MXPA00004582A - Immunoglobulin molecules having a synthetic variable region and modified specificity - Google Patents

Abstract

The invention provides modified immunoglobulin molecules, particularly antibodies, that immunospecifically bind a member of a binding pair which immunoglobulins have a variable domain containing one or more complimentary determining regions that contain the amino acid sequence of a binding site for that member of the binding pair, which site is derived from the other member of the binding pair and is not naturally found in the complementary determining region. The invention further provides for therapeutic and diagnostic use of the modified immunoglobulin.

Description

IMMUNOGLOBULIN MOLECULES WITH A SYNTHETIC VARIABLE REGION AND MODIFIED SPECIFICITY REFERENCE TO RELATED APPLICATIONS This application claims the benefit of Provisional Application Series No. 60 / 065,716, filed on November 14, 1997, and Serial Provisional Application No. 60 / 081,403, filed on April 10, 1998, which are they incorporate in the present like reference in their fortresses. 1. FIELD OF THE INVENTION The present invention relates to modified immunoglobulin molecules, specifically antibodies that bind to a member of a binding pair and have at least one complementarity determining region (CDR) that contains the amino acid sequence of a binding site for this member of the binding pair, whose binding site comes from another member of the binding pair. This invention also relates to methods of treatment, diagnosis, or detection for diseases or disorders associated with the expression of the binding pair member, particularly cancer or infectious diseases, using the modified antibodies of the invention. The present invention also relates to pharmaceutical compositions and diagnostic kits containing the modified antibodies of the invention. 2. BACKGROUND OF THE INVENTION 5 2.1 ANTIBODIES OF THE IMMUNE SYSTEM Antibodies are proteins belonging to the immunoglobulin superfamily. The immunoglobulin superfamily includes T cell receptors, B cell receptors, adhesion molecules to the cell surface such as co-receptors CD4, CD8, CD19, and the invariant domains of MHC molecules. In its soluble form, the antibodies are glycoproteins produced by mature B cells that are also known as plasma cells. The antibodies are secreted to the blood and other extracellular fluids to circulate throughout the body in all animals and humans in response to foreign antigens. Antibodies have two main functions. The first is to recognize or bind to foreign antigens. The The second is to mobilize other elements of the immune system to destroy the alien entity. The receptors on the surfaces of immune effector cells are designed to recognize antigens and cell surface markers in other cells. This process of Recognition imparts information as to whether the markers are proprietary or not, and is an important element involved in the modulation of the response of the immune system to the presence of antigens. The portion of an antigen to which a body is attached is known as an antigenic determinant or epitope. Some antigens are able to evoke an immune response, although others are recognized as their own by the immune system. Antigens that can evoke an immune response are called immunogens, and are usually macromolecules of molecular weight of at least 5000 dalton, such as proteins, nucleic acids, carbohydrates and lipids. The smaller non-immunogenic molecules, called haptens, can also stimulate an immune response when coupled to a molecule large carrier 2. 2 STRUCTURE OF M ANTIBODIES The fundamental complete unit of an antibody is a four-chain Y-shaped structure (Figure 1). At the beginning of 1970, Wu and Kabat assembled the amino acid sequences of a large collection of antibodies and demonstrated that the structure of the antibodies, and indeed, all members of the immunoglobulin superfamily, consists of a constant reaction and four relatively conserved structure regions of semi-rigid beta plate with three regions of relatively short hypervariable sequences known as complementarity determining regions (CDRs) interposed between them (Wu and Kabat, 1970, J. Exp. Med 132 (2). 211-250; Wu and Kabat, 1971, Proc. Nati Acad. Sci. USA 68 (7): 1501-1506). This prediction was confirmed by crystallographic studies of the structure of the antibodies (Poljak et al., 1973, Proc. Nati, Acad Sci USA 7Cj (12): 3305-3310, Diesenhofer et al., 1976, Hoppe Seylers Z Physiol Chem ( Germany, west) 357 (10): 435-445; Diesenhofer et al., 1976, Hoppe Seylers Z Physiol Chem (Germany, west) 357 (10): 1421-1434). . "f Figure 1 represents the general structure of an antibody molecule.Antibodies are made up of two shorter light chains linked through disulfide bonds to two longer heavy chains, which are connected by disulfide bonds between them. indicated in Figure 2, heavy and light antibody protein chains are composed of multiple domains, each approximately 110 amino acid residues in length Each light and heavy chain of an antibody has a variable region and its amino terminus (VL and VH, respectively), is the variable region of the antibody that confers the antigen-binding specificity.A variable domain of the heavy chain and a variable domain of the light chain together form a single antigen-binding site, thus, the fundamental immunoglobulin unit (^ has two antigen binding sites) The diversity in the variable regions of the light chain 5 and Sada is limited to the three "hypervariable" or CDR regions. There is a total of 6 CDRs in each antibody molecule (Figure 2), each of which CDR contains from about 5 to about 10 amino acids, or up to about 20 amino acids when the CDR is recombined from. endogenously, as is common in some classes of antibodies. The three CDRs of the variable region of each light chain and / each heavy chain form loops that are clustered together and are connected to the remaining four parts of the variable region, called the regions of Structure ("FR") which are relatively conserved between the molecules of the antibody. The antibody diversity is generally created by changing the sequences of the CDRs. The variable regions are different for each antibody, while the constant regions are more highly conserved. Although the light chain only has a constant region domain, the constant region of the heavy chain is composed of multiple domains, called CHi, CH, CH3, ... CHx. The region domains constant are loaded with the various effector functions of the antibody, such as complement binding and binding to Fc receptors expressed by fg ^ lymphocytes, granulocytes, cells of the monocyte lineage, kill the stimulation of B cells for 5 suffer proliferation, cells, mast cells and other immune effector cells. Other effector functions are differentiation, activation of the complement cell lysis system, opsonization, attraction of macrophages. Antibodies from different isotypes have different domains constants and therefore different effector functions. The best-studied isotypes are IgG and IgM. All animal species express some different classes of antibodies. Five classes of human antibodies (IgG, IgA, IgM, IgD and IgB), and within these classes, different subclasses are recognized based on the structural differences, such as the number of immunoglobulin units in a single antibody molecule, the disulfide bridge structure of the individual units of the differences in the length and sequence of the chains IgG antibodies are, until now, the most useful of the three classes for therapeutic pharmaceutical diagnosis and use, although antibodies of other classes may find use in certain uses. 2. 3. MANIPULATION OF ANTIBODIES The development of monoclonal antibody technology, first discovered by Kohler and Milstein (1975, Nature 256: 495-497), has allowed the generation of unlimited amounts of antibodies of precise and reproducible specificity. The Kohler procedure and Milstein includes the fusion of splenic cells obtained from an immunized animal, with an immortal myeloma cell lines to produce hybridomas. The genes that produce an antibody having the required specificity are then selected from these hybridomas. Hybridomas produce monoclonal antibodies that are uniform in their properties and specificity. To date, the identification and production of suitable antibodies useful in diagnosis and therapeutic applications has depended on the choice. The generation of antibody-producing hybridomas includes immunization of a mouse with an antigen or, otherwise, the antigen is added to spleen cell preparations in vi tro. The population of splenic cells and, therefore, potential monoclonal antibodies with a specific specificity depends on the animal's immune reaction to the antigen. Additional approaches to generate useful antibodies for diagnostic and therapeutic uses have been developed as an alternative to the laborious immunization procedure mentioned above. One approach is to clone the antibody genes in phage viruses, which are expressed on the surfaces of the virus in a single variable region as described in Clackson et al., 1991, Nature 352: 624; Marks et al., 1992, J. Mol. Biol. 222 581; Zebedee et al., 1992, Proc. Nati Acad. Sci. USA 8_9: 3576. Through the use of phage library techniques it is possible to generate large libraries that express much of the inherent genetic diversity. However, such libraries are still restricted by the repertoire of the antibodies from which they were obtained. In yet another approach, the variable domain genes that are randomly mutated and expressed, also give rise to the production of large libraries as described in Pack (1997, High Quality Antibody Libraries, Abstracts for the Eighth International Conference of Antibody Engineering ). Although both methods are useful in the generation of great diversity, these are generally little more successful in identifying useful antibodies when compared to traditional immunization methods because they depend on the random generation of the CDR sequences. In addition, the antibodies generated through immunization of mice are of limited use in human treatments. Given the mouse monoclonal antibodies are foreign and thus immunogenic to humans, they induce a response * ^ 1 of the human anti-mouse antibody (HAMA) (Shawler et al., 1985, J. Im unol. 135: 1530; Chatenaud et al., 1986, J.

Immunol 137: 830). 2. 4. PHARMACEUTICAL PRODUCTS BASED ON THE HANDLING OF INTRAMOLECULAR INTERACTIONS The effectiveness of a pharmaceutical compound is obtained with The frequency of the pharmacist's ability to improve, antagonize or mimic the binding of one molecule to another, for example, a ligand to its receptor, or a pathogen to a cellular receptor, thereby obtaining some physiological and pharmacological activity useful for the prevention or decrease of the disease. Until recently, pharmaceutical compounds. were limited to synthetic or natural products discovered by chance, and were _ the effectors of small molecules that mimic the binding of the ligands that occur naturally. Even when there Information available related to the structure of the ligands or their binding sites, currently available methods does not easily lead to the development of effective pharmaceutical compounds. Methods such as the use of molecular modeling to design analogs of molecules Small-scale data based on the crystal structure for ligand-receptor binding pairs or detection by binding to a receptor using combinatorial libraries of peptides or natural product extracts have not proven to be reliable. In addition, these products Synthetic or natural agents do not always have the ability to discriminate binding affinity and specificity for receptor subtypes, which may give rise to undesirable side effects due to insufficient control over pharmacological effects. There is a great need for a method to more directly reproduce or inhibit the effects of natural interactions, and to be able to design specific pharmaceutical compounds that interact with the members of a particular binding pair and more closely mimic the behavior of ligands that occur naturally. The citations of the aforementioned references should not be considered as an admission that such references are the prior art of the present invention. 3. COMPENDIUM OF THE INVENTION The present invention is based on the observation of the present inventors that the binding site contained within a member of a binding pair for another member of the binding pair can be transplanted to at least one CDR of an immunoglobulin molecule to confer specificity on the immunoglobulin for the second member of the binding pair. The present invention aims to provide a method for designing immunoglobulins, particularly antibodies, with a particular specificity, which method avoids the unpredictable immunization and detection processes currently used to isolate specific antibodies. In particular, modified, synthetic antibodies that immunospecifically bind to a member of a binding pair. are manipulated so that the variable region of the modified antibody has one or more CDRs that contain the binding sequence for this binding pair member, whose binding sequence is obtained from the other binding partner member. This method, thus, drastically simplifies the process of identifying suitable antibodies and makes available antibodies to multiple antigens that are inaccessible due to immune tolerance or cryptic expression. Accordingly, the present invention offers modified immunoglobulin molecules, particularly antibodies, that immunospecifically bind to a first member of a binding pair, whose binding pair consists of the first member and a second member, whose antibodies contain a domain. variable having at least one CDR containing an amino acid sequence of the binding site for the first member of the binding pair, whose binding site is obtained from the second member of the binding pair. In a preferred aspect of the invention, the amino acid sequence of the binding site is not in the form natural within the CDR. The binding pair can be any of two molecules that specifically interact with each other. In specific embodiments, the first member of the binding pair is a cancer antigen (i.e., a molecule expressed on the surface of a cancer cell), an antigen of an infectious disease agent (i.e., a molecule on the surface / ie of an infectious disease agent) or a cellular receptor for an infectious disease agent. Such cancer antigens include the antigen of the globule of human milk fat (HMFG), an epitope of polymorphic epithelial mucin antigen (PEM), or a protein antigen associated with human colon carcinoma. These antigens of infectious disease agents include a receptor Brambell (FcRB), and antigens of HSV-2, gonococci, Treponema pallidum, Chalmydia trachomatis or human pap.ilomavirus. In other specific embodiments, the binding pair is a receptor-ligand binding pair, for example, where the first member of the binding pair is a bradykinin receptor. The invention also provides the methods of treatment or prevention using the modified immunoglobulins of the invention. For example, modified antibodies having one or more CDRs containing the site of • • • binding for a cancer antigen or an antigen of an infectious disease agent or a cellular receptor for a Infectious disease agent can be used in the treatment or prevention of a cancer or an infectious disease associated with the expression of the particular cancer antigen or infectious disease agent antigen or the cellular receptor for the disease agent infectious. The invention further provides methods for screening or detection or diagnosis using the modified immunoglobulins of the invention. For example, modified antibodies having one or more CDRs containing the binding site for a cancer antigen or an antigen of an infectious disease agent can be used in the screening, detection and diagnosis of _ a cancer or an infectious disease associated with the expression of the cancer antigen or antigen of the agent of particular infectious disease. The invention also provides therapeutic and diagnostic kits and pharmaceutical compositions containing the modified immunoglobulins of the invention. The invention further provides methods for producing the synthetic modified immunoglobulin of the invention. Section 6, below, describes the synthesis of the • • synthetic modified antibodies in which one of the CDR contains a bradykinin amino acid sequence comprising the binding sequence for the bradykinin receptor. The example demonstrates that this modified, synthetic antibody binds immunospecifically to the bradykinin receptor, and competes with bradykinin to bind to the bradykinin receptor. The activity of The modified, synthetic antibody is antagonized by an antagonist of bradykinin activity. 4. BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a schematic diagram showing the structure of the light and heavy chains of an immunoglobulin molecule, each chain consisting of a variable region positioned in the amino terminal region (H2N-) of the _ immunoglobulin and a constant region positioned in the carboxyl terminal region (-COOH) of the immunoglobulin.

Figure 2 is a schematic diagram of an IgG showing the four regions of the structure (FR1, FR2, FR3 and FR4) and three complementarity determining regions (CDR1, CDR2 and CDR3) and the variable regions of light and heavy chains (labeled as VL and VH, respectively). The domains of the constant region are indicated as CL for the constant domain of the light chain and CHi, CH2 and CH3 for the three domains of the constant region of the heavy chain. Fab indicates the portion of the antibody fragment that includes the variable region domains of the light and heavy chains, and the CL and CHi domains. Fc indicates the fragment of the constant region containing the CH2 and CH3 domains. Figures 3A-C. (TO) . The structure of the expression vector pMRROlO.l, which contains a sequence of the constant region of the human kappa light chain. (B) The structure of the pGammal expression vector containing a sequence encoding the heavy chain of the human IgGl constant region (CH1, CH2, CH3) and the hinge region sequences. (C) The structure of the expression vector pNEPuDGV containing a sequence coding for the constant domain layer of the light chain and the constant domain and the hinge region of the heavy chain. For the three vectors see Bebbington et al., 1991, Methods in Enzymology 2: 136-145. 20 Figures 4A-H. The amino acid and nucleotide sequences for the variable domains of the heavy and light chain that have a CDR containing bradykinin sequences and corresponding to the consensus sequences of the variable domain of the heavy and light chain of the synthetic antibodies. All these sequences also contain a leader sequence. (A) The amino acid sequence (SEQ ID NO: 58) and the corresponding nucleotide sequence? 'F (SEQ ID NO: 58) for the variable region of the consensus light chain ConVL1. (B) The sequence of 5 amino acids (SEQ ID NO: 60) and the corresponding nucleotide sequence (SEQ ID NO: 59) for the variable region of the light chain BKCDR1 in which CDR1 contains a bradykinin sequence. (C) The amino acid sequence (SEQ ID NO: 62) and the nucleotide sequences corresponding (SEQ ID NO: 61) for the variable region of the light chain BKCDR2 in whose CDR2 contains a bradykinin sequence. (D) The amino acid sequence (SEQ ID NO: 64) and the corresponding nucleotide sequences (SEQ ID NO: 63) for the variable region of the BKCDR3 light chain in which CDR3 contains a bradykinin sequence. (E) The amino acid sequence (SEQ ID NO: 66) and the corresponding nucleotide sequences (SEQ ID NO: 65) for the variable region of the consensus heavy chain ConVHl. (F) The amino acid sequence (SEQ ID NO: 68) and the sequence of corresponding nucleotides (SEQ ID NO: 67) for the variable region of the heavy chain BKCDR4 in which CDR4 contains a bradykinin sequence. (G) The amino acid sequence (SEQ ID NO: 70) and the corresponding nucleotide sequence (SEQ ID NO: 69) of the variable region of the heavy chain BKCDR5 in which CDR5 contains a bradykinin sequence. (H) The amino acid sequence (SEQ ID NO: 72) and the corresponding nucleotide sequence (SEQ ID NO: 71) of the variable region of the V-, heavy chain BKCDR6 in which the CDR6 contains a bradykinin sequence. Figure 5A a schematic diagram of the general steps that were followed to assemble a manipulated gene encoding the modified, synthetic antibody, containing A bradykinin sequence. The oligonucleotides used. to assemble the gene are indicated as "oligol" to "oligolO". Figures 6A and B. (A) Nucleotide sequences of the oligonucleotides used to assemble the consensus light chain (conVL1) and the variable regions of the chain containing bradykinin, by the scheme indicated in Figure 5 (SEQ ID NOS: 24-41). (B) Nucleotide sequences of the oligonucleotides used to assemble the variable region of the consensus heavy chain (ConVHl) and the variable regions of the heavy chain containing bradykinin, as indicated in Figure 5 (SEQ ID NOS: 42-56). Figures 7A-C. (A) Stimulation of PGE synthesis by bradykinin in SV-T2 cells as indicated in ng / well of PGE for each treatment. In the lower legend, the Figure a "-" indicates that the cells were incubated in the absence of the factor while "+" indicates that the cells were incubated in the presence of the factor, ie, fT # 1 nM bradykinin (top line) or 1 nM HOE 140, a bradykinin antagonist (lower line). (B) Stimulation of the synthesis of PGE2 by certain modified, synthetic antibodies having CDRs containing bradykinin sequences are represented as pg / well of PGE2, as a function of the dilution of the synthetic antibody BKCDR3 (lines with dark squares), BKCDR4 (lines with triangles dark) and BKCDR5 (lines with dark diamonds), the variable region of the consensus heavy chain (lines with dark circles) and the medium only (line with light circles). (C) The bar graph represents the stimulation of PGE2 (in PGE2 in pg / well) in SV-T2 cells incubated in the presence or absence of bradykinin (indicated as respectively in the legend below the graph) and with an antibody having the variable domain BKCDR3, BKCDR4 or BKCDR5 or an antibody having the variable domain and consensus of the heavy chain (ConVH), as indicated over 20 the bars of the graph.

. DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to modified immunoglobulin molecules, particularly antibodies that bind immunospecifically (e.g., when determined by any method known in the art to determine the binding specificity of an antibody to its antigen, e.g., as described in section 5.7, infra, and whose binding immunospecifically excludes the non-specific binding, but not necessarily the cross-reactivity often observed with naturally occurring antibodies) to a first member of a binding pair and has at least one complementarity determining region (CDR) containing a amino acid sequence coming of the second member of the binding pair, whose amino acid sequence is a binding sequence for the first member of the binding pair. The binding pair can be any of two molecules, including proteins, nucleic acids, carbohydrates or lipids that interact with each other, although Preferably the binding counterpart of which the binding site is obtained is a protein molecule. In preferred embodiments, the antibody contains a binding sequence for a cancer antigen (i.e., a molecule on the surface of a cancer or tumor cell), a Infectious disease antigen, (i.e., a molecule on the surface of an infectious disease agent), a cellular receptor for a pathogen, or a receptor or ligand (preferably, a receptor or ligand of a receptor binding pair) -link in which the ligand is binds the receptor and thereby causes a physiological response). The present invention also provides methods of treatment using the modified immunoglobulins of the invention, for example, but not as limitation, a modified antibody having at least one CDR containing a binding sequence for a particular cancer antigen or antigen of a Infectious disease or a cellular receptor for an infectious disease agent can be used to treat or prevent a cancer or an infectious disease characterized by the presence of this particular antigen by binding the infectious disease agent to the particular recipient. The present invention also provides methods of diagnosis and detection using the modified immunoglobulins of the invention, for example, but not as limitation, a modified antibody having at least one CDR containing a binding sequence for a particular cancer antigen or antigen of a Infectious disease agent can be used to detect a cancer or infectious disease characterized by this particular antigen or by the binding of the infectious disease agent to the particular recipient. For clarity of the description, and not as a limitation, the detailed description of the invention is divided into the following subsections. . 1. MODIFIED IMMUNOGLOBULIN MOLECULES The invention provides modified immunoglobulin molecules, particularly antibodies, that bind immunospecifically (eg, as determined by any method known in the art for the determination of the binding specificity of an antibody to its antigen)., for example, as described in section 5.7, infra) to a first member of a binding pair, wherein at least one of the CDRs of the antibody contains a binding site for the first member of the binding pair, whose site of The binding comes from one amino acid sequence of the other member of the binding pair. In a preferred aspect of the invention, the amino acid sequence of the binding site is not found naturally within the CDR. The amino acid sequence of the binding site can be identified by any method known in the art. For example, in some cases, the sequence of a member of a binding pair has already been determined directly involved in the binding to the other member of the binding pair. In this case, such a sequence can be used to construct the CDR of a synthetic antibody that specifically recognizes the other member of the binding pair. If the amino acid sequence for the binding site in one member of the binding pair for the other member of the binding pair is not known, it can be determined by any of the The methods known in the art, for example, but not limited to, molecular modeling methods or empirical methods, e.g., testing portions (e.g., peptides) of the member for attachment to the other member , or making mutations in the member and determining the mutations that prevent the union. The binding pair can be any of two molecules, which includes proteins, nucleic acids, carbohydrates or lipids that interact with each other, although preferably the binding counterpart from which the binding site is obtained is a protein molecule. In preferred embodiments, the modified immunoglobulin contains a binding sequence for a cancer antigen, an infectious disease antigen, a cellular receptor for a pathogen, or a receptor or ligand that participates in the receptor-ligand binding pair. In the specific modalities, the union pair is a pair of protein-protein interaction that is a homotypic interaction (that is, the interaction between two of the same proteins) or a heterotypic interaction (ie the interaction between two different proteins). In a specific embodiment, the first member is a member of a ligand-receptor binding pair, preferably, of a receptor-ligand binding pair in which the ligand binds to the receptor and thereby causes a physiological response, as it can be intracellular signaling. For example, and not as limitation, the ligand or receptor may be a hormone, autocoid, growth factor, cytokine or neurotransmitter, or receptor for a hormone, autocoid, growth factor, cytokine or neurotransmitter or any receptor or ligand involved in the signal transduction. (For reviews of signal transduction pathways see, for example, Campbell, 1997, J. Pediat, 131: S42-S44, Hamilton, 1997, J. Leukoc, Biol. 62: 145-155, Soede-Bobok & Touw, 1997, J. Mol. Med. 75: 470-477, Heldin, 1995, Cell 8_0: 213-223, Kishimoto et al., 1994, Cell 76: 253-262, Miyajima et al., 1992, Annu Rev. Immunol., 10: 295-331, and Cantley et al., 1991, Cell 64 281-302). In the specific embodiments, a member of the binding pair is ligated such as, but not limited to, cholecystokinin, galanin, IL-1, IL-2, IL-4, IL-5, IL-6, IL-11. , a chemokine, leptin, a protease, neuropeptide Y, neurokinin-1, neurocin-2, 'neurokinin-3, bombesin, gastrin, corticotropin-releasing hormone, endothelin, melatonin, somastotatin, vasoactive intestinal peptide, epidermal growth factor, factor of tumor necrosis, dopamine, endothelin or a receptor for any of these ligands. In other embodiments, a member of the binding pair is a receptor, such as, but not limited to, an opioid receptor, a glucose transporter, a glutamate receptor, or an orphanin receptor, an erythropoietin receptor, a receptor insulin, tyrosine 5 kinase receptor (TK), KIT primordial cell factor receptor, nerve growth factor receptor, growth factor receptor. insulin type, granulocyte colony stimulating factor receptor, somatotropin receptor, neutrophil factor receptor derived from glial or gp39 receptor, class of G protein receptor or β2-adrenergic receptor, or a ligand that binds to any of these receptors. In another embodiment, one of the members of the binding pair is a gate ion channel to the ligand, such as but not limited to a calcium channel, a sodium channel, a potassium channel. In certain embodiments, the invention provides modified immunoglobulins that bind immunospecifically to a receptor and are antagonists of the ligand that binds to this receptor, for example, but not as a limitation, are endorphin antagonists, enkephalin. or nociceptin. In other embodiments, the invention provides modified, synthetic antibodies that bind immunospecifically to a receptor and are receptor agonists, for example, but not as limitation, the endorphin, enkephalin or nociceptin receptors. In a In a preferred embodiment, the modified immunoglobulin does not bind to a fibronectin receptor. In another preferred embodiment, the binding sequence is not Arg-Gly-Asp, it is not a multimer of a binding sequence, and preferably it is not a multimer of the sequence Arg-Gly-Asp. In other specific embodiments, the modified immunoglobulin has a CDR that contains a binding site for a transcription factor. In a preferred aspect, the modified immunoglobulin does not bind to a specific DNA sequence, particularly it does not bind to a site of binding of the transcription factor. In preferred embodiments, the modified immunoglobulin has, at least one CDR containing an amino acid sequence of a binding site for a cancer antigen or a tumor antigen (eg, as is described in detail in section 5.3.1, infra), more preferably, the antigen is an antigen associated with human colon carcinoma or epithelial mucin antigen. In other embodiments, at least one CDR of the modified immunoglobulin contains a sequence of amino acids for a binding site for a human milk fat globule receptor. In other embodiments, the modified immunoglobulin has at least one CDR that contains an amino acid sequence of a binding site for an antigen of a breast, ovarian, uterus, tumor.

