CA2348156A1 - Human proteins involved in endoplasmic reticulum protein degradation - Google Patents

Abstract

The invention relates to degradation of proteins via the ubiquitin-proteasome pathway. More particularly, the invention relates to the degradation of proteins in the ER, including cystic fibrosis transmembrane conductance regulator (CFTR) via the ubiquitin-proteasome pathway. The invention provides methods and compositions for inhibiting such degradation and for promoting the maturation of .DELTA.F508 into a functional CFTR and for understanding the role of loss of CFTR function in CF. The invention resides in the discovery of human proteins responsible for the ubiquitination of .DELTA.F508, CFTR, and .alpha.1-AT.

Description

BACKGROUND OF THE INVENTION

Field of the invention The invention relates to degradation of proteins via the ubiquitin-proteasome pathway. More particularly, the invention relates to the degradation of proteins at the endoplasmic reticulum, including cystic fibrosis transmembrane 11 conductance regulator (CFTR), via the ubiquitin-proteasome pathway.
Summar,~r of the related art Covalent modification of proteins through their conjugation with other proteins is an important biological mechanism for regulating protein metabolism 16 and biological activity. Hershko and Ciechanover, Annu. Rev. Biochem. 61:

807 (1992) discloses conjugation of ubiquitin, one of the most conserved eukaryotic proteins, to other proteins through an enzymatic mechanism, as well as its role in protein degradation. Rock et al., Cell 78: 761-771 (1994) discloses that ubiquitination of protein antigens is required for processing of such antigens.
21 Murray, Cell ~: 149-152 (1995), teaches that ubiquitination of cyclin is involved in cell cycle regulation. Scheffner et al., Cell 7~: 495-505 (1993) discloses that ubiquitination of p53 is involved in degradation of this tumor suppressor.
The enzymatic pathway for ubiquitination has been reasonably well defined. Jentsch, Annu. Rev. Genet. 26: 179-207 (1992) discloses that 26 ubiquitination requires initial activation of a conserved C-terminal glycine residue by the ubiquitin activating enzyme, E1, through formation of ubiquitin adenylate in an ATP-dependent process which liberates PPi, followed by thioester formation at a thiol site in E1 with release of AMP. Ubiquitin is then transferred to a thiol site in ubiquitin conjugating enzyme, E2, through formation 1 of a thioester bond. Ubiquitin is then transferred to.an epsilon amino group of a lysine residue in the target protein through an amide linkage, usually with the involvement of ubiquitin-protein isopeptide ligase, E3. Hopkin, J. Natl. Inst.
Health Res. 9: 36-42 (1997), teaches that target specificity is regulated by the particular combination of E2 and E3 protein, with more than 30 E2 proteins and 6 10 E3 proteins being known at present.
Most ubiquitin-conjugating enzymes thus far identified are soluble proteins of the cytosol or of the nucleoplasm. Recent studies in yeast, however, report an integral membrane ubiquitin conjugating enzyme which is associated with endoplasmic reticulum (ER) membrane. Sommer and Jentsch, Nature 3,~5:
11 176-179 (1993), discloses UBC6, a yeast integral membrane ubiquitin conjugating enzyme, and suggests that this enzyme mediates degradation of proteins at the ER membrane. Biederer et al., EMBO J. 15: 2069-2076 (1996), teaches that polyubiquitination, UBC6, a functional proteasome and UBC7, a soluble ubiquitin-conjugating enzyme, are all required for proteolysis of key components 16 of the translocation apparatus of the ER membrane.
The ER protein degradation system has now been proposed to be associated with human disease. Aridor and Balch, Nature Medicine 5_: 745-750 (1999) teaches that many sporadic and inherited diseases arise from point mutations which cause disorders in protein conformation and prevent export of 21 the protein from the ER. In many cases, the mutant protein undergoes rapid degradation and the disease pathology is triggered by the absence of the protein from its target compartment. In other cases, the mutant protein accumulates in the ER, with resultant toxic effects. Welsh and Smith, Cell 73:1251-1254 (1993) discloses that cystic fibrosis (CF) is caused by the functional absence of a 26 plasma membrane chloride channel called cystic fibrosis transmembrane conductance regulator (CFTR). Tsui, Trends Genet. 8: 392-398 (1992), teaches that the vast majority of CF cases are due to a deletion of a single phenylalanine delta F508, hereafter "nF508") from a cytoplasmic portion of CFTR. Ward and Kopito, J. Biol. Chem. 2 9: 25710-25718 (1994), teaches that nF508 is retained and degraded in a pre-Golgi compartment. Yang et al., Proc. Natl. Acad. Sci. USA
90:
9480-9484 (1993), discloses that overexpressed nF508 precursors accumulate at ER
membranes. Fra and Sitia, Sub-Cell Biochem. 21: 143-168 (1993), suggests that immature eF508 molecules fail to fold properly and are degraded by a pathway 6 similar to yeast pathways described for ER degradation.
Qu et al., J. Biol. Chem. 271: 22791-22795 (1996) discloses that mutation in the secretory protein a,-antitrypsin (al-AT) is associated with adult-onset emphysema and infantile liver disease. The reference further teaches that lung injury is due to a decrease in elastase inhibitory capacity ordinarily provided by 11 a~-AT, whereas liver injury is due to the hepatotoxic effect of the abnormally folded mutant protein, which is retained in the ER The authors demonstrate that degradation of the mutant a~-AT protein, like that of nF508, is mediated by the proteasome. Qu et al. also teaches that a,-AT associates with the transmembrane molecular chaperone calnexin, and that it is the ubiquitination of calnexin that 16 targets the complex for proteasome-mediated degradation.
These observations illustrate the need for new approaches for treating diseases mediated by defects in ER processing.
Cheng et al., Cell 63: 827-834 (1990) suggests therapeutic treatment for CF
by blocking degradation of oF508. Unfortunately, such approaches have not been 21 successful. Ward et al., Cell $~: 121-127 (1995), teaches that proteasome inhibitors block the degradation of nF508 molecules, but that this leads to accumulation of polyubiquitinated oF508 forms which are not processed into a functional post-ER
compartment.
There is, therefore, a need for methods and compositions for treating 26 human disease associated with proteasome-mediated ER protein degradation, including promoting the maturation of mutant proteins such as oF508 and mutant al-AT. Such methods may reside in preventing the ubiquitination of proteins that are the target of proteasome-mediated ER protein degradation. Ideally, such methods would be specific for such proteins, including nF508 or CFTR or a,-AT, rather than preventing ubiquitination of proteins generally.

BRIEF SUMMARY OF THE INVENTION
The invention provides methods and compositions for treating human disease associated with proteasome-mediated ER protein degradation. The invention resides in the discovery of human proteins involved in proteasome-6 mediated ER protein degradation and responsible for the ubiquitination of ER
proteins such as oF508, CFTR, and a,-AT. In a preferred embodiment, such treatment entails promoting the maturation of oF508 into a functional CFTR and provides understanding of the role of loss of CFTR function in cystic fibrosis (CF).
In another preferred embodiment, such treatment entails promoting the 11 maturation of mutant a,-AT and/or preventing its accumulation iri the ER.
Thus, the methods and compositions according to the invention are more specific for proteins that are degraded in the ER by the ubiquitin-proteasome pathway, such as nF508, CFTR, and at-AT, than are methods that would prevent ubiquitination of proteins generally.
16 In certain aspects, the invention provides new purified ubiquitin-conjugating enzymes and allelic variants thereof. In some embodiments, the new purified ubiquitin-conjugating enzyme is membrane-bound. The primary amino acid sequence of one preferred embodiment of such a membrane-bound ubiquitin-conjugating enzyme (HSUBC14) is shown in Figure 1. The primary 21 amino acid sequence of a second preferred embodiment of such a membrane-bound ubiquitin-conjugating enzyme (HSUBC15) is shown in Figure 2. In some other embodiments, the new purified ubiquitin-conjugating enzyme is soluble.
The primary amino acid sequence of a preferred embodiment of such a soluble ubiquitin-conjugating enzyme (HSUBC18) is shown in Figure 3.
26 In other aspects, the invention provides ubiquitin conjugating enzyme expression elements. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding a ubiquitin conjugating enzyme selected from the group consisting of HSUBC14, HSUBC15, HSUBC18, and dominant negative mutants thereof, isolated or recombinant nucleic acid sequences specifically homologous or specifically complementary thereto, and vectors comprising any such isolated or recombinant nucleic acid sequences, preferably expression vectors. Such ubiquitin conjugating enzyme expression elements also include, without limitation, isolated or recombinant nucleic acids 6 capable of expressing antisense transcripts targeted against a ubiquitin conjugating enzyme selected from the group consisting of HSUBC14, HSUBC15, and HSUBC18, and vectors comprising such isolated or recombinant nucleic acids, preferably expression vectors.
The purified protein and its structural information provided herein 11 enables the preparation of HSUBC14-binding molecules (HSUBCI4BMs), HSUBC15-binding molecules (HSUBCI5BMs), and HSUBC18-binding molecules (HSUBCI8BMs), molecules that bind to HSUBC14, HSUBC15, or HSUBC18, respectively. Thus, in some other aspects, the invention provides methods for identifying HSUBCI4BMs, HSUBCI5BMs, and HSUBCI8BMs. One preferred 16 method according to these aspects of the invention comprises screening for HSUBCI4BMs, HSUBCISBMs, or HSUBCI8BMs by contacting purified HSUBC14, HSUBC15, or HSUBC18 according to the invention with populations of molecules or mixed populations of molecules, and determining the presence of molecules which bind specifically to HSUBC14, HSUBC15, or HSUBC18.
21 Another preferred method according to these aspects of the invention comprises rationally designing molecules to bind HSUBC14, HSUBC15, or HSUBC18 based upon structural information from the purified HSUBC14, HSUBC15, or HSUBC18 provided by the invention, and determining whether such rationally designed molecules bind specifically to HSUBC14, HSUBC15, or HSUBC18. These aspects 26 of the invention include HSUBCI4BMs, HSUBCISBMs, and HSUBCI8BMs identified by the methods according to the invention.
HSUBCI4BMs, HSUBCI5BMs, and HSUBCI8BMs can be used in conventional assays to detect the presence or absence, and/or quantity of 1 HSUBC14, HSUBC15, or HSUBC18, or complexes of HSUBC14, HSUBC15, or HSUBC18 with ubiquitin in a biological sample. Thus, in other aspects, the invention pro~.~ides methods for determining the presence or absence and/or quantity of H~UBC14, HSUBC15, HSUBC18, or complexes thereof with ubiquitin in a biological sample. Such methods comprise providing a detectable 6 HSUBC14BM, HSUBC15BM, or HSUBC18BM to a biological sample, allowing the detectable HSUBC14BM, HSUBC15BM, or HSUBC18BM to bind to HSUBC14, HSUBC15, HSUBC18, or complex thereof with ubiquitin, if any is present in the biological sample, and detecting the presence or absence and/or quantity of a complex of the detectable HSUBC14BM, HSUBC15BM, or HSUBC18BM with the 11 HSUBC24, HSUBC15, HSUBC18, or complex thereof with ubiquitin.
Nucleic acid sequences specifically complementary to and/or specifically homologous to nucleic acid sequences encoding HSUBC14, HSUBC15, or HSUBC18 can also be used in conventional assays to detect the presence or absence of HSUBC14, HSUBC15, or HSUBC18 nucleic acid in a biological sample.
16 Thus, in other aspects, the invention provides methods for determining the presence or absence, and/or quantity of, HSUBC14, HSUBC15, or HSUBC18 nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and/or amplification assays, such assays comprising providing to the biological sample a nucleic acid sequence which is specifically 21 complementary and/or specifically homologous to HSUBC14, HSUBC15, or HSUBC18 nucleic acid.
In a sixth aspect, the invention provides methods for identifying modulating ligands of HSUBC14, HSUBC15, or HSUBC18. Some HSUBCI4BMs, HSUBCISBMs, and HSUBCI8BMs are capable of acting as antagonists or agonists 26 of HSUBC14, HSUBC15, or HSUBC18. Thus, the method according to these aspects of the invention comprises providing HSUBCI4BMs, HSUBCI5BMs, or HSUBCI8BMs to an assay system for HSUBC14, HSUBC15, or HSUBC18 participation in the ubiquitin-conjugation pathway, and determining whether 1 such HSUBCI4BMs, HSUBCISBMs, or HSUBC18BIVIs interfere with or enhance the ability of HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-conjugation pathway. The HSUBCI4BMs, HSUBCI5BMs, or HSUBCI8BMs are preferably provided as a population of molecules (most preferably rationally designed molecules), or as a mixed population of molecules, as for example in a 6 screening procedure. These aspects of the invention include modulating ligands of HSUBC14, HSUBC15, or HSUBC18 identified by this method according to the invention.
In other aspects, the invention provides modulating ligands of HSUBC14, HSUBC15, or HSUBC18. Preferred modulating ligands are HSUBCI4BMs, 11 HSUBCISBMs, or HSUBCI8BMs which act as antagonists, interfering with the ability of HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-conjugation pathway. Other preferred modulating ligands are HSUBCI4BMs, HSUBCISBMs, or HSUBCI8BMs which act as agonists, enhancing the ability of HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-conjugation 16 pathway. In certain embodiments, such HSUBCI4BMs, HSUBCI5BMs, or HSUBCI8BMs preferably interact with HSUBC14, HSUBC15, or HSUBC18 to inhibit or enhance the formation of a thioester bond between ubiquitin and HSUBC14, HSUBC15, or HSUBC18, and/or transfer of ubiquitin to a protein targeted for proteasome-mediated ER protein degradation, such as oF508, CFTR, 21 or al-AT.
In yet other aspects, the invention provides methods for modulating the conjugation of ubiquitin or its transfer to a target protein, such as oF508, CFTR, or a,-AT. One preferred embodiment of the method according to these aspects of the invention comprises providing a modulating ligand of HSUBC14, HSUBC15, 26 or HSUBC18, or a recombinant expression unit which expresses HSUBC14, HSUBC15, or HSUBC18, or an antagonist thereof, to a biological system in which ubiquitin is conjugated to a target protein, such as nF508, CFTR, or al-AT.
In still yet other aspects, the invention provides oligonucleotides that are 1 specifically complementary to a portion of a nucleotide sequence shown in Figure 1, Figure 2, or Figure 3. Preferred embodiments include hybridization probes and antisense oligonucleotides.
In still yet other aspects, the invention provides a method for therapeutically treating diseases associated with proteasome-mediated ER
6 protein degradation. In certain preferred embodiments, the invention provides a method for therapeutically treating cystic fibrosis caused by failure of oF508 or CFTR precursors to mature into functional CFTR. In certain other preferred embodiments, the invention provides a method for therapeutically treating emphysema caused by failure of mutant al-AT to be secreted. In yet other 11 preferred embodiments, the invention provides a method for therapeutically treating Liver disease caused by an accumulation of mutant al-AT in the ER.
Preferred embodiments of these methods utilize agents that interfere with HSUBC14, HSUBC15, or HSUBC18 protein function or expression of a gene encoding HSUBC14, HSUBC15, or HSUBC18.

BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the nucleotide sequence [SEQ ID NO: 1] and deduced amino acid sequence [SEQ ID NO: 2] for HSUBC14, with the active site cysteine at 6 position 94 underlined.
Figure 2 shows the nucleotide sequence [SEQ ID NO: 3] and deduced amino acid deduced amino acid sequence [SEQ ID NO: 4] for HSUBC15, with the active site cysteine at position 91 underlined.
Figure 3 shows the nucleotide sequence [SEQ ID NO: 5] and deduced 11 amino acid sequence [SEQ ID NO: 6] for HSUBC18.
Figure 4 shows the alignment of the amino acid sequence for HSUBC14 with the yeast protein Ubc6 [SEQ ID NO: 7].
Figure 5 shows the alignment of the amino acid sequence for HSUBC15 with HSUBC14, the yeast protein Ubc6 [SEQ ID NO: 7], and the C. elegans protein 16 ced 1022.1 [SEQ ID NO: 8].
Figure 6 shows the alignment of the amino acid sequence for HSUBC18 with the yeast protein Ubc7 [SEQ ID NO 9].
Figure 7 shows the results of an immunostaining experiment comparing the immunostaining patterns of HSUBC14 (Ubchl4) and calreticulin.
21 Figure 8 shows the results of an immunostaining experiment comparing the immunostaining patterns of HSUBC15 (Ubchl5) and calreticulin.
Figure 9 shows the results of an immunostaining experiment comparing the immunostaining patterns of HSUBC18 (IJbchl8) and calreticulin.

DETAILED DESCRII''I ION OF THE PREFERRED EMBODIMENTS
The invention relates to degradation of proteins via the ubiquitin-proteasome pathway. More particularly, the invention relates to the proteasome-mediated ER protein degradation of target proteins, including, but not limited to, 6 cystic fibrosis transmembrane conductance regulator (CFTR) and al-antitrypsin (al-AT), via the ubiquitin-proteasome pathway.
The invention provides methods and compositions for treating human disease associated with proteasome-mediated ER protein degradation. The invention resides in the discovery of human proteins involved in proteasome-11 mediated ER protein degradation and responsible for the ubiquitination of ER
proteins such as nF508, CFTR, and a,-AT. In a preferred embodiment, such treatment entails promoting the maturation of oF508 into a functional CFTR and provides understanding of the role of loss of CFTR function in cystic fibrosis (CF).
In another preferred embodiment, such treatment entails promoting the 16 maturation of mutant a~-AT and/or preventing its accumulation in the ER.
Thus, the methods and compositions according to the invention are more specific for proteins that are degraded in the ER by the ubiquitin-proteasome pathway, such as nF508, CFTR, and a1-AT, than are methods that would prevent ubiquitination of proteins generally.
21 The novel human proteins of the invention are ubiquitin conjugating enzymes. Certain of the new proteins are membrane-bound, while certain others are soluble proteins. Because there are subtle differences in preferred embodiments of some aspects of the invention relating to the membrane-bound proteins as compared to the soluble proteins, the membrane-bound and soluble 26 proteins are separately described below. In particular, the first ten aspects of the invention described below relate to membrane-bound proteins, while the description of the eleventh to twentieth aspects relates to soluble proteins.
Necessarily, there is considerable overlap in the descriptions relating to the two 1 types of proteins, and they are combined in the Summary of the Invention above.
In a first aspect, the invention provides new purified transmembrane domain-containing ubiquitin-conjugating enzymes and allelic variants thereof.
The primary amino acid sequence of one preferred embodiment of the new 6 ubiquitin-conjugating enzyme (HSUBC14) is shown in Figure 1. The active site cysteine, C94, forms thioester bonds with ubiquitin. Amino acid residues 231-form a transmembrane domain. The transmembrane domain can be deleted to form a soluble HSUBC14, which is a preferred embodiment of this aspect of the invention. Accordingly, for purposes of the invention, "I-ISUBC14" refers to both 11 the soluble and transmembrane domain-containing embodiments, unless otherwise specified or evident from context. The full length protein has 39%
sequence identity to yeast Ubc6. An alignment of IiSUBCI4 with yeast Ubc6 is shown in Figure 4.
The primary amino acid sequence of a second preferred embodiment of a 16 new ubiquitin-conjugating enzyme (HSUBC15) is shown in Figure 2. The active site cysteine, C91, forms thioester bonds with ubiquitin. Amino acid residues 288-303 form a transmembrane domain. The transmembrane domain can be deleted to form a soluble I3SUBC15, which is a preferred embodiment of this aspect of the invention. Accordingly, for purposes of the invention, "I-iSUBCIS"
21 refers to both the soluble and transmembrane domain-containing embodiments, unless otherwise specified or evident from context. The full length protein has 22% sequence identity to yeast Ubc6 and 40% sequence identity to a C. elegans homologue, ced1022.1. An alignment of I-iSUBCIS with yeast Ubc6 and ced1022.1 is shown in Figure 5.
26 For purposes of the invention, the terms "HSUBC14" and "HSUBC15" are intended to include allelic variants thereof. An "allelic variant", as used herein, is a protein having at least about 50% amino acid sequence identity, more preferably at least about 75%, even more preferably at least about 85%, still more 1 preferably at least about 95%, , even more preferably at least about 96%, yet even more preferably at least about 97%, more preferably yet at least about 98% and most preferably at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4, or to a portion or protein conjugate thereof which retains the biological activities of HSUBC14 or HSUBC15, 6 respectively, to (1) form a thioester linkage with ubiquitin, and (2) to transfer ubiquitin to a target protein such as nF508 or to CFTR, both under conditions as described in the examples below and at a rate at least 10% of that of HSUBC14 or HSUBC15, respectively, preferably at least 25% as fast, more preferably at least 50% as fast, and most preferably at least 75% as fast.
11 Preferably, such biologically active portion of HSUBC14 comprises an amino acid sequence spanning residue 94 in Figure 1, more preferably comprises at least the amino acid sequence NTRLCLS, yet more preferably comprises at least about 25 additional amino acids of HSUBC14, even more preferably at least about 50 additional amino acids of HSUBC14, still more preferably at least about 16 75 additional amino acids of HSUBC14, yet even more preferably at least about 100 additional amino acids of HSUBC14, and most preferably at least about 150 additional amino acids of HSUBC14.
Preferably, such biologically active portion of HSUBC25 comprises an amino acid sequence spanning residue 91 in Figure 2, more preferably comprises 21 at least the amino acid sequence KKICLS, yet more preferably comprises at least about 25 additional amino acids of HSUBC15, even more preferably at least about 50 additional amino acids of HSUBC15, still more preferably at least about 75 additional amino acids of HSUBC15, yet even more preferably at least about 100 additional amino acids of HSUBC15, and most preferably at least about 150 26 additional amino acids of HSUBC15.
The term "spanning residue x" is intended to mean comprising residue x and amino acid residues in both the N-terminal and the C-terminal directions from residue x, as that residue is indicated in Figure 1 or Figure 2.
Preferably, 1 such residues in the N-terminal and C-terminal directions are immediately adjacent residue x. Such allelic variants have the biological activity of or HSUBC15, as discussed above. In alternative preferred embodiments, such allelic variants are either rationally designed or naturally occurring allelic variants, i.e., they are expressed in actual individual mammals, most preferably 6 from actual individual humans or mice. Rationally designed allelic variants can be produced according to standard art-recognized procedures (see e.g., international publication W095/18974).
"Purified", as used herein means having less than about 25% by weight, and preferably less than about 10% by weight contamination with other proteins.
11 Such purified proteins may be obtained from natural sources, from recombinant expression, or by chemical synthesis. "Protein", as used herein and hereinbelow is intended to encompass any polypeptide having at least 10 amino acid residues.
16 In a second aspect, the invention provides ubiquitin conjugating enzyme expression elements. Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding HSUBC14, HSUBC15, or dominant negative mutants thereof, isolated or recombinant nucleic acid sequences specifically homologous or specifically complementary thereto, and vectors 21 comprising any such isolated or recombinant nucleic acid sequences, preferably expression vectors. Such ubiquitin conjugating enzyme expression elements also include; without limitation isolated or recombinant nucleic acids capable of expressing antisense transcripts targeted against HSUBC14 or HSUBC15 and vectors comprising such isolated or recombinant nucleic acids, preferably 26 expression vectors.
For purposes of the invention, amino acid sequence identity and homology are determined using the program Clustal W Version 1.6 to do sequence alignment (Thompson et al., Nucleic Acids Res 22: 4673-4680 (1994)). For viewing 1 aligned sequences, the program GeneDoc Version 2.2 was used. A sequence is "specifically homologous" to another sequence if it is sufficiently homologous to specifically hybridize to the exact complement of the sequence. A sequence is "specifically complementary" to another sequence if it is sufficiently homologous to specifically hybridize to the sequence. A sequence "specifically hybridizes" to 6 another sequence if it hybridizes to form Watson-Crick or Hoogsteen base pairs either in the body, or under conditions which approximate physiological conditions with respect to ionic strength, e.g.,140 mM NaCI, 5 mM MgClz.
Preferably, such specific hybridization is maintained under stringent conditions, e.g., 0.2X SSC at 68°C.
1I A "recombinant expression element" is a nucleic acid sequence which encodes HSUBC14 or HSUBC15, or a portion encoding at least 15 contiguous amino acids thereof, or a dominant negative mutant thereof, or is capable of expressing an antisense molecule specifically complementary thereto, or a sense molecule specifically homologous thereto, wherein the recombinant expression 16 unit may be in the form of linear DNA or RNA, covalently closed circular DNA
or RNA, or as part of a chromosome, provided however that it cannot be the native chromosomal locus for HSUBC14 or HSUBC15. Preferred recombinant expression elements are vectors, which may include an origin of replication and are thus replicatable in one or more cell type. Certain preferred recombinant 21 expression elements are expression vectors, and further comprise at least a promoter and passive terminator, thereby allowing transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell. Preferred recombinant expression elements have at least 75% nucleic acid sequence identity with the nucleic acid sequence set forth in SEQ ID NO: 2 or 26 SEQ ID NO: 4, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 99%, and encode a protein or peptide having either HSUBC14 or HSUBC15 biological activity, as described above, or activity as a dominant negative mutant thereof, as further described below.

