MXPA00004581A - Modified antibodies with enhanced ability to elicit an anti-idiotype response - Google Patents

Abstract

The invention relates to modified immunoglobulin molecules in which one or more variable region residues that form intrachain disulfide bonds are substituted with amino acid residues that do not contain sulfydryl groups, such that the intrachain disulfide bond does not form. Such immunoglobulin molecules have an enhanced ability to elicit an anti-idiotype response. The invention further provides for the methods of prevention and treatment of cancer and/or infectious diseases using the modified immunoglobulins of the invention.

Description

MODIFIED ANTIBODIES WITH BETTER CAPACITY TO PRODUCE AN ANTI-IDIOTIDE RESPONSE REFERENCE TO RELATED APPLICATIONS The application claims the benefit of the provisional application series No. 60 / 065,716, filed on November 14, 1997, and the provisional application number series No. 60 / 081,403, filed on April 10, 1998, which they are incorporated herein as a reference in their strengths. 1. FIELD OF THE INVENTION The present invention relates to modified immunoglobulins and vaccine compositions thereof, in which one or more variable region cysteine residues forming intrachain chain disulfide bonds have been replaced with amino acid residues that do not contain a sulfhydryl group and, therefore, do not form disulfide bonds. The present invention also relates to the use of the vaccine compositions of the invention to treat or prevent certain diseases and conditions, particularly cancers and infectious diseases. 2. BACKGROUND OF THE INVENTION 2.1 STRUCTURE OF A MUNOGLOBULI A The basic unit of the immunoglobuiin structure is a complex of four identical or identical low molecular weight polypeptides or "light" and two high molecular weight chains identical or identical. "heavy" chains, linked together by non-covalent associations and disulfide bonds. Each light and heavy chain of an antibody has a variable region at its amino terminus and a constant domain at its carboxyl terminus (Figure 1). The variable regions are different for each antibody and contain the antibody antigen binding site. Each variable domain is composed of four regions of relatively conserved structure and three regions of hypervariability of the sequence called complementary determining regions or CDR (Figure 2). For the most part, it is the CDRs that form the antigen binding site and confer specificity of the antigen. The constant regions are more highly conserved than the variable domains, with slight variations of glass to the haplotype differences. Based on their amino acid sequences, light chains are classified as kappa or lambda. Heavy chains of constant region are composed of multiple domains (CH1, CH2, CH3 ... CHx), the number depends on the specific antibody class. The CH1 region is separated from the CH2 region by a hinge region that allows flexibility in the antibody. The variable region of each light chain is aligned with the variable region of each heavy chain, and the constant region of each light chain is aligned with the first constant region of each heavy chain. The CH2-CHx domains of the constant region of a heavy chain form an "Fc region" that is responsible for the effector functions of the immunoglobulin molecule, such as complement binding and binding of Fc receptors expressed by lymphocytes. , granulocytes, monocyte lineage cells, killer cells, mast cells and other immune effector cells. As can be seen in Figure 3, the light and heavy chains of an IgG molecule form the variable region domain and the constant region domain. Each domain is composed of a sandwich of two extended, parallel protein layers of approximately 100 amino acids in length that are connected by a single disulfide bond (see Roitt et al., Immunology, 3rd edition, London, Mosby, 1993, page 4.4). Each of the two extended protein layers of the domain, in turn, has two adjacent "antiparallel" strands that adopt a beta-plate conformation (see, eg, Stryer, 1975, Biochemistry, WH Freeman et al., Page 950 ). Each of the domains has a similar three-dimensional structure based on the fold of the immunoglobulin. 2. 2 IMMUNOTHERAPY AND ANTI-IDIOTIDE ANTIBODIES In modern medicine, immunotherapy or vaccination has practically eradicated diseases such as polio, 'tetanus, tuberculosis, smallpox, measles, hepatitis, etc. The approach of using vaccines has taken advantage of the capacity of the immune system to prevent infectious diseases. The use of immunotherapy has also been explored for cancer treatments. The era of tumor immunology began with experiments by Prehn and Main, who showed that antigens in methylcholanthrene-induced sarcomas (MCA) were specific tumors in that transplant assays could not detect these antigens in normal mouse tissue (Prehn et al, 1957, J. Nati, Cancer Inst. 18: 79-778). This notion was confirmed by other experiments demonstrating that specific resistance to the tumor against MCA-induced tumors could be produced in the native host, i.e., the mouse in which the tumor originated (Klein et al., 1990, Cancer Res. 20: 151-1572). There are many reasons why immunotherapy is desired for use in cancer patients. First, if cancer patients are immunosuppressed during surgery, with subsequent anesthesia and chemotherapy, this can worsen immunosuppression, so with adequate immunotherapy in the preoperative period, this immunosuppression can be avoided or reversed. This could lead to fewer infectious complications and accelerate the healing of the wound. Second, tumor volume is minimal after surgery and immunotherapy is more likely to be effective in this situation. A third reason is the possibility that the tumor cells diffuse into the circulation during surgery and the effective immunotherapy applied at this time can eliminate these cells. There are two types of immunotherapy, "active immunotherapy" and "passive immunotherapy." In "active immunotherapy" an antigen in the form of a vaccine is administered to a patient to produce a protective immune response. "Passive immunotherapy" includes the administration of antibodies to a patient without producing a concomitant immune response. When a specific antibody of an animal is injected as an immunogen into a second suitable animal, the injected antibody will produce an immune response. Antibody treatment is traditionally characterized as passive since the patient is not the source of the antibodies. However, the term passive is misleading because the patient can produce secondary anti-idiotypic antibodies that in turn elicit an immune response that is cross-reactive with the original antigen. Immunotherapy where the patient generates secondary antibodies is often more effective from a therapeutic point of view than passive immunotherapy because the patient's own immune system continues to struggle with the cells carrying the specific antigen long after the initial introduction of the antibody. In an anti-idiotype response, antibodies produced initially during an immune response or introduced into an organism will carry new unique epitopes for which the organism is not tolerant and, therefore, will induce the production of secondary antibodies (termed "Ab2"), some of which are directed against the idiotype (ie, the antigen binding site) of the primary antibody (termed "Abl"), ie, the antibody that was initially produced or introduced exogenously. These secondary antibodies or Ab2 in the same way will have an idiotype that will induce the production of tertiary antibodies (termed "ab3"), some of which will recognize the Ab2 antigen binding site, and so on. This is known as the "network" theory. Some of the secondary antibodies will have a binding site analogous to the original antigen, and thus reproduce the "internal image" of the original antigen. And, tertiary antibodies or Ab3 that recognize this antigen-binding site of the Ab2 antibody will also recognize the original antigen (Figure 4). So, the anti-idiotypic antibodies have binding sites that are similar in conformation and charge to the antigen, and each one produces the same response to greater than that of the cancer antigen itself. The administration of an exogenous antibody that can produce a strong anti-idiotypic response, in this way, can serve as an effective vaccine, maintaining a constant immune response. To date, anti-idiotypic vaccines have included murine antibodies because the anti-idiotypic response occurs as part of the response of the common human anti-mouse antibody (HAMA). A strong anti-idiotypic cascade has been observed when Abl has been damaged in its structure (Madiyalakan et al., 1995, Hybrido at 14: 199-203), returning to the strangest antibody. The direct administration to the individual of exogenously produced anti-idiotypic antibodies that are grown against the idiotype of an anti-tumor antibody has been carried out (US Pat. No. 4,918.14). After administration, the body of the individual will produce anti-antibodies that not only recognize these anti-idiotype antibodies, but will also recognize the original tumor epitope, thereby directing the activation of complement and other responses of the immune system so that a strange entity attack the tumor cells that express the tumor epitope. However, although anti-idiotypic vaccines are desirable targets and some have been identified, the ability to deliver antibodies that reproducibly cause the generation of such an anti-idiotypic response is currently not possible. (Foon et al., 1995, J. Clin. Invest 9: 334-342; Madiyalakan et al., 1995, Hybridoma 14: 199-203). One of the reasons for the failure to generate an anti-idiotypic response is that, Abl, although exogenous, is still very similar "likewise", as all the antibodies have very similar structures, and the anti-idiotypic responses to the molecules themselves tend to ta be very limited. Thus, there is a need in the art for methods to reliably generate an anti-idiotype response for a specific antibody. 3. SUMMARY OF THE INVENTION The present invention is based on the knowledge of the present inventors that an antibody in which one or more cysteine residues of the variable region forming one or more intrachain chain disulfide bonds have been replaced with residues of amino acids that do not contain sulfhydryl groups, so that the particular disulfide bonds do not form, produce a stronger anti-idiotype response than an antibody in which the disulfide bonds of the variable region are intact. Accordingly, the present invention provides the modified immunoglobulin molecules or antibodies (and functionally active fragments, derivatives and analogs thereof), and vaccine compositions containing these immunoglobulin molecules, wherein the variable region of the immunoglobulin is object of diminished conformational constraints, such as, but not limited to, the breaking of one or more intrachain or interchain disulfide bonds. Specifically, the invention provides the modified immunoglobulins containing a variable region and are identical, except for one or more substitutions of amino acids in the variable region, to a second immunoglobulin molecule, the second immunoglobulin molecule being capable of immuno-specific binding ( that is, the specific binding of the immunoglobulin to its antigen as determined by any method known in the art for determining antigen-antibody binding, which excludes non-specific binding but not necessarily cross-reactivity with other antigens) an antigen, a or more amino acid substitutions being the substitution of one or more amino acid residues that does not have a s? lhydryl group at one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the immunoglobulin molecule. In preferred embodiments, the second immunoglobulin molecule can immuno-specifically bind to a cancer antigen; in other preferred embodiments, the second immunoglobulin molecule can be immuno-specifically linked to an infectious disease agent antigen or a cellular receptor for an infectious disease agent. The invention further provides methods for producing an anti-idiotype response in an individual by administering the modified immunoglobulins of the invention. In particular embodiments, the modified immunoglobulins of the invention can be used to treat or prevent cancer, specifically by administering an immunoglobulin molecule of the invention, whose immunoglobulin molecule was obtained (i.e., by modification according to the invention to replace one or more cysteine residues of the variable region that form an intrachain disulfide bond with an amino acid residue that does not contain a sulfhydryl group) from an immunoglobulin molecule that can bind immuno-specifically to a cancer antigen, the expression of which Cancer antigen is associated with the particular type of cancer. In addition, in other embodiments, the modified immunoglobulin molecules of the invention can be used to treat or prevent an infectious disease by administering an immunoglobulin molecule from an immunoglobulin molecule that can bind immuno-specifically to an antigen of or a cellular receptor for the infectious disease agent causing the infectious disease. The invention also provides the production methods of the modified immunoglobulin molecules of the invention and the vaccine compositions containing the modified immunoglobulin molecules of the invention. 4. BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a schematic diagram showing the structure of the 'light and heavy chain' of an immunoglobulin molecule, each chain consisting of a variable region positioned in the amino terminal region (HN-) and a constant region positioned in a carboxyl terminal region (-COOH) Figure 2 is a schematic diagram of an IgG showing the four structural regions (FR1, FR2, FR3 and FR4) and three regions that determine complementarity (CDR1, CDR2 and CDR3) in the variable regions of the light and heavy chains (labeled as VL and VH, respectively).