Prostate, bladder, lung, skin, pancreas, colon, gastrointestinal tract, B lymphocytes or T lymphocytes. In other preferred embodiments of the invention, at least one CDR or the modified antibody contains an amino acid sequence for a binding site for a antigen of an infectious disease agent (eg, as described in detail in section 5.3.2, infra), or a binding site for a cellular receptor of an infectious disease agent, preferably where the binding site is not is an amino acid sequence of a Plasmodium um antigen, or is not an Asn-Ala-Asn-Pro binding site (SEQ ID NO: 1) or Asn-Val-Asp-Pro (SEQ ID NO: 2). In the further embodiments, the modified antibody has a CDR that contains the binding site for a bacterial or viral enzyme. The modified immunoglobulin molecules of the invention can be obtained from any type of immunoglobulin molecules, for example, but not limited to, antibodies, T cell receptors, B cell receptors, cell surface adhesion molecules such as the CD4, CD8, CD19 co-receptors and the invariant domains of the MHC molecules. In a preferred embodiment of the invention, the modified immunoglobulin molecule is an antibody, which can be any kind of antibody, for example, an IgG, IgE, IgM, IgD and IgA, most preferably an antibody is an IgG. In addition, the antibody can be any subclass of the particular classes of antibodies. In another specific mode, the modified immunoglobulin molecule is a T cell receptor. The immunoglobulin that is modified to generate the modified immunoglobulin can be any available immunoglobulin molecule, and is preferably a monoclonal antibody or is a synthetic antibody. The antibody that is modified can be natural or an antibody Previously existing or can be synthesized from known antibody consensus sequences, such as consensus sequences for the light and heavy chain variable regions in Figures 4A and B, or any other consensus or germline sequences of the Antibody (i.e., non-recombined genomic sequences) (e.g., those consensus and germ line sequences of the antibody described in Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th edition.) NIH publication No. 91 -3242, pp 2147-2172). As noted above, each antibody molecule has six CDR sequences, three in the light chain and three in the heavy chain, and five of these CDRs are CDRs of the germ line (ie, they come directly from the genomic sequence of the germline of the animal, without recombination) and one of the CDRs is a non-germ-line CDR (i.e., it differs in sequence from the genomic sequence of the animal's germline and is generated by recombination V, | of the germline sequences). If a CDR is a germ line sequence or not of the germ line 5 it can be determined by sequencing the CDR and then comparing the sequence with known germline sequences, for example, as listed in Kabat et al., (1991 , Sequences of Proteins of Immunological Interest, 5th edition, NIH publication No. 91-3242, pp. 2147-2172). The variation Significant of the known germline sequences indicates that the CDR is a non-germline CDR. Accordingly, in other embodiments of the invention, the CDR containing the amino acid sequence of the binding site is a CDR of the germline or, of otherwise, it is a CDR not of the germ line. The binding site can be inserted into any of the antibody CDRs, and it is within the skills of the technique to insert the binding site into different CDRs of the antibody and then detect the modified antibodies results for the ability to bind to the specific member of the binding pair, for example, as described in section 5.7, infra. Thus, it is possible to determine the CDR that contains the binding site optimally. In the specific modalities, a CDR of the variable region of The heavy or light chain is modified to contain the amino acid sequence of the binding site, in another specific embodiment, the modified antibody contains an Ít. variable domain in which the first, second or third CDR of the heavy variable region or the first, second or third CDR of the variable region of the light chain contains the amino acid sequence of the binding site. In another embodiment of the invention, more than one CDR contains the amino acid sequence of the binding site or more than one CDR containing a different binding site for the same molecule or contains a different binding site for a different molecule. In particular embodiments, two, three, four, c-Vnco or six CDRs have been manipulated to contain a binding site for the first member of the binding pair. In a preferred embodiment, one or more CDRs contain .15 a binding site for the first member of a binding pair and one or more other CDRs contain a binding site for a molecule on the surface of an immune cell, as wf may be, but is not limited to, cells T, B cells, NK cells, K cells, TIL cells or neutrophils. By For example, a modified antibody having a binding site for a cancer antigen or an infectious disease antigen and a binding site for a molecule on the surface of an immune cell can be used to direct the immune cell to a cancer cell. carrier of the cancer antigen or to the agent of the infectious disease. In the specific embodiments of the invention, the amino acid sequence of the binding site is inserted into the CDR without replacing any of the 5 amino acid sequences of the CDR itself or, otherwise, the amino acid sequence of the binding site. it replaces all or a part of the amino acid sequence of the CDR. In specific embodiments, the amino acid sequence of the binding site replaces amino acids 1, 2, 5, 8, 10, 15 or 20 of the sequence of the CDRs. The amino acid sequence of the binding site present in the CDR may be the minimum binding site necessary for binding of the binding pair member (which can be determined empirically by any of the methods known in the art); otherwise, the binding site may be greater than the minimum binding site necessary for the union of the binding pair member. In particular embodiments, the amino acid sequence of the binding site is at least four amino acids in length, or when less than 6, 8, 10, 15 or 20 amino acids in length. In other embodiments, the amino acid sequence of the binding site is no greater than 10, 15, 20 or 25 amino acids in length, or is 5-10, 5-15, 5-20, 10-15, 10-20 or 10-25 amino acids in length. In addition, the total length of the CDR (i.e., the combined length of the sequence of the binding site and the remainder of the CDR sequence) must be of a suitable number of amino acids to allow binding of the antibody to the antigen. It has been observed that the CDRs have a range of amino acid residue numbers, and the size ranges observed for the CDR (as defined by the abbreviations indicated in Figure 2) are given in Table 1.

Table 1 CDR Number of residues Ll 10-17 vi 7 L3 7-11 Hl 5-7 H2 9-12 H3 2-25 (Compiled from data in Kabat and Wu, 1971, Ann NY Acad. Sci. 190: 382-93) .

Although many of the H3 regions of the CDR are 5-9 residues in length, certain H3 regions of the CDR have been observed to be much longer. In particular, a number of antiviral antibodies have H3 regions of the Heavy chain CDR 17-24 residues long. Accordingly, in the specific embodiments of the invention, the CDR containing the binding site is within the size range provided for this specific CDR in Table 1, ie, if it is the first CDR of the light chain, Ll, the CDR is 10 to 17 residues of 5 amino acids; if it is the second CDR of the light chain, L2, the CDR is of 7 amino acid residues; if it is the third CDR of the light chain, L3, the CDR is 7 to 11 amino acid residues; if it is the first CDR of the heavy chain, Hl, the CDR is from 5 to 7 amino acid residues; if it is the second CDR of the heavy chain, H2, the CDR is from 9 to 12 amino acid residues; and if it is the third CDR of the heavy chain, H3, the CDR is from f2 to 25 amino acid residues. In other specific modalities, the CDR containing the binding site is 5-10, 5-15, 5-20, 11-15, 11-20, 11-25 or 16-25 amino acids in length. In other embodiments, the CDR containing the binding site is at least 5, 10, 15 or 20 amino acids or is no greater than 10, 15, 20, 25 or 30 amino acids in length. In the specific modalities, immunoglobulin modified of the invention contains a portion of a variable region, ie, where the heavy or light chain contains less than the structure regions and three CDRs, for example, but is not limited to, where the variable region contains one or two CDR, and preferably the regions of structure involved.

In a specific embodiment, the modified antibody binds immunospecifically to the bradykinin receptor (eg, but is not limited to the modified antibody described in section 6. In particular, the modality provides a modified antibody in which at least one CDR contains the amino acid sequence Arg-Pro-Pro-Gly-Phe-Gly-Phe-Ser-Pro-Phe-Arg (SEQ ID NO: 3) In other specific embodiments, the modified antibody binds immunospecifically to human milk fat globule antigen, and at least one of the CDR of the modified antibody contains an amino acid sequence selected from the following: (i) Ala-Tyr-Trp-Ile-Glu (SEQ ID NO: 4); (ii) Glu-Ile-Leu-Pro-Gly-Ser-Asn-Asn-Ser-Arg-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (SEQ ID NO: 5); (iii) Ser-Glu-Asp-Ser-Ala-Val-Tyr-Tyr-Cys-Ser-Arg-Ser-Tyr-Asp-Phe-Ala-Trp-Phe-Ala-Tyr (SEQ ID NO: 6); (iv) Lys-Ser-Ser-Gln-Ser-Leu-Leu-Tyr-Ser-Ser-Asn-Gln-Lys-Ile-Tyr-Leu-Ala (SEQ ID NO: 7); (v) Trp-Ala-Ser-Thr-Arg-Glu-Ser (SEQ ID NO: 8); and (vi) Gln-Gln-Tyr-Tyr-Arg-Tyr-Pro-Arg-Thr (SEQ ID NO: 9). In a more specific embodiment, the CDRs of the variable region of the heavy chain contain the amino acid sequences (i) - (iii) above, while the CDRs of the variable region of the light chain contain the amino acid sequences (iv) - (vi) previous.

In specific embodiments, the invention provides a modified antibody that binds to the antigen associated with human colon carcinoma and contains a variable region having at least one CDR containing one of the following amino acid sequences: Thr-Ala-Lys-Ala-Ser -Gln-Ser-Val-Ser-Asn-Asp-Val-Ala (SEQ ID NO: 10); Ile-Tyr-Tyr-Ala-Ser-Asn-Arg-Tyr-Thr (SEQ ID NO: 11); Phe-Ala-Gln-Gln-Asp-Tyr-Ser-Ser-Pro-Leu-Thr (SEQ ID NO: 12); Phe-Thr-Asn-Tyr-Gly-Met-Asn (SEQ ID NO: 13); Ala-Gly-Trp-Ile-Asn-Thr-Tyr-Thr-Gly-Glu-Pro-Thr-Tyr-Ala-Asp-Asp-Phe-Lys-Gly (SEQ ID NO: 14); or Ala-Arg-Ala-Tyr-Tyr-Gly-Lys-Tyr-Phe-Asp-Tyr (SEQ ID NO: 15). After constructing the antibodies containing the modified CDRs, the modified antibodies can also be altered and detected to select an antibody having greater affinity or specificity. Antibodies with higher affinity or specificity for the target antigen can be generated and selected by any method known in the art. For example, but not as limitation, the nucleic acid encoding the modified, synthetic antibody can be mutagenized, randomly, i.e., by chemical or site-directed mutagenesis, or by making particular mutations at specific positions in the nucleic acid that encodes for the modified antibody, and then the detection of the exposed antibodies from the mutated nucleic acid molecules for binding affinity to the target antigen. Detection can be carried out by individually testing the expressed antibody molecules or by detecting a library of mutated sequences, for example, by phage display techniques (see, for example, U.S. Patent Nos. 5,223,409; 5,403,484 and 5,571,698, all from Ladner et al., PCT publication WO92 / 01047 by McCafferty et al., or any of the other known phage display techniques.Therefore, in a specific embodiment, the modified antibody has a higher specificity or affinity for an antigen that the antibody that occurs naturally and that binds immunospecifically to it antigen. In another embodiment, the modified antibody exhibits a binding constant for an antigen of at least 2 x M. The modified antibodies of the invention can also be further modified in any known manner.

The technique for the modification of antibodies is provided provided that the other modification does not prevent or inhibit the binding of the modified antibody to the particular antigen. In particular, the modified antibodies of the invention may have one or more substitutions, deletions, amino acid insertions in addition to inserting or replacing the CDR sequences with the amino acid sequences of a binding sequence. Such substitutions, deletions or insertions of amino acids can be any substitution, deletion or insertion that does not prevent or inhibit the immunospecific binding of the modified antibody to the target antigen. For example, these other amino acid substitutions include substitutions of functionally equivalent amino acid residues. For example, one or more amino acid residues may be replaced by another amino acid of a similar polarity that acts as a functional equivalent giving rise to a silent alteration. Substitutes for an amino acid can be selected from other members of the class to which the amino acid belongs. For example, amino acids do not polar (hydrophobic) include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Amino acids of neutral polarity include glycine, serine threonine, cysteine, tyrosine, asparagine and glutamine. The amino acids with positive charge (basic) include arginine, lysine and histidine. The negatively charged amino acids (acids) include aspartic acid and glutamic acid. In addition, one or more amino acid residues within the sequence can be substituted by an amino acid not Traditional or chemical analog amino acids can be introduced as substitution or addition in the immunoglobulin sequence. Non-traditional amino acids include, (9 but not limited to, the D isomers of the common amino acids, α-aminoisobutyric acid, 4-aminobutyric acid, 5 Abu, 2-aminobutyric acid, α-Bu, e-Ah x, 6-aminobutyric acid, - Aminohexaenoic, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexyl anine, ß-alanine, fluoroaminoacids, designer amino acids such as ß-methyl amino acids, C a-methyl amino acids, N-a-methyl amino acids, and a / aino acids in general. In addition, the amino acid can be B (dextrorotatory) or L (levorotatory). In a particular embodiment of the invention, the modified immunoglobulin has further been modified to improve its ability to produce an anti-idiotype response, for example, as described in the co-pending application of the United States serial No., entitled "Modified Antibodies with Better Capacity to Produce an Anti-Idiotype Response", by Burch, filed on November 13, 1998 (file No. 6750-015), which is incorporated herein by reference in its entirety. Such modifications are made to reduce the limitations of conformation over a variable region of the immunoglobulin, for example, by eliminating or reducing intrachain or interchain chain disulfide bonds. Specifically, the modified immunoglobulin is further modified such that one or more cysteine residues of the variable region forming the disulfide bonds are replaced with an amino acid residue that does not have a disulfide bond. Identification of the cysteine residues that form a disulfide bond in a variable region of an antibody The particular can be achieved by any of the known methods. For example, but without limitation, it is well known in the art that intrachain cysteine residues that form intrachain disulfide bonds are highly conserved among the antibody classes and in all species. A) Yes Thus, the cysteine residues involved in the formation of disulfide bonds can be identified by comparison of sequences with other antibody molecules in which the residues are known to form a disulfide bond (for example the consensus sequences that are provided in Figures 4A and E, or those described in Kabat et al., 1991, Sequences of Proteins of Immunological Interest 5th edition U.S. Department of Health and Human Services, Bethesda, Maryland). Table 1 provides a list of the positions of the cysteine residues that form disulfide bonds for different antibody molecules. Table 1 (obtained from Kabat et al., 1991, Proteins of Immunological Interest sequences, 5th edition, U.S. Department of Health and Human Services, Bethesda, Maryland).

Species Dcrninio variable Subgroup Cysteine forming disulfide bonds (positions) Human Kappa light I 23,88 Human Kappa light II 23,88 Human Kappa light III 23,88 Human Kappa light TV 23,88 Human Lambda light I 23,88 Human Lambda light II 23,88 Human Light Lambda III 23,88 Human Lambda Light IV 23,88 Human Lambda Light V 23,88 Human Lambda Light VI 23,88 Light Kappa Mouse I 23,88 Light Kappa Mouse II 23,88 Light Kappa Mouse III 23,88 Kappa Lightweight Mouse IV 23,88 Kappa Lightweight Mouse V 23,88 Kappa Lightweight Mouse VI 23,88 Kappa Lightweight Mouse VII 23,88 Kappa Lightweight Miscellaneous Miscellaneous Mouse 23,88 Light Lambda Mouse 23,88 Lightweight Lambda Chimp 23,88 Light Kappa rat 23,88 Light Lambda rat 23,88 Species Variable domain Subgroup Cysteine forming disulfide bonds (positions) Kappa Rabbit] Lightweight 23,88 Lightweight lambda rabbit 23,88 Light Kappa dog 23,88 Lightweight Kappa pig 23,88 Lightweight Lambda pig 23 (88) Light Lambda Cobayo 23,88 Light Lambda Sheep 23 (88) Light Lambda Chicken 23.88 Light Lambda Turkey 23.88 Hydrolagus Light Lambda 23 (88) Coillei (Fish with Rat Tail) • Light Kappa Shark 23.88 Heavy Human I 22.92 Heavy Human II 22.92 Heavy Human III 22.92 Heavy Mouse KA) 22.92 Heavy Mouse KB) 22.92 Heavy Mouse II (A) 22.92 Heavy Mouse II (B) 22.92 Heavy Mouse II (C) 22.92 Heavy Mouse III (A) 22.92 Heavy Mouse III (B) 22.92 Heavy Mouse III (OR 22.92 Heavy Mouse III (D) 22.92 Heavy Mouse V (A) 22.92 Heavy Mouse V (B) 22.92 Heavy Mouse Miscellaneous 22.92 Heavy Rat 22.92 Variable Daninio species Subgroup Cysteine forming disulfide bonds (positions) Heavy Rabbit 22,92 Guinea Pig Heavy 22,92 Heavy Cat 22 (92) Heavy Dog 22,92 Heavy Pork 22 (92) Heavy Mink 22 (92) Heavy Sea Lion 22 (92) Heavy Seal 22 (92) Heavy Chicken 22, 92 Heavy Duck 22 (92) Heavy Goose 22 (92) Heavy Pigeon 22 (92) Heavy Turkey 22 (92) Heavy Cayman 22.92 Heavy Xenopus Frog 22.92 Elops [sic] Heavy 22.92 Heavy Gold Fish 22.92 Hydrolagus Heavy 22 (92) colliei (fish with rat tail) Heavy Shark 22.92 The numbers of the positions () indicate that the protein was not sequenced for this position, but the residue is inferred by comparison with the known sequences. It is important to note that, for all the antibody molecules listed in Table 1, the cysteine residues that form the intrachain disulfide bonds are the residues at positions 23 and 88 of the variable domain of the light chain and the residues at positions 22 and 92 of the variable domain of the heavy chain. The numbers of the positions refer to the residue corresponding to this residue in the consensus sequences as defined in Kabat, (1991, Sequences of Proteins of Immunological Interest, 5th edition, U. S. Departament of Health and Human Services, Bethesda, Maryland) or as indicated in the heavy and light chain variable region sequences depicted in Figures 4A and E, respectively (as determined by aligning the sequence of the specific antibody with the consensus sequence or the variable region sequence). of the heavy or light chain shown in Figures 4A and E). Therefore, in one embodiment of the invention, the modified immunoglobulin molecule is further modified so that the residues at positions 23 and / or 88 of the light chain are substituted with an amino acid residue that does not contain a sulfhydryl group and / or residues at positions 22 and / or 92 are substituted with an amino acid residue that does not contain a sulfhydryl group. The amino acid residue that replaces the cysteine residue that forms the disulfide bond is any amino acid residue that does not contain a sulfhydryl group, for example, alanine, arginine, asparagine, aspartate (or aspartic acid), glutamine, glutamate, (or glutamic acid), (f glycine, histin, isoleucine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.) In a preferred embodiment, the cysteine residue is replaced with a residue of glycine, serine, threonine, tyrosine, asparagine or glutamine, more preferably with an alanine residue In addition, the disulfide-bonding cysteine residue can be replaced by a non-traditional amino acid or analogous chemical amino acid, as listed above, which does not contain a sulfhydryl group. specific modalities, the substitution of the disulfide bond-forming residue is in the region The variable of the heavy chain is either in the variable region of the light chain or in both variable regions of the heavy chain and the light chain. In other modalities _ specific, one of the residues that forms a particular disulfide bond is substituted (or deleted) Or, otherwise, both residues that form a particular disulfide bond can be replaced (or deleted). In other specific embodiments, the invention offers the functionally active fragments of an immunoglobulin. modified. Functionally active fragment means that the fragment can be immunospecifically bound to the target antigen determined by any method known in the art to determine the immunospecific binding (by \ "Example, as described in section 5.7 below). For example, such fragments include, but are not limited to: F (ab ') 2 fragments containing the variable regions of the light and heavy chains, the light constant region and the CH1 domain of the heavy chain, whose fragments can be generated by digestion with pepsin from antibody, and Fab fragments, generated by reducing the disulfide bonds of an F (ab ') 2 fragment (Figure 1; King et al., 1992, Bi ocpem J. 281: 317); and the Fv fragments, that is, fragments containing the variable region domains of the heavy and light chains (Reichmann and Winter, 1988, J. Mol. Biol. 203: 825; King et al., 1993, Bi ochem. J. 290: 723). The invention also includes single chain antibodies (SCA) (U.S. Patent No. 4,946,778; Bird, 1988, Science 242: 243-426; Huston et al., 1988, Proc Nati. Acad.