1 "Dominant negative mutants" are proteins or peptides derived from HSUBC14 or HSUBC15 which inhibit the biological activity of HSUBC14 or HSUBC15, respectively. Preferred dominant negative mutants include variants in which the C at position 94 of HSUBC14 or the C at position 91 of HSUBC15 is substituted, preferably by S. Preferred dominant negative mutants can be 6 derived from HSUBC14 or HSUBC15 and interfere with covalent bond formation between ubiquitin and HSUBC14 or HSUBC15, respectively, or interfere with transfer of ubiquitin from HSUBC14 or HSUBC15 to nF508, CFTR, or a1-AT.
Such dominant negative mutants can be prepared by art recognized procedures (see e.g., Townsley et al., Proc. Natl. Acad. Sci. USA 94: 2362-2367 (1997)).
11 Preferably, such dominant negative mutant is a protein or peptide having from 50% amino acid sequence identity to about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4, or to a portion or protein conjugate thereof which inhibits the biological activity of HSUBC14 or HSUBC15 to form a thioester linkage with ubiquitin or transfer ubiquitin to a 16 target protein such as nF508, CFTR, or a~-AT, under conditions as described in the following examples. Preferably, such inhibition is by at least 50%, preferably by at least 75%, more preferably by at least 90% and most preferably by at least 99%. In certain preferred embodiments, such inhibitory portion comprises an amino acid sequence spanning residue 94 of HSUBC14, as shown in Figure 1, 21 more preferably comprises at least about 25 additional amino acids of HSUBC14, or at least about 50 additional amino acids of HSUBC14, or at least about 75 additional amino acids of HSUBC14, or at least about 100 additional amino acids of HSUBC14, or even at least about 150 additional amino acids of HSUBC14. In certain other preferred embodiments, such inhibitory portion comprises an amino 26 acid sequence spanning residue 91 of HSUBC15, as shown in Figure 2, more preferably comprises at least about 25 additional amino acids of HSUBC15, or at least about 50 additional amino acids of HSUBC15, or at least about 75 additional amino acids of HSUBC15, or at least about 100 additional amino acids of WO 00/23599 PCT/US99l24563 HSUBC15, or even at least about 150 additional amino acids of HSUBC15.
For purposes of this aspect of the invention, the term "spanning residue x"
means comprising amino acid residues in both the N-terminal and C-terminal directions from residue x, as that residue is shown in Figure 1 or Figure 2.
Preferably, residue x itself may be substituted by one or more amino acids, more 6 preferably from about 1 to about 50 amino acids, or residue x may be absent.
Preferably the amino acids in the N-terminal and C-terminal directions from residue x are each independently within 20 amino acids of residue x, as shown in Figure 1 or Figure 2, more preferably within 10, even more preferably within 5, and most preferably are immediately adjacent residue x as shown in Figure 1 or 11 Figure 2. As used herein, oF508 may be used to refer to either the phenylalanine residue at position 508 of CFTR, or may more usually be used to refer to a mutant CFTR molecule in which such phenylalanine residue is substituted by one or more amino acids, more preferably from about 1 to about 50 amino acids, or in which such phenylalanine residue is deleted.

The purified protein and its structural information provided herein enables the preparation of HSUBCI4BMs and HSUBCI5BMs, molecules that bind to HSUBC14 or HSUBC15, respectively. Thus, in a third aspect, the invention provides methods for identifying HSUBCI4BMs or HSUBCI5BMs. One 21 preferred method according to this aspect of the invention comprises screening for HSUBCI4BMs or HSUBCISBMs by contacting purified HSUBC14 or HSUBC15 according to the invention with populations of molecules or mixed populations of molecules and determining the presence of molecules which bind specifically to HSUBC14 or HSUBC15. Another preferred method according to 26 this aspect of the invention comprises rationally designing molecules to bind HSUBC14 or HSUBC15 based upon structural information from the purified HSUBC14 or HSUBC15 provided by the invention and determining whether such rationally designed molecules bind specifically to HSUBC14 or HSUBC15. In either case, soluble HSUBC14 and soluble HSUBC15 can be prepared by removing the respective transmembrane domains, and the soluble proteins are preferably used as targets for HSUBCI4BMs or HSUBCISBMs. Thus, for purposes of this aspect of the invention, the terms "HSUBC14" and "HSUBC15"
specifically include soluble HSUBC14 and soluble HSUBC15.

