37 ° C. The NCE2 protein was purified from the Used cells by sequential anion exchange and size exclusion chromatography. For anion exchange chromatography, the bacterial extract was loaded at a protein / gel ratio of 15 mg protein / ml gel on Q-sepharose (Pharmacia) equilibrated with HEPES 50 mM (pH 7.8) and 1 mM DTT. The NCE2 protein was retained by the gel and eluted using a linear gradient of sodium chloride in the gel equilibration buffer. The fractions containing the NCE2 protein were determined by the assay for the formation of the thioester of NEDDd. NCE2 was found to elute to O.dM NaCl. The active fractions were combined and concentrated by microfiltration and then subjected to size exclusion chromatography on Superdex-75 (Pharmacia) using a 50 mM HEPES column buffer (pH 7.8), 1 mM DTT and 50 mM NaCl. The fractions were assayed for the formation of 1 5I-NEDD8-thioester. NCE2 eluted at an expected volume for a 21 kDa protein, suggesting that it exists as a monomer. SDS-PAGE analysis with Commassie staining indicated that the preparation was predominantly protein NCE2 (> 90%). The purified NCE2 protein migrated on an 8% TRICINA gel at a molecular weight of 21 kDa (data not revealed) .

Example 11 Formation of thioester of NCE2 and NEDDd The ability of NCE2 to form a thioester linkage with NEDDd was evaluated as follows. The NCE2 protein, either purified or from the bacterial lysate, was incubated with 125 I-NEDDd (106 cpm / μg) in a buffer containing 25 mM HEPES (pH 7.0), 10 M MgCl 2, 1 mM ATP and 20 nM purified NA or ubiquitin activation enzyme. The reaction was allowed to proceed at 30 ° C for 5 minutes. The reaction was stopped by the addition of the SDS sample buffer either with or without 10 mM DTT. Samples were subjected to SDS-PAGE and autoradiography. In the reaction containing NCE2 (band 3), autoradiography showed two radiolabeled bands with apparent molecular masses of 7 and 29 kDa, which are the expected molecular masses of NEDDd and NEDDd-NCE2, respectively. Only the 7 kDa band was detected when the sample was incubated in 10 mM DTT before electrophoresis, consistent with the 29 kDa band which is a thioester of NEDD8-NCE2. Analogous reactions containing NCEl instead of NCE2 (lanes 2 and 4) are shown for comparison. These results demonstrate that NCE2 is capable of forming a thioester linkage with NEDDd, but not with ubiquitin, in an NAE-dependent reaction. These data support the view that NCE2 is a conjugation enzyme to NEDDd.

Example 12 Preparation of dominant negative mutants The active site cysteine of a cloned NCE1 or NCE2 is assigned by examining the sequential alignment with the known Ubc proteins (see Figure 6 for alignment). The active site cysteine is replaced by a serine using site-specific mutagenesis, standard. The mutant protein is expressed in bacteria and purified. The ability of the mutant protein to form a stable oxygen ester with NEDD8 is established as described in Examples 8 and 11 above, except that linkage formation is not labile in DTT. The activity of the dominant negative mutant is then established by the introduction of the mutant protein in increasing concentrations in an assay as described in Examples 8 and 11 above, and demonstrating the dose-dependent inhibition of NEDD8 / NCE1 or the formation of the NCE2 complex.

It is noted that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that it is clear from the present description of the invention.

Claims

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. The beta subunit of the purified NEDD8 activation protein, (NAEl-beta).

2. The beta subunit of the purified NEDDd activation protein, according to claim 1, characterized in that it has the amino acid sequence described in SEQ ID NO: 23.

An expression element of NAEl-beta which is an isolated or recombinant nucleic acid sequence, characterized in that it encodes NAEl-beta or because it encodes a protein or peptide comprising residues 214-217 of SEQ ID NO: 2 and that it has either the biological activity of NAEl-beta or activity as a dominant negative mutant thereof.

4. The expression element of NAEl-beta according to claim 3, characterized in that the nucleic acid sequence has at least 75% nucleic acid sequence identity, with the nucleic acid sequence described in SEQ ID NO: 1:

5. The expression element of NAEl-beta according to claim 3, characterized in that the nucleic acid sequence contains at least 90% nucleic acid sequence identity with the nucleic acid sequence described in SEQ ID NO: 1.