The domains of the constant region are indicated as C? for the constant domain of the light chain and CH, CH and CH; for the three domains of the constant region of the heavy chain. Fab indicates the portion of the antibody fragment that includes the variable region domains for light and heavy chains and the C__ and CH: domains. Fc indicates the fragment of the constant region that contains the CH2 and CH3 domains. Figure 3 is a schematic diagram of an antibody structure as shown in Figure 2, but drawn to highlight that each domain (the loop structures labeled VL, Vh, C ?, CHi, CH2 and CH3, respectively) is structurally defined by a disulfide bond (indicated by darker lines) that maintains the three-dimensional structure (Roitt et al., Immunolgy, second edition, London: Gower Medi'cal Publishing, 1989, page 5.3). Figure 4 is a schematic diagram showing the development of the internal image carrying anti-idiotype antibodies (Ab2) and anti-idiotype antibodies (Ab3) of idiotype antibodies (Abl) directed against a ligand in an anti-idiotypic cascade. Figure 5 is the modification of the variable region of an immunoglobulin substituting the cysteine residues in the variable regions with alanine residues to break an intrachain disulfide bond of the variable region. CH :, CH2 and CH3 are constant regions. Vri is the variable region of the heavy chain and V? it is the variable region of the light chain.

Figure 6A-C. (TO) . The structure of the expression vector pMRROlO.l, which contains a sequence of the constant region of the human kappa light chain. (B) The structure of the expression vector pGammal containing a sequence coding for the heavy chain sequences of constant region (CH1, CH2, CH3) and the hinge region of human IgGl. (C) The structure of the expression vector pNEPuDGV containing a sequence coding for the kappa constant domain of the light chain and the constant domain and the hinge region of the heavy chain. For all three vectors see Bebbington et al., 1991, Methods in Enzymology 2: 135-145. I Figures 7A and B. (A) The amino acid sequence (SEQ ID NO: 70) and the corresponding nucleotide sequence (SEQ ID NO: 69) including the leader sequence for the variable region of the consensus light chain ConVL1. (B) The amino acid sequences (SEQ ID NO: 72) and corresponding nucleotides (SEQ ID NO: 71) for the variable region of the consensus heavy chain ConVHl including the leader sequence. Figures 8A-B. (A) Amino acid sequence (SEQ ID NO: 74) and the corresponding nucleotide (SEQ ID NO: 73) of 2CAVLCOL1, which is the variable region sequences of the light chain of an antibody derived from mAb31.1, in the which alanine residues have been replaced by cysteine residues at positions 23 and 88, whose residues are framed. (B) Amino acid sequence (SEQ ID NO: 76) and corresponding nucleotides (SEQ ID NO: 75) of 2CAVHC0L1, which is the variable region sequence of the heavy chain of an antibody derived from mAb31.1, in which the alanine residues have been replaced by cysteine residues at positions 23 and 88, whose residues are framed. Figures 9A-D (A) Oligonucleotide sequences for the oligonucleotides used to assemble 2CAVHC0L1, the heavy chain variable region specific for human colon cancer antigen (SEQ ID NOS: 13-22).

(B) Sequences of oligonucleotides for the oligonucleotides used to assemble the light chain variable region gene 2CAVLC0L1 specific for human colon cancer antigen (SEQ ID NOS: 23-34). (C) Oligonucleotide sequences for the oligonucleotides used to assemble the light chain consensus region known as ConVLl (SEQ ID NOS: 35-52). (D) Oligonucleotide sequences for the oligonucleotides used to assemble the heavy chain consensus region known as ConVLl (SEQ ID NOS: 53-67). Figure 10 is a schematic diagram of the general steps that were followed for the assembly of a modified gene encoding the modified antibody, synthetic, specific for the human colon cancer antigen. Figure 11. Dotted bands showing the result of a test for antibody binding competition from mAB31.1, but not having changes from cysteine to alanine with the same antibody that is labeled with biotin for an antigen preparation from of cells LS-174-T. The concentration of the unlabeled antibody is indicated as unlabeled nM antibody. The "blk" band has no antigen. Figures 12A-D. (A) Results of the antibody-binding assay assay of biotin-labeled anti-I colon carcinoma cell antibody for LS-174T cells in the presence of antisera from mice vaccinated with single vehicle, control antibody that binds to the antibody of the colon carcinoma cells but has not been modified and peptides CDR1, CDR2, CDR3, CDR4, CDR5, and CDR6, the CDR sequences containing the binding site of the bradykinin receptor expressed as percent of the binding of the control to the LS cells -174T. (B) Results of competition binding assays of biotin-labeled anticolon carcinoma cell antibody to LS-174T cells in the presence of antisera from mice vaccinated with single vehicle, control antibody that binds to the antibody of colon carcinoma cells, but it has not been modified, 2CAVHC0L1 and 2CAVLC0L1. (C) Diagram showing the binding of an antibody labeled with biotin (indicated by "b") (and inverted) to the antigen (dark triangles). (D) Diagram showing the inhibition of biotin-labeled antibody binding (indicated by "b") (and inverted) by anti-idiotype antibodies (dark arrows) to the antigen (dark triangles). Figure 13. Nucleotide sequence for the light chain variable region having a CDR containing a binding sequence for HMFG1 (SEQ ID NO: 68).

. DETAILED DESCRIPTION OF THE INVENTION I The present invention provides modified immunoglobulins (particularly antibodies and functionally active fragments, derivatives and analogs thereof) that produce a stronger immune response, particularly a stronger anti-idiotypic response than the corresponding unmodified immunoglobulins. In particular, the modified immunoglobulins of the invention are immunoglobulins which, when not modified, bind immuno-specifically to an antigen, and are modified to decrease the conformational constraints in a variable region of the immunoglobulin molecule, preferably in a that at least one of the cysteines participating in the formation of an intrachain chain disulfide in the variable region of the immunoglobulin has been replaced with an amino acid residue that does not have a sulfhydryl group and, therefore, does not form a disulfide bond, decreasing by This means the conformational limitations of at least one of the variable regions of the immunoglobulin (Figure 5). In the preferred embodiments of the invention, the modified immunoglobulin molecule comes from an immunoglobulin molecule that is capable of immuno-specifically binding to a cancer antigen; in other preferred embodiments, the modified immunoglobulin molecule is derived from an immunoglobulin that is capable of immuno-specifically binding an antigen of an infectious disease agent or a cellular receptor for an infectious disease agent. The invention also provides the vaccine compositions containing the modified immunoglobulin molecules of the invention. In addition, the invention provides methods for generating an anti-idiotype response in an individual by administration of the modified immunoglobulin molecules of the invention. In specific embodiments, the invention provides methods of treating or preventing cancer by administering a modified immunoglobulin molecule of the invention which, in its unmodified state, is capable of immuno-specifically binding to a cancer antigen, the expression of which is associated with the particular cancer. The administration of the modified immunoglobulin produces an anti-idiotype reaction in the individual, causing the production, by the individual, of antibodies specific for the cancer antigen. In another specific embodiment, the modified immunoglobulin, in its unmodified state, is capable of binding an antigen of an infectious disease agent or a cellular receptor for an infectious disease agent. These immunoglobulins can be used to treat or prevent the infectious disease caused by the infectious disease agent. For clarity of the description, and not as a limitation, the detailed description of the invention is divided into the following subsections. . 1. MODIFIED ANTIBODIES The modified immunoglobulins, particularly antibodies, of the invention are immunoglobulins which, at least in the unmodified state, can bind immuno-specifically to an antigen and have been modified to improve their ability to produce an anti-idiotype response. These immunoglobulins are modified to reduce the conformational constraints in a variable region of the immunoglobulin, for example, by eliminating or reducing intrachain or interchain disulfide bonds, chemical modification and other methods known in the art. Specifically, the invention provides a first immunoglobulin molecule that contains a variable region and that is identical, except for one or more substitutions of amino acids in the variable region, to a second immunoglobulin molecule, the second immunoglobulin molecule being able to bind and immuno-specifically to an antigen, amino acid substitutions being the substitution of one or more residues of amino acids that do not have a sulfhydryl group in one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the second immunoglobulin molecule. The invention also provides nucleic acids that contain a nucleotide sequence encoding a modified immunoglobulin of the invention. The identification of the cysteine residues that form a disulfide bond in a variable region of a specific antibody can be performed by any of the methods known in the art. For example, but not as a limitation, it is well known in the art that cysteine residues that form intrachain chain disulfides are highly conserved between classes of antibodies and cross species. Thus, the cysteine residues involved in the formation of disulfide bonds can be identified by sequence comparison with other antibody molecules in which the residues are known to form a disulfide bond. Table 1 provides a list of the positions of the cysteine residues that form the disulfide bond for different antibody molecules. Table 1 (obtained from Kabat et al., 1991, Proteins of Immunological Interest sequences, 5th edition, U.S. Department of Health and Human Services, Bethesda, Maryland).