6 Molecules that bind specifically to HSUBC14 or HSUBC15 are molecules that bind to HSUBC14 or HSUBC15 with greater affinity than to other unrelated proteins. Preferably, binding affinity of the molecule for FISUBC14 or HSUBC15 is at least 5-fold greater than its affinity for unrelated proteins, more preferably at least 10-fold greater, still more preferably at least 50-fold greater, and most 11 preferably at least 100-fold greater. This aspect of the invention includes HSUBCI4BMs and HSUBC25BMs identified by the methods according to the invention.
As used herein, a"HSUBC14-binding molecule", or "HSUBC14BM", is a molecule or macromolecule which binds under physiological conditions to 16 HSUBC14. A "HSUBC15-binding molecule", or "HSUBC15BM", is a molecule or macromolecule which binds under physiological conditions to HSUBC15. "Binds under physiological conditions" means forming a covalent or non-covalent association with an affinity of at least 106M-', most preferably at least 109 M-' , either in the body, or under conditions which approximate physiological 21 conditions with respect to ionic strength, e.g., 140 mM NaCI, 5 mM MgCl2. A
"population of molecules", as used herein, refers to a plurality of identical molecules. A"mixed population of molecules" refers to a plurality of molecules wherein more than one type of molecule is present.
in certain preferred embodiments, a HSUBC14BM or HSUBC15BM
26 according to the invention is a peptide or a peptidomimetic. For purposes of the invention, a "peptide" is a molecule comprised of a linear array of amino acid residues connected to each other in the linear array by peptide bonds. Such peptides according to the invention may include from about three to about 500 1 amino acids, and may further include secondary, tertiary or quaternary structures, as well as intermolecular associations with other peptides or other non-peptide molecules. Such intermolecular associations may be through, without limitation, covalent bonding (e.g., through disulfide linkages), or through chelation, electrostatic interactions, hydrophobic interactions, hydrogen bonding, 6 ion-dipole interactions, dipole-dipole interactions, or any combination of the above.
In certain preferred embodiments, such an HSUBC14BM or HSUBC15 comprises a complementarity determining region of an antibody which binds under physiological conditions to a peptide-containing epitope of HSUBC14 or 11 HSUBC15, or a peptidomimetic of such a complementarity determining region.
For purposes of the invention, a "complementarity determining region of an antibody" is that portion of an antibody which binds under physiological conditions to an epitope, including any framework regions necessary for such binding, and which is preferably comprised of a subset of amino acid residues 16 encoded by the human heavy chain V, D and J regions, the human light chain V
and J regions, and/or combinations thereof. Examples of such preferred embodiments include an antibody, or an antibody derivative, which may more preferably be a monoclonal antibody, a human antibody, a humanized antibody, a single-chain antibody, a chimeric antibody, or an antigen-binding antibody 21 fragment.
Those skilled in the art are enabled to make any such antibody derivatives using standard art-recognized techniques. For example, Jones et al., Nature ~2_l:
522-525 (1986) discloses replacing the CDRs of a human antibody with those from a mouse antibody. Marx, Science 229: 455- 456 (1985) discusses chimeric 26 antibodies having mouse variable regions and human constant regions.
Rodwell, Nature 342: 99-100 (1989) discusses lower molecular weight recognition elements derived from antibody CDR information. Clackson, Br. J. Rheumatol. X052: 36-39 (1991) discusses genetically engineered monoclonal antibodies, including Fv 1 fragment derivatives, single chain antibodies, fusion proteins chimeric antibodies and humanized rodent antibodies. Reichman et aL, Nature 332: 323-327 (1988) discloses a human antibody on which rat hypervariable regions have been grafted. Verhoeyen, et al., Science 239: 1534-1536 (1988) teaches grafting of a mouse antigen binding site onto a human antibody.
6 In addition, those skilled in the art are enabled to design and produce peptidomimetics having binding characteristics similar or superior to such complementarity determining region (see e.g., Horwell et al., Bioorg. Med.
Chem.
4_: 1573 (1996); Liskamp et al., Recl. Trav. Chim. Pays- Bas 1: lI3 (1994);
Gante et al., Angew. Chem. Int. Ed. Engl. ~: 1699 (1994); Seebach et al., Helv. Chim.
Acta 11 79: 913 (1996)). Accordingly, all such antibody derivatives and peptidomimetics thereof are contemplated to be within the scope of the present invention.
Compositions according to the invention may further include physiologically acceptable diluents, stabilizing agents, localizing agents or buffers.
Additional preferred HSUBCI4BMs or HSUBCISBMs according to the 16 invention include small molecules, which can be identified using screening or rational design approaches as discussed later herein.
HSUBCI4BMs and HSUBCISBMs can be used in conventional assays to detect the presence or absence, and/or quantity of HSUBC14 or HSUBC15, or 21 complexes of HSUBC14 or HSUBC15 with ubiquitin, in a biological sample.
Thus, in a fourth aspect, the invention provides methods for determining the presence or absence and/or quantity of HSUBC14 or HSUBC15 or complex thereof with ubiquitin in a biological sample. Such methods comprise providing a detectable HSUBC14BM or HSUBC15BM to a biological sample, allowing the 26 detectable HSUBC14BM or HSUBC15BM to bind to HSUBC14, HSUBC15, or complex thereof with ubiquitin, if any is present irt the biological sample, and detecting the presence or absence and/or quantity of a complex of the detectable HSUBC14BM or HSUBC15BM with the HSUBC14, HSUBC15, or complex thereof with ubiquitin.
A detectable HSUBC14BM or HSUBC15BM is an HSUBC14BM or HSUBC15BM which can be detected in an assay. Such detection is preferably through the direct or indirect binding of a tag or label on the HSUBC14BM or HSUBC15BM. "Direct or indirect binding" means that the tag or label may be 6 directly connected to the HSUBC14BM or HSUBC15BM by intermolecular association, or may be connected via intermediate molecules to the HSUBC14BM
or HSUBC15BM by intermolecular association. Such intermolecular associations may be through, without limitation, covalent bonding (e.g., through disulfide linkages), or through chelation, electrostatic interactions, hydrophobic 11 interactions, hydrogen bonding, ion-dipole interactions, dipole-dipole interactions, or any combination of the above. Preferred tags and labels include, without limitation, radioisotopes, heavy metals, fluorescent labels, chemoluminescent labels, enzymes and enzyme substrates. Preferred biological samples include blood, serum, plasma, cells, tissue portions, and cell or tissue 16 extracts. In certain preferred embodiments, the method according to this aspect of the invention takes the form of a conventional ELISA or RIA. In another preferred embodiment, the method employs either direct or indirect immunofluorescence. Additional preferred embodiments utilize in vivo imaging of cells expressing HSUBC14 or HSUBC15 using conventional imaging agents 21 directly or indirectly bound to an HSUBC14BM or HSUBC15BM according to the invention.
Nucleic acid sequences specifically complementary to and/or specifically homologous to nucleic acid sequences encoding HSUBC14 or HSUBC15 can also 26 be used in conventional assays to detect the presence or absence of HSUBC14 or HSUBC15 nucleic acid in a biological sample. Thus, in a fifth aspect, the invention provides methods for determining the presence or absence and/or quantity of HSUBC14 or HSUBC15 nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and/or amplification assays, such assays comprising providing to the biological sample a nucleic acid sequence which is specifically complementary and/or specifically homologous to HSUBC14 or HSUBC15 nucleic acid. Particularly preferred embodiments include Northern blotting, dot or slot blotting, and polymerase 6 chain reaction.
In a sixth aspect, the invention provides methods for identifying modulating ligands of HSUBC14 or HSUBC15. Some HSUBCI4BMs and HSUBCISBMs are capable of acting as antagonists or agonists of HSUBC14 or 11 HSUBClS. Thus, the method according to this aspect of the invention comprises providing HSUBCI4BMs or HSUBCI5BMs to an assay system for HSUBC14 or HSUBC15 participation in the ubiquitin-conjugation pathway, and determining whether such HSUBCI4BMs or HSUBCISBMs interfere with or enhance the ability of HSUBC14 or HSUBC15 to participate in the ubiquitin-conjugation 16 pathway. The HSUBCI4BMs or HSUBCISBMs are preferably provided as a population of molecules (most preferably rationally designed molecules), or as a mixed population of molecules, as for example in a screening procedure. This aspect of the invention includes modulating ligands of HSUBC14 or HSUBC15 identified by this method according to the invention.
21 In preferred embodiments of this aspect of the invention, the method comprises providing HSUBCI4BMs or HSUBCISBMs to an assay system for HSUBC14 or HSUBC15 participation in the ubiquitination of ER proteins, and determining whether such HSUBCI4BMs or HSUBCISBMs interfere with or enhance the ability of HSUBC14 or HSUBC15 to participate in the ubiquitination 26 of ER proteins. More preferably, the ER protein is nF508, CFTR, or a,-AT.
Assessment of ability to interfere with or enhance the ability of HSUBC14 or HSUBC15 to participate in the ubiquitin-conjugation pathway can conveniently be carried out using an in vitro activity system, as later described herein.