6. An expression element of NAEl-beta which is an isolated or recombinant nucleic acid sequence, characterized in that it has at least 75% nucleic acid sequence identity with the exact complement of the nucleic acid sequence described in SEQ ID NO: 1.

7. The NAEl-beta expression element according to claim 6, characterized in that it has at least 90% nucleic acid sequence identity with the exact complement of the nucleic acid sequence described in SEQ ID NO: 1.

6. An expression element of NAEl-beta which is a vector or recombinant expression unit, characterized in that it comprises the nucleic acid sequence according to any of claims 3-7.

9. A method for identifying NAElBBMs, characterized in that it comprises contacting purified NAEl-beta according to the invention and populations of molecules or mixed populations of molecules, and determining the presence of molecules that specifically bind to NAEl-beta.

10. An NAE1BBM, characterized in that it is identified by the method according to claim 9.

11. A method for determining the presence or absence and / or the amount of NAEl-beta, heterodimer of NAEl, or the heterodimer complex of NAE1 / NEDD8 in a biological sample, the method is characterized in that it comprises the provision of a detectable NAE1BBM to a biological sample, allowing the detectable NAE1BBM to bind to NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAEl / NEDDd, if any is present in the biological sample, and the presence or absence is detected and / or the amount of a complex of the detectable NAE1BBM and the NAEl-beta, the heterodimer of NAEl, or the heterodimer complex of NAEl / NEDDd.

12. A method for determining the presence or absence and / or amount of NAEl-beta nucleic acid in a biological sample, characterized in that it comprises providing the biological sample with a nucleic acid sequence that is specifically complementary to the NAEl-beta nucleic acid .

13. A method for identifying the NAEl-beta modulation ligands, characterized in that it comprises providing the NAElBBMs to a test system for the participation of NAEl-beta in the activation / conjugation pathway of NEDDd, and determining whether such NAElBBMs interfere with or 96 improve the ability of NAEl-beta to participate in the NEDDd activation / conjugation pathway.

14. A ligand modulating NAEl-beta.

15. The modulation ligand of NAEl-beta, characterized in that it is identified by the method according to claim 13.

16. The modulating ligand of NAEl-beta according to claim 14, characterized in that it interacts with NAEl-beta to inhibit or enhance the formation of the NAEl heterodimer, the formation of the NEDDd adenylate, the formation of a thiol ester link between NEDDd and NAEl, and / or the transfer of NEDDd to the conjugation enzyme to NEDDd.

17. An antagonist of NAEl-beta, characterized because it interferes with the expression of the NAEl-beta gene. ld.

A method for identifying NAElABMs, characterized in that it comprises the selection of NAElABMs by contacting purified NAEl-alpha and populations of molecules or mixed populations of molecules, and determining the presence of molecules that specifically bind to NAEl-alpha.

19. An NAE1ABM, characterized in that it is identified by the methods according to claim ld.

20. A method for determining the presence or absence and / or the amount of NAEl-alpha, heterodimer of NAEl, or the heterodimer complex of NAEl / NEDDd in a biological sample, the method is characterized in that it comprises the provision of a detectable NAE1ABM to a biological sample, allowing the detectable NAE1ABM to bind to NAEl-alpha, to the heterodimer of NAEl, or to the heterodimer complex of NAEl / NEDDd, if any is present in the biological sample, and the presence or absence is detected and / or the amount of a complex of the detectable NAE1ABM and the NAEl-alpha, the heterodimer of NAEl, or the heterodimer complex of NAEl / NEDDd.

21. A method for detecting the presence or absence of the NAEl-alpha nucleic acid in a biological sample, in which conjugation to NEDDd is suspected, the method is characterized in that it comprises providing the biological sample with a nucleic acid sequence that is specifically complementary to the NAEl-alpha nucleic acid.

22. A method for identifying the NAEl-alpha modulation ligands, characterized in that it comprises providing the NAElABMs to a test system for the participation of NAEl-alpha in the activation / conjugation pathway to NEDDd, and determining whether such NAElABMs interfere with or improve the ability of NAEl-alpha to participate in the activation / conjugation path to NEDDd.