Sci. USA 85: 5879-5883; and Ward et al., 1989, Nature 334: 544-546). Single-chain antibodies are formed by linking the heavy and light chain fragments of the Fv region through an amino acid bridge, giving rise to a single-chain polypeptide. In addition, the invention also provides heavy chain and light chain dimers and diabodies [sic]. The invention further provides the modified antibodies (ffl) which are also chimeric or humanized antibodies. A chimeric antibody is a molecule in which different portions of the antibody molecule are obtained from different animal species, such as those that have a variable region from a murine mAb and a constant region from a human immunoglobulin constant region, for example, antibodies humanized. It is possible to use techniques that have been developed for the production of chimeric antibodies (Morrison et al., 1984, Proc. Nati, Acad. Sci. 81: 6851-6855; Neuberger et al., 1984, Nature 312: 604-608; Takeda et al., 1985, Nature 314: 452-454; International Patent application No. PCT / GB85 / 00392 (Neuberger et al., And Celltech Limited)) by splicing the genes' from a mouse antibody molecule of suitable antigenic specificity together with genes from a human antibody molecule of suitable biological activity. In a modality Specifically, the modified, synthetic antibody is a chimeric antibody containing the variable domain of a non-human antibody and the constant domain of a human antibody. In a more preferred embodiment, the modified antibody is a humanized antibody, particularly an antibody in which the CDRs of the antibody (except for one or more CDRs containing the binding sequence) are obtained from an antibody of a human animal and the framework regions and the constant region come from a human antibody (U.S. Patent No. 5,225,539 to Winter). These CDR-grafted antibodies have been successfully constructed against different antigens, for example, antibodies against IL-2 receptor as described in Queen et al., 1989 Proc. Nati Acad. Sci. USA 86: 10029; antibodies against CAMPATH cell surface receptors as described in Riechmann et al., 1988, Na ture 332: 323; antibodies against hepatitis B in Co et al., 1991, Proc. Nati Acad. Sci. USA 88: 2869; as well as against viral antigens of the respiratory syncytial virus in Tempest et al., 1991, Bio-Technology 9: 267. Variable region genes grafted with CDR have been constructed by different methods such as site-directed mutagenesis as described in Jones et al., 1986, Nature 321: 522; Riechmann et al., 1988, Nature 332: 323; assembly in vi tro of all variable regions grafted with CDR (Queen et al., 1989, Proc.Nat.Accid.Sic.USA 86: 10029); and the use of PCR to synthesize genes encoded with CDR (Daugherty et al., 1991, Nucleic Acids Res. 19: 2471). The CDR-grafted antibodies are generated in which the CDRs of the murine monoclonal antibody are grafted onto the regions of the structure of a human antibody. After the formation j * of the graft, most of the antibodies benefit I 'of the additional amino acid changes in the region of the structure to maintain affinity, presumably because the residues of the structure are necessary to maintain the conformation of the CDRs, and some residues of the structure have been shown as part of the site of antigen combination. So, in the modalities » Specific to the invention, the modified antibody contains a variable domain in which at least one of the regions of the structure has one or more amino acid residues that differ from the residue in this position in the region of the naturally occurring structure. In a preferred embodiment of the invention, the modified antibody is obtained from a human monoclonal antibody. The creation of fully human monoclonal antibodies is possible through the use of transgenic mice. Transgenic mice in which the loci of the mouse immunoglobulin gene have been replaced with human immunoglobulin loci provide affinity maturation machinery in vivo for the production of human immunoglobulins. In certain embodiments, the modified immunoglobulin (or Fragment thereof) is fused by a covalent bond (eg, but not as a limitation, a peptide bond) to the N-terminus or the C-terminus of an amino acid sequence of another protein (or portion thereof, preferably a portion of at least 10, 20 or 50 amino acids thereof) which is not the modified immunoglobulin. Preferably, the modified immunoglobulin is covalently linked to the other protein at the N terminus of the constant domain of the modified immunoglobulin. In preferred embodiments, the invention offers fusion proteins in which the modified immunoglobulin is covalently linked to a portion of a growth enhancing factor or; ufaa portion of an immunostimulatory factor, including interleukin-2, interleukin-4, interleukin-5, interleukin-6, interleukin-7, interleukin-10, interleukin-12, interleukin-15, colony G stimulating factor, necrosis factor tumor, porin, interferon gamma and antigen of NK cells or peptide derived from MHC. The modified immunoglobulin can further be modified, for example, by the covalent attachment of any type of molecule, provided that such covalent attachment does not prevent or inhibit the immunospecific binding of the immunoglobulin to its target antigen. For example, but not as limitation, the modified immunoglobulin can be further modified, for example, by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic dissociation, binding to a cellular ligand or other (protein , etc. Any of the numerous chemical modifications can be performed by known techniques, including but not limited to, specific chemical dissociation, acenylation, formylation, metabolic synthesis, tunicamycin, etc. In addition, the modified antibody may contain one or more amino acids 'non-traditional, for example, as mentioned earlier in this section.10 In the specific embodiments of the invention, the modified immunoglobulin (or a fragment thereof) is attached by covalent linkage to a therapeutic molecule, for example, directing the therapeutic molecule to a particular type of cell or tissue, for example, cell cancer or tumor. The therapeutic molecule can be any type of therapeutic molecule known in the art, for example, but is not limited to, a chemotherapeutic agent, a toxin such as ricin, an antisense oligonucleotide, a radionuclide, an antibiotic, an antiviral, or antiparasitic, etcetera. . 2 METHODS OF PRODUCTION OF MODIFIED IMMUNOGLOBULIN The modified immunoglobulins of this invention can be produced by any method known in the art.

Technique for the synthesis of immunoglobulins, in particular, by chemical synthesis or by recombinant expression, and preferably is produced by recombinant expression techniques (recombinant expression of the modified immunoglobulin of the invention, or fragment of the invention). It requires the construction of a nucleic acid that codes for the modified immunoglobulin, such an isolated nucleic acid containing a nucleotide sequence that codes for the modified immunoglobulin can be produced using any method known in the art. For example, recombinant techniques or chemical synthesis (for example, see Creighton, 1983, "Proteins: Structures and Molecular Principles." WH Freeman &Co., NY, pp. 34-49; and Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual Cold Springs Harbor Press, N.Y.), or using PCR in known immunoglobulin genes to manipulate the nucleotide sequence encoding the CDR sequence containing the binding site. Accordingly, the invention provides acids nucleic acids containing a nucleotide sequence encoding a modified immunoglobulin of the invention, or a functionally active fragment thereof. Preferably, a nucleic acid encoding a modified immunoglobulin can be assembled from oligonucleotides chemically synthesized (for example, as described in Kutmeier et al., 1994, Biotechniques 17: 242), which, in brief, includes the synthesis of a series * of overlapping oligonucleotides containing portions of the sequence encoding for the modified immunoglobulin, the annealing and ligation of these oligonucleotides, and then the amplification of the linked oligonucleotides by PCR, for example, as exemplified in section 6, infra. Accordingly, the invention provides a method of producing a nucleic acid encoding a modified immunoglobulin, the method comprising: (a) synthesizing a series of oligonucleotides, the series consisting of / oligonucleotides containing a portion of the nucleotide sequence encoding the synthetic modified immunoglobulin and oligonucleotides that contain a portion of the nucleotide sequence that is complementary to the sequence of nucleotides encoding the modified, synthetic immunoglobulin, and each of these oligonucleotides having terminal sequences overlapped with another oligonucleotide in the series, except for those oligonucleotides containing the nucleotide sequences coding for the N-terminal and C-terminal portions of the modified, synthetic immunoglobulin; (b) allowing the oligonucleotides to anneal or anneal to each other; and (c) ligating the hybridized oligonucleotides, Thus, a nucleic acid containing the nucleotide sequence encoding the synthetic modified immunoglobulin is produced. \ Otherwise, a nucleic acid containing a < The nucleotide sequence encoding a modified immunoglobulin can be constructed from a nucleic acid containing a nucleotide sequence that codes, for example, for an antibody molecule, or at least one variable region of an antibody molecule. The nucleic acids that contain the nucleotide sequences encoding the antibody molecules can be obtained from existing clones of antibody molecules or variable domains or by isolating a nucleic acid encoding an antibody or variable domain molecule from a source Suitable, preferably a cDNA library, for example, an antibody DNA library or a cDNA library prepared from cells or tissues that express for a repertoire of antibody molecules or a synthetic antibody library (see, for example, example, Clackson et al., 1991, Nature 352: 624; Hane et al., 1997, Proc. Nati Acad. Sci. USA 94: 4937), for example, by hybridization using a probe specific for the specific antibody molecule or by PCR amplification using synthetic primers that can be hybridized for the 3 'and 5' ends of the sequence.

Once a nucleic acid containing a nucleotide sequence that codes for at least one variable region of an antibody molecule has been cloned, then the sequence of the binding site can be inserted into the nucleotide sequence coding for one or more of the CDRs Such manipulation of the coding sequence of the particular CDRs can be obtained by common recombinant DNA techniques, known in the art. For example, the nucleotide sequence encoding the CDR may be replaced by a nucleotide sequence encoding the CDR containing the sequence of the particular binding site, eg, using PCR-based methods, site-directed mutagenesis in vi tro , etc. If a suitable restriction enzyme site is available in the nucleotide sequence of the CDR, then the sequence can be dissociated with the restriction enzyme and a nucleic acid fragment containing the nucleotide sequence coding for the binding site can be bound at the restriction site. The nucleic acid fragment containing the binding site can be obtained from a nucleic acid which codes for all or a portion of the protein containing the binding site or can be generated from synthetic oligonucleotides containing the sequence coding for the binding site and its inverse complement.

The nucleic acid encoding the modified antibody optionally contains a nucleotide sequence that codes for a leader sequence that directs the secretion of the modified antibody molecule, synthetic. Once a nucleic acid coding for at least the variable domain of the modified antibody is obtained, it can be introduced into a vector containing the nucleotide sequence coding for the The constant region of the antibody (see, for example, PCT Publication WO86 / 05807; PCT Publication WO89 / 01036; and US Patent No. 5,122,464). The vectors containing the complete light or heavy chain for co-expression with the nucleic acid to allow the Expression of a complete antibody molecule are also available and are known in the art, for example, pMRRO10.7 and pGam al (see also Bebbington, 1991, Methods in Enzymology 2: 136-145). The expression vector can then be transferred to A host cell can be cultured by conventional techniques and the transfected cells can be cultured by traditional techniques to produce the antibody of the invention. Specifically, once a nucleic variable region of the modified antibody has been generated, the antibody The modification can be expressed, for example, by the method exemplified in section 6. (See also Bebbington, 1991, Methods in Enzymology 2: 136-145.) For example, by transient transfection of the expression vector encoding the modified immunoglobulin in COS cells, culturing the cells for a suitable time to allow the expression of the immunoglobulin and then taking the supernatant of the COS cells, whose supernatant contains the modified, expressed, secreted immunoglobulin. The host cells which are used to express the recombinant antibody of the invention can be bacterial cells such as Escherichia coli, particularly for the expression of recombinant antibody fragments or, preferably, eukaryotic cells, particularly for the expression of recombinant antibody molecules. In particular, mammalian cells such as Chinese hamster ovary (CHO) cells or COS cells, used together with a vector in which the expression of the antibody is under the control of the main promoter element of the intermediate early gene from Human cytomegalovirus is an efficient expression system for immunoglobulins (Foecking et al., 1986, Gene 45: 101; Cockett et al., 1990, Bio / Technology 8: 662). It is possible to use a variety of host-expression vector systems to express the coding sequences of the antibody of the invention. Such host-expression vector systems represent the vehicles by which the coding sequences of interest can be produced and subsequently purified, but also produce cells that can, when transformed or transfected with the coding sequences of the appropriate nucleotides, present the antibody product. of the invention in situ. These systems include, but are not limited to, microorganisms such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage DNA expression vectors, plasmid DNA or cosmid DNA containing antibody coding sequences; yeast (eg, Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing the antibody coding sequences; insect cell systems infected with expression vectors of the recombinant virus (for example baculovirus) containing the antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV, tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the coding sequences of the antibody; or mammalian cell systems (eg COS, CHO, BHK, 293 and 3T3 cells) anchoring recombinant expression constructs containing the promoters obtained from the genome of mammalian cells (eg, the metallothionein promoter) or from mammalian virus (for example, the adenovirus late promoter, 7.5 K promoter of the vaccine virus). In bacterial systems, a number of expression vectors can be conveniently selected depending on the proposed use for the antibody to be expressed. For example, when a large amount of such a protein is to be produced for the generation of pharmaceutical compositions of an antibody, vectors that direct the expression of high concentrations of fusion protein products that are easily purified may be desirable. These vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), in which the antibody coding sequence can be individually ligated into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, 1985. Nucleic Acids Res. 13: 3101-3109; Van Heeke &Schuster, 1989, J. Biol. Chem. 264: 5503-5509); and similar. It is also possible to use pGEX vectors to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).

In general, these fusion proteins are soluble and can be easily purified from cells used by adsorption and binding to beads of matrix glutathione-agarose followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin dissociation sites or factor Xa protease so that the cloned target gene product can be released from the GST portion. In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The sequence encoding the antibody can be cloned individually into non-essential regions (e.g., the polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (e.g., the polyhedrin promoter). In mammalian host cells, it is possible to use different virus-based expression systems. In cases where an adenovirus is used as the expression vector, the coding sequence of the antibody of interest may be linked to an adenovirus transcription / translation control complex, eg, the late promoter and the tripartite leader sequence. This chimeric gene can then be inserted into the adenovirus genome by recombination in vi tro or in vi vo. Insertion into a non-essential region of the viral genome (for example, the El region or E3) will give rise to a recombinant virus that is viable and capable of expressing the antibody in infected hosts (for example, see Logan &Shenck, 1984, Proc. Na ti, Acad. Sci. USA 81: 3655-3659). Specific initiation signals may also be necessary for the efficient translation of inserted antibody coding sequences. These signals include the initiation codon ATG and adjacent sequences. In addition, the initiation codon * must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translation control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be improved by the inclusion of appropriate transcription enhancing elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol, 153: 516-544). In addition, it is possible to choose a strain of host cells that modulate the expression of the inserted sequences, or modify and process the gene product in the specific manner desired. Such modifications (eg glycosylation) and processing (eg, dissociation) of the protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins - # and gene products. Suitable cell lines or host systems can be chosen to ensure correct modification and processing of the expressed foreign protein. For this purpose, it is possible to use eukaryotic host cells that possess the cellular machinery for the proper processing of the primary transcript, the glycosylation and phosphorylation of the gene product. These mammalian host cells include, but are not limited to, CHO, VERO. BHK, HeLa, COS, MDCK, 293, 3T3, W138. For the production with high yield, long-term, of recombinant proteins, stable expression is preferred. For example, the cell lines that express from Stable way the antibody can be manipulated. Instead of using expression vectors that contain viral replication origins, the host cells can _ to be transformed with DNA controlled by suitable expression control elements (eg, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. After the introduction of the foreign DNA, it is possible to let the manipulated cells grow for 1-2 days in an enriched medium, and then change to a medium selective. The selectable marker in the recombinant plasmid confers resistance to selection and allows the cells to stably integrate the plasmid into their chromosomes and grow to form the foci which in turn can be cloned and extended into cell lines. This method can be conveniently used to manipulate cell lines that express the antibody. Such manipulated cell lines can be particularly useful in the detection and evaluation of compounds that interact directly or indirectly with the antibody. It is possible to use different selection systems, including, but not limited to, herpes simplex virus thymidine kinase genes (Wigler et al., 1997, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szyblaska &Szybalski). , 1962, Proc. Nati, Acad. Sci. USA 48: 2026), and of adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22: 817) in cells tk ~, hgprt "or aprt-, respectively, is also It is possible to use antimetabolite resistance as the basis for the selection of the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Nati Acad Sci USA 77: 3567; O'Hare et al., 1981 Proc Nati, Acad. Sci. USA 78: 1527), gpt that confers resistance to mycophenolic acid (Mulligan &Berg, 1981, Proc. Nati, Acad. Sci. USA 78: 2072), neo that confers resistance to aminoglycoside G- 418 (Colberre-Garapin et al., 1981, J. Mol. Bio. 150: 1), and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30: 147) The expression levels of the synthetic modified antibody can be increased by the amplification of the vector (for a review see Bebbington and Hentshcel, The Use of Vectors Based on Gene Amplification for the Expression of Cloned Genes in Mammalian Cells in DNA Cloning, vol. 3. (Academic Press, New York, 1987)). When a marker in the vector system expressing the immunoglobulin can be amplified, the increase in the level of the inhibitor present in the culture of the host cell will increase the copy number of the marker gene. Since the amplified region is associated with the immunoglobulin gene, the production of immunoglobulin will also increase (Crouse et al., 1983, Mol Cell. Biol. 3: 257). The host cell can be co-transfected with two expression vectors of the invention, the first vector encoding a polypeptide from the heavy chain and the second vector encoding a polypeptide from the light chain. The two vectors may contain identical selectable markers that allow equal expression of a heavy and light chain polypeptide. Otherwise, it is possible to use a single vector that codes for both heavy and light chain polypeptides. In such situations, the light chain must be placed before the heavy chain to avoid an excess of free, toxic heavy chain (Proudfoot, 1986, Nature 322: 652; Kohler, 1980, Proc. Nati. Acad. Sci. USA 77: 2197). The coding sequences H > for heavy and light chains they may contain cDNA or genomic DNA. The invention provides a recombinant cell containing a vector encoding a synthetic antibody having a CDR containing the amino acid sequence of an active binding site for a member of a binding pair. 5.3. THERAPEUTIC USE OF THE MODIFIED, SYNTHETIC ANTIBODIES The invention also provides methods for the treatment or prevention of diseases and disorders associated with the expression of a particular molecule by administering a therapeutic of the invention (referred to herein as "Therapeutic"). These Therapeutics include the modified immunoglobulins of the invention, and functionally active fragments thereof, (e.g. as described in section 5.1, above, and the nucleic acids encoding the modified immunoglobulins of the invention and the functionally active fragments thereof (eg, as described in section 5.2, supra). In general, the administration of products of a species origin or species reactivity that is the same species as that of the individual. Thus, in the preferred embodiments, the therapeutic methods of the invention utilize a modified antibody that is derived from a human antibody; in other embodiments, the methods of the invention utilize a modified antibody that is obtained from a chimeric or humanized antibody. Specifically, pharmaceutical compositions containing the modified antibodies (or functionally active fragment thereof) of the invention that immunospecifically bind to a particular molecule can be used in the treatment or prevention of diseases or disorders associated with the expression of the particular molecule, for example, an antigen. In particular, in the embodiments described in greater detail in the following subsections, modified antibodies that immunospecifically bind to a tumor or cancer antigen or an infectious disease agent antigen or a cellular receptor for an infectious disease agent. they can be used to treat or prevent tumors, cancers or infectious diseases associated with the expression of the particular antigen. Modified immunoglobulins that bind immunospecifically to a ligand or receptor can be used to treat or prevent a disease associated with a defect in decreasing or increasing the amount of the particular ligand receptor. In certain embodiments, the modified immunoglobulins are used to treat or prevent autoimmune disease, which includes but is not limited to rheumatoid arthritis, lupus, ulcerative colitis, or 5 psoriasis. Modified immunoglobulins can also be used to treat allergies. The individual to which the present invention is applicable can be any mammal or vertebrate species including, but not limited to, cows, horses, sheep, - 10 pigs, birds (eg chickens), goats, cats, dogs, hamsters, mice, rats, monkeys, rabbits, chimpanzees and humans. In a preferred mode, the individual is a human. 5.3.1 TREATMENT AND PREVENTION OF CANCERS The invention provides methods of treatment or prevention of cancers characterized by the presence of antigens of a particular cancer, which are a member of a binding pair. The method includes administration to a An individual in need of such treatment or prevention of a Therapeutic of the invention, for example, a modified, synthetic antibody (or functionally active fragment thereof) that immunospecifically binds to the particular cancer antigen, which antibody contains a domain Variable with a CDR containing the amino acid sequence of a binding site for the cancer antigen. Cancers, which include, but are not limited to, neoplasms, tumors, metastases or any disease or • I disorder characterized by uncontrolled growth of cells, can be treated or prevented by the administration of the synthetic modified antibody of the invention whose modified antibody binds immunospecifically to one or more antigens associated with the cancer cancer cells to be treated or prevented. Whether a particular Therapeutics is effective for the treatment or prevention of a certain type of cancer can be determined by any method known in the art, / for example, but not limited to, those methods described in section 5.6, infra. For example, but not as limitation, cancers and tumors associated with the following cancer and tumor antigens can be treated or prevented by administration of a synthetic antibody of the invention, containing in their CDRs the sequence recognizing these cancer antigens: KS antigen 1/4 pan-carcinoma (Perez and Walker, 1990 ,. J. Immunol. 142: 32-37; Bumal, 1988, Hybridoma 7 (4): 407-415), ovarian cancer antigens (CA125) (Yu et al., 1991, Cancer Res. 51 (2): 48-475), prostatic acid phosphate (Tailor, et al., 1990, Nucí. Acids.

Res. 18 (1): 4928), prostate-specific antigen (Hentttu and Vihko, 1989, Biochem Biophys, Res. Comm 10 (2): 903-910, Israeli et al., 1993, Cancer Res. 227-230), antigen associated with p97 melanoma (Estin et al., 1989, J. Nati. Cancer Instit. 81 (6): 445-44), gp75 melanoma antigen (Vijayasardahl et al., 1990, J. Exp. Med. 171 (4): 1375-1380), high molecular weight melanoma antigen (HMW-MAA) (Natali et al., 1987, Cancer 59: 55-3; Mittelman et al., 1990, J. Clin. Invest 86: 2136-2144)), prostate-specific membrane antigen, carcinoembryonic antigen (CEA) (Foon et al., 1994, Proc. Am. Soc. Clin. Oncol. 13: 294), polymorphic epithelial mucin antigen. , human milk fat globule antigen, antigens associated with colorectal tumor such as: CEA, TAG-72 (Yokata et al., 1992, Cancer Res. 52: 3402-3408), C017-1A (Ragnhammar et al. , 1993, Int. J. Cancer 53: 751-758); GICA 19-9 (Herlyn et al., 1982, J. Clin Immunol.2: 135), CTA-1 and LEA, antigen 38.13 of Burkit lymphoma, CD19 (Ghetie et al., 1994, Blood 83: 1329- 1336), CD20 antigen from human B-lymphoma (Reff et al., 1994, Blood 83: 435-445), CD33 (Sgouros et al., 1993, J. Nucí, Med. 34: 422-430), antigens specific to melanoma such as ganglioside GD2 (Saleh et al., 1993, J. Immunol., 151, 3390-3398), ganglioside GD3 (Shitara et al., 1993, Cancer Immunol. Immunother. 36: 373-380), ganglioside GM2 (Livingston et al., 1994, J. Clin. Oncol 12: 1036-1044), GM3 ganglioside (Hoon et al., 1993, Cancer Res. 53: 5244-5250), specific cell surface antigen type of transplantation from S v tumor (TSTA) such as virus-induced tumor antigens including tumor T-DNA antigen T and 5 RNA tumor envelope antigens RNA, oncofetal-alpha-fetoprotein antigen such as colon CEA, oncofetal antigen bladder tumor (Hellstrom et al., 1985, Cancer Res. 45: 2210-2188), differentiation antigen such as human lung carcinoma antigen L6, L20 (Hellstrom et al., 1986, Cancer Res. 46: 3917-3923), fibrosarcoma antigens, Gp37 antigen of human leukemia T cells, / (Bhattacharya-Chatterjee et al., 1988, J. Óf Immun 141: 1398-1403), neoglucoprotein, sphingolipids, breast cancer antigen such as EGFR (receptor of the epidermal growth factor), HER2 antigen (pl85), polymorphic epithelial mucin (PEM) (Hilkens et al., 1992, Trends in Bio, Chem. Sci. 17: 359), malignant human lymphocyte APO-1 antigen (Bernhard et al., 1989, Science 245: 301-304), differentiation antigen (Feizi, 1985, Nature 314: 53-57) such as antigen I found in fetal erythrocytes and primary endoderm, antigen I found in adult erythrocytes, embryos before implantation, I (Ma) found in gastric adenocarcinomas, M18 and M39 that they are found in breast epithelium, SSEA-1 found in myeloid cells (VEP8, VEP9, Myl, VIM-D5 and D? 56-22 found in colorectal cancer, TRA-1-85 (blood group H), C14 found in adenocarcinoma colonic, F3 found in Q lung adenocarcinoma, AH6 found in gastric cancer 5, hapten Y, Law found in embryonal carcinoma cells, TL5 (blood group A), EGF receptor that is found in A431 cells, the Ei series (blood group B) that is found in pancreatic cancer, FC10.2 that is found in embryonic carcinoma cells, gastric adenocarcinoma, CO-514 (Lea blood group) found in adenocarcinoma, NS-10 found in adenocarcinomas, CO-43 (blood group Le), G49 found in EGF receptor of cells A431, MH2 (blood group ALe / Law) that is found in colonic adenocarcinoma, 19.9 found in colon cancer, gastric cancer, mucins, T5A7 found in myeloid cells, R24 found in melanoma, 4.2, GD3, Dl.l, OFA-1, GM2 OFA-2, GD2 and MI: 22: 25: 8 found in embryonic carcinoma cells and SSEA-3, SSEA-4 found in embryos in stages of 4-8 cells. In another embodiment, the antigen is a T cell receptor derived from the peptide of a cutaneous T-cell lymphoma (see Edelson, 1998, The Cancer Journal 4_: 62). In other embodiments of the invention, the individual who will be treated with the modified antibody of this invention can, optionally, be treated with other cancer treatments such as surgery, radiation therapy or chemotherapy, in particular, therapeutics V. of the invention used to treat or prevent cancer can be administered together with one or a combination of chemotherapeutic agents including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas , cisplatin, carboplatin, mitomycin, dacarbazine, procarbazine, an etoposide, a canfatecin, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mj.toxantrone, asparaginase, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, and so on. In a preferred embodiment, the modified antibody, Synthetic is conjugated with a chemotherapeutic agent or other type of toxin, for example, a ricin toxin or a radionuclide, or some other agent effective to kill cancer or tumor cells or to arrest the growth of cancer cells. In another preferred embodiment, the modified immunoglobulin has a CDR containing a binding site for a cancer antigen and another CDR containing a binding site for the molecule on the surface of an immune cell, such as but not limited to T cells, B cells, cells NK, K cells, TIL or neutrophil cells.