1 Alternatively, the cloned gene encoding HSUBCI4.or HSUBC15 can be expressed in yeast sec61 mutants, thereby allowing them to grow at restrictive temperatures (above 37°C (see Sommer and jentsch, Nature 365: 176-180 (1993)).
Inhibitors can then be identified by their reversal of the ability of cells expressing HSUBC
14 or HSUBC15 to grow at restrictive temperatures. In either case, such interference or 6 enhancement preferably results in a reduction of ubiquitin-conjugation of at least 50%, more preferably at least 90%, and most preferably, at least 99%, or an increase of ubiquitin-conjugation of at least 50%, preferably at least 2-fold, more preferably at least 5-fold, most preferably at least 10-fold.
As used herein, nF508 may be used either to refer to a mutation of the 11 phenylalanine residue at position 508 of CFTR, or may more usually be used to refer to a mutant CFTR molecule in which such phenylalanine residue is substituted by one or more amino acids, more preferably from about 1 to about amino acids, or in which such phenylalanine residue is deleted.
16 In a seventh aspect, the invention provides modulating ligands of HSUBC14 or HSUBC15. Preferred modulating ligands are HSUBCI4BMs or HSUBCISBMs which act as antagonists, interfering with the ability of HSUBC14 or HSUBC15 to participate in the ubiquitination of ER proteins, and preferably are capable of interfering with the conjugation of ubiquitin to eF508, CFTR, or a,-21 AT. Other preferred modulating ligands are HSUBCI4BMs or HSUBCI5BMs which act as agonists, enhancing the ability of HSUBC14 or HSUBC15 to participate in the ubiquitination of ER proteins, and preferably are capable of enhancing the conjugation of ubiquitin to nF508, CFTR, or a~-AT. In certain embodiments, such HSUBCI4BMs or HSUBCISBMs preferably interact with 26 HSUBC14 or HSUBC15 to inhibit or enhance the formation of a thioester bond between ubiquitin and HSUBC14 or HSUBC15 and/or inhibit or enhance the transfer of ubiquitin to nF508, CFTR, or a~-AT.
Preferably, such inhibition or enhancement is specific, i.e., the modulating ligand interferes with or enhances the ability of HSUBC14 or HSUBC1S to participate in the conjugation of ubiquitin to nF508, CFTR, or al-AT at a concentration that is lower than the concentration of the ligand required to produce another, unrelated biological effect. Preferably, the concentration of the ligand required for ubiquitin-nF508, CFTR, or al-AT conjugation modulating 6 activity is at least 2-fold Lower, more preferably at least 5-fold lower, even more preferably at least 10-fold lower, and most preferably at least 20-fold lower than the concentration required to produce an unrelated biological effect.
In an eighth aspect, the invention provides methods for modulating the 11 conjugation of ubiquitin to HSUBC14 or HSUBC15 or its transfer to a target protein, such as nF508, CFTR, or a~-AT. One preferred embodiment of the method according to this aspect of the invention comprises providing a modulating ligand of HSUBC14 or HSUBC15 or a recombinant expression unit which expresses HSUBC14 or HSUBC15 or an antagonist thereof to a biological 16 system in which ubiquitin is conjugated to a target protein, preferably an ER
protein such as nF508, CFTR, or a~-AT.
The term "biological system", as used herein, includes in vitro cell or tissue extracts, cell cultures, tissue cultures, organ cultures, living plants and animals, including mammals, including without limitation humans and mice. An 21 "antagonist" is a molecule which inhibits the biological activity of HSUBC14 or HSUBC15.
In a ninth aspect, the invention provides oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 26 1 or Figure 2. Preferred embodiments include hybridization probes and antisense oligonucleotides.
For purposes of the invention, the term oligonucleotide includes polymers of two or more deoxyribonucleotide, or any modified nucleoside, including 2'-halo-nucleosides, 2'-O-substituted ribonucleosides,.deazanucleosides or any combination thereof. Preferably, such oligonucleotides have from about 10 to about I00 nucleosides, more preferably from about 15-50, and most preferably from about 15 to 35. Such monomers may be coupled to each other by any of the numerous known internucleoside linkages. In certain preferred embodiments, 6 these internucleoside linkages may be phosphodiester, phosphotriester, phosphorothioate, or phosphoramidate linkages, or combinations thereof. The term oligonucleotide also encompasses such polymers having chemically modified bases or sugars and/or having additional substituents, including without limitation lipophilic groups, intercalating agents, diamines and 11 adamantane. For purposes of the invention the term "2'-O-substituted" means substitution of the 2' position of the pentose moiety with a halogen (preferably Cl, Br, or F), or an O-lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an O-aryl or allyl group having 2-6 carbon atoms, wherein such alkyl, aryl or allyl group may be unsubstituted or may be substituted, e.g., 16 with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carballcoxyl, or amino groups; or such 2' substitution may be with a hydroxy group (to produce a ribonucleoside), an amino or a halo group, but not with a 2'-H group. Certain embodiments of such oligonucleotides are useful in hybridization assays. Other embodiments are useful as antisense 21 oligonucleotides for use in animal model or human therapeutic settings.
In a tenth aspect, the invention provides a method for therapeutically treating diseases associated with proteasome-mediated ER protein degradation.
In certain preferred embodiments, the invention provides a method for 26 therapeutically treating cystic fibrosis caused by failure of nF508 or CFTR
precursors to mature into functional CFTR. Slowing the rate of ubiquitination of nF508 allows it to mature into functional CFTR. Thus, interference with HSUBC14 or HSUBC15 function or expression should allow maturation into 1 functional CFTR.
In certain other preferred embodiments, the invention provides a method for therapeutically treating emphysema caused by failure of mutant a,-AT to be secreted. Slowing the rate of ubiquitination of calnexin should slow the rate of degradation of the al-AT that is associated to it, thereby allowing it to be secreted.
6 Preferably, these embodiments utilize agents that interfere with HSUBC14 or HSUBC15 protein function or expression of a gene encoding HSUBC14 or HSUBC15. Preferred agents that interfere with HSUBCI4 or HSUBC15 protein function include modulating ligands of HSUBC14 or HSUBC15, respectively, preferably modulating ligands of HSUBC14 or HSUBC15 which act as antagonists 11 of HSUBC14 or HSUBC15. Preferred agents that interfere with the expression of a gene encoding HSUBC14 or HSUBC15 include antisense nucleic acids or antisense oligonucleotides specifically complementary to a portion of the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3.
In other preferred embodiments, the invention provides a method for 16 therapeutically treating liver disease caused by accumulation of mutant al-AT in the ER Qu ef al. teaches that there is a lag in ER degradation of mutant a,-AT
in hosts susceptible to the development of liver disease. Enhancing the rate of ubiquitination of calnexin should increase the rate of degradation of the a1-AT
associated with it.
21 Preferably, these embodiments utilize agents that enhance HSUBC14 or HSUBC15 protein function or expression of a gene encoding HSUBC14 or HSUBC15. Preferred agents that enhance HSUBC14 or HSUBC15 protein function include modulating ligands of HSUBC14 or HSUBC15, respectively, preferably modulating ligands of HSUBC14 or HSUBC15 which act as agonists of 26 HSUBC14 or HSUBC15.
In an eleventh aspect, the invention provides a new purified soluble ubiquitin-conjugating enzyme and allelic variants thereof. The primary amino acid sequence of a preferred embodiment of the new ubiquitin-conjugating enzyme (HSUBC18) is shown in Figure 3. The active site cysteine, C89, forms thioester bonds with ubiquitin. The protein has 62% sequence identity to yeast Ubc7. An alignment of HsUbcl8 with yeast Ubc7 is shown in Figure 6.
For purposes of the invention, the term "HSUBC18" is intended to include 6 allelic variants thereof. An "allelic variant", as used herein, is a protein having at least about 75%, more preferably at least about 85%, still more preferably at least about 95%, even more preferably at least about 96%, yet even more preferably at least about 97%, more preferably yet at least about 98% and most preferably at least about 99% sequence identity to the amino acid sequence set forth in SEQ
ID
11 NO: 6, or to a portion or protein conjugate thereof which retains the biological activities of HSUBC18 to (1) form a thioester linkage with ubiquitin, and (2) to transfer ubiquitin to a target protein such as nF508 or to CFTR, both under conditions as described in the examples below and at a rate at least 10% of that of HSUBC18, preferably at least 25% as fast, more preferably at least 50% as fast, 16 and most preferably at least 75% as fast. Preferably, such biologically active portion comprises an amino acid sequence spanning residue 89 in Figure 3, more preferably comprises at least about 25 additional amino acids of HSUBC18, even more preferably at least about 50 additional amino acids of HSUBC18, still more preferably at least about 75 additional amino acids of HSUBC18, yet even more 21 preferably at least about 100 additional amino acids of HSUBC18, and most preferably at least about 150 additional amino acids of HSUBC18. "Spanning residue 89" is intended to mean comprising amino acid residues in both the N-terminal and the C-terminal directions from residue 89, as that residue is indicated in Figure 3. Preferably, such residues in the N-terminal and C-terminal 26 directions are immediately adjacent residue 89. Such allelic variants have the biological activity of HSUBC18, as discussed above. In alternative preferred embodiments, such allelic variants are either rationally designed or naturally occurring allelic variants, i.e., they are expressed in actual individual mammals, 1 most preferably from actual individual humans or Fnice. Rationally designed allelic variants can be produced according to standard art-recognized procedures (see e.g., international publication W095/ 18974). "Purified", as used herein means having less than about 25% by weight, and preferably less than about 10% by weight contamination with other proteins. Such purified proteins may be 6 obtained from natural sources, from recombinant expression, or by chemical synthesis. "Protein", as used herein and hereinbelow is intended to encompass any polypeptide having at least 10 amino acid residues.
In a twelfth aspect, the invention provides HSUBC18 expression elements.
11 Such elements include, without limitation, isolated or recombinant nucleic acid sequences encoding HSUBC18 or dominant negative mutants thereof, or capable of expressing antlsense transcripts thereof or nucleic acid sequences specifically homologous or specifically complementary thereto, and vectors comprising any such recombinant expression elements, preferably expression vectors.
16 A sequence is "specifically homologous" to another sequence if it is sufficiently homologous to specifically hybridize to the exact complement of the sequence. A sequence is "specifically complementary" to another sequence if it is sufficiently homologous to specifically hybridize to the sequence. A sequence "specifically hybridizes" to another sequence if it hybridizes to form Watson-21 Crick or Hoogsteen base pairs either in the body, or under conditions which approximate physiological conditions with respect to ionic strength, e.g., 140 mM
NaCI, 5 mM MgCl2. Preferably, such specific hybridization is maintained under stringent conditions, e.g., 0.2X SSC at 68°C. A "recombinant expression element"
is a nucleic acid sequence which encodes HSUBC18, or a portion encoding at least 26 15 contiguous amino acids thereof or encoding a dominant negative mutant thereof, a nucleic acid sequence specifically homologous or specifically complementary thereto, or a nucleic acid capable of expressing an antisense molecule specifically complementary thereto or a sense molecule specifically 1 homologous thereto, wherein the recombinant expression unit may be in the form of linear DNA or RNA, covalently closed circular DNA or RNA, or as part of a chromosome, provided however that it cannot be the native chromosomal locus for HSUBC18. Preferred recombinant expression elements are vectors, which may include an origin of replication and are thus replicatable in one or more cell 6 type. Certain preferred recombinant expression elements are expression vectors, and further comprise at least a promoter and passive terminator, thereby allowing transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell. Preferred recombinant expression elements have at least 75% nucleic acid sequence identity with the nucleic acid 11 sequence set forth in SEQ ID NO: 5, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 99%, and encode a protein or peptide having either HSUBC18 biological activity, as described above, or activity as a dominant negative mutant thereof, as further described below.
"Dominant negative mutants" are proteins or peptides derived from 16 HSUBC18 which inhibit the biological activity of HSUBC18. Preferred dominant negative mutants include variants in which the C at position 89 of HSUBC18 is substituted, preferably by S. Preferred dominant negative mutants can be derived from HSUBC18 and interfere with covalent bond formation between ubiquitin and HSUBC18 or transfer of ubiquitin from HSUBC18 to a target 21 protein such as nF508, CFTR, or al-AT. Such dominant negative mutants can be prepared by art recognized procedures (see e.g., Townsley et al., Proc. Natl.
Acad.
Sci. USA 94: 2362-2367 (1997)). Preferably, such dominant negative mutant is a protein or peptide having from 75% amino acid sequence identity to about 99%
sequence identity to the amino acid sequence set forth in SEQ ID NO: 5, or to a 26 portion or protein conjugate thereof which inhibits the biological activity of HSUBC18 to form a thioester linkage with ubiquitin or transfer ubiquitin to a protein target such as oF508, CFTR, or a,-AT, under conditions as described in the following examples by at least 50%, preferably by at least 75%, more z9 preferably by at least 90% and most preferably by at least 99%. Preferably, such inhibitory portion comprises an amino acid sequence spanning residue 89, more preferably comprises at least about 25 additional amino acids of HSUBC18, or at least about 50 additional amino acids of HSUBC18, or at least about 75 additional amino acids of HSUBC18, or at least about 100 additional amino acids of 6 HSUBC18, or even at least about 150 additional amino acids of HSUBC18. For purposes of this aspect of the invention, the term "spanning residue 89" means comprising amino acid residues in both the N-terminal and C-terminal directions from residue 89, as that residue is shown in Figure 3. Preferably, residue 89 itself may be substituted by one or more amino acids, more preferably from about 1 to 11 about 50 amino acids, or residue 89 may be absent. Preferably the amino acids in the N-terminal and C-terminal directions from residue 89 are each independently within 20 amino acids of residue 89, as shown in Figure 3, more preferably within 10, even more preferably within 5, and most preferably are immediately adjacent residue 89 as shown in Figure 3. As used herein, oF508 may be used to refer to 16 either the phenylalanine residue at position 508 of CFTR, or may more usually be used to refer to a mutant CFTR molecule in which such phenylalanine residue is substituted by one or more amino acids, more preferably from about 1 to about amino acids, or in which such phenylalanine residue is deleted.
21 The purified protein and its structural information provided herein enables the preparation of HSUBC18 binding molecules, HSUBCIBBMs. Thus, in a thirteenth aspect, the invention provides methods for identifying HSUBCI8BMs. One preferred method according to this aspect of the invention comprises screening for HSUBCI8BMs by contacting purified HSUBC18 26 according to the invention and populations of molecules or mixed populations of molecules and determining the presence of molecules which bind specifically to HSUBC18. Another preferred method according to this aspect of the invention comprises rationally designing molecules to bind HSUBC18 based upon 1 structural information from the purified HSUBC18 provided by the invention and determining whether such rationally designed molecules bind specifically to HSUBC18. Molecules that bind specifically to HSUBC18 are molecules that bind to HSUBC18 with greater affinity than to other unrelated proteins. Preferably, binding affinity of the molecule for HSUBC18 is at least 5-fold greater than its 6 affinity for unrelated proteins, more preferably at least 10-fold greater, still more preferably at least 50-fold greater, and most preferably at least 100-fold greater.
This aspect of the invention includes HSUBCIBBMs identified by the methods according to the invention.
As used herein, a"HSUBC18-binding molecule", or "HSUBC18BM", is a 11 molecule or macromolecule which binds under physiological conditions to HSUBC18. "Binds under physiological conditions" means forming a covalent or non-covalent association with an affinity of at least 106M-', most preferably at least 109M-' , either in the body, or under conditions which approximate physiological conditions with respect to ionic strength, e.g.,140 mM NaCI, 5 mM
16 MgCl2. A "population of molecules", as used herein, refers to a plurality of identical molecules. A"mixed population of molecules" refers to a plurality of molecules wherein more than one type of molecule is present.
In certain preferred embodiments, a HSUBC18BM according to the invention is a peptide or a peptidomimetic. For purposes of the invention, a 21 "peptide" is a molecule comprised of a linear array of amino acid residues connected to each other in the linear array by peptide bonds. Such peptides according to the invention may include from about three to about 500 amino acids, and may further include secondary, tertiary or quaternary structures, as well as intermolecular associations with other peptides or other non-peptide 26 molecules. Such intermolecular associations may be through, without limitation, covalent bonding (e.g., through disulfide linkages), or through chelation, electrostatic interactions, hydrophobic interactions, hydrogen bonding, ion-dipole interactions, dipole-dipole interactions, or any combination of the above.