Species Variable domain - Cysteine group that form disulfide bonds (positions) Human Kappa light I 23,88 Human Kappa light II 23,88 Human Kappa light III 23,88 Human Kappa light IV 23,88 Human Lambda light I 23,88 Human Light Lambda II 23,88 Human Light Lambda III 23,88 Human Lambda Light IV 23,88 Human Lambda Light V 23,88 Human Lambda Light VI 23,88 Light Kappa Mouse I 23,88 Light Kappa Mouse II 23,88 Kappa Mouse light III 23.88 Species Variable domain Subgroup Cysteine forming disulfide bonds (positions) Light Kappa Mouse IV 23.88 Light Kappa Mouse V 23.88 Light Kappa Mouse VI 23.88 Light Kappa Mouse VII 23.88 Light Kappa Mouse Miscellaneous 23.88 Light Lambda Mouse 23.88 Chiiipancé Light Lambda 23.88 Kappa Light Rat 23,88 Light Lambda Rat 23,88 Light Kappa Rabbit 23,88 Light Lambda Rabbit 23,88 Light Kappa Dog 23,88 Light Kappa Pig 23,88 Light Lambda Pig 23 (88) Light Lambda Cobayo 23,88 Light Lambda Sheep 23 (88) Light Lambda chicken 23, 88 Light Lambda lamb 23,88 Hydrolagus Light lambda 23 (88) coillei (fish with rat tail) Kappa light shark 23,88 Heavy Human I 22,92 Heavy Human II 22,92 Heavy Human III 22, 92 Heavy Mouse KA) 22.92 Heavy Mouse KB) 22.92 Heavy Mouse II (A) 22.92 Heavy Mouse II (B) 22.92 Species Variable domain Subgroup Cysteine forming disulfide bonds (positions) Heavy Mouse II (C) 22.92 Heavy Mouse III (A) 22.92 Heavy Mouse III (B) 22.92 Heavy Mouse III (C) 22.92 Heavy Mouse III (D) 22.92 Heavy Mouse V (A) 22.92 Heavy Mouse V (B) 22.92 Heavy Mouse Miscellaneous 22.92 Heavy Rat 22.92 Heavy Rabbit 22.92 Heavy guinea pig 22.92 Heavy Cat 22 (92) Heavy Dog 22.92 Heavy Pork 22 (92) Mink Heavy 22 (92) Heavy Sea Lion 22 (92) Heavy Seal 22 (92) Heavy Chicken 22.92 Heavy Duck 22 (92) Heavy Goose 22 (92) Heavy pigeon 22 (92) Heavy Turkey 22 (92) Heavy Cayman 22.92 Heavy Xenopus Frog 22.92 Elops [sic] Heavy 22.92 Heavy Goldfish 22.92 Heavy Hydrolagus. 22 (92) colliei (fish with rat tail) Heavy Shark 22,92 The numbers of the positions () indicate that the protein was not sequenced for this position, but the residue is inferred by comparison with the known sequences. It is important to note that, for all the antibody molecules listed in Table 1, the cysteine residues that form the intrachain disulfide bonds are the residues at positions 23 and 88 of the variable domain of the light chain and the residues at positions 22 and 92 of the variable domain of the heavy chain. The numbers of the positions refer to the residue corresponding to this residue in the consensus sequences as defined in Kabat, (1991, Sequences of Proteins of Immunological Interest, 5th edition, U.S. Departament of Health and Human Services, Bethesda, Maryland) or as indicated in the heavy and light chain variable region sequences depicted in Figures 7A and B, respectively ("corresponding" means determined by aligning the sequence of the specific antibody with the consensus sequence or sequence). of the variable region of the heavy or light chain shown in Figure 7A or B). Accordingly, in one embodiment of the invention, the modified immunoglobulin molecule is an antibody in which the residues at positions 23 and / or 88 of the light chain are substituted with an amino acid residue that does not contain a sulfhydryl group and / or the residues at positions 22 and / or 92 of the heavy chain are substituted with an amino acid residue that does not contain a sulfhydryl group. In the modified immunoglobulin of the invention, the amino acid residue that replaces the cysteine residue forming the disulfide bond is any amino acid residue that does not contain a sulfhydryl group, for example, alanine, arginine, asparagine, aspartate (or aspartic acid), glutamine, glutamate, (or glutamic acid), glycine, histin, isoleucine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine. In a preferred embodiment, the cysteine residue is replaced with a residue I of glycine, serine, threonine, tyrosine, asparagine or glutamine, more preferably with an alanine residue. In addition, the disulfide bond forming cysteine residue can be replaced by a non-traditional amino acid or analogous chemical amino acid not containing a sulfhydryl group (for example, but not as a limitation, using the usual protein synthesis methods). Non-traditional amino acids include, but are not limited to, the D isomers of the common amino acids, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, α-Albu, e-Ahx, hexane amino acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, t-butylglycine, t-butylalanine, phenylglycine, cyclohexanilane, β-alanine, fluoroamino acids, designer amino acids such as β-methyl amino acids, C a -methyl amino acids, Na-methyl amino acids, and analogous amino acids in general. In addition, the amino acid can be B (dextrorotatory) or L (levorotatory). In an alternative embodiment, the disulfide-bond-forming residue (deletion) is lost. In specific embodiments, the substitution of the disulfide bond-forming residue is in the variable region of the heavy chain or is in the variable region of a light chain or is in both heavy chain and light chain variable regions. In other specific embodiments, one of the residues forming a specific disulfide bond is replaced (or subjected to deletion) or, otherwise, both residues that form a particular disulfide bond can be replaced (or subjected to deletion). In other embodiments, the invention features immunoglobulin molecules having one or more amino acid substitutions relative to the second immunoglobulin molecule of a disulfide bond-forming residue in the variable region with an amino acid residue that does not contain a sulfhydryl group and that additionally has one or more other amino acid substitutions (ie, they are not a replacement of a disulfide-bonding residue with a residue that does not contain a sulfhydryl group).