In certain embodiments of the invention wherein the CDRs of the modified, synthetic antibody include an amino acid sequence that immunospecifically binds to a protein antigen associated with human colon carcinoma, it is preferred that the antibody have the following characteristics: (i) that the antibody recognizes the epitopes of a protein component of the antigen, but does not recognize the epitopes of the carbohydrate component (s) of the antigen; (ii) the antigen is not detectable in normal human-tissue; and (iii) the antigen is not detectable in human carcinoma cells other than colon carcinoma cells. In other embodiments, the CDR of the modified synthetic antibody includes an amino acid sequence that immunospecifically binds to an antigen which is not detectable in human carcinoma cells other than breast carcinoma cells. In yet other embodiments the CDR of the modified synthetic antibody includes an amino acid sequence that immunospecifically binds to an antigen which is not detectable in human carcinoma cells other than ovarian carcinoma cells. . 2.1.1 MALIGNITIES Malignancies and related disorders that may be treated or prevented by administration of a Therapeutic of the invention include, but are not limited to, those listed in Table 2 (for a review of these disorders see Fishman et al. ., 1985, Medicine, 2nd edition JB Lippincott Co., Philadelphia): TABLE 3 [sic] RELATED MALIGNITIES AND DISORDERS Leukemia Acute leukemia Acute lymphocytic leukemia Acute myelocytic leukemia Myeloblastic Promyelocytic Monellitic monocytic erythroleukemia Chronic leukemia Chronic myelocytic (granulocytic) leukemia Chronic lymphocytic leukemia Polycythemia vera Lymphoma Hodgkin's disease Non-Hodgkin's disease Multiple myeloma Waldenstrom's macroglobulinemia Disease of heavy chain Solid tumors fv Sarcomas and carcinomas fibrosarcoma 5 myxosarcoma liposarcoma chondrosarcoma osteogenic sarcoma chordoma 10 angiosarcoma endotheliosarcoma linfang ^ osarcoma linfangioendoteliosarcoma sinovioma 15 mesothelioma Ewing tumor leiomyosarcoma rhabdomyosarcoma P colon carcinoma 20 pancreatic cancer breast cancer ovarian cancer prostate cancer squamous cell carcinoma 25 basal cell carcinoma adenocarcinoma sweat gland carcinoma sebaceous gland carcinoma papillary carcinoma papillary adenocarcinomas cystadenocarcinoma medullary carcinoma bronchogenic carcinoma renal cell carcinoma hepatoma carcinoma of the canal biliary choriocarcinoma seminoma embryonic carcinoma Wilms tumor cervical cancer uterine cancer testicular tumor lung carcinoma small cell lung carcinoma bladder carcinoma epithelial carcinoma glioma astrocytoma medulloblastoma craniopharyngoma ependymoma pinealoma f hemangioblastoma 5 acoustic neuroma oligodendroglioma meningioma melanoma neuroblastoma 10 retinoblastoma In specific modalities, malignancy or changes / disproliferative (such as metaplasia and dysplasia), or hyperproliferative disorders are treated or prevented in the ovary, bladder, breast, colon, lung, skin, pancreas, prostate, uterus, gastrointestinal tract , B-lymphocytes or T lymphocytes. In other specific modalities, sarcoma, melanoma, or leukemia is treated or prevented. 20 5.3.1.2 PREMALIGN STATES The Therapeutics of the invention may also be administered to treat premalignant conditions and to prevent progression to a neoplastic or malignant state, which includes, but is not limited to those conditions mentioned in Table 3. This prophylactic or therapeutic use is indicated in known conditions or that is suspected of preceding progress to neoplasia or cancer, in particular, where cell growth has occurred. Neoplasms consisting of hyperplasia, metaplasia or more specifically, dysplasia (for a review of these abnormal growth states see Robbins and Angeli, 197, Basic Pathology, 2nd edition W: B. Saunders Co., Philadelphia, pp. 68-79). Hyperplasia is a form of controlled cell proliferation that involves an increase in the number of cells in a tissue or organ, without significant alteration in structure or function. As an example, endometrial hyperplasia usually precedes endometrial cancer. Metaplasia is a form of controlled cell growth in which a type of adult or completely differentiated cells replaces another type of adult cells. Metaplasia can occur in cells of epithelial or connective tissue. Atypical metaplasia includes a somewhat disordered metaplastic epithelium. Dysplasia is usually a precursor to cancer, and is found mainly in the epithelium; it is the most disordered form of growth of non-neoplastic cells that includes a loss in the uniformity of the individual cells and in the architectural orientation of the cells. The dysplastic cells usually have abnormally large nuclei, deeply stained and present pleomorphism. Dysplasia occurs characteristically where there is chronic irritation or inflammation, and is usually found in the cervix, respiratory tract, oral cavity, and gallbladder. Otherwise, or in addition to the presence of abnormal cell growth characterized as hyperplasia, metaplasia or dysplasia, the presence of one or more characteristics of a transformed phenotype, or of a malignant phenotype, shown in vivo or shown in vi tro by a One-patient cell sample may indicate the convenience of prophylactic or therapeutic administration of a Therapeutic. As mentioned above, such characteristics of a transformed phenotype include changes in morphology, less binding to the substrate, loss of contact inhibition, loss of anchorage dependence, release of proteases, increase in sugar transport, decrease in serum requirements, expression of fetal antigens, disappearance of the cell surface protein of 250,000 dalton, etc. (see also id., on pp. 84-90 for characteristics associated with a transformed or malignant phenotype). In a specific modality, leukoplakia, hyperplastic or dysplastic lesions with benign appearance of the epithelium or Bowen's disease, a carcinoma in itself, are preneoplastic lesions that are indicative of the convenience of prophylactic intervention. In another modality, the fibrocystic disease (cystic hyperplasia, mammary dysplasia, particularly ('Adenosis (benign epithelial hyperplasia) is an indication of convenience of prophylactic intervention. In other embodiments, a patient having one or more of the following predisposing factors for malignancy is treated by administering an effective amount of the therapeutic of the invention: a chromosomal translocation associated with a malignancy (eg, the Philadelphia chromosome for chronic myelogenous leukemia, t (14,18) for follicular lymphoma, etc.), familial polyposis or Garndner syndrome (possible predecessors of colon cancer), benign monoclonal gammopathy (a possible predecessor of multiple myeloma), and a first degree kinship with people who have cancer or precancerous disease showing a Mendelian (genetic) inheritance pattern (eg, familial polyposis of the colon, Garndner syndrome, hereditary exostosis, polyendocrine adenomatosis, carcinoma medullary thyroid with amyloid and pheochromocytoma production, Peutz-Jeghers syndrome, Von Recklinghausen neurofibromatosis, retinoblastoma, carotid body tumor, cutaneous melanocarcinoma, intraocular melanocarcinoma, xeroderma pigmentosa, ataxia telangiectasia, Chediak-Higashi syndrome, albinism, Fanconi aplastic anemia and Bloom syndrome; see Robbins and Angeli, 197, Basic Patgy, 2nd edition, W. B. Saunders Co., Philadelphia, pp. 112-113) etc). In another specific embodiment, the therapeutic of the invention is administered to a human patient to prevent progression to ovarian, breast, colon, lung, pancreatic, bladder, skin, prostate, colon [sic], gastrointestinal, B lymphocytes, T or uterine lymphocytes, melanoma or sarcoma. . 3.2. TREATMENT OF INFECTIOUS DISEASES The invention also provides the methods of treating or preventing infectious diseases by administering a Therapeutic of the invention, in particular a modified immunoglobulin (or functionally active fragment thereof) that binds immuno-specifically to a infectious disease antigen or a cellular receptor for the infectious disease agent or an enzyme expressed by the infectious disease agent. As described in more detail below, infectious agents include, but are not limited to, viruses, bacteria, fungi, protozoa and parasites. In specific embodiments, infectious diseases are treated or prevented by the administration of a modified antibody of an immunoglobulin (or functionally active fragment thereof) that immunospecifically recognizes one of the following antigens of an infectious disease agent: hemagglutinin from human influenza (Genbank access No.

J02132; Air 1981, Proc Nati, Acad. Sci. USA 78: 739-743; Newton et al., 1983, Virology 128: 495-501), G glycoprotein of human respiratory syncytial virus (Genbank Access No. Z33429; Garcia et al., 1994, J. Virol; Collins et al., 1984, Proc. Nati, Acad. Sci USA 81: 783), the core protein, matrix protein or other protein of the virus of Dengue (Genbank Accession No. M19197; Hahn et al., 1988, / Virology 12: 1780), hemagglutinin of measles virus (Genbank Access No. M81899; Rota et al., 1992, Virology 188: 135-142), glycoprotein gB type 2 herpes simplex virus (Genbank Access No. M14923; Bzik et al., 198, Virology 155: 322-333), VP1 of poliovirus I (Emini et al., 1983, Nature 304; 99), HIV envelope glycoproteins 1 (Putney et al., 198, Science 234: 1392-1395), hepatitis B surface antigen (Itoh et al., 198, Nature 308: 19; Neurath et al. 198, Vaccine 4:34), diphtheria toxin (Audibert et al., 1981, Nature 289: 543), 24M epitope of streptococci (Beachey, 1985, Adv. Exp. Med. Biol. 185: 193), gonococcal pilin [sic] (Rothbar and Schoolnik, 1985, Adv. Exp. Med. Biol. 185: 247), g50 pseudorabies virus (gpD), pseudorabies virus II (gpB), gilí pseudorabies virus (gpC), glycoprotein H of the pseudorabies virus, p E-glycoprotein of the pseudorabies virus, glycoprotein 195 V.? of transmissible gastroenteritis, protein matrix of transmissible gastroenteritis, pig rotavirus 38 glycoprotein, pig parvovirus capsid protein, Serpulina hydrodisenteriae protective antigen, bovine viral diarrhea glycoprotein 55, newcastle disease virus hemagglutinin-neuraminidase, pig influenza hemagglutinin, pig influenza neuraminidase, foot and mouth disease virus, pig cra virus, swine influenza virus, African swine fever virus, Mycoplasma hi opneumoniae, rhinotracheitis virus of infectious bovine (for example, the glycoprotein E or infectious bovine rhinotracheitis virus glycoprotein G), infectious laryngotracheitis virus (eg G glycoprotein or infectious laryngotracheitis glycoprotein I glycoprotein), a La Crosse virus glycoprotein (Gonzales-Scarano and col., 1982, Virology 120: 42), neonatal bovine diarrhea virus (Matsuno and Inouye, 1983, Infection and Immunity 39: 155), equine encephalomyelitis virus of Venezuela (Mathews and Roehring, 1982, J. Immunol., 129: 273), punta toro virus [sic] (Dalrymple et al., 1981, in Replication of Negative Strand Viruses Bioshop and Compans (eds.), Elsevier, NY, p. 17), murine leukemia virus (Steeves et al., 1974, J. Virol. 14: 187), mouse mammary tumor virus (Massey and Schochetman, 1981, Virology 115: 20), core protein of hepatitis virus B and / or hepatitis B virus surface antigen or a fragment derived therefrom (see, for example, U.S. Patent Publication No. GB 2034323 A published June 4, 1980; Gane and Varmus, 1987; Ann. Rev. Biochem. 5: 51-93; Tiollais et al., 1985, Nature 317: 489-495), equine influenza virus antigen or equine herpes virus (eg, equine influenza virus type A / neuraminidase Alaska). 91, equine influenza virus type A / neuraminidase Miami 63, equine influenza virus type A / neuraminidase Kentucky 81, glycoprotein B equine herpes virus type 1, glycoprotein D equine herpes virus type 1, bovine respiratory syncytial virus antigen or bovine parainfluenza virus (for example, respiratory syncytial virus binding protein bo wine (BRSV G), bovine respiratory syncytial virus fusion protein (BRSV F), bovine respiratory syncytial virus nucleocapsid protein (BRSV N), bovine parainfluenza virus type 3 fusion protein, and bovine parainfluenza virus hemagglutinin neuraminidase type 3), glycoprotein 48 or glycoprotein 53 of bovine viral diarrhea virus. Cellular receptors that can be targeted for treatment of an infectious disease are listed in Table 3, along with the pathogen that binds to the cell receptor.