23. A ligand modulating NAEl-alpha.

24. A modulation ligand, characterized in that it was identified by the method according to claim 22.

25. The modulating ligand according to claim 23, characterized in that it interacts with NAEl-alpha to inhibit the formation of the NAEl heterodimer, the formation of NEDDd adenylate, the formation of a thiol ester link between NEDDd and NAEl, and / or the transfer of NEDDd to the conjugation enzyme to NEDDd.

26. An antagonist of NAEl-alpha, characterized in that it interferes with the expression of the NAEl-alpha gene.

27. A method for the modulation of activation and / or conjugation of NEDDd, characterized in that it comprises providing a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit expressing NAEl-beta or NAEl-alpha on an antagonist of it, to a biological system in which NEDDd is conjugated to another protein. 2d.

A method for modulating the auxin response in plants, characterized in that it comprises the provision of a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit that expresses NAEl-beta or NAEl-alpha, or an antagonist of the same, to a plant that is undergoing auxin treatment.

29. A method for modulating the function of APP and / or the accumulation of the beta peptide in a biological system, characterized in that it comprises providing a modulating ligand of NAEl-beta or NAEl-alpha or a recombinant expression unit expressing NAEl- beta or NAEl-alpha or an antagonist thereof to a biological system.

30. A purified complex of NAEl-beta or NAEl-alpha, or a purified complex of portions thereof.

31. A purified complex of NAEl-beta, or NAEl-alpha and NEDDd, or a purified complex of portions thereof.

32. An allelic variant of NAEl-alpha.

33. An expression element of the allelic variant of NAEl-alpha, characterized in that it is selected from isolated or recombinant nucleic acid sequences coding for NAEl-alpha, or nucleic acid sequences specifically homologous or specifically complementary to it, the vectors which comprise any such nucleic acid sequences, and recombinant expression units that express NAEl-beta or antisense transcripts or dominant negative mutants thereof.

34. An allelic variant of conjugation enzyme 1 to NEDDd (NCEl).

35. The allelic variant of conjugation enzyme 1 to NEDDd according to claim 34, characterized in that it has at least 95% amino acid sequence identity to the amino acid sequence described in SEQ ID NO: 4.

36. An expression element of the allelic variant of NCE1 which is an isolated or recombinant nucleic acid sequence, characterized in that it has at least 90% nucleic acid sequence identity to the nucleic acid sequence described in SEQ ID NO: 3, and which codes for a protein having biological activity of NCEl or activity as a dominant negative mutant thereof.

37. The expression element of the allelic variant of NCEl according to claim 36, which has at least 95% sequential identity to the nucleic acid sequence described in SEQ ID NO: 3.

38. An expression element of the allelic variant of NCE1 which is an isolated or recombinant nucleic acid sequence, characterized in that it has at least 75% nucleic acid sequence identity to the exact complement of the nucleic acid sequence described in SEQ ID NO : 3.

39. The expression element of the allelic variant of NCEl according to claim 38, characterized in that it has at least 90% nucleic acid sequence identity to the exact complement of the nucleic acid sequence described as SEQ ID NO: 3.

40. An expression element of the allelic variant of NCE1 which is a vector or recombinant expression unit, characterized in that it comprises the nucleic acid sequence according to any of claims 36-39.

41. A method for identifying NCElBMs, characterized in that it comprises contacting purified NCEl and populations of molecules or mixed populations of molecules, and determining the presence of molecules that specifically bind to NCEl.

42. An NCE1BM, characterized in that it is identified by the method according to claim 41.

43. A method for determining the presence or absence and / or the amount of NCEl or the NCE1 / NEDD8 complex in a biological sample, characterized in that the method comprises providing a detectable NCE1BM to a biological sample, allowing detectable NCE1BM to be linked to NCEl , or to the NCEl / NEDDd complex, if any is present in the biological sample, and detecting the presence or absence and / or the amount of a complex of the detectable NCE1BM and NCEl or the NCEl / NEDDd complex.

44. A method for determining the presence or absence and / or amount of nucleic acid of NCEl in a biological sample, characterized in that it comprises providing the biological sample with a nucleic acid sequence that is specifically complementary to the nucleic acid of NCEl.

45. A method for identifying modulating ligands of NCEl, characterized in that it comprises the provision of NCElBMs to a test system for the participation of NCEl in the activation / conjugation pathway of NEDDd, and determining whether such NCElBMs interfere with or improve the ability of NCEl to participate in the activation / conjugation route to NEDD8.