In particular, the invention provides a first immunoglobulin molecule containing a variable region and which is identical, except for one or more amino acid substitutions in the variable region, to a second immunoglobulin molecule, the second immunoglobulin molecule being able to bind immuno specifically to an antigen, wherein at least one of the one or more amino acid substitutions is the substitution of an amino acid residue that does not have a sulfhydryl group at one or more positions corresponding to one or more cysteine residues forming a bond disulfide in the second immunoglobulin molecule. In a preferred embodiment, amino acid substitutions that are not the substitution of a disulfide-bonding cysteine residue with a residue that does not have a sulfhydryl group are not stabilizing changes. Stabilizing changes are defined as those changes of amino acids that increase the stability of the antibody molecule. These changes of the stabilizing amino acid are not changes that substitute an amino acid that is not common at this particular position in the specific antibody molecule (eg, defined by consensus sequences for a number of antibody molecules provided in Kabat et al., 1991). , Sequences of Proteins of Immunological Interest, 5th edition, US Department of Health and Human Services, Bethesda, Maryland). With a common residue in this specific position, "for example, it is the amino acid at this position in the consensus sequence for this antibody molecule (see PCT publication WO 96/02574, dated February 1, 1996 from Steipe et al. .) These other amino acid substitutions which can be any amino acid substitution that does not alter the ability of the modified immunoglobulin to produce the formation of anti-anti-idiotype antibodies, for example, as determined, for example, as described in section 5.5, infra For example, these other amino acid substitutions include functionally equivalent amino acid residue substitutions.For example, one or more amino acid residues can be substituted by another amino acid of a similar polarity that acts as a functional equivalent. Substitutes for an amino acid within the sequence can be selected from other members of the class to which the am For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Amino acids of neutral polarity include glycine, serine threonine, cysteine, tyrosine, asparagine and glutamine. The amino acids with positive charge (basic) include arginine, lysine and histidine. The negatively charged amino acids (acids) include aspartic acid and glutamic acid. The modified antibodies of the invention can be obtained from antibodies that are capable of binding immuno-specifically to any antigen. In a preferred embodiment, the modified antibodies are obtained from antibodies capable of immuno-specifically binding to a cancer antigen, more preferably to a tumor antigen. Specific modalities, the modified antibodies are obtained from antibodies that are capable of binding polymorphic epithelial mucin antigen, protein antigen associated with human colon carcinoma, carbohydrate antigen associated with human colon carcinoma, human milk fat globule, or is an antigen from a breast cancer, ovarian cancer, uterus, prostate, bladder, lung, skin, colon, pancreas, gastrointestinal system, B lymphocytes or T lymphocytes or any other cancer characterized by the expression of specific antigens, for example, those that they are described in section 5.2.1, infra. In preferred embodiments, the modified antibody is obtained from Mab 31.1. (available from the American Type Culture Collection, 10801 University Boulervard, Manassas, Virginia 20110-2201 under 12314), Mab 33.28 (under number 12315) or Mab HMFG-1 (see PCT publication WO 90/05142 and PCT publication WO92 / 04380). In another specific embodiment, the modified antibodies of the invention are obtained from antibodies that are capable of immuno-specific binding to an antigen of an infectious disease agent or a cellular receptor for an infectious disease agent. In preferred embodiments, the antigen of the agent for infectious disease is a bacterial antigen, a viral antigen or an antigen of a parasite or any other antigen of an infectious disease agent, such as those infectious disease agents described in section 5.2.2, infra. The immunoglobulin molecules of the invention can be of any type, class or subclass of immunoglobulin molecules. In a preferred embodiment, the immunoglobulin molecule is an antibody molecule, more preferably of a type selected from the group consisting of IgG, IgE, IgM, IgD and IgA, most preferably an IgG molecule. Otherwise, the immunoglobulin molecule is a T cell receptor, a B cell receptor, a cell surface adhesion molecule such as CD4, CD8, or CD19 co-receptors, or an invariant domain of a molecule. MHC. The modified immunoglobulin can be obtained from any antibody of what occurs naturally, preferably a monoclonal antibody, or it can be obtained from a synthetic or manipulated antibody. In another aspect of the invention, the modified immunoglobulin molecules are obtained from an antibody in which the binding site for a member of a binding pair or a portion of an antigen is inserted into or replaces all or a portion of one of CDRs in the variable region, for example, as described in the co-pending application of the United States series No., entitled "Immunoglobulin Molecules Having a Variable Synthetic Region and Modified Specificity ", de Burch, filed on November 13, 1998 (file No. 6750-016), which is incorporated herein by reference in its entirety, In particular, synthetic antibodies are I antibodies that immuno-specifically bind to a first member of a binding pair where at least one of the CDRs of the antibody contains a binding site for the first member of the binding pair, whose binding site is obtained from an amino acid sequence of the other member of the binding pair In one aspect of the invention, the amino acid sequence of the binding site is not found naturally within the CDR In addition, at least one of the CDRs may contain a portion of an antigen, particularly a epitope The amino acid sequence of the binding site can be identified by any method known in the art, for example, in some cases, the sequence of a member of a binding pair it has already been determined directly involved in the union of the other member of the union pair. In this case, such a sequence can be used to construct the CDR of a synthetic antibody that specifically recognizes the other member of the binding pair. If the amino acid sequence for the binding site in one member of the binding pair for the other member of the binding pair is not known, this can be determined by any method known in the art, for example, but is not limited to, Molecular modeling methods or empirical methods, for example, by testing portions (for example, peptides) of the member for attachment to the other member, or by making mutations in the member and determining mutations that prevent binding. The binding pair can be any of two molecules, including proteins, nucleic acids, carbohydrates, or lipids that interact with each other, although preferably the binding partner from which the binding site is derived is a protein molecule. In preferred embodiments, the modified immunoglobulin contains a binding sequence for a cancer antigen, an infectious disease antigen, a cellular receptor for a pathogen or a receptor or ligand that participates in a receptor-ligand binding pair. In specific embodiments, the binding pair is a pair of protein-protein interaction which is homotypic interaction (ie, the interaction between two of the same proteins) or a heterotypic interaction (ie, the interaction between two different proteins) . In a specific embodiment, the first member is a member of a ligand-receptor binding pair, preferably, of a receptor-ligand binding pair in which the ligand binds to the receptor and thereby produces a physiological response, such as It can be intracellular signaling. For example, and not as a limitation, the ligand or receptor may be a hormone, autocoid [sic], growth factor, cytokine or neurotransmitter, or a receptor of a hormone, autdcoid, growth factor, cytokine or neurotransmitter or any receptor or ligand involved in the transduction of the signal. (For revisions of the signal transduction pathways see, for example, Campbell, 1997, J. Pediat, 131: S42-S44, Hamilton, 1997, J-Leukoc, Biol 62: 145-155, Soede-Bobok &Touw , 1997, J. Mol. Med. 75: 470-477, Heldin, 1995, Cell 80: 213-223, Kishimoto et al., 1994, Cell 76: 253-252, Miyajima et al., 1992, Annu. Immunol 1: 0: 295-331; and Cantley et al., 1991, Cell 64: 281-302). In the specific embodiments, a member of the binding pair is ligated such as, but not limited to, cholecystokinin, galanin, IL-1, IL-2, IL-4, IL-5, IL-6, IL-11. , chemokine, leptin, a protease, neuropeptide Y, neurokinin-1, neurokinin-2, neurokinin-3, bombesin, gastrin, corticotropin-releasing hormone, endothelin, melatonin, somatostatin, vasoactive intestinal peptide, epidermal growth factor, tumor necrosis, dopamine, endothelin or a receptor for any of these ligands. In other embodiments, a member of the binding pair is a receptor, such as, but not limited to, an opioid receptor, a glucose transporter, a glutamate receptor, an orphanin receptor, an erythropoietin receptor, a receptor insulin, tyrosine kinase receptor (TK), KIT primordial cell factor receptor, nerve growth factor receptor, insulin-like growth factor receptor, granulocyte colony-stimulating factor receptor, somatotropin receptor, receptor neurotrophic factor derived from the glial or gp39 receptor, the class of G protein receptor or β2 adrenergic receptor, or a ligand that binds to any of these receptors. In another embodiment, one of the members of the binding pair is a ligand gate ion channel, such as but not limited to a calcium channel, a sodium channel, or a potassium channel. In certain embodiments, the invention provides modified immunoglobulins that bind immunocypecifically to a receptor and are antagonists of the ligand that binds to this receptor, for example, but not as a limitation, are endorphin, enkephalin, or nociceptin antagonists. In other embodiments, the invention provides synthetic, modified antibodies that bind immuno- • specifically to a receptor and are receptor agonists, for example, but not as limitation, the endorphin, enkephalin or nociceptin receptors. In a preferred embodiment, the modified immunoglobulin does not bind to the fibronectin receptor. In another preferred embodiment, the binding sequence is not Arg-Gly-Asp, it is not a multimer of a binding sequence and it is preferably not a multimer of the Arg-Gly-Asp sequence. In other specific embodiments, the modified immunoglobulin has a CDR that contains a binding site for a transcription factor. In a preferred aspect, the modified immunoglobulin does not bind to a specific DNA sequence, particularly it does not bind to a transcription factor binding site. In preferred embodiments, the modified immunoglobulin has at least one CDR that contains an amino acid sequence of a binding site for a cancer antigen or a tumor antigen (eg, as described in detail in section 5.2.1 infra. .), most preferably, the antigen is antigen associated with human colon carcinoma or epithelial mucin antigen. In other embodiments, at least one CDR of the modified immunoglobulin contains an amino acid sequence for a binding site for a human milk fat globule receptor. In other embodiments, the modified immunoglobulin has at least one CDR containing an amino acid sequence of a binding site for an antigen from a tumor of the breast, ovary, uterus, prostate, bladder, lung, skin, pancreas, colon, gastrointestinal tract , B lymphocytes or T lymphocytes. In other preferred embodiments of the invention, at least one CDR of the modified antibody contains an amino acid sequence for a binding site for an antigen of an infectious disease agent (e.g., as described in detail). in section 5.2.2, infra), or a binding site for a cellular receptor of an infectious disease agent, preferably where the binding site is not an amino acid sequence of a plasmodium antigen, or is not the site of binding Asn-Ala-Asn-Pro (SEQ ID NO: 1) or Asn-Val-Asp-Pro (SEQ ID NO: 2). In the further embodiments, the modified antibody has a CDR that contains the binding site for a bacterial or viral enzyme. The synthetic antibody can be based on (i.e., the sequences of the binding site inserted in the CDR of) the sequence of an antibody that occurs naturally or existing or can be synthesized from known consensus sequences of the antibody, as can be be the consensus sequences for the variable regions of the light and heavy chain in Figures 7A and B, or any other consensus or germ line sequences of the antibody (i.e., non-recombined genomic sequences) (e.g., those consensus and germ line sequences of the antibody described in Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th edition, NIH publication No. 91-3242, pp. 2147-2172). Each reservoir molecule has six CDR sequences, three in the light chain and three in the heavy chain, and five of these CDRs are germline CDRs (ie, they come directly from the genomic sequence of the animal germline, without recombination ) and one of the CDRs is a non-germ-line CDR (ie, it differs in sequence from the genomic sequence of the animal's germ line and is generated by recombination of the germline sequences). If a CDR is a germ line or non-germline sequence it can be determined by sequencing the CDR and then comparing the sequence with known germline sequences, for example, as listed in Kabat et al., (1991, Sequences of Proteins of Immunological Interest, 5th edition, NIH publication No. 91-3242, pp. 2147-2172). The significant variation of the known germline sequences indicates that the CDR is a non-germline CDR. Accordingly, the CDR containing the amino acid sequence of the binding site or antigen is a germline CDR or, otherwise, is a non-germline CDR. The binding site or sequence of the antigen can be inserted into any of the CDRs of the antibody, and it is within the skill of the art to insert the binding site into different CDRs of the antibody and then detect the resulting modified antibodies for the ability to bind to the specific member of the binding pair, for example, as described in section 5.5, infra, or to produce an immune response against the antigenic site, for example, as described in section 5.5, infra. Thus, it is possible to determine the CDR that optimally contains the binding site or antigen. In specific embodiments, a CDR of the heavy or light chain variable region is modified to contain the amino acid sequence of the binding site or antigen, in another specific embodiment, the modified antibody contains a variable domain in which the first, second or third CDR of the heavy variable region or the first, second or third CDR of the variable region of the light chain contains the amino acid sequence of the binding site or antigen. In another embodiment of the invention, more than one CDR contains the amino acid sequence of the binding site or antigen or more than one CDR that contains a different binding site for the same molecule or contains a different binding site for a different molecule. In the particular embodiments, two, three, four, five or six CDRs have been manipulated to contain a binding site for the first member of the binding pair. In a preferred embodiment, one or more CDRs contain a binding site for the first member of a binding pair and one of the other CDRs contains a binding site for a molecule on the surface of an immune cell, such as, but it is not limited to T cells, B cells, NK cells, K cells, TIL cells or neutrophils. For example, a modified antibody having a binding site for a cancer antigen or an infectious disease antigen and a binding site for a molecule on the surface of an immune cell can be used to direct the immune cell to a cell of -Cancer carrying the cancer antigen or the infectious disease agent. In the specific embodiments of the invention, the binding site or amino acid sequence of the antigen is inserted into the CDR without replacing any of the amino acid sequences of the CDR itself or, otherwise, the binding site or the amino acid sequence of the antigen replaces all or a part of the amino acid sequence of the CDR. In the specific modalities, the amino acid sequence of the binding site replaces amino acids 1, 2, 5, 8, 10, 15 or 20 of the CDR sequence. The amino acid sequence of the binding site or antigen present in the CDR may be the minimum binding site necessary for the binding of the binding pair member or to produce an immune response against the antigen (which can be determined empirically by any of the methods known in the art); otherwise, the sequence may be greater than the minimum binding site or the antigen sequence necessary for the binding of the binding pair member or to produce an immune response against the antigen. In particular embodiments, the antigen binding site or sequence of apino acids is at least four amino acids in length, or is at least 6, 8, 10, 15 or 20 amino acids in length. In other embodiments, the amino acid sequence of the binding site is more than 10, 15, 20 or 25 amino acids in length, or is 5-10, 5-15, 5-20, 10-15, 10-20 or 10-25 amino acids in length. In addition, the total length of the CDR (i.e., the combined length of the sequence of the binding site and the remainder of the CDR sequence) must be of a suitable number of amino acids to allow binding of the antibody to the antigen. It has been observed that the CDRs have a range of numbers of amino acid residues, and the size ranges observed for the CDR (as defined by the abbreviations indicated in Figure 2) are given in Table 2.

Table 2 CDR Number of residues Ll 10-17 L2 7 L3 7-11 Hl 5-7 H2 9-12 H3 2-25 (Compiled from the data in Kabat and Wu, 1971, Ann NY Acad.