1 In certain preferred embodiments, such an HSUBC18BM comprises a complementarity determining region of an antibody which binds under physiological conditions to a peptide-containing epitope of HSUBC18, or a peptidomimetic of such a complementarity determining region. For purposes of the invention, a "complementarity determining region of an antibody" is that 6 portion of an antibody which binds under physiological conditions to an epitope, including any framework regions necessary for such binding, and which is preferably comprised of a subset of amino acid residues encoded by the human heavy chain V, D and J regions, the human light chain V and J regions, and/or combinations thereof. Examples of such preferred embodiments include an 11 antibody, or an antibody derivative, which may more preferably be a monoclonal antibody, a human antibody, a humanized antibody, a single-chain antibody, a chimeric antibody, or an antigen-binding antibody fragment.
Those skilled in the art are enabled to make any such antibody derivatives using standard art-recognized techniques. For example, Jones et al., Nature X21:
16 522-525 (1986) discloses replacing the CDRs of a human antibody with those from a mouse antibody. Marx, Science 229: 455- 456 (1985) discusses chimeric antibodies having mouse variable regions and human constant regions. Rodwell, Nature 42: 99-100 (1989) discusses lower molecular weight recognition elements derived from antibody CDR information. Clackson, Br. J. Rheumatol. 30~r2: 36-21 (1991) discusses genetically engineered monoclonal antibodies, including Fv fragment derivatives, single chain antibodies, fusion proteins chimeric antibodies and humanized rodent antibodies. Reichman et al., Nature 332: 323-327 (1988) discloses a human antibody on which rat hypervariable regions have been grafted. Verhoeyen, et al., Science 239: 1534-1536 (1988) teaches grafting of a 26 mouse antigen binding site onto a human antibody.
In addition, those skilled in the art are enabled to design and produce peptidomimetics having binding characteristics similar or superior to such complementarity determining region (see e.g., Horwell et al., Bioorg. Med.
Chem.

4: 1573 (1996); Liskamp et aL, Recl. Trav. Chim. Pays- Bas 1: 113 (1994);
Gante et al., Angew. Chem. Int. Ed. Engl. 33: 1699 (1994); Seebach et al., Helv. Chim.
Acta 79: 913 (1996)). Accordingly, all such antibody derivatives and peptidomimetics thereof are contemplated to be within the scope of the present invention.
Compositions according to the invention may further include physiologically 6 acceptable diluents, stabilizing agents, localizing agents or buffers.
Additional preferred HSUBCI8BMs according to the invention include small molecules, which can be identified using screening or rational design approaches as discussed later herein.
11 HSUBCI8BMs can be used in conventional assays to detect the presence or absence, and/or quantity of HSUBC18, or HSUBC18/ubiquitin complex in a biological sample. Thus, in a fourteenth aspect, the invention provides methods for determining the presence or absence and/or quantity of HSUBC18 or HSUBC18/ubiquitin complex in a biological sample. Such methods comprise 16 providing a detectable HSUBC18BM to a biological sample, allowing the detectable HSUBC18BM to bind to HSUBC18 or HSUBC18/ubiquitin complex, if any is present in the biological sample, and detecting the presence or absence and/or quantity of a complex of the detectable HSUBC18BM and HSUBClB, or HSUBC28/ubiquitin complex.
21 A detectable HSUBC18BM is an HSUBC18BM which can be detected in an assay. Such detection is preferably through the direct or indirect binding of a tag or label on the HSUBC18BM. "Direct or indirect binding" means that the tag or label may be directly connected to the HSUBC18BM by intermolecular association, or may be connected via intermediate molecules to the HSUBC18BM
26 by intermolecular association. Such intermolecular associations may be through, without limitation, covalent bonding (e.g., through disulfide linkages), or through chelation, electrostatic interactions, hydrophobic interactions, hydrogen bonding, ion-dipole interactions, dipole-dipole interactions, or any combination of the 1 above. Preferred tags and labels include, without limitation, radioisotopes, heavy metals, fluorescent labels, chemoluminescent labels, enzymes and enzyme substrates. Preferred biological samples include blood, serum, plasma, cells, tissue portions, and cell or tissue extracts. In certain preferred embodiments, the method according to this aspect of the invention takes the form of a conventional 6 ELISA or RIA. In another preferred embodiment, the method employs either direct or indirect immunofluorescence. Additional preferred embodiments utilize in vivo imaging of cells expressing HSUBC18 using conventional imaging agents directly or indirectly bound to an HSUBC18BM according to the invention.

Nucleic acid sequences specifically complementary to and/or specifically homologous to nucleic acid sequences encoding HSUBC18 can also be used in conventional assays to detect the presence or absence of HSUBC18 nucleic acid in a biological sample. Thus, in a fifteenth aspect, the invention provides methods 16 for determining the presence or absence and/or quantity of HSUBC18 nucleic acid in a biological sample. In preferred embodiments, such assays are nucleic acid hybridization and/or amplification assays, such assays comprising providing to the biological sample a nucleic acid sequence which is specifically complementary and/or specifically homologous to HSUBC18 nucleic acid.
21 Particularly preferred embodiments include Northern blotting, dot or slot blotting, and polymerase chain reaction.
In a sixteenth aspect, the invention provides methods for identifying modulating ligands of HSUBC18. Some HSUBCI8BMs are capable of acting as 26 antagonists or agonists of HSUBC18. Thus, the method according to this aspect of the invention comprises providing HSUBCI8BMs to an assay system for HSUBC18 participation in the ubiquitin-conjugation pathway, and determining whether such HSUBCI8BMs interfere with or enhance the ability of HSUBC18 to participate in the ubiquitin-conjugation pathway. The HSUBCI8BMs are preferably provided as a population of molecules (most preferably rationally designed molecules), or as a mixed population of molecules, as for example in a screening procedure. This aspect of the invention includes modulating ligands of HSUBC18 identified by this method according to the invention.
6 In preferred embodiments of this aspect of the invention, the method comprises providing HSUBCI8BMs to an assay system for HSUBC18 participation in the ubiquitination of ER proteins, and determining whether such HSUBCIBBMs interfere with or enhance the ability of HSUBC18 to participate in the ubiquitination of ER proteins. More preferably, the ER protein is eF508, 11 CFTR, or a~-AT. Assessment of ability to interfere with or enhance the ability of HSUBC18 to participate in the conjugation of ubiquitin to eF508, CFTR, or a~-AT
can converuentiy be carried out using an in vitro activity system, as later described herein. Alternatively, the cloned gene encoding HSUBC18 can be expressed in yeast sec61 mutants, thereby allowing them to grow at restrictive 16 temperatures (above 37°C (see Sommer and Jentsch, Nature ~5: 176-180 (1993)).
Inhibitors can then be identified by their reversal of the ability of cells expressing HSUBC18 to grow at restrictive temperatures. In either case, such interference or enhancement preferably results in a reduction of ubiquitin-eF508, CFTR, or a,-AT conjugation of at least 50%, more preferably at least 90%, and most preferably, 21 at least 99%, or an increase of ubiquitin-eF508, CFTR, or a,-AT conjugation of at least 50%, preferably at least 2-fold, more preferably at least 5-fold, most preferably at least 10-fold.
In a seventeenth aspect, the invention provides modulating ligands of 26 HSUBC18. Preferred modulating ligands are HSUBCI8BMs which act as antagonists, interfering with the ability of HSUBC18 to participate in the ubiquitination of ER proteins and preferably are capable of interfering with the conjugation of ubiquitin to eF508, CFTR, or a~-AT. Other preferred modulating 1 ligands are HSUBCI8BMs which act as agonists, enhancing the ability of HSUBC18 to participate in the ubiquitination of ER proteins and preferably are capable of enhancing the conjugation of ubiquitin to nF508, CFTR, or a~-AT. In certain embodiments, such HSUBCI8BMs preferably interact with HSUBC18 to inhibit or enhance the formation of a thioester bond between ubiquitin and 6 HSUBC18 and/or transfer of ubiquitin to a protein targeted for proteasome-mediated ER protein degradation, such as oF508, CFTR, or a1-AT.
Preferably, such inhibition or enhancement is specific, i.e., the modulating ligand interferes with or enhances the ability of HSUBC18 to participate in the conjugation of ubiquitin to an ER protein such as eF508, CFTR, or a,-AT at a 11 concentration that is lower than the concentration of the ligand required to produce another, unrelated biological effect. Preferably, the concentration of the ligand required for ubiquitin-nF508, CFTR, or al-AT conjugation modulating activity is at least 2-fold lower, more preferably at least 5-fold lower, even more preferably at least 10-fold lower, and most preferably at least 20-fold lower than 16 the concentration required to produce an unrelated biological effect.
In an eighteenth aspect, the invention provides methods for modulating the conjugation of ubiquitin to HSUBC18 or its transfer to a target protein, preferably an ER protein such as oF508, CFTR, or al-AT. One preferred 21 embodiment of the method according to this aspect of the invention comprises providing a modulating ligand of HSUBC18 or a recombinant expression unit which expresses HSUBC18 or an antagonist thereof to a biological system in which ubiquitin is conjugated to a target protein, such as nF508, CFTR, or al-AT.
The term "biological system", as used herein, includes in vitro cell or tissue 26 extracts, cell cultures, tissue cultures, organ cultures, living plants and animals, including mammals, including without limitation humans and mice. An "antagonist" is a molecule which inhibits the biological activity of HSUBC18.

1 In a nineteenth aspect, the invention provides oligonucleotides that are specifically complementary to a portion of a nucleotide sequence shown in Figure 3. Preferred embodiments include hybridization probes and antisense oligonucleotides.
For purposes of the invention, the term oligonucleotide includes polymers 6 of two or more deoxyribonucleotide, or any modified nucleoside, including 2'-halo-nucleosides, 2'-O-substituted ribonucleosides, deazanucleosides or any combination thereof. Preferably, such oligonucleotides have from about 10 to about 100 nucleosides, more preferably from about 15-50, and most preferably from about 15 to 35. Such monomers may be coupled to each other by any of the 11 numerous known internucleoside linkages. In certain preferred embodiments, these internucleoside linkages may be phosphodiester, phosphotriester, phosphorothioate, or phosphoramidate linkages, or combinations thereof. The term oligonucleotide also encompasses such polymers having chemically modified bases or sugars and/or having additional substituents, including 16 without limitation lipophilic groups, intercalating agents, diamines and adamantane. For purposes of the invention the term "2'-O-substituted" means substitution of the 2' position of the pentose moiety with a halogen (preferably Cl, Br, or F), or an O-lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an O-aryl or allyl group having 2-6 carbon atoms, wherein 21 such alkyl, aryl or allyl group may be unsubstituted or may be substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, vitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl, or amino groups; or such 2' substitution may be with a hydroxy group (to produce a ribonucleoside), an amino or a halo group, but not with a 2'-H group. Certain embodiments of such oligonucleotides are useful in 26 hybridization assays. Other embodiments are useful as antisense oligonucleotides for use in animal model or human therapeutic settings.
In a twentieth aspect, the invention provides a method for therapeutically 1 treating diseases associated with proteasome-mediated ER protein degradation.
In certain preferred embodiments, the invention provides a method for therapeutically treating cystic fibrosis caused by failure of eF508 or CFTR
precursors to mature into functional CFTR. Slowing the rate of ubiquitination of nF508 allows it to mature into functional CFTR. Thus, interference with 6 HSUBC14 or HSUBC15 function or expression should allow maturation into functional CFTR.
In certain other preferred embodiments, the invention provides a method for therapeutically treating emphysema caused by failure of mutant a,-AT to be secreted. Slowing the rate of ubiquitination of calnexin should slow the rate of 11 degradation of the a,-AT that is associated to it, thereby allowing it to be secreted.
Preferably, these embodiments utilize agents that interfere with HSUBC 18 protein function or expression of a gene encoding HSUBC18. Preferred agents that interfere with HSUBC18 protein function include modulating ligands of HSUBC18, preferably modulating ligands of HSUBCI8 which act as antagonists 16 of HSUBC18. Preferred agents that interfere with the expression of a gene encoding HSUBC18 include antisense nucleic acids or antisense oligonucleotides specifically complementary to a portion of the nucleotide sequence set forth in SEQ ID NO: 5.
In other preferred embodiments, the invention provides a method for 21 therapeutically treating liver disease caused by accumulation of mutant a,-AT in the ER. Qu et al. teaches that there is a lag in ER degradation of mutant al-AT in hosts susceptible to the development of liver disease. Enhancing the rate of ubiquitination of calnexin should increase the rate of degradation of the a,-AT
associated with it.
26 Preferably, these embodiments utilize agents that enhance HSUBC18 protein function or expression of a gene encoding HSUBCIB. Preferred agents that enhance HSUBC18 protein function include modulating ligands of HSUBC18, preferably modulating ligands of HSUBC18 which act as agonists of 1 HSUBC18.
The patents and publications cited hereinabove and hereinbelow reflect the knowledge in the art and are hereby incorporated by reference in entirety, whether or not specifically so stated. Any inconsistency between these patents 6 and publications and the present disclosure shall be resolved in favor of the present disclosure.
The following examples are intended to further illustrate certain particularly preferred embodiments of the invention and are not intended to limit 11 the scope of the invention. Searches of the human EST database utilized the program BLAST (Altschul et al.., Nucleic Acids Res 25: 3389-3402 (1997)).
Searches for transmembrane helices used the program Antheprot V.3.0 Gilbert Deleague, Institute de Biologie et Chemie des Proteines 69 367 Lyon cdex 07, France.