Viral diseases can be treated or prevented by the methods of the present invention which include, but are not limited to, those caused by hepatitis type A, hepatitis B, hepatitis C, influenza, varicella, adenovirus, herpes simplex type I (HSV-I), herpes simplex type II (HSV-II), rinderpest, rhinovirus, deervirus, rotavirus, respiratory syncytial virus, papilloma virus, papovavirus, cytomegalovirus, equinovirus, arbovirus, hantavirus, coxsachie virus, parotitis, measles virus, rubella virus, poliovirus, human immunodeficiency virus type I (HIV-1), human immunodeficiency virus type II (HIV-II), picornavirus, enterovirus, calicivirus, and any of the group of Norwalk virus, togaviruses (such as the virus of the Dengue), alphavirus, flavivirus, coronavirus, rabies virus, Marburg virus, ebola virus, parainfluenza virus, orthomyxovirus, bunyavirus, arenavirus, reovirus, rotavirus, orbivirus, cell leukemia virus Type I human PT, human T cell leukemia virus type II, simian immunodeficiency virus, lentivirus, polyoma virus, parvovirus, Epstein-Barr virus, human herpes virus 6, herpes cercopithecine virus 1 (virus B) and poxvirus. Bacterial diseases that can be treated or prevented by the methods of the present invention are caused by bacteria including, but not limited to, mycobacteria rickettsia, mycoplasma, Neisseria spp. (for example, Neisseria menningi tidis and Neisseria gonorrhoeae), Legionella, Vijrio cholerae, Streptococci, such as Streptococcus pneumoniae, Corynebacteria diphtheriae, Clostridium tetani, Bordetella pertussis, Haemophilus spp. (for example, influenza), Chlamydia spp., enterotoxigenic Escherichia coli. Protozoa diseases that can be treated or prevented by the methods of the present invention are caused by protozoa which include, but are not limited to, plasmodium, eimeria, leishmania, kokzidioa and trypanosoma. In the specific embodiments of the invention, the Therapeutics of the invention is administered together with an antibiotic, antifungal, antiviral or any other suitable drug useful in the treatment or prevention of the infectious disease. In a preferred embodiment, the synthetic modified antibody is conjugated to a compound effective against the infectious disease agent to which the modified, synthetic antibody is directed, for example, an antibiotic, an antifungal or antiviral. In another preferred embodiment, the modified immunoglobulin has a CDR containing a binding site for an antigen of an infectious disease agent and another CDR containing a binding site for a molecule on the surface of an immune cell, such as but not it is limited to T cells, B cells, NK cells, K cells, TIL cells or neutrophils. . 3. GENETIC TREATMENT In a specific embodiment, nucleic acids comprising a sequence encoding a modified, synthetic antibody of the invention are administered to treat or prevent a disease or disorder associated with the expression of a molecule to which the modified antibody, Synthetic binds immunospecifically. In this embodiment of the invention, the nucleic / therapeutic acid codes for a sequence that occurs within the cell (without a leader sequence) or between the cells (with the leader sequence), a modified immunoglobulin of the invention. Any of the methods for genetic treatment available in the art can be used in accordance with the present invention. Exemplary methods are described below. For general reviews of genetic treatment methods see Goldspiel et al., 1993, Clinical Pharmacy 12: 488-505; Wu and WU, 1991, Biotherapy 3: 87-95; Tolstoshev 1993, Ann. Rev. Pharmacol. Toxicol 32: 573-596; Mulligan, 1993, Science 260: 926-932; and Morgan and Aderson, 1993, Ann Rev. Biochem. 62: 191-217). Methods that are commonly used in the technique of recombinant DNA technology that can be used are described in Ausubel et al., (Eds.), 1993, Current Protocols in Molecular Biolohy, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression A Laboratory Manual, Stokton Press, NY; and in chapters 12 and 13, Dracopoli et al., (eds.), 1994, Current Protocols in Human Genetics John Wiley & Sons, NY). In one aspect, the therapeutic nucleic acid contains an expression vector that expresses the modified immunoglobulin or fragment thereof in a suitable host. In particular such a nucleic acid has a promoter operably linked to the coding sequence for the synthetic antibody, the promoter being inducible or constitutive and, optionally, tissue-specific. In another embodiment, a nucleic acid molecule is used in which sequences encoding the antibody and any other desired sequences are flanked by regions that favor homologous recombination at a desired site in the genome, thus providing intrachromosomal expression of the modified antibody (Koller and Smithies, 1989, Proc. Nati, Acad. Sci. USA 86: 8932-8935, Zijlstra et al., 1989, Nature 342: 435-438). The delivery of the nucleic acid in a patient can be direct, in which case the patient is exposed directly to the nucleic acid or nucleic acid carrier vector, or a complex or indirect supply, in which case, it is first < • transform the. cells with the nucleic acid in vi tro, then the patient is transplanted. These two approaches are known, respectively, as genetic treatment, in vivo or ex vivo. In a specific embodiment, the nucleic acid is administered directly in vivo, where it is expressed to produce the antibodies. This may be achieved by any of the numerous methods known in the art, for example, by building it as part of a suitable nucleic acid vector / expression vector and administering it so as to become intracellular, eg, by infection using a retroviral vector or other defective or attenuated viral vector (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by the use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont ), or coating with lipids or receptors on the surface of the cells or transfection agents, encapsulation in biopolymers (for example polysaccharide poly-β-l-> 4-N-acetylglucosamine, see US Patent No. 5,635,493), encapsulation in liposomes, microparticles, or microcapsules, or administering it at the link to a peptide 94 and can be determined by a person skilled in the art. . 3.4 IMMUNIZATION WITH VACCINATION The modified antibody of the present invention can be used as a vaccine in an individual in which immunity is desired for the binding site for the particular molecule or antigen. The vaccines and methods of the present invention can be used to prevent a disease or disorder, or to treat a particular disease or disorder, wherein an anti-idiotype response against a particular synthetic antibody is useful from a therapeutic or prophylactic point of view. The methods and compositions of the present invention can be used to produce a humoral and / or cell-mediated response against the synthetic antibody of the vaccine in an individual. In a specific embodiment, the methods and compositions produce a humoral response against the synthetic antibody administered in an individual. In another specific embodiment, the methods and compositions produce a cell-mediated response against the synthetic antibody administered in an individual. In a preferred embodiment, the methods and compositions produce a humoral and cell-mediated response. . 4 PHARMACEUTICAL PREPARATIONS AND METHODS OF ADMINISTRATION 5.4.1 FORMULATIONS AND ADMINISTRATION Therapeutic compositions containing a modified immunoglobulin for use in accordance with the present invention may be formulated in any conventional manner using one or more physiologically acceptable carriers or excipients. Thus, modified immunoglobulins (or functionally active fragments thereof or nucleic acids encoding antibodies or fragments) and their physiologically acceptable salts and solvents can be formulated for administration by inhalation or insufflation (through the mouth or nose) or for oral, buccal, parenteral or rectal administration. For oral administration, therapeutics may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients as binding agents (eg, pre-gelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (for example lactose, microcrystalline cellulose and calcium acid phosphate); lubricants (for example, magnesium stearate, talc or silica); disintegrators (e.g., potato starch or sodium starch glycolate); or wetting agents (for example sodium lauryl sulfate). The tablets can be coated by well-known methods. The 96 Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions or may be presented as anhydrous products for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by the conventional means with pharmaceutically acceptable additives as suspending agents (for example, sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (for example lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (for example methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavors, coloring agents and sweeteners as appropriate. Preparations for oral administration can be suitably formulated to obtain controlled release of the active compound. For oral administration, therapeutics can take the form of tablets or dragees formulated in a conventional manner. For administration by inhalation, the Therapeutics according to the present invention are conveniently supplied in the form of a spray preparation in a aerosol from pressurized containers or nebulizer, with the use of a suitable propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, * < dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to supply a measured quantity. Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator may be formulated containing a mixture of powder of the compound and a powder base suitable as lactose or starch. The . Therapeutics can be formulated for parenteral (ie, intravenous or intramuscular) administration by injection, through, for example injection of a bolus or continuous intravenous line. Formulations for injection may be presented in unit dosage form, for example, in ampoules or in containers for multiple doses with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Otherwise, the active ingredient may be in powder form for constitution with a suitable vehicle, for For example, sterile water, without pyrogens, before use. 98 Therapeutics can also be formulated in rectal compositions such as suppositories or retention enemas, for example, containing bases for traditional suppositories such as cocoa butter or other glycerides. In addition to the formulations described above, therapeutics can also be formulated as a depot preparation. These long-acting formulations can be administered by implantation (for example subcutaneous or intramuscular) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a salt poorly soluble. The modified immunoglobulins of the invention can be administered as separate compositions or as a single composition with more than one antibody bound by traditional chemical or molecular biology methods. In addition, the The diagnostic and therapeutic value of the antibodies of the invention can be increased by their use in combination with radionuclides or with toxins such as ricin or with chemotherapeutic agents such as methotrexate. The composition, if desired, may also contain minor amounts of wetting agents or emulsifiers 99 or pH buffering agents. The composition may be a liquid solution, suspension, emulsion, tablet, pill, capsule, prolonged-release formulation or powder The oral formulation may include normal carriers such as the 5 pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. In general, the ingredients are supplied separately or mixed together in the unit dosage form, for example, as an anhydrous lyophilized powder or concentrate without water in a hermetically sealed container such as an ampoule or sachet indicating the amount of the active compound. Where the composition is administered by injection, it is possible to provide an ampoule of sterile diluent for the ingredients to be mixed before administration. The invention also provides a package or kit _ Pharmaceutical containing one or more containers filled with one or more of the ingredients of the vaccine formulations of the invention. Associated with the recipient (s) may be a note in the form prescribed by a government agency regulating the manufacture, use or sale of pharmaceutical or biological products, whose note indicates the approval of the agency for the manufacture, use or sale for human administration. 100 The compositions may, if desired, be presented in a package or dosing device which may contain one or more unit dosage forms containing the active ingredient. The package can, for example, understand a sheet of metal or plastic, such as a blister pack. The package or dispensing device may be accompanied by instructions for administration. The composition containing a compound of the invention formulated in a pharmaceutical carrier compatible can also be prepared, placed in a suitable container and labeled for treatment of an indicated disorder. Many methods can be used to introduce the vaccine formulations of the invention; These include, but are not limited to, oral, intracerebral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal and by scarification routes of administration _ (scratching the top l of the skin, for example, using a bifurcated needle) or any other way normal immunization. The precise dose of the modified immunoglobulin molecule to be used in the formulation will also depend on the route of administration and the nature of the patient and should be decided according to the judgment of the patient. practitioner and the circumstances of each patient according 101 with the normal clinical techniques. An effective immunizing amount is that amount sufficient to produce an immune response to the synthetic antibody in the host for which the vaccine preparation is administered. The 5 effective dose can also be extrapolated from dose-response curves obtained from test systems in animal models. . 4.2 EFFECTIVE DOSAGE 10 The nucleic acid compounds and sequences described herein can be administered to a patient in two therapeutically effective to treat certain abnormalities or diseases such as cancers or infectious diseases. A therapeutically effective dose refers to that amount of a compound sufficient to originate a healthy benefit in the treated individual. _ The toxicity and therapeutic efficacy of the compounds can be determined by normal pharmaceutical procedures in cell cultures or experimental animals, for example, to determine LD5 (lethal dose for 50% of the population) and ED50 (the therapeutically effective dose in 50% of the population), the ratio of the dose between toxic and therapeutic effects is the therapeutic index and this can be expressed as the LD50 / ED50 ratio. It 102 they prefer compounds that have large therapeutic indices. Although it is possible to use compounds that have toxic side effects, care must be taken to design a delivery system that directs such compounds to the site of affected tissue to minimize potential damage to uninfected cells and, thereby, reduce the effects collateral The data obtained from cell culture assays and animal studies can be used in the formulation of a dosage range for human use. The dosage of these compounds is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending on the dosage form employed and the route of administration used. For any of the compounds used in the method of the invention, the therapeutically effective dose can be estimated initially from assays in cell cultures. A dose can be formulated in animal models to obtain a concentration range in circulating plasma that includes the IC50 (ie, the concentration of the test compound that achieves a medium to maximum inhibition of symptoms) as determined in the culture. cell phone. Such information can be used to determine more precisely the doses 103 useful in humans. Plasma concentrations can be measured, for example, by high performance liquid chromatography. ^ » 5.4.3 VACCINE FORMULATIONS AND ADMINISTRATION The invention also provides the vaccine formulations containing the Therapeutics of the invention, whose vaccine formulations are suitable for administration in order to produce a protective immune response (humoral). and / or mediated by cell), against certain antigens, for example, for the treatment and prevention of diseases. Adequate preparations of these vaccines include injectables, such as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquids before the injection can also be prepared. The preparation can also be emulsified, or the polypeptides can be encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, buffered saline, dextrose, glycerol, ethanol, sterile isotonic aqueous buffer or the like, and combinations thereof. Also, if desired, the The vaccine preparation may also include amounts 104 minor auxiliary substances such as wetting agents or emulsifiers, buffering agents and / or adjuvants that improve the effectiveness of the vaccine. Examples of adjuvants that may be effective include, but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L- alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanin-2- (V -2 '-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) -ethylamine. The efficacy of an adjuvant can be determined by measuring the induction of anti-idiotype antibodies directed against the injected immunoglobulin formulated with the specific adjuvant. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained-release formulation or powder. The oral formulation may include normal carriers such as the pharmaceutical grades of mannitol, lactose, magnesium starch stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. In general, the ingredients are supplied separately or mixed together in unit dosage form, for example, as a dehydrated lyophilized powder or concentrate without water in a sealed container such as an ampoule or sachet indicating the amount of the active agent . When the 105 As the composition is administered by injection, a vial of the sterile diluent can be provided so that the ingredients can be mixed before administration. In a specific embodiment, the modified lyophilized immunoglobulin of the invention is provided in a first container; a second container contains the diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol and an antiseptic (eg, 0.005% of bright green). The invention also provides a pharmaceutical pack or kit containing one or more containers filled with one or more of the ingredients of the vaccine formulations of the invention. Associated with the recipient (s) may be a note in the form prescribed by a government office that regulates the manufacture, use or sale of the pharmaceutical or biological products, whose note shows the approval On the part of the dependence on manufacturing, use or sale for human administration. If desired, the compositions may be present in a package or dispensing device that may contain one or more unit dosage forms containing the active ingredient. The package may, for example, contain metal or plastic foil, such as a blister pack. He pack or dispensing device can be accompanied by 106 instructions for administration. The composition containing a compound of the invention formulated in a compatible pharmaceutical carrier can also be prepared, placed in a suitable container and labeled for the treatment of an indicated condition. The individual to whom the vaccine is preferably administered is a mammal, most preferably a human, but it can also be a non-human animal that includes, but is not limited to cows, horses, sheep, pigs, birds (e.g. chickens) , goats, cats, dogs, hamsters, mice and rats. It is possible to use different methods to introduce the vaccine formulations of the invention; these include N, but are not limited to oral, intracerebral intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal and by scarification (scraping the upper layers of the skin, for example, using a bifurcated needle) or any other immunization route normal. In a specific embodiment, scarification is employed. The precise dose of the modified immunoglobulin molecule that can be employed in the formulation will also depend on the route of administration and the nature of the patient, and should be decided according to the judgment of the physician and the circumstances of each patient in accordance with 107 the normal clinical techniques. An effective immunizing amount is sufficient to produce a I? K 'immune response to the host-modified immunoglobulin molecule (i.e., an anti-idiotype reaction) for which the vaccine preparation is administered. Effective doses can also be extrapolated from dose-response curves obtained from test systems in animal models. 5.5 DIAGNOSTIC METHODS Modified immunoglobulins, particularly antibodies, (and functionally active fragments thereof) that bind to a specific molecule that is a member of a binding pair can be used as diagnosis and prognosis, as described herein. In different embodiments, the present invention offers the measurement of a member of the binding pair, and the uses of such measurements in clinical applications. The immunoglobulins modified in the present invention can be used, for example, in the detection of an antigen in a biological sample in which it is possible to test for patients aberrant levels of the molecule to which the modified immunoglobulin binds and / or for the presence of abnormal forms of these molecules . By levels aberrant "means increased or decreased in relation to 108 to the one presenting, or a normal level representing the one presenting in a similar sample of a portion of the body or of an individual not having the disorder. Antibodies (Modified of this invention may also be included as a reagent in a kit for use in a diagnostic or prognostic technique.) In the specific embodiments of the invention, a modified antibody of the invention that immunospecifically binds to a cancer antigen or tumor or a The antigen of an infectious disease agent can be used for diagnosis, prognosis or detection of a cancer or tumor of an infectious disease associated with the expression of the cancer or tumor antigen or the antigen of the infectious disease agent. In a preferred aspect, The invention provides a method for diagnosing or detecting the presence of or a predisposition to the development of a cancer, characterized by the increased presence of a cancer antigen, which is a first member of a binding pair consisting of the first member and one second In another embodiment, the method consists in measuring in an individual the level of immunospecific binding of a modified antibody in a sample obtained from the individual, in which the modified antibody binds immunospecifically to the cancer antigen and in which the modified antibody comprises a variable domain having at least one CDR 109 containing the portion of the second member, the portion containing a binding site for the cancer antigen and not being found naturally within the CDR, wherein an increase in the level of the immunospecific binding, relative to the level of the Immunospecific binding in an analogous sample of an individual not having cancer or a predisposition to develop cancer, indicates the presence of cancer or a predisposition for the development of cancer. In another preferred aspect, the invention provides a method of diagnosis or detection for the presence of an infectious disease agent, which is characterized by the presence of an antigen of the infectious disease agent, whose antigen is a first member of a pair of A union consisting of the first member and a second member, the method consists in measuring in an individual the level of immunospecific binding of a modified antibody in a sample obtained from the individual, in which the modified antibody binds immunospecifically with the antigen and in the which modified antibody comprises a variable domain having at least one CDR containing a portion of at least four amino acids of the second member, the portion containing a binding site for the antigen and not being found naturally within the CDR, in which an increase in the level of the union 110 immunospecific, in relation to the level of immunospecific binding in an analogous sample of an individual not having the infectious disease agent, indicates the presence of the infectious disease agent. In another preferred embodiment, the invention provides a method for detecting abnormal levels of a particular ligand or receptor in a sample obtained from an individual by comparing the immunospecific binding of a modified antibody that binds to the particular ligand or receptor in the sample with the binding immunospecific of the modified antibody in a sample having normal levels of the ligand or receptor. The measurement of a molecule that is bound by a modified antibody can be valuable in the detection and / or determination of the stage of diseases related to the molecule in an individual, in the detection of such diseases in a population, in the differential diagnosis of the physiological state of an individual and in the supervision of the effect of a therapeutic treatment on an individual. The following assays are designed to detect molecules to which the modified antibodies bind immunospecifically. In specific modalities, these diagnostic methods can be used to detect abnormalities in the level of gene expression, or abnormalities in structure 111 and / or temporal, tissue, cellular or subcellular location of the particular molecule to be tested. In tissue or cell type to be analyzed it will generally include those that are known, or that are suspected to express the particular molecule. The methods of isolating proteins that are employed herein may, for example, be such as those described in Harlow and Lane (Harlow, E. and Lane, D., 1988"Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). The isolated cells may be obtained from cell cultures or from a patient. Modified antibodies (or functionally active fragments thereof) useful in the present invention can, moreover, be used histologically, as in a microscope of immunofluorescence or immunoelectronic, for in si tu detection of the molecule. The detection in if your can be carried out separating a histological sample of a patient, ^ such as sections embedded in paraffin of affected tissues and applying a modified antibody to them, marked of the present invention. The modified antibody (or functionally active fragment thereof) is preferably applied by spreading the modified antibody, labeled on a biological sample. If the molecule to which the antibody binds is present in the cytoplasm, it can be It is desirable to introduce the modified antibody into the cell, for example, making the cell membrane permeable. By using this procedure it is possible to determine not only the presence of the specific molecule, but also its distribution in the examined tissue. By using the present invention, those skilled in the art will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified to achieve in-situ detection. Usually, assays for the specific molecule will comprise incubating a sample, such as a biological fluid, a tissue extract, freshly harvested cells or lysates of cultured cells, in the presence of a modified antibody, detectable by brand and detecting the bound antibody by any of the different techniques well known. The biological sample can be contacted with and immobilized on a solid phase or carrier support such as nitrocellulose or other solid support that is capable of immobilizing the cells, cell particles or proteins. soluble. The support can then be washed with the appropriate buffer solutions followed by treatment with the modified antibody, which can be detected with a label. The solid phase support can then be washed with the buffer solution a second times to separate the unbound antibody. The amount of 113 The united mark on the solid support can then be detected by traditional means. By "solid phase carrier or carrier" is meant any carrier capable of binding an antigen or an antibody. Well-known carriers or supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, garbos and magnetite. The nature of the carrier can be soluble to some degree or insoluble for the purposes of the present invention. The support material can have almost any possible structural configuration provided that the coupled molecules are capable of binding to an antigen or antibody. Thus, the configuration of the support can be steric, as in a bead, or cylindrical as in the internal surface of a test tube, or the external surface of a rod. Otherwise, the surface can be flat like a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know many other carriers to bind antibody or antigen, and will be able to determine them by use of routine experimentation. The binding activity of a particular modified antibody can be established according to well-known methods. Those skilled in the art will be able to determine 114 the optimal operating and test conditions for each determination using common experimentation. "* - One of the ways in which a modified antibody can be detectably labeled is by binding of the same to an enzyme and the use of an enzyme immunoassay (EIA) (Voller, a.," The Enzyme Linked Immunosorbent Assay (ELISA) ", 1978, Diagnostic Horizons 2: 1-7, Microbilogical Associates Quarterly Publication, Walkersville, MD), Voller et al., 1978, J. Clin. Pa thol., 31: 507-520, Butler, 1981 , 10 Meth, Enzymol 73: 482-523, Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, FL, Ishikawa et al., (Eds.), 1981, Eryzyme Immunoassay, Kgaku Shoin, Tokyo)) The enzyme that is bound to the modified antibody will react with a suitable substrate preferably a chromogenic substrate, in such form to produce a chemical moiety that can be detected, for example, by spectrophotometric, fluorimetric or visual means. Enzymes that can be used to detectably label the modified antibody include, but are not limited to, adas 20 a, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate 115 dehydrogenase, glucoamylase and acetylcholinesterase. Detection can be carried out by colorimetric methods • i use a chromogenic substrate for the enzyme. Detection can also be carried out by visual comparison of the degree of enzymatic reaction of a substrate compared to standards prepared in the same way. Detection can also be carried out using any of a variety of other immunoassays. For example, by radioactive labeling of the antibodies or synthetic fragments it is possible to detect the protein for which the antibody was designed by the use of a radioimmunoassay '(RIA) (see, for example, Weintraub, 1986, Principies of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography. It is also possible to label the modified antibody with a fluorescent compound. When the antibody labeled with If the fluorescence is exposed to light of adequate wavelength, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, Allococyanin, o-phthaldehyde and fluorescamine. 116 The modified antibody can also be detectably labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to antibody using metal chelating groups such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). The modified antibody can also be detectably labeled by coupling it with a chemiluminescent compound *. The presence of the antibody labeled with chemiluminescence is then determined by detecting the presence of the luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, acrominium acridinium ester, imidazole, acridinium salt and oxalate ester. In the same way, it is possible to use a compound ^ bioluminescent to label the modified, synthetic antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems, in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. The compounds important bioluminescent for marking purposes 117 they are luciferin, luciferase and aequorin. . 6 DEMONSTRATION OF THE THERAPEUTIC UTILITY The Therapeutics of the invention are preferably tested in vi tro, and then in vivo, for the desired therapeutic or prophylactic activity, before its use in humans. For example, in vitro assays that can be used to determine whether administration of a specific therapeutic is indicated include assays of cell cultures in vi tro in which suitable cells of a cell line or cultured cells of a patient having a disease or Particular disorder is exposed or otherwise administered a Therapeutic, and the effect of Therapeutic on the cells is observed. Where the Therapeutic is a modified immunoglobulin that recognizes a cancer or tumor antigen, the potential efficacy of the modified immunoglobulin can be assessed by contacting the Therapeutics with the cultured cells (of a patient or of the cultured cell line) and then assaying cell survival or growth using any of the methods known in the art, for example, cell proliferation can be assayed by measuring the 3 incorporation of H-thymidine, by direct cell count, by detecting changes in activity transcriptional 118 of genes known as protooncogenes, for example fos, myc) or cell cycle markers; the viability of the cells can be assessed by trypan blue staining, »• Differentiation can be assessed visually based on 5 changes in morphology, etc. Where the Therapeutic is a modified antibody that recognizes an antigen of an infectious disease agent or a cellular receptor for an infectious disease agent, the potential efficacy of the antibody can be assessed. by contacting the Therapeutics with the cultured cells (of a patient or the cultured cell line) that are infected with the infectious disease agent and then assaying the cells for the reduction of the infectious disease agent or by reduction in the physiological indicators of infection with the infectious disease agent. Otherwise, the Therapeutics may be tested by contacting the Therapeutics with cells (cultured from a patient or from a cultured cell line) that are susceptible to infection by the infectious disease agent but not infected with the infectious disease agent, exposing the cell to the infectious disease agent and then determining whether the rate of infection of the cells contacted with the Therapeutics was25 lower than the infection rate of the cells not 119 placed in contact with the Therapeutist. Infection of the cells with an infectious disease agent can be assayed by any of the methods known in the art.

("Technique." 5) When the Therapeutics is a modified immunoglobulin specific for a particular ligand or receptor, the potential efficacy of the modified immunoglobulin can be tested by contacting the Therapeutics with the cultured cells (of a patient or cell line). cultured) that expresses the receptor member of the binding pair and determines if the Therapeutic prevents the binding of the ligand to the receptor and / or the signaling of the receptor or if the Therapeutic simulates the signaling of the receptor. These indicators can be measured by any of the methods known in the art for measuring ligand-receptor binding and receptor signaling (eg, as exemplified in section 6). Therapeutics can also be tested for efficacy in appropriate animal models, and in studies clinical in humans. The effectiveness of the Therapeutics can be determined by any method in the art, for example, after the administration of the Therapeutics to the animal model or to the human individual, the animal or human individual is evaluated for any indicator of the disease or disorder that is intended to treat with the Therapeutics. By 120 For example, the efficacy of the Therapeutics can be assessed by measuring the level of the molecule against which the modified S antibody is directed in the animal model or human individual at appropriate time intervals before, during or after treatment. Any change or absence of change in the amount of the molecule can be identified and correlated with the effect of the treatment on the individual. The concentration of the molecule can be determined by any method known in the art, by example, by any of the immunoassay methods described in section 5.5, supra or 5.7, infra. In other respects, modified antibodies can be tested for efficacy by monitoring the individual for improvement or recovery from the disease or The particular condition associated with the molecule against which the modified, synthetic antibody was directed. When the modified antibody is directed against a tumor or cancer antigen, the progress of the particular tumor or cancer can be followed by any known method of diagnosis or detection to monitor the cancer or tumor. For example, but not as a limitation, the cancer or tumor process can be monitored by testing the levels of the cancer antigen or particular tumor (or other antigen associated with the cancer or particular tumor) in the serum of the tumor. individual or by injecting a specific labeled antibody for 121 the antigen. In addition, other imaging techniques such as computerized tomographic scanning (CT) or sonograms, or any other method of imaging can be used to monitor the progress of the cancer or tumor. It is also possible to perform biopsies. Before carrying out such tests in humans, tests for the efficacy of modified immunoglobulins can be performed in animal models of cancer or particular tumor. Where the therapeutic is specific for an antigen of an infectious disease agent or a cellular receptor of an infectious disease agent, the effectiveness of the modified antibody can be tested by administering the modified antibody to an individual (a human individual or an animal model for the disease) and then monitoring agent concentrations. the particular infectious disease or the symptoms of the particular infectious disease. The levels of the infectious disease agent can be determined by any of the methods known in the art, to assess the levels of an infectious disease agent, for example, the viral titer, in the case of a virus, or bacterial concentrations. (for example, growing a sample of a patient), etc.

The levels of the infectious disease agent can also be determined by measuring the levels of an antigen against which the modified immunoglobulin is directed. One 122 decreased levels of the infectious disease agent or a relief of the symptoms of the infectious disease indicate that the modified antibody is effective. Where the Therapeutics is administered as a vaccine, the immunopotency of a vaccine formulation containing the modified antibody of the invention can be determined by monitoring the anti-idiotypic response of the test animals after immunization with the vaccine. The humoral response can be taken as an indication of a "generalized immune response, other components of which, particularly cell-mediated immunity may be important for protection against a disease." Test animals may include mice, rabbits, Finally, since chimpanzees are a protected species, the antibody response to a vaccine of the invention can be first studied in different animals. smaller, less expensive, with the goal of finding one or two of the best candidate immunoglobulin molecules or best combinations of immunoglobulin molecules for use in chimpanzee efficacy studies.The immune response of test individuals can be analyzed by different methods such as 123 reactivity of the resulting immune serum to the antibodies, as tested by the known techniques, for example, the enzyme-linked immunosorbent assay (ELISA), immunoabsorption tests, radioimmunoprecipitations, etc .; or protection from infection and / or attenuation of disease symptoms in immunized hosts. As an example of tests on suitable animals, the vaccine composition of the invention can be tested in rabbits for the ability to induce an anti-idiotypic response to the modified immunoglobulin molecule. For example, it is possible to use New Zealand white rabbits, males, 'without specific pathogens (SPF), young adults. The rabbits test group each receives an effective amount of the vaccine. A control group of rabbits receives an injection in 1 mM Tris-HCl pH 9.0 of the vaccine containing a natural antibody. The blood samples can be extracted from the rabbits every one or two weeks, and the serum can be analyzed for the anti-idiotypic antibodies for the modified immunoglobulin molecule and the anti-anti-idiotypic antibodies specific for the antigen against which the modified antibody using, for example, radioimmunoassay (Abbott Laboratories). The presence of anti-idiotypic antibodies can be assayed using ELISA. Because rabbits can give a variable response by their nature 124 exogamic, it may also be useful to test vaccines in mice. (• 5.7 TESTS OF MODIFIED IMMUNOGLOBULINS 5 After constructing an immunoglobulin having one or more CDRs containing a binding site for a specific molecule, it is possible to use any binding assay known in the art to assess the binding between the resulting modified antibody and the specific molecule.

These assays can also be performed to select antibodies that • have a higher affinity or specificity for the specific antigen. For example, but not as a limitation, the binding of the modified antibody to the specific molecule can be tested using the different immunoassays known in the art including, but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays ELISA (enzyme-linked immunosorbent assay), immunoassays "sandwich", immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, immunoassays in situ (using colloidal gold, enzymes or radioisotope labels, for example), western absorption assays, precipitation reactions, assays agglutination (for example, the agglutination tests in 125 gel, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays and immunoelectrophoresis assays, etc. In a »• modality, the antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting the binding of a secondary antibody or reagent to the primary antibody. In another embodiment, the secondary antibody is labeled. Many means are known in the art to detect the union in an immunoassay and are within the scope of the present invention. An in vitro assay system useful in assessing the binding of the modified antibody to its target molecule is described below. In short, a reaction mixture of the modified antibody and the test sample are incubated under conditions and for a sufficient time to allow the two components to interact with, for example, the union of one with the other, thus forming a complex, which may represent a transient complex Which can be separated and / or detected in the reaction mixture. These tests can be performed in different ways. For example, a method for performing such an assay would include anchoring the modified body or the test substance on a solid phase and detecting the complexes antibody / molecule anchored on the solid phase at term 126 of the reaction. In one embodiment of such a method, the modified antibody can be labeled, directly or indirectly, and the test sample can be anchored on a solid surface. In practice, it is pose to conveniently use microtiter plates as the solid phase. The anchored component can be immobilized by non-covalent or covalent bonds. The non-covalent binding can be carried out simply by coating the solid surface with a solution of the test sample and drying. To perform the test, the non-immobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are separated (eg, by washing) under conditions such that any of the complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be achieved in different ways. Where the previously non-immobilized component is pre-marked, the detection of the immobilized mark on the surface indicates that the complexes were formed. Where the previously non-immobilized component is not pre-marked, it is pose to use an indirect mark to detect the complexes anchored on the surface. Otherwise, it is pose to perform a reaction in a 127 liquid phase, separating the reaction products from the non-reactive components and detecting the complexes. ft 5.8 TRANSGENIC ANIMALS The invention also provides animals that are transgenic (ie, contain a coding nucleic acid) for a modified immunoglobulin of the invention (or a functional fragment thereof). Animals of any kind, including, but not limited to mice, rats, rabbits, guinea pigs, sheep, pigs, micro-nerves, goats and non-human primates, for example, baboons, -monos and chimpanzees can be used to generate transgenic animals of the invention. Therefore, in the specific modalities, the Invention provides recombinant non-human animals containing a recombinant nucleic acid containing a nucleotide sequence encoding a modified immunoglobulin of the invention, in particular, a recombinant non-human animal that is transgenic to a Nucleic acid encoding a modified antibody that immunospecifically binds to a cancer or tumor antigen or that is transgenic to a nucleic acid encoding a modified antibody that immunospecifically binds to an antigen of a infectious disease or a cellular receptor of an agent of 128 infectious disease. Any known technique can be used to introduce the transgene of the antibody in animals for ("Produce the founder lines of transgenic animals." 5 Techniques include, but are not limited to pronuclear microinjection (Hoppe and Wagner, 1989, US Patent No. 4,873,191); retrovirus-mediated gene transfer in germ lines (Van der Putten et al., 1985 Proc. Nati, Acad. Sci. USA 82: 6148-6152); -10 gene targeting in embryonic primordial cells (Thompson et al., 1989, Cell 56: 313-321); embryo electroporation ( Lo, '1983, Mol-Z Cell, Biol. 3: 1803-1814), and sperm-mediated gene transfer (Lavtrano et al., 1989, Cell 57: 717-723), etc. For a review of these techniques see Gordon, 1989, Transgeni c Animáis, Intl. Rev. Cytol. 115: 117-229, which is incorporated herein by reference in its entirety. The present invention provides transgenic animals that carry the nucleotide sequence encoding the antibody modified as transgene in all its cells, as well as the animals that carry the transgene in some, but not all of its cells, ie, mosaic animals. The transgene can be integrated as a single transgene or in concatamers, for example, head-to-head cascades or waterfalls head to tail. The trasgene can also be 129 selectively introduced and activated in a particular cell type following, for example, the teaching of Lasko et al., (Lasko et al., 1992, Proc. Nati. Acad. Sci. USA ("89: 6232-6236). The regulatory sequences necessary for this specific activation of the cell type will depend on the particular cell type of interest and will be apparent to those skilled in the art. When it is desired that the nucleotide encoding the transgene of the synthetic antibody be integrated into the chromosomal site of the endogenous immunoglobulin, gene targeting is preferred. In short, when such a technique is to be used, vectors containing some nucleotide sequences homologous to the endogenous immunoglobulin are designed for the purpose of integration, through homologous recombination. with chromosomal sequences, in and disrupting the function of the nucleotide sequence of the endogenous immunoglobulin gene. The frangen can also be selectively introduced into a specific cell type, thus inactivating the endogenous immunoglobulin in only this cell type, for example, following the teaching of Gu et al., (Gu et al., 1994 Science 265: 103-106). The regulatory sequences necessary for such specific inactivation of the cell type will depend on the specific cell type of interest and will be apparent to those skilled in the art. 25 Methods for the production of transgenic animals 130 Single copy with selected integration sites are also well known to those skilled in the art (see, for example, Bronson et al., 1996, Proc. Nati. Acad. Sci.