Sci. 190: 382-93. I Although many of the H3 regions of the CDR are 5-9 residues in length, certain H3 regions of the CDR have been observed to be much longer. In particular, a number of antiviral antibodies have H3 regions of the heavy chain CDR of 17-24 residues long. Accordingly, in the specific embodiments of the invention, the CDR containing the binding site or antigen portion is within the size range provided for this specific CDR in Table 2, ie, if it is the first CDR of the light chain , Ll, the CDR is 10 to 17 amino acid residues, if it is the second CDR of the light chain, L2, the CDR is of 7 amino acid residues; if it is the third CDR of the light chain L3, the CDR is from 7 to 11 amino acid residues; if it is the first CDR of the heavy chain, Hl, the CDR is from 5 to 7 amino acid residues; if it is the second CDR of the heavy chain, H2, the CDR is 9 to 12 amino acid residues; and if it is the third CDR of the heavy chain, H3, the CDR is from 2 to 25 amino acid residues. In other specific embodiments, the CDR containing the binding site is 5-10, 5-15, 5-20, 11-15, 11-20, 11-25 or 16-25 amino acids in length. In other embodiments, the CDR containing the binding site is at least 5, 10, 15 or 20 amino acids or is no greater than 10, 15, 20, 25 or 30 amino acids in length. After constructing the antibodies containing the modified CDRs, the modified antibodies can also be altered and detected to select an antibody having greater affinity or specificity. Antibodies having higher affinity or specificity for the target antigen can be generated and selected by any of the methods known in the art. For example, but not as limitation, the nucleic acid encoding the synthetic modified antibody can be mutagenized, randomly, i.e., by chemical or site-directed mutagenesis, or by making particular mutations at specific positions in the nucleic acid encoding the modified antibody, and then detecting the exposed antibodies of the mutated nucleic acid molecules for binding affinity for the target antigen. Detection can be performed by testing the antibody molecules expressed individually or by detecting a library of mutated sequences, for example, by phage display techniques (see, for example, U.S. Patent Nos. 5,223,409, 5,403,484 and 5,571,698, all of which are incorporated herein by reference). Ladner et al, PCT publication WO 92/01047 by McCaferty et al., Or any of the other known phage display techniques). In specific embodiments, the invention provides a functionally active fragment, derivative or analogue of the modified immunoglobulin molecules of the invention. Functionally active means that the fragment, derivative or analog can produce anti-anti-idiotype antibodies (ie, tertiary antibodies or Ab3 antibodies) that recognize the same antigen as the antibody from which the fragment, derivative or analogue is recognized (by example, as determined by the methods described in section 5.5 below). Specifically, in a preferred embodiment, the antigenicity of the idiotype of the immunoglobulin molecule can be enhanced by deletion of the structure and CDR sequences that are N-terminal to the specific CDR sequence that specifically recognizes the antigen. To determine the CDR sequences that bind to the antigen, it is possible to use synthetic peptides containing the CDR sequences in antigen binding assays or any binding assay method known in the art. Accordingly, in a preferred embodiment, the invention includes modified immunoglobulin molecules having a disulfide bond-forming cysteine residue in a variable region domain replaced with an amino acid residue that does not contain a sulfhydryl group and in which a of this variable domain has been subjected to deletion at the N-terminus of the CDR sequence that recognizes the antigen.

Other embodiments of the invention include fragments of the modified antibodies of the invention such as, but not limited to, F (ab ') fragments. containing the variable region, the constant region of a light chain and the CH1 domain of the heavy chain can be produced by digestion with pepsin of the antibody molecule, and the Fab fragments, which can be generated by reducing the disulfide bridges of the fragments F (ab ') :. The invention also provides the dimers of the heavy chain and the light chain of the modified antibodies of the invention, or any minimum fragment thereof such as Fvs or single chain antibodies (SCA). (e.g., as descr in U.S. Patent 4,946,778; Bird, 1988, Science 242: 423-42; Huston et al., 1988, Proc Nati, Acad. Sic. USA 85: 5879-5883; and Ward et al. , 1989, Nature 334: 544-54) or any other molecule with the same specificity as the modified antibody of the invention. Techniques for the production of "chimeric antibodies" have been developed (Morrison et al., 1984, Proc. Nati, Acad. Sci, 81: 851-855, Neuberger et al., 1984, Nature 312: 604-608; col., 1985, Nautre 314: 452-454) by dividing the genes of a mouse antibody molecule of appropriate antigenic specificity together with genes from a human antibody molecule of suitable biological activity. A chimeric antibody is a molecule in which different portions come from different animal species, such as those having a variable region obtained from a murine monoclonal antibody and a constant domain from a human immunoglobulin, for example, humanized antibodies. In a preferred embodiment, the modified immunoglobulin of the invention is a humanized antibody, more preferably, an antibody having a variable domain wherein the regions of the structure are of a human antibody and the CDRs are of an antibody of an animal not human, preferably a mouse (see, application of International Patent No. PCT / GB 8500392 of Neuberger et al., and Celltech Limited).