Example 1 Identification and Cloning of Human HSUBC14 Gene The human EST database was searched using the first 120 amino acids of the S, cerevisiae Ubc6 gene product as a query sequence. The EST clone GenBank 21 accession # W90647 was found to contain a nucleic acid sequence encoding the amino acid sequence MITPNGRXKCNTRLCLSITDFHPDTWNP. This sequence contains 24 amino acids which are identical to the yeast Ubc6 sequence flanking the active site cysteine. This clone was used to search for further EST
clones. The search led to the construction of a contiguous consensus sequence from 26 overlapping clones which predicts a gene to encode a protein having 259 amino acids, with a predicted molecular mass of 28,897 Da. The contiguous nucleotide sequence was obtained using nested PCR on a human leukocyte cDNA library.
The first PCR used primers having the sequence 1 GAGAGATGAGCAGCACCAGC (forward) and CTCACTCCTGCGCGATGCTC
(reverse). The second PCR was carried out with the primers GGGAATTCCCATATC AGCAGCACCAGCAGTAAG (forward, initiator methionine codon underlined) and CCCAAGCTTT~CTCCTGCGCGATGCTCCTCAG (reverse, reverse compliment 6 of stop codon underlined). The second PCR product was digested with NdeI and HindIII and ligated with the large fragment of NdeI/HindIII-digested pT7-7 to yield the plasmid pT7-7-HSUBC14. The insert was sequenced by standard procedures. The nucleotide sequence and deduced amino acid sequence are shown in Figure 1. The encoded full-length protein has 259 amino acids, and 11 shares 39% amino acid sequence identity and 55% sequence homology with yeast Ubc6. This homology suggests that HSUBC14 plays a role in human ER
proteasome-mediated protein degradation, analogous to the role played by Ubc6 in yeast. An alignment of HSUBC14 with yeast Ubc6 is shown in Figure 4.
16 Example 2 Exlaression and localization of HSUBC14 Expression of Ubcl4 in HeLa cells was carried out by transfecting HeLa cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the human Ubcl4 cDNA was inserted at the CIaI and KpnI site. This insertion generates a 21 protein sequence in which the N-terminus of Ubcl4 was extended by the amino acid sequence MDYKDDDDKLAAANSS. Expression of the protein was confirmed by Western blot using anti-FLAG antibodies that recognize the sequence DYKDDDDK. When cell extract was centrifuged to separate the soluble and particulate fractions, anti-FLAG immunoreactivity on Western blot was 26 detected only in the particulate fraction, as expected for a membrane-anchored ubiquitin conjugating enzyme.
To determine the intracellular localization of HSUBC14, HeLa cells transfected with the pFLAG-CMV-2-HSUBC14 plasmid described above were 1 subjected to immunostaining using a mouse anti-FLAG antibody in conjunction with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The mouse anti-FLAG antibody was detected with a secondary goat anti-mouse antibody conjugated to OG488 (Molecular Probes). The rabbit anti-calreticulin antibody was detected with a goat secondary anti-rabbit antibody conjugated to RedX
6 (Molecular Probes). Calreticulin is a resident protein of the endoplasmic reticulum and is present in all cells. The immunostaining pattern of calreticulin is perinuclear, with reticular staining extending to the cell periphery. The immunostaining pattern of the anti-FLAG in the transfected cells was largely coincident with the calreticulin pattern, indicating that HSUBC14 was mainly 11 localized to the endoplasmic reticulum (see Figure 7). In addition, the anti-FLAG
immunostaining pattern detected localization of HSUBC14 at the nuclear rim, which was not distinctly stained by the anti-calreticulin antibody, and is therefore a specific characteristic of HSUBC14 localization.
A mutant of HSUBC14 was constructed by replacing the active site 16 cysteine with a serine using standard site-specific mutagenesis. The immunostaining pattern of the mutant was determined by the same methods described for the wild-type and was found to be identical to that of wild-type HSUBC14.
21 Example 3 Thioester bond formation of HSUBC14 with ubic~uitin Components (as indicated below) are incubated in a reaction buffer containing 25 mM Hepes (pH7.0),10 mM MgZ+ and 1 mM ATP for 5 minutes at 30°C. The reaction is stopped by addition of SDS sample loading buffer.
Each 26 sample is divided into two aliquots, to one of which was added DTT to a final concentration of 10 mM. The DTT-containing sample is heated in a 95 °C
bath for two minutes. Samples are separated on 10% SDS-Tricine PAGE, followed by transfer to nitrocellulose filters. Filters are stained using conventional Western 1 blot staining procedures with anti-FLAG antibodies. HSUBC14 is expected to migrate as both a 29 kDa band and a 35 kDa band in the presence of ubiquitin and ATP, and the presence of the 35 kDa band is expected to be reversible by DTT.
Reaction No. Pr ins 6 1 E1 + ubiquitin 2 particulate fraction (from Example 2) + ubiquitin 3 particulate fraction (from Example 2) + ubiquitin + El Example 4 11 Identification and Cloning of Human HSUBC15 Gene The human EST database was searched using GenBank accession #
AA488873 as the starting query to obtain other human EST clones that contain overlapping nucleic acid sequences. Sequences of the identified EST clones were aligned using the program CLUSTALW (Thompson et al., Nucleic Acids Res.
16 22:4673-4680 (1994)) or the program SeqMan (DNASTAR). These analyses generated a contiguous sequence, as well as a consensus sequence (CON1).
Homology search of CON1 led to the identification of a putative C. elegans Ubc gene (ced1022.1 ce02575). Another homology search was conducted using 10-20%
of the 5' and 3' sequences of CONl as the query sequence. the new EST clones 21 were assembled and used to construct a second consensus sequence (CON2).
The CON2 sequence was translated, and the process was repeated until an initiator methionine and a stop codon were identified.
The coding sequence of HSUBC15 was obtained by nested PCR on a human leukocyte cDNA library. In the first PCR reaction, the primers 26 CAGCGACCCACCATGGAGACC (forward) and GAAGCAGTTGAGTCACAGCTC (reverse) were used. The primers CCATCGATGGAGACCCGCTACAAC (forward) and CGCGGATCCTTATAACTCAAAGTC (reverse) were used in the second PCR

1 reaction. The product was Iigated to pCR2.1 and sequenced. The experimentally obtained nucleotide and deduced protein sequences are shown in Figure 2.
HSUBC15 contains 318 amino acids and has a predicted molecular mass of 35,181 Da. The full-length protein shares 22% amino acid sequence identity with yeast Ubc6 and 40% amino acid sequence identity with C, elegr~ns ced1022.1. This 6 homology suggests that HSUBC15 may play a role in human ER proteasome-mediated protein degradation analogous to the role played by Ubc in yeast. An alignment of HSUBC15 with yeast Ubc6 and ced1022.1 is shown in Figure 5.
Example 5 11 Expression and localization of HSUBC15 Expression of HSUBC15 in HeLa cells was carried out by transfecting HeLa cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the human Ubcl5 cDNA was inserted at the CIaI and KpnI site. This insertion generates a protein sequence in which the N-terminus of HSUBC15 is extended 16 by the amino acid sequence MDYKDDDDKLAAANSS. Expression of the protein was confirmed by Western blot using anti-FLAG antibodies that recognize the sequence DYKDDDDK. When cell extract is centrifuged to separate the soluble and particulate fractions, anti-FLAG immunoreactivity on Western blot is detected in the particulate fraction, as expected for a membrane-anchored 21 ubiquitin conjugating enzyme. Deletion of the transmembrane domain allows expression of soluble protein.
To determine the intracellular localization of HSUBC15, HeLa cells transfected with the pFLAGCMV-2-HSUBC15 plasmid described above were subjected to immunostaining using a mouse anti-FLAG antibody in conjunction 26 with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The mouse anti-FLAG antibody was detected with a secondary goat anti-mouse antibody conjugated to OG488 (Molecular Probes). The rabbit anti-calreticulin antibody was detected with a goat secondary anti-rabbit antibody conjugated to RedX

(Molecular Probes). Calreticulin is a resident protein of the endoplasmic reticulum and is present in all cells. The immunostaining pattern of calreticulin is perinuclear, with reticular staining extending to the cell periphery. The immunostaining pattern of the anti-FLAG in the transfected cells was coincident with the calreticulin pattern, indicating that HSUBC15 was mainly localized to 6 the endoplasmic reticulum (see Figure 8). The anti-FLAG immunostaining pattern did not detect localization of HSUBC15 at the nuclear rim, which is a specific characteristic of HSUBC14 localization.
A mutant of HSUBC15 was constructed by replacing the active site cysteine with a serine using standard site-specific mutagenesis. The 11 immunostainirtg pattern of the mutant was determined by the same methods described for the wild-type and was found to be identical to that of wild-type HSUBC15.
Example 6 16 Thioester bond formation of HSUBC15 with ubic~uitin Components (as indicated below) are incubated in a reaction buffer containing 25 mM Hepes (pH 7.0),10 mM Mg2+ and 1 mM ATP for 5 minutes at 30°C. The reaction is stopped by addition of SDS sample loading buffer.
Each sample is divided into two aliquots, to one of which was added DTT to a final 21 concentration of 10 mM. The DTT-containing sample is heated in a 95 °C bath for two minutes. Samples are separated on 10% SDS-Tricine PAGE, followed by transfer to nitrocellulose filters. Filters are stained using conventional Western blot staining procedures with anti-FLAG antibodies. HSUBC15 is expected to migrate as both a 35 kDa band and a 41 kDa band in the presence of ubiquitin 26 and ATP, and the presence of the 41 kDa band is expected to be reversible by DTT.
Reaction No. Proteins 1 El + ubiquitin 2 particulate fraction (from Example 5) + ubiquitin 3 particulate fraction (from Example 5) + ubiquitin + E1 Example 7 6 Preparation of dominant negative mutants of HSUBC14 and HSUBC15 The active site cysteine of a cloned HSUBC14 or HSUBC15 is replaced by a serine using standard site-specific mutagenesis. The mutant protein is expressed in bacteria and purified. The ability of the mutant protein to form a stable oxygen ester with ubiquitin is established as described in Example 3 above, 11 except that the bond formation is not labile in DTT. Dominant negative mutant activity is then established by introducing the mutant protein in increasing concentrations in an assay as described in Example 3 above and demonstrating dose-dependent inhibition of ubiquitin/HSUBC14 or ubiquitin/HSUBC15 complex formation.