46 A modulating ligand of NCEl

47. The modulating ligand of NCEl, characterized in that it is identified by the method according to claim 45.

48. The modulating ligand of NCEl according to claim 47, characterized in that it interacts with NCEl to inhibit or enhance the formation of a thiol ester link between NEDD8 and NCEl, and / or the transfer of NEDDd to the target protein of NEDDd.

49. An antagonist of NCEl, characterized in that it interferes with the expression of the NCEl gene.

50. Enzyme 2 that is conjugated to NEDDd, purified (NCE2).

51. The conjugation enzyme 2 to NEDD8, purified, according to claim 50, characterized in that it has the amino acid sequence described as SEQ ID NO: 5.

52. An expression element of NCE2 which is an isolated or recombinant nucleic acid sequence, characterized in that it has at least 90% sequential identity to the nucleic acid sequence described in SEQ ID NO: 5 and that it codes for a protein having activity of NCE2 or activity as a dominant negative mutant thereof.

53. The expression element of NCE2 according to claim 52, characterized in that it has at least 95% sequential identity to the nucleic acid sequence described in SEQ ID NO: 5.

54. An expression element of NCE2 which is an isolated or recombinant nucleic acid sequence, characterized in that it has at least 75% sequential identity to the exact complement of the nucleic acid sequence described in SEQ ID NO: 5.

55. The expression element of NCE2 according to claim 54, characterized in that it has at least 90% sequential identity of nucleic acid to the exact complement of the nucleic acid sequence described as SEQ ID NO: 5.

56. An expression element of NCE2 that is a vector or recombinant expression unit, characterized in that it comprises the nucleic acid sequence according to any of claims 52-55.

57. A method for identifying NCE2BMs, characterized in that it comprises contacting purified NCE2 and populations of molecules or mixed populations of molecules and determining the presence of molecules that specifically bind to NCE2.

58. An NCE2BM, characterized in that it is identified by the method according to claim 57.

59. A method for determining the presence or absence and / or the amount of NCE2 or the NCE2 / NEDD8 complex in a biological sample, the method is characterized in that it comprises the provision of a detectable NCE2BM to a biological sample, allowing the detectable NCE2BM to be linked to NCE2, or to the NCE2 / NEDD6 complex, if any are present in the biological sample, and detecting the presence or absence and / or amount of a complex of the detectable NCE2BM and of NCE2 or the complex of NCE2 / NEDD6.

60. A method for determining the presence or absence and / or amount of nucleic acid of NCE2 in a biological sample, characterized in that it comprises providing the biological sample with a nucleic acid sequence that is specifically complementary to the nucleic acid of NCE2.

61. A method for identifying modulating ligands of NCE2, characterized in that it comprises providing NCE2BMs to a test system for the participation of NCE2 in the activation / conjugation pathway of NEDDs, and determining whether NCE2BMS interfere with or improve the ability of NCE2 to participate in the activation / conjugation route to NEDDd.

62. A ligand modulating NCE2.

63. The modulating ligand of NCE2, characterized in that it is identified by the method according to claim 61.

64. The modulating ligand of NCE2 according to claim 62, characterized in that it interacts with NCE2 to inhibit or enhance the formation of a thiol ester link between NEDDd and NCE2, and / or the transfer of NEDDd to the target protein of NEDDd.

65. An antagonist of NCEl, characterized in that it interferes with the expression of the NCEl gene.

66. A purified complex of NCEl and NEDDd, or a purified complex of portions of the same.

67. A dominant negative mutant of NCEl or NCE2 HUMAN PROTEINS RESPONDING TO THE ACTIVATION AND CONJUGATION OF NEDD8 SUMMARY OF THE INVENTION The invention relates to the covalent modification of proteins through their conjugation with other proteins. More particularly, the invention relates to the modulation of such conjugation involving the NEDDd protein. The invention provides compositions and methods for detecting and / or modulating the activation and / or conjugation of NEDDd, as well as compositions and methods for discovering molecules that are useful in the detection and / or modulation of activation and / or conjugation of NEDDd. The present invention arises from the purification and characterization of the novel enzymes of activation and conjugation to NEDDd.