The grafted CDR is another method of humanizing antibodies. This includes reshaping the Murino antibodies to transfer all the specificity of the antigen and binding affinity to a human structure (Winter et al., US Patent No. 5,225,539). CDR-grafted antibodies have been successfully constructed against different antigens, for example, antibodies against the IL-2 receptor as descr in Queen et al., 1989 (Proc. Nati, Acad. Sci. USA 86: 10029); antibodies against CAMPATH cell surface receptors as descr in Riechmann et al., (1988, Nature, 332: 323); antibodies against hepatitis B in Colé et al., (1991, Proc. Nati. Acad. Sci. USA 88: 2869); as well as against viral antigens-respiratory syncytial viruses in Tempest et al., (1991, Bio-Technology 9: 267). CDR-grafted antibodies are generated in which the CDRs of murine monoclonal antibody are grafted onto a human antibody. After the formation of the graft, most of the antibodies benefit from the changes of the additional amino acids in the region of the structure to maintain the affinity, presumably because the residues of the structure are necessary to maintain the conformation of the CDR and It has been shown that some residues of the structure are part of the antigen binding site. However, to preserve the region of the structure so as not to induce any antigenic site, the sequence is compared with the established germline sequences followed by computer modeling. In other embodiments, the invention provides the fusion proteins of the modified immunoglobulins of the invention (or functionally active fragments thereof), for example in which the modified immunoglobulin is fused by a covalent bond (e.g., a peptide bond), at the N-terminus or the C-terminus of an amino acid sequence of another protein (or portion thereof, preferably a portion of at least 10, 20, or 50 amino acids of the protein) that it is not the modified immunoglobulin. Preferably, the modified immunoglobulin or fragment thereof is covalently bound to the other protein at the N-terminus of the constant domain. In preferred embodiments, the invention provides the fusion proteins in which the modified immunoglobulin is covalently bound to IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, interferon - ?, peptide from MHC, G-CSF, TNF, porins, NK cell antigens or cellular endocytosis receptor. Modified immunoglobulins of the invention include analogs and derivatives that are modified, ie, by the covalent attachment of any type of molecule so long as such covalent binding does not prevent the modified immunoglobulin from generating an anti-idiotypic response (eg, is determined by any of the methods described in section 5.5, infra). For example, but not as limitation, the derivatives and analogues of the modified immunoglobulins include those that have also been modified, for example, by glycosylation, acetylation, pegylation, phosphilation [sic], amidation, derivatization by known protecting / blocking groups, proteolytic dissociation, the binding to a cellular ligand or other protein, etc. Any of the different chemical modifications can be carried out by known techniques, including, but not limited to, specific chemical dissociation, acetylation, forylation, metabolic synthesis of tunicamycin, etc. In adon, the analog The derivative may contain one or more non-traonal amino acids, for example, such as those mentioned earlier in this section. The methods for producing the modified immunoglobulins, the fragments, analogues and derivatives of the same, are described in section 5.4, infra. . 2. THERAPEUTIC UTILITY The present invention offers methods for the production of anti-idiotype antibodies and antibodies Anti-anti-idiotype in an individual by administering a therapeutic compound (mentioned in the present "therapeutic"). These therapeutics include the modified immunoglobulins of the invention, and the functionally active tf fragments, analogs and derivatives thereof (eg, as described in section 5.1., Supra), and the nucleic acids encoding the modified antibodies. of the invention and functionally active fragments and derivatives thereof (for example, as described in section 5.1, supra). In general, the administration of products of origin of the species or reactivity of the species that is the same species as that of the individual is preferred. Thus, in a preferred embodiment, the methods of the invention utilize a modified antibody that is obtained from an antibody human; in other embodiments, the methods of the invention utilize a modified antibody derived from chimeric or humanized antibody. Specifically, the vaccine compositions (for example, as described in section 5.3, infra) containing the modified antibodies of the invention are administered to the individual to produce an antibody (ie, the anti-idiotype antibody or Ab2) that specifically recognizes the idiotype of the modified antibody, the Ab2, in turn, induces the production of anti-antibodies. - 25 anti-idiotype (Ab3) that specifically recognizes idiotype 4 of Ab2, so that these Ab3 antibodies have the same or similar binding specificity as the modified antibody. The invention offers the methods of administering the modified antibodies of the invention to produce an anti-idiotype response, that is, to generate Ab2 and Ab3 type antibodies. Otherwise, the invention provides the methods of administering the modified antibodies of the invention to an individual to generate Ab2 antibody, isolate Ab2 antibodies and then administer Ab2 antibodies to a second individual to generate Ab3 type antibodies in this second individual. Accordingly, the invention provides a method for generating an anti-idiotype response in an individual consisting of administering an amount of a first immunoglobulin molecule (or fragment, analog or functionally active derivative thereof) sufficient to induce an anti-viral response. idiotype, the first immunoglobulin containing a variable region and being identical, except for one or more substitutions of amino acids in the variable region, to a second immunoglobulin molecule, the second immunoglobulin molecule being able to bind immuno-specifically to an antigen, the one or more amino acid substitutions being the substitution of an amino acid residue that does not have a sulfhydryl group at one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the second immunoglobulin molecule. In another embodiment, the method further determines isolating the anti-idiotype antibody that recognizes the idiotype of the second immunoglobulin molecule and administering the anti-idiotype antibody to a second individual. In the specific embodiments that are described in greater detail in the following subsections, the modified antibodies of the invention can be used to induce an anti-idiotype response for infectious agents and diseased or abnormal cells, as it can be but not 'limited to, bacteria, parasites, fungi, viruses, tumors and cancers. The modified antibodies of the invention can be used to treat or prevent any disease or disorder that can be managed with treatment or prevention by generating an anti-anti-idiotypic response to a specific antigen. In other embodiments, the modified antibodies can be used for the treatment of autoimmune diseases, such as, but not limited to, rheumatoid arthritis, lupus, ulcerative colitis or psoriasis, or for the treatment of allergy. The methods and compositions of vaccines of the present invention can be used to induce a humoral and / or cell-mediated response against a modified immunoglobulin in an individual. In a specific embodiment, the methods and compositions of the invention induce a humoral response in an individual. In another specific embodiment, the methods and compositions of the invention induce a cell-mediated response in an individual. In a preferred embodiment, the methods and compositions of the invention induce humoral response and cell-mediated response. The individuals for whom the present invention is applicable may be any mammal or vertebrate species including, but not limited to, cows, horses, sheep, pigs, birds (e.g., chickens), goats, cats, dogs, hamsters, mice ', rats, monkeys, rabbits, chimpanzees and humans. In a preferred embodiment, the individual is a human. The compositions and methods of the invention can be used to prevent a disease or disorder, or to treat a specific disease or disorder, where an anti-idiotypic response against a particular immunoglobulin molecule is effective to treat or prevent the disease or disorder. . 2.1 TREATMENT AND PREVENTION OF CANCER Cancers, including, but not limited to, neoplasms, tumors, metastases or any disease or disorder characterized by uncontrolled growth of cells, can be treated or prevented by administration of a modified immunoglobulin (or functionally active fragment, derivative or analogue thereof) of the invention, or a nucleic acid encoding the modified immunoglobulin or the functionally active fragment, derivative or analog thereof) of which the modified immunoglobulin is obtained from an immunoglobulin that specifically recognizes one or more antigens associated with the cancer cancer cells that will be treated or prevented. Whether a particular Therapeutics is effective for the treatment or prevention of a certain type of cancer can be determined by any method known in the art, for example, but is not limited to those methods described in section 5.5, infra. For example, but not as a limitation, cancers associated with the following cancer antigens can be treated or prevented by administration of a modified antibody of the invention, from an antibody that recognizes these cancer antigens: KS pan-carcinoma antigen ( Perez and Walker, 1990, J. Immunol., 142: 32-37, Bumal, 1988, Hybridoma 7 (4): 407-415), ovarian cancer antigens (CA125) (Yu et al., 1991, Cancer Res. 51 (2): 48-475), prostatic acid phosphate (Tailor, et al., 1990, Nucí Acids, Res. 18 (1): 4928), prostate specific antigen (Hentttu and Vihko, 1989, Biochem. Res. Comm 10 (2): 903-910; Israeli et al., 1993, Cancer Res. 53: 227-230), antigen associated with p97 melanoma (Estin et al., 1989, J. Nati. Cancer Institute 81 (6): 445-44), gp75 melanoma antigen (Vijayasardahl et al., 1990, J. Exp. Med. 171 (4): 1375-1380), high molecular weight melanoma antigen (HMW-MAA) (Natali et al., 1987, Cancer 59: 55-3; Mittelman et al., 1990, J. Clin. Invest 86: 2136-2144)), prostate-specific membrane antigen, carcinoembryonic antigen (CEA) (Foon et al., 1994, Proc. Am. Soc. Clin. Oncol. 13: 294), polymorphic epithelial mucin antigen, human milk fat globule antigen, antigens associated with colorectal tumor such as: CEA, TAG-72 (Yokata et al., 1992, Cancer Res. 52: 3402-3408), C017-1A (Ragnhammar et al., 1993, Int. J. Cancer 53: 751-758); GICA 19-9 (Herlyn et al., 1982, J. Clin Immunol.2: 135), CTA-1 and LEA, antigen 38.13 of Burkit lymphoma, CD19 (Ghetie et al., 1994, Blood 83: 1329- 1336), CD20 antigen from human B-lymphoma (Reff et al., 1994, Blood 83: 435-445), CD33 (Sgouros et al., 1993, J. Nucí, Med. 34: 422-430), antigens specific to melanoma such as ganglioside GD2 (Saleh et al., 1993, J. Immunol., 151, 3390-3398), ganglioside GD3 (Shitara et al., 1993, Cancer Immunol. I munother. 36: 373-380), GM2 ganglioside (Livingston et al., 1994, J. Clin. Oncol 12: 1036-1044), GM3 ganglioside (Hoon et al., 1993, Cancer Res. 53: 5244-5250), cell surface antigen type of transplant tumor specific (TSTA) such as virus-induced tumor antigens including tumor T-DNA antigen T and tumor RNA virus envelope antigens, oncofetal-alpha-fetoprotein antigen such as colon CEA, tumor oncofetal antigen of bladder (Hellstrom et al., 1985, Cancer Res. 45: 2210-2188), differentiation antigen such as human lung carcinoma antigen L6, L20 (Hellstrom et al., 1986, Cancer Res. 46: 3917-3923), fibrosarcoma antigens, Gp37 antigen of human leukemia T cells, (Bhattacharya-Chatterjee et al., 1988, J. Of Immun. 141: 1398-1403), neoglycoprotein, sphingolipids, breast cancer antigen such as EGFR (epidermal growth factor receptor), HER2 antigen (pl85"), polymorphic epithelial mucin (PEM) (Hilkens et al., 1992 , Trends in Bio, Chem. Sci. 17: 359), malignant human lymphocyte APO-1 antigen (Bernhard et al., 1989, Science 245: 301-304), differentiation antigen (Feizi, 1935, Nature 314: 53-57) such as antigen I found in fetal erythrocytes and primary endoderm, I (Ma) found in gastric adenocarcinomas , M18 and M39 that are found in breast epithelium, SSEA-1 found in myeloid cells (VEP8, VEP9, Myl, VIM-D5 and 0: 56-22 that are found in colorectal cancer, TRA-1-85 ( blood group H), C14 found in colonic adenocarcinoma, F3 found in lung adenocarcinoma, AH6 found in gastric cancer, hapten Y, Le 'found in embryonal carcinoma cells, TL5 (blood group A ), EGF receptor that is found in A431 cells, the Ei series (blood group B) that is found in pancreatic cancer, FC10.2 that is found in embryonic carcinoma cells, gastric adenocarcinoma, CO-514 (Lea blood group) is found in adenocarcinoma, NS-10 that is found in adenocarcinomas, CO- 43 (Le 'blood group), G49 receptor, EGF (blood group ALec / Le-) which is found in colonic adenocarcinoma, 19.9 which is found in colon cancer, gastric cancer, mucins, T5A- which is found in myeloid cells, R- which is found in melanoma, 4.2, G, Dl.l, OFA-1, G? -, OFA-2, Gr_, Ml: 22: 25: 8 which is found in embryonic carcinoma cells and SSEA-3, SSEA-4 found in embryos in stages of 4-8 cells. In another embodiment, the antigen is a T cell receptor derived from the peptide of a cutan T cell lymphoma. (see Edelson, 1998, The Cancer Journal 4:62). In other embodiments of the invention, the individual to be treated with the modified antibody of this invention can, optionally, be treated with other cancer treatments such as surgery, radiation therapy or chemotherapy, in particular, the Therapeutics of the invention used to treat or prevent cancer can be administered together with one or a combination of chemotherapeutic agents including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, cisplatin, carboplatin, mitomycin, dacarbazine, procarbazine, an etoposide, a canfatecine, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, asparaginase, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, and so on. . 2.1.1 MALIGNITIES Malignancies and related disorders that can be treated or prevented by administration of the invention include, but are not limited to, those listed in Table 3 - (for a review of these disorders see Fishman et al., 1985, Medicine, 2nd edition JB Lippincott Co., Philadelphia): TABLE 3 RELATED MALIGNITIES AND DISORDERS Leukemia Acute leukemia Acute lymphocytic leukemia Acute myelocytic leukemia Promyelocytic myeloblatic Myelomonocytic Monocitic Erythroleukemia Chronic leukemia Chronic lymphocytic leukemia Polycythemia vera Lymphoma Lymphoma Hodgkin's disease Non-Hodgkin's disease Multiple myeloma Waldenstrom's macroglobulinemia Chain disease heavy Tumors and carcinomas fibrosarcoma mixosarcoma liposarcoma osteogenic sarcoma chordoma angiosarcoma endotheliosarcoma lymphangiosarcoma lymphangioendotheiosarcoma smovioma mesothelioma mesothelioma Ewing tumor leiomyosarcoma rhabdomyosarcoma colon carcinoma pancreatic cancer breast cancer ovarian cancer prostate cancer squamous cell carcinoma basal cell carcinoma adenocarcinoma carcinoma gland seborrhea carcinoma of sebaceous gland carcinoma papillary adenocarcinoma papillary cystadenocarcinoma medullary carcinoma bronchogenic carcinoma renal cell carcinoma hepatoma bile duct carcinoma choriocarcinoma seminoma embryonic carcinoma Wilms tumor cervical cancer uterine cancer testicular tumor lung carcinoma small cell lung carcinoma bladder carcinoma epithelial carcinoma glioma astrocytoma meduloblastoma craniopharyngoma ependymoma pinealoma hemangioblastoma acoustic neuroma oligodendroglioma meningioma melanoma neuroblastoma retinoblastoma In specific modalities, malignancy or dysproliferative changes (such as metaplasias and dysplasias), or hyperproliferative disorders are treated or prevented in the ovary, bladder, breast, colon, lung, skin, pancreas or uterus. In other specific modalities, it treats or prevents sarcoma, melanoma, or leukemia. . 2.1.2 PREMALIGN STATES The Therapeutics of the invention may also be administered to treat premalignant conditions and to prevent progression to a neoplastic or malignant state, which includes, but is not limited to, those conditions listed in Table 3. This use prophylactic or therapeutic is indicated in known conditions or that is suspected of preceding progress to neoplasia or cancer, in particular, where non-neoplastic cell growth has occurred consisting of hyperplasia, metaplasia or more specifically, dysplasia (for a review of these growth states abnormal see Robbins and Angeli, 197, Basic Pathology, 2nd edition W: B. Saunders Co., Philadelphia, pp. 8-79). Hyperplasia is a form of controlled cell proliferation that involves an increase in the number of cells in a tissue or organ, without significant alteration in structure or function. As an example, endometrial hyperplasia usually precedes endometrial cancer. Metaplasia is a form of controlled cell growth in which a type of adult or completely differentiated cells replaces another type of adult cells. Metaplasia can occur in cells of epithelial or connective tissue. Atypical metaplasia includes a somewhat disordered metaplastic epithelium. Dysplasia is usually a precursor to cancer, and is found mainly in the epithelium; it is the most disordered form of growth of non-neoplastic cells that includes a loss in the uniformity of the individual cells and in the architectural orientation of the cells. The dysplastic cells usually have abnormally large nuclei, deeply stained and present pleomorphism. Dysplasia occurs characteristically where there is chronic irritation or inflammation, and is usually found in the cervix, respiratory tract, oral cavity, and gallbladder. Otherwise, or in addition to the presence of abnormal cell growth characterized as hyperplasia, metaplasia or dysplasia, the presence of one or more characteristics of a transformed phenotype, or of a malignant phenotype, shown in vivo or shown in vi tro by a Cell sample from a patient may indicate the convenience of prophylactic or therapeutic administration of the vaccine composition. As mentioned above, such characteristics of a transformed phenotype include changes in morphology, less binding to the substrate, loss of contact inhibition, loss of anchoring dependence, release of proteases, increase in sugar transport, decrease in serum requirements, expression of fetal antigens, disappearance of the cell surface protein of 250,000 dalton, etc. (see also id., on pp. 84-90 for characteristics associated with a transformed or malignant phenotype). In a specific modality, leukoplakia, hyperplastic or dysplastic lesions with benign appearance of the epithelium or Bowen's disease, a carcinoma in yes t u, are preneoplastic lesions that are indicative of the convenience of prophylactic intervention. In another modality, fibrocystic disease (cystic hyperplasia, mammary dysplasia, particularly adenosis (benign epithelial hyperplasia) is indicative of the convenience of prophylactic intervention.In other modalities, a patient who presents one or more of the following predisposing factors for malignancy is treated by administering an effective amount of the therapeutic of the invention: a chromosomal translocation associated with a malignancy (e.g., the Philadelphia chromosome for chronic myelogenous leukemia, t (14,18) for follicular lymphoma, etc.), familial polyposis or Garndner syndrome (possible predecessors of colon cancer), benign monoclonal gammopathy (a possible predecessor of multiple myeloma), and a first degree kinship with people who have cancer or precancerous disease showing a Mendelian (genetic) inheritance pattern (for example, familial polyposis of the colon, Garndner syndrome, hereditary exostosis, adeno polyendocrine matosis, medullary thyroid carcinoma with amyloid and pheochromocytoma production, Peutz-Jeghers syndrome, von Recklinghausen neurofibromatosis, retinoblastoma, carotid body tumor, cutaneous melanocarcinoma, intraocular melanocarcinoma, xeroderma pigmentosa, ataxia telangiectasia, Chediak-Higashi syndrome, albinism , Fanconi aplastic anemia and Bloom syndrome; see Robbins and Angeli, 197, Basic Pathology, 2nd edition, W. B. Saunders Co. , Philadelphia, pp. 112-113) etc). In another specific embodiment, the therapeutic of the invention is administered to a human patient to prevent progression to ovarian, breast, colon, lung, pancreatic, skin, prostate, gastrointestinal, B lymphocyte, T lymphocyte or uterine cancer. , melanoma or sarcoma. . 2.2. TREATMENT OF INFECTIOUS DISEASES The invention also provides methods of treating or preventing infectious diseases by administering a Therapeutic of the invention, in particular a modified immunoglobulin molecule (or functionally active fragment, derivative or analogue thereof, or an acid). nucleic acid coding for the modified immunoglobulin, or the fragment, analog or functionally active derivative thereof) that is obtained from an immunoglobulin molecule that can bind immuno-specifically to an antigen of the causative agent of the infectious disease or a cellular receptor of the agent of the infectious disease. As described in more detail below, infectious agents include, but are not limited to, viruses, bacteria, fungi, protozoa and parasites. In specific embodiments, infectious diseases are treated or prevented by the administration of a modified immunoglobulin of the invention (or functionally active fragment, derivative or analogue thereof, or nucleic acid encoding the same) that is obtained from a immunoglobulin which specifically recognizes one of the following antigens of an infectious disease agent: influenza virus haemagglutinin (Genbank accession No. J02132; Air 1981, Proc Nati, Acad Sci USA 78: 739-743; Newton et al. , 1983, Virology 128: 495-501), glycoprotein G of the human respiratory syncytial virus (Genbank Access No. Z33429; Garcia et al., 1994, J. Virol; Collins et al., 1984, Proc. Nati. Acad. Sci USA 81: 783), the core protein, matrix protein or other protein of the dengue virus (Genbank Access No.