Example 8 Reversal of nF508 pheno a HEK cells are transfected with an expression vector expressing oF508 mutant CFTR using standard procedures (see Ward et al., Cell 83: 121-127 (1995)).
21 Transfected cells are established as a cell line and transfected with an expression vector expressing the dominant negative mutant prepared according to Example 4 or Example 9. In these transfectants, eF508 protein is not expected to form the 7 kDa ladder characteristic of polyubiquitination.
26 Example 9 Identification and cloning of HSUBC18 The human EST database was searched using the yeast Ubc7 active site sequence as the initial query sequence in the homology search. The EST clone H85522 was discovered to contain a similar active site sequence and was used as the query sequence for a further search. Cloning was achieved using nested PCR.
The first PCR utilized the primers AGGCGAGGTCGCTCGGCGCA (forward) and GCGCCTGTGCGAGGCCAGGT (reverse). The second PCR used the primers GGGAATTCCATATGGCGGGGACC (forward) and 6 CCCAAGCTl'I'CACAGTCCCAGAGACTT (reverse). The PCR product was inserted into the plasmid pT7 at the NdeI and HindIII sites to generate plasmid pT7-7-HsUBCIB. The plasmid insert was sequenced and the nucleotide sequence and deduced amino acid sequence are shown in Figure 3. The encoded full-length protein has 165 amino acids (18.565 kDa) and shares 62% amino acid 11 sequence identity and 75% homology with yeast Ubc7. This high level of homology predicts that HSUBC18 plays a role in human ER proteasome protein degradation analogous to the role played by Ubc7 in yeast. An alignment of HSUBC18 with the yeast protein Ubc7 is shown in Figure 6.
16 Example 10 Expression and localization of HSUBC18 Expression of HSUBC18 in HeLa cells was carried out by transfecting HeLa cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the human Ubcl8 cDNA was inserted at the CIaI and KpnI site. This insertion 21 generates a protein sequence in which the N-terminus of HSUBC18 was extended by the amino acid sequence MDYKDDDDKLAAANSS. Expression of the protein was confirmed by Western blot using anti-FLAG antibodies that recognize the sequence DYKDDDDK.
To determine the intracellular localization of HSUBC18, HeLa cells 26 transfected with the pFLAG-CMV-2-HSUBC15 plasmid described above were subjected to immunostaining using a mouse anti-FLAG antibody in conjunction with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The mouse anti-FLAG antibody was detected with a secondary goat anti-mouse antibody 1 conjugated to OG488 (Molecular Probes). The imntunostaining pattern of the anti-FLAG in the transfected cells indicated that HSUBC18 was concentrated in the nucleus but was detected throughout the cytoplasm as well.
Example 12 6 Preparation of HSUBC18 The HSUBC18 gene construct, prepared according to Example 9, was subcloned into the NdeI and HindIII sites of a modified pGEX-2TK plasmit (Pharmacia) so as to express a fusion protein of glutathione-S-transferase (GST) and HSUBC18. The pGEX-HSUBC18 plasmid was transformed into the E. coli 11 strain BL21(DE3) (Novagen). Expression of the GST-HSUBC18 fusion was induced by the addition of 1 mM IPTG. An S100 fraction of bacterial cells expressing the GST-HSUBC18 fusion was incubated with glutathione-Sepharose resin (Pharmacia). The resin was washed with PBS buffer containing 0.1%
TritonX-100 and 0.25 M KCI, and the GST-HSUBC18 fusion eluted with PBS
16 buffer containing 5 mM glutathione. The eluate was incubated with biotinylated thrombin, which cleaves the GST-HSUBC18 fusion to generate GST and HSUBC18. The sample was dialyzed to remove glutathione. The biotinylated thrombin was removed by incubation with streptavidin agarose (Pierce) and the GST was removed by incubation with glutathione-Sepharose.

Example 12 Thioester bond formation with ubiduitin Proteins (as indicated below) were incubated in a reaction buffer containing 25 mM Hepes (pH7.0),10 mM Mg2+ and 1 mM ATP for 5 minutes at 26 30°C. The reaction was stopped by addition of SDS sample loading buffer. Each sample was divided into two aliquots, to one of which was added DTT to a final concentration of 10 mM. The DTT-containing sample was heated in a 95 °C
bath for two minutes. Samples were separated on 10% SDS-Tricine PAGE, followed 1 by silver staining. HSUBC18 migrates at a slower rate in the presence of ubiquitin and ATP, and that effect is reversible by DTT.
Reaction No. Proteins 1 E1 + ubiquitin 2 HSUBC18 + ubiquitin 6 3 HSUBC18 + ubiquitin + El Example 13 Preparation of dominant ne~~ative mutants of HSUBC18 11 The active site cysteine of HSUBC18, cloned as described in Example 9, was replaced by a serine using standard site-specific mutagenesis. The mutant protein was expressed in bacteria and purified. The ability of the mutant protein to form a stable oxygen ester with ubiquitin was established as described in Example 12 above, except that the bond formation was not labile in DTT.
16 Dominant negative mutant activity was then established by introducing the mutant protein in increasing concentrations in an assay as described in Example 22 above and demonstrating dose-dependent inhibition of ubiquitin/HSUBC18 complex formation.

Claims (22)

What is claimed is:

1. A purified HSUBC18 protein, having at least about 75% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 6.

2. A purified HSUBC18 protein, having at least about 85% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 6.

3. A purified HSUBC18 protein, having at least about 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 6.

4. A purified HSUBC18 protein, having the amino and sequence set forth in SEQ ID NO: 6.

5. A purified HSUBC18 protein, having at least about 85% amino and sequence identity to a biologically active portion of the amino acid sequence set forth in SEQ ID NO:6, wherein the biologically active portion comprises at least 25 amino acids spanning residue 89 in SEQ ID NO: 6, and wherein the biologically active portion forms a thioester linkage with ubiquitin and transfers ubiquitin to a target protein at a rate at least 25% as fast as the protein having the amino and sequence set forth in SEQ ID NO: 6.

6. A purified HSUBC18 protein, having at least about 85% amino acid sequence identity to a biologically active portion of the amino acid sequence set forth in SEQ ID NO:6, wherein the biologically active portion comprises at least 50 amino acids spanning residue 89 in SEQ ID NO: 6, and wherein the biologically active portion forms a thioester linkage with ubiquitin and transfers ubiquitin to a target protein at a rate at least 25% as fast as the protein having the amino acid sequence set forth in SEQ ID NO: 6.

7. A purified HSUBC18 protein, having at least about 85% amino acid sequence identity to a biologically active portion of the amino acid sequence set forth in SEQ ID NO:6, wherein the biologically active portion comprises at least 75 amino acids spanning residue 89 in SEQ ID NO: 6, and wherein the biologically active portion forms a thioester linkage with ubiquitin and transfers ubiquitin to a target protein at a rate at least 25% as fast as the protein having the amino and sequence set forth in SEQ ID NO: 6.

8. A purified HSUBC18 protein, having at least about 85% amino acid sequence identity to a biologically active portion of the amino acid sequence set forth in SEQ ID NO:6, wherein the biologically active portion comprises at least 100 amino acids spanning residue 89 in SEQ ID NO: 6, and wherein the biologically active portion forms a thioester linkage with ubiquitin and transfers ubiquitin to a target protein at a rate at least 25% as fast as the protein having the amino acid sequence set forth in SEQ ID NO: 6.

9. An HSUBC18 expression element selected from isolated or recombinant nucleic acid sequences encoding the HSUBC18 protein according to any one of claims 1-8, isolated or recombinant nucleic acid sequences specifically homologous or specifically complementary thereto, and vectors comprising any such nucleic acid sequences.

10. An HSUBC18 expression element selected from isolated or recombinant nucleic acid sequences having at least about 75% nucleic acid sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 5, isolated or recombinant nucleic acid sequences specifically homologous or specifically complementary thereto, and vectors comprising any such nucleic acid sequences.

11. A method for determining the presence or absence and/or quantity of HSUBC18 or HSUBC18/ubiquitin complex in a biological sample, the method comprising providing a detectable HSUBC18BM to a biological sample, allowing the detectable HSUBC18BM to bind to HSUBC18 or HSUBC18/ubiquitin complex, if any is present in the biological sample, and detecting the presence or absence and/or quantity of a complex of the detectable HSUBC18BM and HSUBC18 or HSUBC18/ubiquitin complex.

12 A method for identifying HSUBC18BMs comprising contacting the HSUBC18 protein according to any one of claims 1-8 with populations of molecules or mixed populations of molecules and determining the presence of molecules which bind spedfically to the HSUBC18 protein.

13. An HSUBC18BM identified by the method according to claim 12.

14. A method for determining the presence or absence and/or quantity of HSUBC18 or HSUBC18/ubiquitin complex in a biological sample, the method comprising providing a detectable HSUBC18BM to a biological sample, allowing the detectable HSUBC18BM to bind to HUSBC18, or HSUBC18/ubiquitin complex, if any is present in the biological sample, and detecting the presence or absence and/or quantity of a complex of the detectable HSUBC18BM and HSUBC18 or HSITBC18/ubiquitin complex.

15. A method for determining the presence or absence and/or quantity of HSUBC18 nucleic acid in a biological sample comprising providing to the biological sample a nucleic acid or oligonueleotide which is specifically complementary to the HSUBC18 expression element according to claim 9 or 10.

16. A method for identifying modulating ligands of HSUBC18 comprising providing HSUBC18 binding molecules to an assay system for participation of HSUBC18 in the ubiquitin-conjugation pathway, and determining whether such HSUBC18 binding molecules interfere with or enhance the ability of HSUBC18 to participate in the ubiquitin-conjugation pathway.

17. A modulating ligand of HSUBC18.

18. A modulating ligand of HSUBC18 identified by the method according to claim 16.

19. The modulating ligand of HSUBC18 according to claim 18, which interacts with HSUBC18 to inhibit or enhance the formation of a thioester bond between ubiquitin and HSUBC18, and/or transfer of ubiquitin to an ER
protein.

20. The modulating ligand of HSUBC18 according to claim 19, wherein the ER protein is CFTR or .DELTA.F508.

21. An agent that interferes with the expression of the HSUBC18 gene.

22. An oligonucleotide that specifically hybridizes under stringent conditions to a portion of the nucleotide sequence set forth in SEQ ID NO: 5.