• • USA 93: 9067-9072). Once the transgenic animals have been generated, it is possible to assay the recombinant antibody gene using standard techniques. The initial detection can be carried out by Southern blot analysis or the PCR techniques to analyze animal tissues to test if the integration of the trasngen was carried out. The level of mRNA expression of the transgene in the tissues of transgenic animals can also be assessed using techniques that include but are not limited to northern blot analysis of tissue samples obtained from the animal, analysis of in situ hybridization and RT-PCR. Samples of the tissue expressing the gene can also be evaluated immunocytochemically using antibodies specific for the transgenic product of the antibody. 6 EXAMPLE: MODIFIED, SYNTHETIC ANTIBODIES, CONTAINING BRADICININ This example describes the construction of modified, synthetic antibodies that bind immunospecifically to the bradykinin (BR) receptor. The bradykinin receptor is binds to a native ligand known as bradykinin. The 131 BR-bradykinin interaction is an example of a binding pair that can be used in the methods of the invention. The BR-bradykinin interaction occurs when the amino acids in bradykinin, known as the binding site, make contact with the bradykinin receptor. The modified, synthetic antibodies of this example contain amino acids obtained from the bradykinin binding site. These modified, synthetic antibodies, therefore, mimic the bradykinin ligand and bind predictably to the bradykinin (BR) receptor. Six modified, synthetic antibodies were constructed, containing bradykinin sequences and were shown to bind to BR as constructed as described below. The strategy for producing modified, synthetic antibodies containing bradykinin binding sequences is outlined as follows: 1) using oligonucleotides, a variable region gene was engineered to contain a CDR with a bradykinin binding sequence; 2) the manipulated variable region gene was then inserted into expression vectors of a mammal containing the appropriate constant regions; 3) a vector containing the light and heavy chains was transfected into mammalian cells and the synthetic modified antibody was expressed; and 132 4) modified, synthetic antibodies were tested for BR binding. (6.1) CONSTRUCTION OF THE VARIABLE REGION GENE CONTAINING THE BRADICININ UNION SITE To construct the variable region gene coding for a CDR containing the bradykinin binding site, the following strategy was performed: First, the single-stranded oligonucleotides were tempered to create double-stranded, cohesive DNA fragments (as in the diagram of Figure 5, step 1, see also, Kutemeer et al., 1994 BioTechniques 17: 242). Specifically, oligonucleotides of approximately 80 bases in length corresponding to the sequences of interest with overlapping regions of 20 bases were synthesized using automated techniques from GenoSys Biotech Inc. The specific sequences of these oligonucleotides are presented in Figures 6A and B (for the construction of the light chain variable regions and heavy, respectively). Figure 6A lists the sequences of the oligonucleotides used in the manipulation of the variable region genes of the light chain containing a bradykinin unioh sequence. Figure 6B lists the sequences of the oligonucleotides used in the manipulation of the variable region genes of the chain 133 heavy containing a bradykinin binding sequence. The combination of the oligos used to manipulate the six CDRs of bradykinin (BKCDR1, BKCDR2, BKCDR3, BKCDR4, BKCDR5, BKCDR6) as well as the two consensus regions (ConVL1 and ConVH1) 5 are mentioned in Table 5. ut < -? Table 5 Oligonudeotides used in the manipulation of modified, synthetic antibodies, with bradynamine sequence. Name Oligol Oligo 2 Olgol Oligo 4 Oligo S? Llgo6 Oligo 7 Oligo 8 Oligo 9 OligolO OHgol l Oligol 2 ConVl Ll UKLCI BKLC2 BKLC3 BKLC4 BKLC5 BKLC6 BKLCT DKLCt BKLC9 BKLCIO or BKCDHI Ll BKLCI DKLCDRI2 BKLCJ BKLC4 DK1.CJ, BKLC6 BKLC7 BK1.C8 BKLCDRI9 BKJLCIO or BKCDRI Ll BKI.CI BKI.C2 BKI. UR21 BKLC4 DKLC5 BKLC6 BKLC7 BKLC4 BKLC4 BKLC9 BKLCR BKLCCI BKLCCI BKLCCI BKLCC BKLC9 BKLC9 BKLC9 BKLC9 BKLC9 BKLCC BKLCC BKLIC2 BKICC BKIIC4 BKIIC5 BKIIC5 BKIIC6 BKIIC6 BKIIC7 DK11C8 BK1IC9 BKIIIC 10 BKCDR4 BKIICI B IIOR4. DK1IÜR43 B IIC4. ÜKIIC5 n ??? c6 BKIIC7 BKIICS BK1IDR49 DK1ICI0 BKCDRS DK1ICI BKIIC2 UKIIDR5) HKIIC4 BKIIC5 BKIIC6 BKIICT UKHURJI BK1IC9 DKJICIO BKCDRC BK1ICI B IIC2 BICHO BK1IC4 BK1ICS BKIIC8 BKIIC7 BKJICÍ BKIIC9 BKIIC10 135 To combine the oligos in the desired gene, groups of 10 or 12 oligos were used to manipulate a variable region I) t gene as described below. Each ? oligonucleotide was phosphorylated at the 5 'position as follows: 25 μl of each oligo was incubated for one hour in the presence of T4 polynucleotide kinase and 50 mM ATP at 37 ° C. The reactions were interrupted by heating for five minutes at 70 ° C followed by precipitation with ethanol. Once phosphorylated, the complementary oligonucleotides (oligo 1 10 + oligo 10, oligo 2 + oligo 9, oligo 3 + oligo 8, oligo 4 + oligo 7, oligo 5 + oligo 6) as shown in Figure 5, were then mixed. 'sides in sterile and tempered microcentrifuge tubes by heating the tube in a 65 ° C water bath for five minutes followed by cooling to room temperature for 30 minutes. The tempering gave rise to double-stranded DNA fragments, short with cohesive ends. Next, the double-stranded, cohesive DNA fragments were ligated into longer strands (Figure 5), 136 a variable chain reaction li was containing sequence 137 of bradykinin; BKCDR4, a heavy chain variable region containing bradykinin sequence in CDR4; BKCDR5, a ¿a (heavy chain variable region containing bradykinin sequence in CDR5; and BKCDR6, a heavy chain variable region containing bradykinin sequence in CDR6.) The sequences of the eight manipulated variable region genes are shown in Figures 4A through 4F. one of the manipulated genes prepared by combining the oligonucleotides was treated as follows: The resulting manipulated variable region gene was purified by gel electrophoresis to remove excess unbound oligomylotides and other incomplete DNA fragments, the bound product was run on 1% low melting point agarose gel at constant 110 V for two hours. The main band containing the full-length DNA product was cut and placed in a sterile 1.5 ml centrifuge tube. To release the DNA from the agarose, the slice of the gel was digested with f3-Agrase I at 40 ° C for three hours. The DNA was recovered by precipitation with 0.3 M NaOAc and isopropanol at -20 ° C for one hour followed by centrifugation at 12,000 rpm for 15 minutes. The purified DNA package was resuspended in 50 μl of TE buffer, pH 8.0. The manipulated variable region gene was then amplified by PCR.

Specifically, 100 ng of the variable region gene 138 manipulated were mixed with 25 mM dNTP, 200 ng of the primers and 5U of Pfu DNA polymerase thermostable, high * fidelity, in buffer. The DNA was purified for 28 cycles. The resulting PCR product was analyzed in 1% agarose gel. Each purified DNA corresponding to the manipulated variable region genes was subsequently inserted into the bacterial vector pUC19. PUC19 is a plasmid vector of E. coli with a high copy number of 2686 base pairs containing a 54-base pair polylinker cloning site in the lacZ selection marker and an Amp. To prepare the vector for insertion of the manipulated variable region gene, 10 μg of pUC19 were linearized with Hinc II (50 U) for three hours at 37 ° C giving rise to a vector with 5 'GTC blunt end sequences. To avoid self-ligation again, the linear vector DNA was dephosphorylated with 25 U of alkaline phosphatase of the intestine ^ of bovine (CIP) for one hour at 37 ° C. To insert the - * gene of variable region manipulated in the vector pUC19, Approximately 0.5 μg of the dephosphorylated linear vector DNA was mixed with 3 μg of the phosphorylated variable region gene in the presence of T4 DNA ligase (1000 U) and incubated at 16 ° C for 12 hours. The bacterial vector containing the manipulated variable region gene was then used to transform 139 bacterial cells. Specifically, freshly prepared, competent DH5-a cells, 50 μl, were mixed with 1 μg of pUC19 containing the manipulated variable region gene and transferred to an electroporation tube (0.2 cm space, Bio-Rad). Each tube was pulsed at 2.5 kV / 200 ohm / 25 μF in an electroporator (Bio-Rad Gene Pulser). Immediately afterwards, 1 ml of the SOC medium was added to each tube and the cells were allowed to recover for one hour at 37 ° C in centrifuge tubes. An aliquot of cells from each transformation was separated, diluted 1: 100, then 100 μl plated on LB plates containing ampicillin (Amp 40 μg / ml). The plates were incubated at 37 ° C overnight due to the presence of the Amp marker. Only the transformants containing the vector pUC19 grew on the LB / Amp plates. A single colony of transformants was selected and grown overnight in a sterile 3 ml LB / Amp glass tube with constant agitation at 37 ° C. The plasmid DNA was isolated using Easy prep columns. (Pharmacia Biotech) and suspended in 100 μl of TE buffer, pH 7.5. To confirm the presence of the gene insert in pUC19, 25 μl of the plasmid DNA from each colony was digested with restriction endonuclease Hinc II for one hour at 37 ° C, and analyzed on a 1% agarose gel. By this method the plasmid DNA containing the gene insert was resistant to enzymatic cleavage due to the loss of the restriction site (5 '..GTCGAC..3') and migrated as a closed circular DNA (CC), whereas the plasmids without insert were unfolded and migrated as a linear double-stranded DNA fragment ( L) on the gel. To confirm the correct gene sequences of the manipulated variable region genes and eliminate the possibility of unwanted mutations generated during the construction procedure, DNA sequencing was performed using the M13 / pUC reverse primer. (5'AACAGCTATGACCATG 3 ') for the clones as well as for the gene products * of the PCR using the primer of 20 bases of 5' end (5 'GAATTCATGGCTTGGGTGTG 3') in the automated ABI 377 DNA sequencer. All clones were confirmed with correct sequences. Six manipulated variable region genes that contained the bradykinin sequence were constructed by the methods of this Example. The name of the modified, synthetic antibody and the location corresponding to the bradykinin binding sequence within the variable region gene are shown in Table 6. For example, the synthetic antibody termed hAbBKCDR1 contained the bradykinin binding sequence (BK) in the CDR1 of the variable region light chain (VL) gene. This synthetic antibody had a consensus sequence (con) in the gene of 141 variable region heavy chain (VH) Table 6. Synthetic Modified Antibodies Containing C «bradykinin Name of the antibody VL V? modified, synthetic hAbBKCDRl BKCDR1 ConVHl hAbBKCDR2 BKCDR2 ConVHl hAbBKCDR3 BKCDR3 ConVHl hAbBKCDR4 ConVLl BKCDR4 hAbBKCDR5 ConVLl BKCDR5 hAbBKCDRd ConVLl BKCDR6 The amino acid sequences corresponding to the variable regions of each of the six synthetic, modified antibodies of this example are listed in Table 7. The CDRs are shown in bold type. The amino acids of the bradykinin binding site are: ArgProProGlyPheSerProPheArg and are indicated in underlined CDRs. Table 5 also illustrates the consensus sequence of a gene from subgroup I of the human kappa light chain VL and the subgroup I of the human heavy chain VH. In cases where the consensus CDR was too short to distribute the sequence of the complete bradykinin binding site, the amino terminal residues of the bradykinin binding site were deleted since the terminal carboxy residues 142 they were known to be more important in receptor binding (Stewart and Vavrek, Chemistry of peptide B2 bradykinin antagonist, pp. 5196, Burch, R.M., editor, Bradykinin Antagonist, Basin and Clinical Research, New York; Marcel Dekker, 1991; which are incorporated herein by reference). 143 Table 7. Amino acid sequences of genes with manipulated variable region Subgroup ^ L of the light chain in human kappa (Kabat et al., 1991) Amino Acid Region Consensus BKCDR1 BKCDR2 BKCDR3 1 FR1 Asp Asp Asp Asp He He He - * j Gln Gln Gln Gln 4 Met Met Met Met Thr Thr Thr 6 Gln Gln Gln Gln 7 Ser Ser Ser Pro Pro Pro Pro 9 Ser Ser Ser Ser 10 Ser Ser Ser Ser 11 Leu Leu Leu Leu / 12 Ser Ser Ser Ser 13 Ala Ala Ala Ala 14 Ser Ser Ser 15 Val Val Val Val 16 Gly Gly Gly Gly 17 Asp Asp Asp Asp 18 Arg Arg Arg Arg 19 Val Val Val Val Thr Thr Thr Thr 21 lie Thr Thr Thr Thr Thr Thr 23 Thr Th C Thr Thr Thr 24 CDR1 Arg Arg Arg Arg 25 Ala Pro Ala Ala 26 Ser Pro Ser Ser 27 (A-F) Gln £ í? Gln Gln 28 Ser Phe Ser Ser 29 He Ser lie He 144 Amino Acid Region Consensus BKCDR1 BK.CDR2 BKCDR3 30 Ser Pro Ser Ser 31 Asn Phe Asn Asn T5 Tyr Arg Tyr Tyr 33 Leu Leu Leu Leu 34? The Ala Ala Ala FR2 Tf TF Tf Tf 36 Tyr Tyr Tyr Tyr 37 Gln Gln Gln Gln 38 Gln Gln Gln Gln 39 Lys Lys Lys 40 Pro Pro Pro 41 Gly Gly Gly 42 Lys Lys Lys 43 Wing Wing Wing 44 Pro Pro Pr Pro 45 Lys Lys Lys 46 Leu Leu Leu Leu 47 Leu Leu Leu Leu 48 lie lie Lie 49 Tyr Tyr Tyr Tyr 50 CDR2 Ala Ala Pro Ala 51 Ala Ala Glv Ala 52 Ser Ser Phe Ser 53 Ser Ser Ser 54 Leu Leu Pro Leu 55 Glu Glu Phe Glu 56 Being Ser Arg Being 57 FR3 Gly. Gly Gly Gly 58 Val Val Val Val 59 Pro Pro Pro Pro 60 Being Being Being 61 Arg Arg Arg Arg 62 Phe Phe Phe Phe 63 Being Being Being 64 Gly Gly Gly Gly 65 Being Being Being 66 Gly Gly Gly Gly 67 Being Being Being 68 Gly Gly Gly Gly 69 Thr Thr Thr Thr 70 Arg Arg Arg Arg 71 Phe Phe Phe - Phe 72 Thr Thr Thr Thr 73 Leu Leu Leu Leu 74 Thr Thr Thr Thr 145 Amino Acid Region Consensus BKCDRl BKCDR2 BKCDR3 75 He lie He lie 76 Be Ser Ser 77 Be Ser Be Ser 78 Leu Leu Leu Leu 79 Gln Gln Gln Gln 80 Pro Pro Pro Pro 81 Glu Glu Glu Glu 82 Asp Asp Asp Asp r Phe Phe 83 Phe Phe 84 Wing Wing Aia 85 Thr Thr Thr Thr 86 T r Tyr Tyr Tyr 87 Tyr Tyr Tyr Tyr 88 Cys Cys Cys Cys 89 CDR3 Gin Gln Gln Arg 90 Gln Gln Gln Pro Tyr Tyr Tyr Pro 91 92 Asn Asn Asn Glv 93 Being Ser Phe 94 Leu Leu Leu Ser 95 -. 95 - (A-F) Pro Pro Pro Pro Phe 96 Trp Trp Trp 97 Thr Thr Thr Arg 98 FR4 Phe Phe Phe Phe 99 Giy Gly Gly Gly 100 Gin Gin Gin Gin 101 Gly Gly Gly Gly 102 Thr Thr Thr Thr 103 Lys Lys Lys Lys 104 Val Val Val Val 105 Glu Glu Glu Glu 106 He He He He 107 Lys Lys Lys Lys 108 Arg Arg Arg Arg 109 Thr Thr Thr Thr Subgroup 1 V "of the heavy chain in human (Kabat et al., 1991) Amino Acid Region Consensus BKCDR4 BKCDR5 BKCDR6 FR1 Gln GIn Gln Gln 2 Val Val Val Val Gln Gln Gln 3 Gln 4 Leu Leu Leu Leu l Val Val Val 5 Va 146 Amino Acid Region Consensus BKCDR4 BKCDR5 BKCDR6 6 Gln Gln Gln Gln 7 Being Being Being 8 Gly Gly Gly Gly 9 Ala Ala Ala Ala Glu Glu Glu Glu 11 Val Val Val Val 12 Lys Lys Lys Lys 13 Lys Lys Lys Lys 14 Pro Pro Pro Pro Gly Gly Gly Gly 16 Ala Ala Ala Ala 17 Being Being Being 18 Val Val Val Val 19 Lys Lys Lys Lys Val Val Val Val 21 Being Being Being 22 Cys C > s Cys Cys 23 Lys Lys Lys Lys 24 Ala Ala? La Ala Being Being Being 26 / Gly Gly Gly Gly 27 Tyr Tyr Tvr Tyr 28 Thr Thr Thr Thr 29 Phe Phe Phe Phe Thr Thr Thr Thr 31 CDR4 Ser Pro Ser Ser 32 Tyr GJv Tyr Tyr Ala Phe Ala Ala 34 I have been He (A-B) Be Pro Be Ser 35A Trp Phe Trp Trp 35B Asn Arg Asn Asn 36 FR2 TF TF TF T 37 Val Val Val Val 38 Arg Arg Arg Arg 39 Gln Gln Gln Gln 40 Ala Ala Ala Ala 41 Pro Pro Pro Pro 42 Gly Gly Gly Gly 43 Gln Gln Gln Gln 44 Gly Gly Gly Gly 45 Leu Leu Leu Leu 46 Glu Glu Glu Glu 47 TF TF TF TF 48 Met Met Met Met 147 Amino Acid Region Consensus BKCDR4 BKCDR5 BKCDR6 ly 49 Gly Gly Gly G 50 CDR5 Trp Trp Trp Trp 51 He He He lie 52 (AC) Asn Asn Asn Asn Gly Gly 53 Gly Gly Asn 54 Asn Asn Lys 39 Lys Lys Lys 40 Pro Pro Pro 41 Gly Gly Gly Gly 42 Lys Lys Lys 43 Wing Wing Wing Wing 44 Pro Pro Pro 45 Lys Lys Lys 46 Leu Leu Leu Leu 47 Leu Leu Leu He He He 48 He yr 49 Tyr Tyr Tyr T Ala 50 CDR2 Ala Wing Pro 51 Wing Ala GJ? Wing 52 Ser Ser Phe Ser 53 Ser Ser Ser 54 Leu Leu Pro Leu 55 Glu Glu Phe Glu 56 Ser Ser Are 57 FR3 Gly Gly Giy Gly 58 Val Val Val 59 Pro Pro Pro 60 Ser Ser Ser 61 Arg Arg Arg Arg 62 Phe Phe Phe Phe 63 Being Being Being 64 Gly Gly Gly Gly 65 Being Being Being 66 Gly Gly Gly Gly 67 Being Being Being 68 Gly Gly Gly Gly 69 Thr Thr Thr Thr 70 Arg Arg Arg Arg 71. Phe Phe Phe Phe • 72 Thr Thr Thr Thr 73 Leu Leu Leu Leu 74 Thr Thr Thr Thr 75 He He He He Is Being Being Ser 76 77 Being Being Being 148 Amino Acid Region Consensus BKCDR4 BKCDR5 BKCDR6 78 Leu Leu Leu Leu 79 Gln Gln Gln Gln 80 Pro Pro Pro Pro 81 Glu Glu Glu Glu 82 Asp Asp Asp Asp 83 Phe Phe Phe Phe 84 Ala Ala Ala Ala 85 Thr Thr Thr Thr 86 Tyr Tyr Tyr Tyr 87 Tyr Tyr Tyr Tyr 88 Cys Cys Cys Cys 89 CDR3 Gln Gln Gln? Rg 90 Gln Gln Gln Pro 55 Gly Gly Ero Gly 56 Asp Asp Pro Asp 57 Thr Thr C] and Thr 58 Asn Asn Phe Asn 59 Tyr Tyr Ser Tyr 60 Ala Ala Ala Ala 61 GIn Gln Phe Gln / 62 Lys Lys Arg Lys 63 Phe Pne Phe Phe 64 Gln Gln Gln Gln 65 Gly Gly Gly Gly 66 FR3 Arg Arg Arg -Arg 67 Val Val Val Val 68 Thr Thr Thr Thr 69 He He He He 70 Thr Thr Thr Thr 71 Ala Ala Ala Ala 72 Asp Asp Asp Asp 73 Thr Thr Thr Thr 74 Being Being Being 75 Thr Thr Thr Thr 76 Being Being Being 77 Thr Tro- Thr Thr 78 Ala Ala Ala Ala 79 Tyr Tyr Tyr Tyr 80 Met Met Met Met 81 Glu Glu Glu Glu 82 (A-C) Leu Leu Leu Leu 82A Being Being Being 82B Being Being Being 82C Leu Leu Leu Leu 149 150 Amino Acid Region Consensus BKCDR4 BKCDR5 BKCDR6 109 Val Val Val Val 110 Thr Tro- Thr Thr (• 111 Val Val Val Val 112 Being Being Being 113 Being Being Being 6. 2 INSERTING THE MANIFOLDED VARIABLE REGION GENE INTO A MAMMER EXPRESSION VECTOR A complete antibody light chain has a region variable and a constant region. A heavy chain of whole antibody contains a variable region, a constant region and a 'hinge region. To construct light chains and complete heavy chains, the modified variable region genes manipulated in the above were then inserted into vectors containing the appropriate constant region. Variable region genes manipulated with bradykinin sequence inserted into a light chain CDR were inserted into vector pMRROlO.l (Figure 3A), which contains a constant region of light chain kappa human. The insertion of the variable region of the light chain manipulated in this vector provided a complete light chain sequence. Otherwise, variable region genes manipulated with the bradykinin sequence inserted into a heavy chain CDR were inserted into the the vector pGAMMAl (Figure 3B), which contains the region 151 constant of human IgGl and hinge region sequences. The insertion of the variable region gene of the heavy chain ^ (t manipulated in this vector gave rise to a complete heavy chain sequence.) To manipulate a mammalian vector encoding a complete antibody, a complete heavy chain sequence and light chain sequence were inserted into a single vector of expression of mammal (Bebbington, CR, 1991 in METHODS: A Companion to Methods in Enzymology, vol. 2, pp. 136-145). The resulting vector encoded a light chain and a heavy chain of the antibody and was designated pNEPuDGV (Figure, 3C). 6. 3 EXPRESSION OF MODIFIED, SYNTHETIC ANTIBODIES IN 15 MAMMALIAN CELLS To examine the production of assembled antibodies, the pNEPuDGV vector was transfected into cells COS. COS cells (a line of African green W monkey kidney cells, CV-1, transformed into an SV40 virus defective origin) were used for the transient short-term expression of synthetic antibodies due to their ability to replicate circular plasmids containing an SV40 origin of replication for a very high copy number. The expression vector of the antibody was transfected into COS7 cells (obtained from the American Type 152 Culture Collection) using calcium precipitation (Sullivan et al., FEBS Lett 258: 120-123, 1991). The transfected cells were grown in Eagle's modified medium UP Dubelcco and cultured for 72 hours after which 5 supernatants containing the antibodies with bradykinin were collected. The supernatants of the transfected COS cells were assayed using the ELISA method for assembled IgG. The ELISA method includes the capture of samples and standards in a 96-well plate wells coated with an anti-human IgG Fc. The assembled, bound IgG was detected with an antihuman kappa chain attached to horseradish peroxidase (HRP) and tetramethylbenzidine substrate (TMB). The color development was proportional to the amount of the assembled antibody present in the sample. 6. 4 MODIFIED, SYNTHETIC ANTIBODIES, CONTAINING BRADICININ IMITATE THE BRADICININ LIGANDS AND JOIN THE BRADICININ RECEPTOR 20 Modified, synthetic antibodies, engineered to contain bradykinin binding sequences, were predicted to mimic the bradykinin ligand and bind to the bradykinin receptor (BR ). To confirm that these modified, synthetic antibodies bind to BR, the synthetic antibodies were tested in a 153 assay binding to the bradykinin receptor. The test to examine the binding of the synthetic antibody to BR was performed in the following manner. SV-T2 cells were transformed by fibroblasts that express approximately 3,000 bradykinin (BR) receptors per cell. The stimulation of the bradykinin receptors on the SV-T2 cells gave rise to a rapid increase in the synthesis of PGE2 that is proportional to the binding of bradykinin. Therefore, the PGE2 released in the medium is indicative of receptor binding. As shown in Figure 7A, the synthesis of PGE2 was stimulated approximately four times by the addition of 1 nM bradykinin (ligand). The synthesis of PGE2 was / quantified by ELISA. The HOE-140 receptor antagonist was also examined in Figure 7A. The addition of HOE-140 and bradykinin or HOE-140 alone did not cause the synthesis of PGE2. In addition, as shown in Figure 7B, the modified antibodies, expressed, were tested for their ability to bind and stimulate the bradykinin receptor. The medium of COS cells transfected with an antibody expression vector pNEPuDGV1 encoding hABBKCDR3, hABBKCDR4, hABBKCDR5, or consensus was used to stimulate bradykinin receptors in SV-T2 cells. Synthetic antibodies having the variable chain regions BKCDR3 and BKCDR5 stimulated the synthesis of PGE2 in a dose-dependent manner. The BKCDR4, the 154 medium ConVH alone, HOE-140 did not stimulate the synthesis of PGE2 (Figures 7B). The lack of synthesis of PGE 2 by cells exposed to BKCDR4 was probably attributed to the fact that % # that the CDR4 consensus sequence was too short to accommodate the entire bradykinin binding sequence. Table 6 shows the comparison of the amino acid sequences of the consensus CDR and the BKCDR sequences. It was shown that the modified, synthetic antibodies BKCDR3 and BKCDR5 carry out binding to the receptor against native ligand bradykinin.