M19197; Hahn et al., 1988, Virology 12: 1780), hemagglutinin from measles virus (Genbank Access No. M81899; Rota et al., 1992, Virology 188: 135-142), glycoprotein gB type 2 (l of the herpes simplex virus (Genbank Access No. M14923; Bzik 5 et al., 198, Virology 155: 322-333), VP1 of poliovirus I (Emini et al., 1983, Nature 304; 99), glycoproteins of the envelope of HIV 1, such as gpl20 (Putney et al., 198, Science 234: 1392-1395), hepatitis B surface antigen (Itoh et al., 198, Nature 308: 19; Neurath et al. 198, Vaccine 4:34), diphtheria toxin (Audibert et al., 1981, Nature 289: 543), 24M streptococcal epitope (Beachey, 1985, Adv. Exp. Med. Biol. 185: 193), pilin [ sic] gonococcal (Rothbar and Schoolnik, 1985, Adv. Exp. Med. Biol. 185: 247), g50 pseudorabies virus (gpD), virus II pseudorabies (gpB), gilí pseudorabies virus (gpC), pseudorabies virus glycoprotein H, pseudorabies virus glycoprotein E, transmissible gastroenteritis glycoprotein 195, transmissible gastroenteritis matrix protein, rotavirus glycoprotein 38 pigs, pig parvovirus capsid protein, Serpulina hydrodi senteri ae protective antigen, bovine viral diarrhea glycoprotein 55"bovine, newcastle disease virus hemagglutinin-neuraminidase, swine influenza hemagglutinin, neuraminidase swine influenza, foot and mouth disease virus, swine flu virus, swine influenza virus, African swine fever virus, My copl asthma hypopneumoniae, infectious bovine rhinotracheitis virus (eg, glycoprotein E or infectious bovine rhinotracheitis virus glycoprotein G), infectious laryngotracheitis virus (eg G glycoprotein or infectious laryngotracheitis virus glycoprotein I), a la Crosse virus glycoprotein (Gonzales-Scarano et al., 1982, Virology 120: 42), neonatal bovine diarrhea virus (Matsuno and Inouye, 1983, Infection and Immunity 39: 155), equine myelitis encephalon virus from Venezuela (Mathews and Roehring, 1982, J. Immunol., 129: 273), punta toro virus [sic] (Dalrymple et al., 1981, in replication of Negative Strand Viruses Bioshop and Compans (eds.), Elsevier, NY, p. 17), murine leukemia virus (Steeves et al., 1974, J. Virol. 14: 187), mouse mammary tumor virus (Massey and Schochetman, 1981, Virology 115: 20), core protein of hepatitis B virus and / or surface antigen of hepatitis virus (see, for example, UK Patent Publication No. GB 2034323 A published on June 4, 1980, Ganem and Varmus, 1987, Ann. Rev. Biochem. 5: 51-93; Tiollais et al., 1985, Nature 317: 489-495), equine influenza virus antigen or herpes virus (for example, influenza virus type A / neuraminidase Alaska 91, equine influenza virus type A / neuraminidase Miami 63, equine influenza virus type A / neuraminidase Kentucky 81, glycoprotein B equine herpes virus type 1, glycoprotein D herpes virus equine type 1, bovine respiratory syncytial virus antigen or bovine parainfluenza virus (for example, bovine respiratory syncytial virus binding protein (BRSV G), bovine respiratory syncytial virus fusion protein (BRSV N), nucleocapsid protein of the syncytial virus bovine respiratory (BRSV N), type 3 bovine parainfluenza virus fusion protein, and hemaglutinin neuraminidase of bovine parainfluenza virus type 3), glycoprotein 48 or glycoprotein 53 of bovine viral diarrhea virus. In other specific embodiments, the infectious diseases are treated or prevented by the administration of a modified immunoglobulin (or functionally active fragment, derivative or analogue thereof, or nucleic acid encoding the same) that recognizes a cellular receptor for the agent of infectious disease, for example but not limited to, cellular receptors, together with their corresponding pathogens that are mentioned in Table 4.