As shown in Figure 7C, the addition of bradykinin stimulated the synthesis of PGE2 four times (second left bar). The addition of BKCDR3 or BKCDR5 to cells pre-stimulated with native bradykinin inhibited the synthesis of PGE2 stimulated by bradykinin. 15 Table 8 Consensus CDR3: Gln Gln Tyr Asn Ser Leu Pro Trp Thr BKCDR3: Arg Pro Pro Gly Phe Ser Pro Phe Arg CDR4 consensus: Ser Tyr Ala lie Ser Trp Asn BKCDR4: Pro Gly Phe Ser Pro Phe Arg Consensus CDR5: Trp lie Asn Gly Asn Gly Asp Thr ñsn Tyr Ala Gln Lys Phe Gln Gly BKCDR5: Trp lie Asn Gly Arg Pro Pro Gly Phe Ser Pro Phe Arg Phe Gln Gly 25 155 Taken together, these results indicate that the modified antibodies containing the bradykinin binding site were able to bind to the bradykinin receptor.The present invention is not limited in scope by the specific embodiments described herein. Some modifications of the invention in addition to those described therein will be apparent to those skilled in the art from the aforementioned description and the accompanying figures, such modifications being proposed to fall within the scope of the appended claims. references are mentioned herein, the descriptions of which are incorporated herein by reference in their entireties.

Claims (155)

156 CLAIMS 1. A modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the first member and not being found naturally in the CDR, the first member being a cancer antigen. 2. The modified immunoglobulin of claim 1, which is an antibody. 3. The modified immunoglobulin of claim 1, wherein the first member is a tumor antigen. 4. The modified immunoglobulin of claim 3, wherein the tumor antigen is polymorphic epithelial mucin antigen. 5. The modified immunoglobulin of claim 3, wherein the tumor antigen is protein antigen associated with human colon carcinoma. 6. The modified immunoglobulin of claim 157 3, in which the tumor antigen is a carbohydrate antigen associated with human colon carcinoma. 7. The modified immunoglobulin of the claim (* 3, in which the tumor antigen is a globule antigen 5 of human milk fat. 8. The modified immunoglobulin of claim 3, wherein the tumor antigen is an antigen for a tumor of the breast, ovary, uterus, prostate, bladder, lung, skin, pancreas, colon, gastrointestinal, B lymphocyte or 10. The modified immunoglobulin of claim 1, wherein the cancer antigen is selected from the group consisting of pan-carcinoma KS 1/4 antigen, ovarian carcinoma antigen, prostatic acid phosphate, antigen Prostate specific, p97 antigen associated with melanoma, gp75 melanoma antigen, high molecular weight melanoma antigen, prostate specific membrane antigen, carcinoembryonic antigen, human milk fat globule antigen, TAG-72 antigen, tumor-associated antigen colorectal, 20 C017-1A, GICA 19-9, CTA-1, LEA, antigen 38.13 of Burkitt's lymphoma, CD19, CD20 antigen of human B-lymphoma, CD33, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, antigen type cell surface of tumor-specific transplantation, oncofetal-alpha-25 fetoprotein L6 antigen, human lung carcinoma L20 antigen, 158 Gp37 antigen from human leukemia T cells, neoglucoprotein, sphingolipids, EGFR, HER2 antigen, < * malignant human lymphocyte APO-1 antigen, I [sic] antigen M18, M39, SSEA-1, VEP8, VEP9, Myl, VIM-D5, D? 56-22, TRA-1-85, 5 C14, F3, AH6, hapten Y, Le ?, TL5, FC10.2, gastric adenocarcinoma antigen, CO-514, NS-10, CO-43, MH2, 19.9 found in colon cancer, mucins of gastric cancer, T5A-; R24, 4.

2, Gj, DL.l. OFA-1, GH ?, OFA-2, GE :, Ml: 22: 25: 8, SSEA-3, SEA-. 10. A modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a domain Variable having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the first member and not 20 being naturally found in the CDR, the first member being an antigen of an infectious disease agent. 11. The modified immunoglobulin of claim 10 which is an antibody. 12. The modified immunoglobulin of claim 159 10, in which the agent of the infectious disease is a bacterium. 13. The modified immunoglobulin of claim t f 10, wherein the agent of the infectious disease is a 5 viruses The modified immunoglobulin of claim 10, wherein the agent of the infectious disease is a parasite. The modified immunoglobulin of claim 10, wherein the antigen for the infectious disease agent is selected from the group consisting of a Brambell receptor, an HSV-2 antigen, an antigen from a gonococcus, an antigen from Treponema pallidum, an antigen of Chlamydia tracho atis or a human papillomavirus antigen. 16. The modified immunoglobulin of claim 10, wherein the antigen for the infectious disease agent is selected from the group consisting of glycoprotein G of the human respiratory syncytial virus, Dengue virus core protein, protein matrix of the 20 Dengue virus, glycoprotein gB of herpes simplex virus type 2, diphtheria toxin, streptococcal 24M epitope, gonococcal pilin [sic], pseudorabies g50 virus, pseudorabies virus glycoprotein H, pseudorabies virus glycoprotein E, glycoprotein 195 25 of transmissible gastroenteritis, 160 matrix protein Transmissible gastroenteritis, pig rotavirus 38 glycoprotein, pig parvovirus capsid protein, Serpulina hydodisenteriae protective antigen, bovine viral diarrhea glycoprotein 55, Newcastle disease virus hemagglutinin - neuraminidase, virus glycoprotein E. infectious bovine rhinotracheitis, glycoprotein G or infectious laryngotracheitis virus glycoprotein I, a la Crosse virus glycoprotein, neonatal bovine diarrhea virus, equine herpes virus type 1 glycoprotein, herpes virus type 1 equine glycoprotein D, bovine parainfluenza virus type 3 fusion protein, and bovine parainfluenza virus type 3 hemagglutinin neuraminidase, bovine viral diarrhea virus glycoprotein 48 and bovine viral diarrhea virus glycoprotein 53. 17. The modified immunoglobulin of claim 12, wherein the infectious disease agent is selected from the group consisting of mycobacteria rickettsia, mycoplasma, neisseria spp. , Shigella, spp. Legionella, Vibrio cholerae, Stroptococci, corynebacteria diphtheriae, Clostridum tetani, Bordetella pertussis, Haemophilus spp. , Chlamydia spp. , and Escherichia coli. 18. The modified immunoglobulin of claim 13, wherein the infectious disease agent is selects from the group consisting of hepatitis type A, hepatitis C, influenza, varicella, adenovirus, herpes simplex type I, herpes simplex type II, rinderpest, echovirus, papillomavirus, papovavirus, cytomegalovirus, equinovirus, arbovirus, hantavirus, coxsachie virus, mumps virus, rubella virus, picornavirus, enterovirus, calicivirus, Nor alk group of virus, togavirus, alphavirus, flavivirus, coronavirus, rabies virus, Marbug virus, ebola virus, parainfluenza virus, orthomyxovirus, bunyavirus, arenavirus , reovirus, rotavirus, orbivirus, human T cell leukemia virus type I, human T cell leukemia virus type II, simian immunodeficiency virus, lentivirus, polyoma virus, parvovirus, Epstein-Barr virus, herpes virus human-6 , herpes virus 1 and poxvirus. 19. The modified immunoglobulin of claim 14, wherein the infectious disease agent is selected from the group consisting of plasmodium, eimeria, leishmania, kokzidioa and trypanosome, and fungi. 20. A modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain having at least one CDR in which when minus 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the first member, whose binding site does not have the sequence Asn-Ala-Asn-Pro, Asn-Val -Asp-Pro, Ser-Phe-Glu-Arg-Phe-Glu-Ile-Phe-Pro-Lys-Glu, Trh-Tyr-Gln-Arg-Thr-Arg-Ala-Leu-Val-Arg-Thr-Gly -Met-Asp-Pro, Ser-Phe-Leu-Thr-Lys-Gly-Pro-Ser and not being found naturally in the CDR, the first member being a cellular receptor for an infectious disease agent. 21. The modified immunoglobulin of claim 20 which is an antibody. 22. The modified immunoglobulin of claim 20, wherein the infectious disease agent is a bacterium. 23. The modified immunoglobulin of claim 20, wherein the infectious disease agent is a virus. 24. The modified immunoglobulin of claim 20, wherein the infectious disease agent is a parasite. 25. The modified immunoglobulin of claim 20, wherein the cellular receptor is selected from the group consisting of the LPV receptor, adenylate cyclase, 163 surface glycoproteins BDV, N-acetyl-9-0-acetylneuraminic acid receptor, highly sulfated heparin sulfate, p65, Isoreceptors containing Gal-Alpha 1-4-Gal, CD16b, Integrin Receptor VLA-2, Receptor EV, CD14, Glucoconjugate Receptors, Decay-Acceleration Factor Receptor, Extracellular Envelope Glycoprotein Receptor, GALV Receptor, CD14 Receptor, Lewis Blood Group Antigen Receptor (b), T Cell Receptor, Heparin Glycoaminoglucan Sulfate Receptor, Fibroblast growth factor receptor, CDlla, CD2, Receptor coupled to G protein, Heparin proteoglycan sulfate, Annexin II, CD13 (aminopeptidase N), N-receptor of human amino peptidase, Hemagglutinin Receptor, CR3 Receptor, Protein Kinase Receptor, Galactose N-acetylgalactosamine-Lecithin Receptor that can be inhibited, Chemokine Receptor, Annexin I, ActA Protein, CD46 Receptor, Opa Receptors Associated with Meningococcal Virulence, CD46 Receptor, Receptor the family of carcinoembryonic antigens, Bgla receptor of the family of carcinoembryonic antigens, gamma interferon receptor, gp70 glycoprotein, Rmc-1 receptor, alpha v beta 3 human integrin receptor, proteoglycan heparin sulfate receptor, CD66 receptor, integrin receptor , Protein of membrane cofactor, CD46, GM1, GM2, GM3, CD3, Ceramide, Protein 164 hemagglutinin-neuraminidase, P-erythrocyte antigen receptor, CD36 receptor, glycophorin A receptor, interferon gamma receptor, KDEL receptor, mucosal receptor homing alfa4beta7 [sic], epidermal growth factor receptor, alpha5betal integrin protein, J774 receptor non-glycosylated, CXCR1-4 receptor, CCRl-5 receptor, CXCR3 receptor, CCR5 receptor, gp46 surface glycoprotein, TNFRp55 receptor, TNFRp75 receptor, soluble interleukin-1 beta receptor. 26. A modified immunoglobulin that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain having at least one CDR in the which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the first member and not being found naturally in the CDR. 27. The modified immunoglobulin of claim 26, which is an antibody. 28. The modified immunoglobulin of claim 26, wherein the first member is a receptor. 29. The modified immunoglobulin of claim 165 26, in which the first member is a ligand. 30. The modified immunoglobulin of the claim "-> • I 26, in which the first member is a receptor agonist 5 31. The modified immunoglobulin of the claim 26, in which the first member is a receptor antagonist. 32. The modified immunoglobulin of claim 26, wherein the first member is a receptor for 10 bradykinin. 33. The modified immunoglobulin of claim 32, wherein the portion consists of the amino acid sequence Arg-Pro-Pro-Gly-Phe-Gly-Phe-Ser-Pro-Phe-Arg. 34. The modified immunoglobulin of claim 15, wherein the receptor is selected from the group consisting of an opioid receptor, a glucose transporter, a glutamate receptor, an orphanin receptor, an erythropoietin receptor, an insulin receptor. , receptor tyrosine kinase, factor receptor 20 primordial KIT cells, nerve growth factor receptor, insulin-like growth factor receptor, granulocyte colony-stimulating factor receptor, somatotropin receptor, glial-derived neurotrophic factor receptor or gp39 receptor, 25 G protein receptor and ß2 adrenergic receptor. 166 35. The modified immunoglobulin of claim 27, wherein the ligand is selected from the group consisting of cholecystokinin, galanin, IL-1, IL-2, IL-4, IL-5, IL-6, IL-11, chemokine, leptin, a protease, neuropeptide Y , neurokinin-1, neurokinin-2, neurokinin-3, bombesin, gastrin, corticotropin-releasing hormone, endothelin, melatonin, somatostatin, vasoactive intestinal peptide, epidermal growth factor, tumor necrosis factor, dopamine and endothelin. 36. The modified immunoglobulin of claim 2, 11, 21 or 22 / wherein the antibody is of a type selected from the group consisting of IgG, IgE, IgM, IgD and IgA. 37. A fragment of the modified immunoglobulin of claim 2, 11, 21 or 27, wherein the fragment can specifically bind to the first member. 38. The fragment of claim 37 wherein the fragment is selected from the group consisting of Fab, a (Fab ') 2, a heavy chain dimer, a light chain dimer and an Fv fragment. 39. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the portion is an insertion within the CDR. 40. The modified immunoglobulin of claim 167 2, 11, 21 or 27, in which the portion replaces one or more amino acids of the CDR. 41. The modified immunoglobulin of the claim * # 2, 11, 21 or 27, in which the CDR containing the portion is 5 a CDR of the germline. 42. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is a non-germline CDR. 43. The modified immunoglobulin of claim 10 2, 11, 21 or 27, wherein the portion is at least 4 amino acids. 44. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the portion is in the range of 10-20 amino acids. 45. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion contains no more than 25 amino acids. 46. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is 20 the first CDR of the variable region of the heavy chain. 47. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is the second CDR of the variable region of the heavy chain. 48. The modified immunoglobulin of claim 25 2, 11, 21 or 27, wherein the CDR containing the portion is 168 the third CDR of the variable region of the heavy chain. 49. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is the first CDR of the variable region of the light chain. 50. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is the second CDR of the variable region of the light chain. 51. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein the CDR containing the portion is the third CDR of the variable region of the light chain. 52. The modified immunoglobulin of claim 2, 11, 21 or 27, in which more than one CDR contains a portion of the binding site. 53. The modified immunoglobulin of claim 2, 11, 21 or 27, wherein a second CDR contains a second binding site for a molecule different from the first member. 54. The modified immunoglobulin of the claim 53, in which Ta different molecule of the first member is a molecule on the surface of an immune cell. 55. The modified immunoglobulin of the claim 54, in which the immune cell is a T cell, B cell, NK cell, K cell, TIL cell or neutrophil. 56. The modified immunoglobulin of claim 2, 11, 21 or 27, which has a higher specificity for the 169 first member than an antibody that occurs naturally and that binds specifically to the first member. 57. Modified immunoglobulin of the claim V 2, 11, 21 or 27, which has a greater affinity for the first 5 is a naturally occurring antibody that binds specifically to the first member. 58. The modified immunoglobulin of claim 2, 11, 21 or 27, which exhibits a binding constant for the first member of at least 2 x 10 7 M. 59. The modified immunoglobulin of the claim 2, 11, 21 or 27, wherein the antibody has a constant affinity for the first member of at least 2 x 10 M./60. The modified immunoglobulin of the claim 1, 10, 10 or 26 in which one or more cysteine residues in the variable region of the immunoglobulin forming a disulfide bridge are substituted with one or more amino acid residues that do not have sulfhydryl groups. 61. The modified immunoglobulin of claim 60, wherein at least one of the one or more residues of Cysteine is in position 23 or 88 of the variable region of the light chain. 62. The modified immunoglobulin of claim 60, wherein at least one of the one or more cysteine residues is in position 23 or 92 of the variable region 25 of the heavy chain. 170 63. The modified immunoglobulin of claim 60, wherein at least one of the amino acid residues that does not have a sulfhydryl group is an alanine. 64. A molecule containing a variable domain that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding cell for the first member and not being found naturally in the CDR, the first member being a cancer antigen. 65. A molecule containing a variable domain that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, and not being naturally found in the CDR, the at least 8 amino acids of the second member containing a binding site for the first member, the first member being an antigen of an agent. of infectious disease. 66. A molecule containing a variable domain that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the first member whose binding site does not have the sequence Asn-Ala-Asn-Pro, Asn-Val-Asp -Pro, 'Ser-Phe-Glu-Arg-Phe-Glu-Ile-Phe-Pro-Lys-Glu,' Trh-Tyr-Gln-Arg-Thr-Arg-Ala-Leu-Val-Arg-Thr-Gly -Met-Asp-Pro, Ser-Phe-Leu-Thr-Lys-Gly-Pro-Ser and not being found naturally in the CDR, the first member being a cellular receptor for an infectious disease agent. 67. A molecule containing a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the variable domain having at least one CDR in the which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member 172 containing a binding site for the first member and not being found naturally in the CDR. 68. The molecule of claim 64, 65, 66 or 67, wherein the molecule is a single-chain antibody. 69. The molecule of claim 64, 65, 66 or 67, which also contains a constant domain. 70. The molecule of claim 69, wherein the variable domain is from a mouse antibody, except for the CDR containing the portion, and the constant domain comes from a human antibody. 71. The molecule of claim 69, wherein the variable domain 'has structure regions from a human antibody and the CDRs of a mouse antibody, except for the CDR containing the portion, and in which the constant domain it's from a human antibody. 72. The molecule of claim 71, wherein the variable domain has at least one region of structure having at least one amino acid change with respect to the region of the naturally occurring structure. 73. The molecule of claim 64, 65, 66 or 67, which is fused by a covalent bond to an immunostimulatory or growth enhancing factor or a functional fragment thereof. 74. The molecule of claim 73, wherein the immunostimulatory factor is selected from the group consisting of interleukin-2, interleukin-4, interleukin-5, interleukin-6, interleukin-7, interleukin-10, interleukin-12, interleukin-15, colony G stimulating factor, tumor necrosis factor, porin, interferon gamma and antigen of NK cells and a receptor of cellular endocytosis. 75. An isolated nucleic acid containing the nucleotide sequence encoding the modified immunoglobulin of claim 1, 10, 20 or 26. 76. An isolated nucleic acid containing the nucleotide sequence encoding the molecule of claim 64, 65 , 66 or 67. 77. The isolated nucleic acid of claim 75, wherein the nucleic acid is a vector. 78. The isolated nucleic acid of claim 76, wherein the nucleic acid is a vector. 79. A cell containing the nucleic acid of claim 75, whose nucleic acid is recombinant. 80. A cell containing the nucleic acid of claim 76, whose nucleic acid is recombinant. 81. A non-human, recombinant animal containing the nucleic acid of claim 75. 82. A recombinant non-human animal containing the nucleic acid of claim 76. 83. A pharmaceutical composition containing a therapeutically or prophylactically effective amount of the modified immunoglobulin of claim 1, 10, 20 or * 26; and a pharmaceutically acceptable carrier. 84. A pharmaceutical composition containing a therapeutic or prophylactically effective amount of the molecule of claim 64, 65, 66 or 67; and a pharmaceutically acceptable carrier. 85. A pharmaceutical composition containing a therapeutically or prophylactically effective amount of the acid The nucleic of claim 75; and a pharmaceutically acceptable carrier. 86. A pharmaceutical composition containing a therapeutically or prophylactically effective amount of the nucleic acid of claim 76; and a carrier 15 pharmaceutically acceptable. 87. A pharmaceutical composition containing a therapeutically or prophylactically effective amount of the recombinant cell of claim 79; and a pharmaceutically acceptable carrier. 88. A pharmaceutical composition containing a therapeutically or prophylactically effective amount of the recombinant cell of claim 80; and a pharmaceutically acceptable carrier. 89. A vaccine composition containing an amount of the modified immunoglobulin of claim 1, 10, 175 20 or 26 sufficient to induce an immune response; and a pharmaceutically acceptable carrier. 90. A vaccine composition containing an amount £ * of the molecule of claim 64, 65, 66 or 67 5 sufficient to induce an immune response; and a pharmaceutically acceptable carrier. 91. A vaccine composition containing an amount of the modified immunoglobulin of claim 60 sufficient to induce an anti-idiotype response; and a 10 pharmaceutically acceptable carrier. 92. A method for identifying or measuring or detecting a cancer antigen in a sample to be analyzed, whose cancer antigen is a first member of a binding pair consisting of the first member and a second member, the The method comprises the steps of: a) contacting the sample for analysis with a modified immunoglobulin that can specifically bind to the cancer antigen, the modified immunoglobulin comprising a variable domain having 20 minus one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of which the second member contains a binding site for the cancer antigen and are not naturally found in the CDR, under conditions such that I can 25 specific binding of modified immunoglobulin 176 occurs to the antigen of any cancer in the sample; and b) detecting any binding that occurs from the modified immunoglobulin to the cancer antigen; wherein the detection of the binding of the modified immunoglobulin to the cancer antigen indicates the presence of the cancer antigen in the sample. 93. A method for identifying or measuring or detecting an antigen of an infectious disease agent in a sample to be analyzed, which antigen is a first member of a binding pair consisting of the first member and a second member, the method comprising the steps of: a) contacting the sample for analysis with a modified immunoglobulin capable of specifically binding to the antigen, the modified immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, wherein at least 8 amino acids of the second member contain a binding site for the antigen and are not found naturally in the CDR, under conditions such that specific binding of the modified immunoglobulin to the antigen in the sample may occur; and b) detecting any binding that occurs from the modified immunoglobulin to the antigen; where the detection of immunoglobulin binding 177 modified to the antigen indicates the presence of the antigen in the sample. 94. A method to identify or measure or detect a ligand in a sample to be analyzed, whose ligand is a first member of a binding pair consisting of the first member and a second member, the method comprises the steps of: a) contacting the sample for analysis with a modified immunoglobulin that can bind specifically to the ligand , the modified immunoglobulin comprising a variable domain having at least one CDR containing / a portion of the second member, which portion contains a binding site for the ligand and are not naturally found in the CDR, under conditions such that specific binding of modified immunoglobulin any ligand in the sample; and b) detecting any binding that occurs from the modified immunoglobulin to the ligand; wherein the detection of the binding of the modified immunoglobulin to the ligand indicates the presence of the ligand in the sample. 95. A method for identifying or measuring or detecting a receptor in a sample to be analyzed, whose receptor is a first member of a binding pair consisting of the first member and a second member, the method comprising the steps of: a) contacting the sample to be analyzed with a modified immunoglobulin that can bind < * specifically to the recipient, the modified immunoglobulin 5 comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, which at least 8 amino acids in the second member contain a binding site for the receptor and are not found naturally in the - 10 CDR, under conditions such that specific binding of the modified immunoglobulin to any receptor in the sample can occur; and b) detecting any binding that occurs from the modified immunoglobulin to the receptor; 15 wherein the detection of the binding of the modified immunoglobulin to the receptor indicates the presence of the receptor in the sample. 96. A kit for detecting a cancer antigen, whose cancer antigen is a first member of a pair of The union consisting of the first member and a second member, the kit contains in a container: a) a modified immunoglobulin that can specifically bind to the cancer antigen, the immunoglobulin comprising a variable domain having at least one 25 CDR in which at least 8 amino acids of the second 179 members have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the cancer antigen and not being found naturally in the CDR; and 5 b) a means for detecting the binding of the cancer antigen to the immunoglobulin. 97. A kit for detecting an antigen from an infectious disease agent, whose antigen is a first member of a binding pair consisting of the first member and a In the second member, the kit contains in a container: a) a modified immunoglobulin that can bind specifically / to the antigen, the immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second 15 members have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the antigen and not being found naturally in the CDR; and b) a means for detecting the binding of the antigen to the immunoglobulin. 98. A kit for detecting a cellular receptor for an infectious disease agent, whose cellular receptor is a first member of a binding pair consisting of the first member and a second member, the kit contains in a 25 container: 180 a) a modified immunoglobulin that can bind specifically to the cellular receptor, the immunoglobulin comprising a variable domain having at least one ? CDR containing a portion of the second member, the portion 5 containing a binding site for the cellular receptor, whose binding site does not have the sequence Asn-Ala-Asn-Pro, Asn-Val-Asp-Pro, Ser-Phe-Glu-Arg-Phe-Glu-Ile-Phe -Pro-Lys-Glu, Trh-Tyr-Gln-Arg-Thr-Arg-Ala-Leu-Val-Arg-Thr-Gly-Met-Asp-Pro, Ser-Phe-Leu-Thr-Lys-Gly-Pro -Ser and not being found naturally in the CDR; and b) a means for detecting the binding of the cellular receptor to the immunoglobulin. 99. A kit for detecting a ligand, which is a first member of a binding pair consisting of the first member and a second member, the kit contains in a container: a) a modified immunoglobulin that can bind specifically to the ligand , the immunoglobulin comprising a variable domain having at least one CDR 20 containing a portion of the second member, the portion containing a binding site for the ligand and not being naturally found in the CDR; and b) a means for detecting the binding of the ligand to the immunoglobulin. 25 100. A kit for detecting a receiver, which is an 181 First member of a binding pair consisting of the first member and a second member, the kit contains in a container: a) a modified immunoglobulin that can bind specifically to the receptor, the immunoglobulin comprising a variable domain having at least one CDR containing a portion of the second member, the portion containing a binding site for the recipient and not being naturally found in the CDR; and 10 b) a means for detecting the binding of the receptor to the immunoglobulin. 101. A method of diagnosis or detection for the presence of or predisposition to develop a cancer characterized by the increase in the presence of an antigen 15 of cancer, which is a first member of a binding pair consisting of the first member and a second member, the method consists of measuring in an individual the specific binding level of a modified immunoglobulin to a sample obtained from the individual, in which immunoglobulin 20 modified specifically binds to the cancer antigen and in which the modified immunoglobulin comprises a variable domain having at least one CDR in which at least 8 amino acids from the second member have been inserted therein, the at least 8 amino acids from the second 25 member containing a binding site for the antigen of 182 cancer and not being found naturally in the CDR, in which an increase in the level of specific binding, relative to the level of specific binding in a sample ("Analogous from an individual not having cancer or a predisposition to develop cancer, indicates the presence of cancer or predisposition to develop cancer." 102. A method of diagnosis or detection for the presence of an infectious disease agent. Characterized by the presence of an antigen of the infectious disease agent, whose antigen is a first member of a binding pair consisting of the first member and a second member, the method consists of measuring in an individual the specific binding level of an immunoglobulin 15 modified to a sample obtained from the individual, in which the modified immunoglobulin binds specifically to the antigen and in which the modified immunoglobulin comprises a variable domain having at least one CDR in which at least 8 amino acids of the second member have 20 inserted into it, the at least 8 amino acids of the second member containing a binding site for the antigen and not being found naturally in the CDR, in which an increase in the level of specific binding, relative to the level of specific union in a sample 25 analogous to an individual not having the agent of the 183 Infectious disease, indicates the presence of the agent of the infectious disease. 103. A method of treatment or prevention, in an individual in need of such treatment or prevention of a cancer characterized by the presence of a cancer antigen, which is a first member of a binding pair consisting of the first member and a second member, and whose cancer antigen is specifically bound by a modified immunoglobulin, the immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids from the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the cancer antigen and not being found naturally in the CDR, the method comprises administering to the individual a therapeutically or prophylactically effective amount of the modified immunoglobulin. 104. A method of treatment or prevention, in an individual in need of such treatment or prevention of an infectious disease characterized by the presence of an antigen of an infectious disease agent, which is a first member of a binding pair consisting of the first member and a second member, and whose antigen is specifically bound by a modified immunoglobulin, the immunoglobulin comprising a variable domain having 184 at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing ('A binding site for the antigen and not being found naturally in the CDR, the method comprises administering to the individual a therapeutically or prophylactically effective amount of the modified immunoglobulin.) 105. A method of treatment or prevention, in an individual in need of such treatment or prevention of * 10 a disease caused by an infectious disease agent that binds to a cellular receptor, whose cellular receptor is a first member of a binding pair consisting of the first member and a second member, and whose cellular receptor is specifically bound by an immunoglobulin 15 modified, the immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the receptor 20 cell, whose binding site does not have the sequence Asn-Ala-Asn-Pro, Asn-Val-Asp-Pro, Ser-Phe-Glu-Arg-Phe-Glu-Ile-Phe-Pro-Lys-Glu, Trh -Tyr-Gln-Arg-T r-Arg-Ala-Leu-Val-Arg-Thr-Gly-Met-Asp-Pro, Ser-Phe-Leu-Thr-Lys-Gly-Pro-Ser and not being found naturally In the CoR, the method comprises 25 administration to the individual of a therapeutic amount or 185 prophylactically effective of the modified immunoglobulin. 106. A method for modulating the activity of a first member of a binding pair, whose binding pair consists of a first and second member, the method comprises the administration of the modified immunoglobulin of claim 1, 10, 23 or 26. 107. A method of producing a modified immunoglobulin that specifically binds to cancer antigen, whose cancer antigen is a first member of a pair of The junction consisting of the first member and a second member, the modified immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted therein, the at least 8 amino acids of the Second member containing a binding site for the cancer antigen and not being naturally found in the CDR, the method consists in growing a recombinant * cell containing a nucleic acid comprising a nucleotide sequence coding for the 20 modified immunoglobulin, so that the modified immunoglobulin, encoded, is expressed for the cell. 108. A method of producing a modified immunoglobulin that binds specifically to an antigen of an infectious disease, whose antigen is a first member of 25 a joint pair consisting of the first member and a 186 second member, the modified immunoglobulin comprising a variable domain having at least one CDR in which ?? When at least 8 amino acids of the second member have been inserted in it, the at least 8 amino acids of the The second member containing a binding site for the antigen and not being naturally found in the CDR, the method consists of growing a recombinant cell containing a nucleic acid comprising a nucleotide sequence encoding the immunoglobulin. Modified, so that the modified immunoglobulin, encoded, is expressed by the cell and recover the modified / immunoglobulin, expressed. 109. A method of producing a modified immunoglobulin that binds specifically to a cellular receptor 15 of an infectious disease agent, whose cellular receptor is a first member of a binding pair consisting of the first member and a second member, the immunoglobulin α * - modified comprising a variable domain having at least one CDR in which at least 8 amino acids 20 second member have been inserted therein, the at least 8 amino acids of the second member containing a binding site for the cellular receptor, whose binding site does not have the sequence Asn-Ala-Asn-Pro, Asn-Val-Asp- Pro, Ser-Phe-Glu-Arg-Phe-Glu-Ile-Phe-Pro-Lys-Glu, Trh-Tyr-Gln-Arg-25 Thr-Arg-Ala-Leu-Val-Arg-Thr-Gly-Met -Asp-Pro, Ser-Phe-Leu- 187 Thr-Lys-Gly-Pro-Ser and not being naturally found in the CDR, the method consists of growing a cell (recombinant containing a nucleic acid comprising a nucleotide sequence that codes for the modified immunoglobulin, so that the Modified immunoglobulin, encoded, expressed by the cell and recover the modified immunoglobulin, expressed 110. A method of producing a modified immunoglobulin that specifically binds to a ligand, whose The ligand is a first member of a binding pair consisting of the first member and a second member, the modified immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted into the 15, the at least 8 amino acids of the second member containing a binding site for the ligand and not being naturally found in the CDR, the method consists of growing a recombinant cell containing a nucleic acid comprising a nucleotide sequence that 20 encodes for the modified immunoglobulin, so that the modified immunoglobulin, encoded, is expressed by the cell and recover the modified immunoglobulin, expressed. 111. A method of producing a modified immunoglobulin that binds specifically to a receptor, whose 25 receiver is a first member of a union pair 188 consisting of the first member and a second member, the modified immunoglobulin comprising a variable domain having at least one CDR in which at least 8 amino acids of the second member have been inserted into the 5 itself, the at least 8 amino acids of the second member containing a binding site for the receptor and not being naturally found in the CDR, the method consists of growing a recombinant cell containing a nucleic acid comprising a nucleotide sequence that 10 encode for the modified immunoglobulin, so that the modified immunoglobulin, encoded, is expressed by the cell and recover the modified immunoglobulin, expressed. 112. A method of producing a nucleic acid encoding the modified immunoglobulin of the Claim 1, 10, 20 or 26, consists of: a) synthesizing a series of oligonucleotides, the series comprising the oligonucleotides containing a portion of the nucleotide sequence encoding the modified immunoglobulin and the oligonucleotides 20 containing a portion of the nucleotide acid sequence [sic] which is complementary to the nucleotide sequence encoding the modified immunoglobulin, and each of the oligonucleotides having overlapping end sequences with another oligonucleotide of the 25 series, except for those oligonucleotides containing 189 the nucleotide sequences encoding the N-terminal and C-terminal portions of the modified immunoglobulin; ? b) allow the oligonucleotides to hybridize between yes; and c) ligating the hybridized oligonucleotides, so as to produce a nucleic acid containing the nucleotide sequence encoding the modified immunoglobulin. 113. A method of producing a modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain having at least one 15 CDR containing a portion of the second member, the portion containing the binding site for the first member and not being naturally found in the CDR, the first member being a cancer antigen, the method comprising: a) growing a recombinant cell containing a nucleic acid produced by the method of the claim 112 so that the modified, encoded immunoglobulin is expressed by the cell; and b) recovering the modified immunoglobulin, expressed. 114. A method of producing an immunoglobulin 25 modified that binds specifically to a first member of 190 a binding pair, whose binding pair consists of the first member and a second member, the antibody comprising a variable domain having at least one CDR containing a portion of the second member, the portion containing the binding site for the first member and not being naturally found in the CDR, the first member being an antigen of an infectious disease agent, the method comprises: a) growing a recombinant cell containing a nucleic acid produced by the method of claim 112 so that the modified immunoglobulin, encoded is expressed by the cell; and b) recovering the modified immunoglobulin, expressed. 115. A method of producing a modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the antibody comprising a variable domain having at least one CDR containing a portion of the second member, the portion containing the binding site for the first member whose binding site does not have the sequence Asn-Ala-Asn-Pro or Asn-Val-Asp-Pro and not being naturally found in the CDR, the first member 'being a cellular receptor for an infectious disease agent, the method comprises: a) growing a recombinant cell containing a nucleic acid produced by the method of claim 191 112 so that the modified, encoded immunoglobulin is expressed by the cell; and b) recovering the modified immunoglobulin, expressed. 116. A method of producing a modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the antibody comprising a variable domain having at least one CDR containing a portion of the second member, the portion containing the binding site for the first member and not being naturally found in the CDR, the first member being a ligand, the method comprises: a) growing a recombinant cell containing a nucleic acid produced by the method of claim 112 so that the modified, encoded immunoglobulin is expressed by the cell; and b) recovering the modified immunoglobulin, expressed. 117. A method of producing a modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the antibody comprising a variable domain having at least one CDR containing a portion of the second member, the portion containing the binding site for the first member and not being naturally found in the CDR, the first member being a receptor, the method comprises: a) growing a recombinant cell containing a M nucleic acid produced by the method of the claim V.r 112 so that the modified immunoglobulin, encoded 5 is expressed by the cell; and b) recovering the modified immunoglobulin, expressed. 118. An isolated nucleic acid produced by the method of claim 112. 119. The isolated nucleic acid of claim 118, which is a vector. 120. A modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain having at least one CDR selected from the CDR1 group. , CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 20 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a cancer antigen . 193 121. A molecule comprising a variable domain that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the molecule encoding a variable domain having at least one CDR selected from the group of CDRl, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids , / the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a cancer antigen. 122. A kit for the detection of a cancer antigen, whose cancer antigen is a first member of a binding pair consisting of the first member and a second member, the kit contains in a container: a) a modified immunoglobulin which is can bind specifically to the antigen, the immunoglobulin comprising a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a of the 194 CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 fv amino acids, when the CDR is CDR1, CDR2 or CDR3 of the variable domain of the light chain or CDR1 or CDR2 of the variable domain of the heavy chain, the portion of the second member containing a binding site for the first member not being naturally found in the CDR; and b) a means for detecting the binding of the cancer antigen to the immunoglobulin. 123. A modified immunoglobulin that specifically binds to a first member of a binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprising a variable domain. 15 having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in the - »- which portion of the CDR is replaced by a .0 portion of the second member so that after the replacement of the CDR 20 is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a disease agent 25 infectious. 195 124. A molecule comprising a variable domain that specifically binds to a first member of a pair of f \ binding, whose binding pair consists of the first member and a second member, the molecule encodes u? variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second 10 member so that after replacement the CDR is at least 20 amino acids, / the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being an infectious disease agent . 125. A kit for the detection of an infectious disease agent, whose antigen is a first member of a binding pair consisting of the first member and a second member In another embodiment, the kit contains in a container: a) a modified immunoglobulin that can bind specifically to the antigen, the immunoglobulin comprising a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the domain 25 variable of the light chain and CDRl and CDR2 of domain 196 heavy chain variable, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, when the CDR is CDR1, CDR2 or CDR3 of the variable domain of the light chain or CDR1 or CDR2 of the variable domain of the heavy chain, the portion of the second member containing a binding site for the first member not being naturally found in the CDR; and b) a means for detecting the binding of the antigen to the immunoglobulin. 126. A kit for the detection of a cellular receptor of / μn infectious disease agent, whose cellular receptor is a first member of a binding pair consisting of the first member and a second member, the kit contains in a container: a) a modified immunoglobulin that can bind specifically to the cellular receptor, the immunoglobulin comprising a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain , in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, when the CDR is CDR1, CDR2 or CDR3 of the variable domain of the light chain or CDR1. or CDR2 of domain 197 heavy chain variable, the portion of the second member containing a binding site for the first non-limiting member being naturally found in the CDR; and b) a means for detecting the binding of the cellular receptor to the immunoglobulin. 127. A modified immunoglobulin that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of / CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 15 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a recipient. 128. A modified immunoglobulin that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain. having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and ^^ CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 5 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a ligand. 129. A modified immunoglobulin that binds / specifically to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one selected CDR from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and ^ CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 20 of the second member so that after replacement of the CDR be at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being an agonist of the receptor. 199 130. A modified immunoglobulin that binds specifically to a first member of a ligand-receptor binding pair, whose binding pair consists of the first (< • member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 10 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a receptor antagonist. . 131. A modified immunoglobulin that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 25 of the second member so that after the replacement the CDR 200 be at least 20 amino acids, the portion of the second member containing a binding site for the first member not being found < flk naturally in the CDR, the first member being a bradykinin receptor. 132. A molecule comprising a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 15 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a receptor. 133. A molecule comprising a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain. having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 5 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member not being found naturally in the CDR, the first member being a ligand.- 134. A molecule comprising a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 20 of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a site of binding for the first member not being naturally found in the CDR, the first member being an agonist of the recipient. 202 135. A molecule comprising a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 10 of the second member so that after the The CDR replacement is at least 20 amino acids, / the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a receptor antagonist. 136. A molecule comprising a variable domain that specifically binds to a first member of a ligand-receptor binding pair, whose binding pair consists of the first member and a second member, the immunoglobulin comprises a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion 25 of the second member so that after of the replacement CDR 203 be at least 20 amino acids, the portion of the second member containing a binding site for the first member not being naturally found in the CDR, the first member being a bradykinin receptor. 137. A kit for the detection of a ligand, which is a first member of a binding pair, consisting of the first member and a second member, the kit containing in a container: a) a modified immunoglobulin that can bind specifically to the ligand, the immunoglobulin comprising / a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, when the CDR is CDR1, CDR2 or CDR3 of the variable domain of the light chain or CDR1 or CDR2 of the variable domain of the chain heavy, the portion of the second member containing a binding site for the first member not being naturally found in the CDR; and b) a means for detecting the binding of the ligand to the immunoglobulin. 138. A kit for the detection of a receiver, which is 204 a first member of a binding pair, consisting of the first member and a second member, the kit containing in a container: a) a modified immunoglobulin that can bind specifically to the receptor, the immunoglobulin comprising a variable domain having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, when the CDR is CDR1, CDR2 or CDR3 of the variable domain of the light chain or CDR1 or CDR2 of the variable domain of the heavy chain, the portion of the second member containing a binding site for the first member not being naturally found in the CDR; and b) a means for detecting the binding of the receptor to the immunoglobulin. 139. The modified immunoglobulin of claim 1, 10, 26, 123, 127, 128, 129, 130 or 131 wherein at least 10 amino acids of the second member have been inserted into the CDR. 140. The modified immunoglobulin of claim 1, 10, 26, 123, 127, 128, 129, 130 or 131 in which at least 15 amino acids of the second member have been inserted. in the CDR. 141. The modified immunoglobulin of claim 1, 10, 26, 123, 127, 128, 129, 130 or 131 in which when \ áf minus 20 amino acids from the second member have been inserted 5 at the CDR. 142. The molecule of claim 64, 65, 66, 67, 124, 132, 133, 134, 135 or 136 wherein at least 10 amino acids of the second member have been inserted into the CDR. 10 143. The molecule of claim 64, 65, 66, 67, 124, 132, 133, 134, 135 or 136 in which at least 15 / amino acids of the second member have been inserted into the CDR. 144. The molecule of claim 64, 65, 66, 67, 15 124, 132, 133, 134, 135 or 136 wherein at least 20 amino acids of the second member have been inserted into the CDR. 145. The kit of claim 96, 97, 98, 99, 100, 125, 126, 137 or 138 in which at least 10 amino acids 20 of the second member have been inserted into the CDR. 146. The kit of claim 96, 97, 98, 99, 100, 125, 126, 137 or 138 in which at least 15 amino acids of the second member have been inserted into the CDR. 147. The kit of claim 96, 97, 98, 99, 100, 25 125, 126, 137 or 138 in which at least 20 amino acids 206 of the second member have been inserted in the CDR. 148. A method of diagnosis or detection for the presence of or predisposition to develop a cancer characterized by the increase in the presence of a cancer antigen, which is a first member of a binding pair consisting of the first member and a second member, the method consists in measuring in an individual the level of specific binding of a modified immunoglobulin to a sample obtained from the individual, in which the modified immunoglobulin specifically binds to the cancer antigen and in which the modified immunoglobulin comprises a domain / variable having at least one CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site p for the first member, and not being found naturally in the CDR, in which an increase in the level of specific binding, relative to the level of specific binding in a similar sample of an individual not having the cancer or a predisposition to develop cancer, indicates the presence of cancer or predisposition to develop cancer. 207 149. A method of diagnosis or detection for the presence of an infectious disease agent (? characterized by the presence of the antigen of the infectious disease agnete, whose antigen is a first member of 5 a binding pair consisting of the first member and a second member, the method consists in measuring in an individual the level of specific binding of a modified immunoglobulin to a sample obtained from the individual, in which the modified immunoglobulin binds specifically to the Cancer antigen and in which the modified immunoglobulin comprises a variable domain having as / less a CDR selected from the group of CDR1, CDR2 and CDR3 of the variable domain of the light chain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion 15 of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member, and not being > 'found naturally in the CDR, in which an increase in The level of specific binding, relative to the level of specific binding in a similar sample of an individual not having the cancer or a predisposition to develop the cancer, indicates the presence of the infectious disease agent. 25 150. A method of treatment or prevention, in a 208 an individual in need of such treatment or prevention of a cancer characterized by the presence of a cancer antigen, whose cancer antigen is a first member of a binding pair consisting of the first member and a second member, and whose antigen cancer is specifically bound by a modified immunoglobulin, the immunoglobulin comprising a variable domain having at least one CDR selected from CDR1, CDR2 and CDR3 of the light chain variable domain and CDR1 and CDR2 from the variable domain of the 10 heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after the 'replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member, not being found Naturally in the CDR, the method comprises administering to the individual a therapeutically or prophylactically effective amount of the modified immunoglobulin. • ^ 151. A method of treatment or prevention, in an individual in need of such treatment or prevention of 20 an infectious disease characterized by the presence of an antigen of an infectious disease agent, whose antigen is a first member of a binding pair consisting of the first member and a second member, and whose antigen is specifically bound by a 25 modified immunoglobulin, the immunoglobulin comprising 209 a variable domain having at least one CDR selected from CDR1, CDR2 and CDR3 of the light chain variable domain and CDR1 and CDR2 from the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second member containing a binding site for the first member, not being naturally found in the CDR, the method comprises administering to the individual a therapeutic or prophylactically effective of the modified immunoglobulin. / 152. A method of treatment or prevention, in an individual in need of such treatment or prevention of a disease caused by an infectious disease agent that binds to a cellular receptor, whose cellular receptor is a first member of a binding pair consisting of the first member and a second member, and whose receptor is specifically bound by a modified immunoglobulin, the immunoglobulin comprising a variable domain having at least one CDR selected from CDR1, CDR2 and CDR3 of the light chain variable domain and CDR1 and CDR2 of the variable domain of the heavy chain, in which a portion of the CDR is replaced by a portion of the second member so that after replacement the CDR is at least 20 amino acids, the portion of the second 210 member containing a binding site for the first member, whose binding site does not have the sequence Asn-Ala-A ^ Asn-Pro, Asn-Val-Asp-Pro, Ser-Phe-Glu-Arg-Phe-Glu-Ile -Phe- Pro-Lys-Glu, Trh-Tyr-Gln-Arg-Thr-Arg-Ala-Leu-Val-Arg-Thr- 5 Gly-Met-Asp-Pro, Ser-Phe-Leu-Thr-Lys- Gly-Pro-Ser and not being found naturally in the CDR, the method comprises administering to the individual a therapeutically or prophylactically effective amount of the modified immunoglobulin. 153. The method of claim 148, 149, 150, 151 or 152 in which at least 10 amino acids of the second member have been inserted into the CDR. 154. The method of claim 148, 149, 150, 151 or 152 in which at least 15 amino acids of the second member have been inserted into the CDR. 155. The method of claim 148, 149, 150, 151 or 152 in which at least 20 amino acids of the second member have been inserted into the CDR. J 20