Table 4 Table 4 (continued) Table 4 (continued) Table 4 (continued) Viral diseases can be treated or prevented by the methods of the present invention which include, but are not limited to, those caused by hepatitis type A, hepatitis B, hepatitis C, influenza, varicella, adenovirus, herpes simplex type I ( HSV-I), herpes simplex type II (HSV-II), rinderpest, rhinovirus, deervirus, rotavirus, respiratory syncytial virus, papilloma virus, papovavirus, cytomegalovirus, equinovirus, arbovirus, hantavirus, coxsachie virus, mumps virus, virus of measles, rubella virus, poliovirus, human immunodeficiency virus type I (HIV-1), human immunodeficiency virus type II (HIV-II), picornavirus, enterovirus, calicivirus, and any of the Norwalk virus group, togavirus (such as dengue virus), alphavirus, flavivirus, coronavirus, rabies virus, Marburg virus, ebola virus, parainfluenza virus, orthomyxovirus, bunyavirus, arenavirus, reovirus, rotavirus, orbivirus, leukemia virus, human T cells type I, human T cell leukemia virus type II, simian immunodeficiency virus, lentivirus, polyoma virus, parvovirus, Epstein-Barr virus, human herpes virus, herpes virus cercopithecine 1 (virus B) poxvirus and encephalitis. Bacterial diseases that can be treated or prevented by the methods of the present invention are caused by bacteria including, but not limited to, gram-negative and gram-positive bacteria, mycobacteria rickettsia, mycoplasma, Neisseria spp. (for example, Neisseria menningi tidis and Neisseria gonorrhoeae), Legionella, Vibri or cholerae, Streptococci, as Streptococcus pneumoniae, corynebacteria diphtheriae, clostridium um tetani, bordetella pertussis, Haemophilus spp. (for example, influenza), Chlamydia spp., Enterotoxigeni Escherichia coli, Shigella spp. etc., and bacterial diseases such as syphilis, Lyme disease, and so on. Protozoa diseases that can be treated or prevented by the methods of the present invention are caused by protozoa including, but not limited to, plasmodium, eimeria, leishmania, kokzidioa, trypanosome, fungi such as candida, and so on. In the specific embodiments of the invention, the Therapeutics of the invention is administered together with an antibiotic, antifungal, antiviral or any other suitable drug useful in the treatment or prevention of the infectious disease. . 3. GENETIC TREATMENT Genetic treatment refers to the treatment or prevention of a disease and is carried out by administering a nucleic acid to an individual who has it. a disease associated with the expression of the antigen that is recognized by the immunoglobulin molecule from which the modified immunoglobulin molecule originates. For example, the disease or disorder may be a cancer associated with the expression of a specific cancer or tumor agent or an infectious disease associated with the expression of a particular antigen of an infectious disease agent or by which the infectious disease agent it binds to a particular cellular receptor. In this embodiment of the invention, the therapeutic nucleic acid encodes a sequence that is produced within the cell (without a leader sequence) or between the cells (with the leader sequence), a modified immunoglobulin. For general reviews of the methods of genetic treatment see Goldspiel et al., 1993, Clinical Pharmacy 12: 488-505; Wu and WU, 1991, Biotherapy 3: 87-95; Tolstoshev 1993, Ann. Rev. Pharmacol. Toxicol 32: 573-596; Mulligan, 1993, Scice 260: 926-932; and Morgan and Aderson, 1993, Ann Rev. Biochem. 62: 191-217). Methods that are commonly used in the technique of recombinant DNA technology that can be used are described in Ausubel et al., (Eds.), 1993, Current Protocols in Molecular Biolohy, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Ecpression A Laboratory Manual, Stokton Press, NY; and in chapters 12 and 13, Dracopoli et al., (eds.), 1994, Current Protocols in Human Genetics John Wiley & Sons, NY). In one aspect, the therapeutic nucleic acid contains an expression vector that expresses the modified immunoglobulin molecule. The delivery of the nucleic acid in a patient can be direct, in which case the patient is exposed directly to the nucleic acid or nucleic acid carrier vector, or a complex or indirect supply, in which case, cells are first transformed with the acid nucleic in vi tro, then the patient is transplanted. These two approaches are known, respectively, as genetic treatment, in vi vo or ex vivo. In a specific embodiment, the nucleic acid is administered directly in vivo, where it is expressed to produce the antibodies. This can be achieved by any of the numerous methods known in the art, for example, by building it as part of a suitable nucleic acid expression vector and administering it so as to become intracellular, for example, by infection using a retroviral vector or other defective or attenuated viral vector (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by the use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or by coating with lipids or receptors on the surface of cells or transfection agents, encapsulation in biopolymers (for example polysaccharide poly-β-l-> 4-N-acetylglucosamine, see US Patent No. 5,635,493), encapsulation in liposomes, microparticles, or microcapsules, or administering it at the link to a peptide that is known to enter the nucleus, administering it at the link to a known ligand r entering the nucleus, administering it in the binding to a ligand subject to endocytosis mediated by the receptor (see, for example, Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432), etc. In another embodiment, the nucleic acid-ligand complex can be formed in which the ligand contains a fusogenic viral peptide for the disruption of endosomes, allowing the nucleic acid to prevent lysosome degradation. In yet another embodiment, the nucleic acid can be directed in vivo to specific uptake and expression of the cell, by targeting a specific receptor (see, for example, PCT publications WO 92/06180 dated April 16, 1992 (Wu et al.), WO 92/22635 dated December 23, 1992, (Wilson et al.); WO 92/20316 dated November 26, 1992 (Findeis et al.); WO 93/14184 dated July 22, 1993 (Young). Otherwise, the nucleic acid can be introduced intracellularly and incorporated into the host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Nati. Acad. Sci. USA 86: 8932-8935; Zijlstra et al., 1989, Nature 342: 435-438). Otherwise, single chain antibodies, such as neutralizing antibodies, which bind to intracellular epitopes can also be administered. These single chain antibodies can be administered, for example, by expressing the nucleotide sequences encoding the single chain antibodies without the target cell population using, for example, techniques such as those described in ( Marasco et al., 1993, Proc. Nati. Acsad. Sci. USA 90: 7889-7893). Adenoviruses are other viral vectors that can be used in genetic treatment. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium where they cause moderate disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3: 499-503 present a review of adenovirus-based genetic treatment. Bout et al., 1994, Human Gene Therapy 5: 3-10 demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelium of rhesus monkeys. Other cases of adenovirus use in genetic treatment can be found in Rosenfeld et al., 1992, Cell 68: 143-155; and Mastrangeli et al., 1993, J. Clin. Invest. 91: 225-234. Adeno-associated viruses (AAV) have also been proposed for use in genetic treatments (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204: 289-300). The form and amount of the therapeutic nucleic acid considered for use depends on the type of the disease and the severity of its desired effect, the condition of the patient, etc., and can be determined by one skilled in the art. . 3. VACCINE AND ADMINISTRATION FORMULATIONS The invention also provides the vaccine formulations containing the Therapeutics of the invention, which vaccine formulations are suitable for administration in order to produce a protective immune response (humoral and / or cell-mediated), against certain antigens, for example, for the treatment and prevention of diseases. Suitable preparations of these vaccines include injectables, such as liquid solutions or suspensions; Suitable solid forms for solution in, or suspension in, liquids before injection may also be prepared. The preparation can also be emulsified, or the polypeptides can be encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, buffered saline, dextrose, glycerol, ethanol, sterile isotonic aqueous buffer or the like, and combinations thereof. In addition, if desired, the vaccine preparation may also include minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and / or adjuvants that improve the effectiveness of the vaccine. Examples of adjuvants that may be effective include, but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L- alanyl-D-isoglutamine, N-acetylmuramii-L-alanyl-D-isoglutaminyl-L-alanin-2- (1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) -ethylamine. The efficacy of an adjuvant can be determined by measuring the induction of anti-idiotype antibodies directed against the injected immunoglobulin formulated with the specific adjuvant. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained-release formulation or powder. The oral formulation may include normal carriers such as the pharmaceutical grades of mannitol, lactose, magnesium starch stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. In general, the ingredients are supplied separately or mixed together in unit dosage form, for example, as a dehydrated lyophilized powder or concentrate without water in a sealed container such as an ampoule or sachet indicating the amount of the active agent . When the composition is administered by injection, a vial of the sterile diluent can be provided so that the ingredients can be mixed before administration. In a specific embodiment, the lyophilized modified immunoglobulin of the invention is provided in a first container; a second container contains the diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol and an antiseptic (eg, 0.005-bright green). The invention also provides a pharmaceutical pack or kit containing one or more containers filled with one or more of the ingredients of the vaccine formulations of the invention. Associated with the container (s) may be a note in the form prescribed by a government office that regulates the manufacture, use or sale of pharmaceutical or biological products, whose note shows approval by the manufacturing unit , use or sale for human administration. If desired, the compositions may be present in a package or dispensing device that may contain one or more unit dosage forms containing the active ingredient. The package may, for example, contain metal or plastic foil, such as a blister pack. The package or dispensing device may be accompanied by instructions for administration. The composition containing a compound of the invention formulated in a compatible pharmaceutical carrier can also be prepared, placed in a suitable container and labeled for the treatment of an indicated condition. The individual to whom the vaccine is preferably administered is a mammal, most preferably a human, but it can also be a non-human animal that includes, but is not limited to cows, horses, sheep, pigs, birds (e.g. chickens) , goats, cats, dogs, hamsters, mice and rats. It is possible to use different methods to introduce the vaccine formulations of the invention; these include, but are not limited to oral, intracerebral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal and scarification (scraping the upper layers of the skin, for example, using a bifurcated needle) or any other route of immunization normal tf. In a specific embodiment, 5 scarification is employed. The precise dose of the modified immunoglobulin molecule that can be used in the formulation will also depend on the route of administration and the nature of the patient, and should be decided according to the judgment of the physician and the circumstances of each patient in accordance with the normal clinical techniques. An effective immunizing amount is sufficient to produce an immune response for the immunoglobulin modified host molecule (ie, an anti-idiotype reaction) for which the vaccine preparation is administered. Effective doses can also be extrapolated from dose-response curves obtained from test systems in animal models. 5.4. METHOD OF PRODUCTION OF MODIFIED IMMUNOGLOBULINS The modified immunoglobulins of the invention can be produced by any method known in the art for the synthesis of immunoglobulins, in particular, by Chemical synthesis or by recombinant expression and, preferably, are produced by recombinant expression techniques. The recombinant expression of the modified immunoglobulin of the invention, or fragment, derivative or analogue thereof, requires the construction of a nucleic acid encoding the modified immunoglobulin. If the nucleotide sequence of the modified immunoglobulin is known, a nucleic acid encoding the modified immunoglobulin can be assembled from chemically synthesized oligonucleotides (for example, as described in Kutmeier et al., 1994, BioTechniques 17: 242) , which, briefly, includes the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the modified immunoglobulin, the annealing and ligation of these oligonucleotides and then the amplification of the oligonucleotides linked by the PCR, for example, as exemplified in section 6, infra. Otherwise, the nucleic acid encoding the modified immunoglobulin can be generated from a nucleic acid encoding the immunoglobulin from which the modified immunoglobulin is obtained. If a clone containing the nucleic acid encoding the particular immunoglobulin is not available, but the sequence of the immunoglobulin molecule is known, it is possible to obtain a nucleic acid encoding the immunoglobulin from a suitable source (e.g. an antibody cDNA library, or cDNA library generated from any tissue or cell that expresses immunoglobulin) or by PCR amplification using synthetic primers that can hybridize to the 3 'and 5' endings of the sequence or by hybridization using an oligonucleotide probe specific for the particular genetic sequence. If an immunoglobulin molecule that specifically recognizes a particular antigen is not available (or a source is not available for a cDNA library to clone a nucleic acid encoding such an immunoglobulin) the immunoglobulins specific for a particular antigen can be generated by either of the methods known in the art, for example, immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, generating monoclonal antibodies, for example, as described in Kohler and Milstein (1975, Nature 256: 495-497) or, as described by Kozbon et al., (1983. Immunology Today 4:72) or Cole et al., (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Otherwise it is possible to obtain a clone that codes for at least the Fab portion of the immunoglobulin by detecting the Fab expression libraries (eg, as described in Huse et al., 1989, Science 246: 1265-1281) for measurements. of Fab fragments that bind to the specific antigen or detecting the antibody libraries (see, for example, Claxon et al., 1991, Nature 352: 624; Hane et al., 1997 Proc. Nati. Acad. Sci. USA 94: 4937). Once a nucleic acid encoding at least the variable domain of the immunoglobulin molecule is obtained, it can be introduced into any available cloning detector, and can be introduced into a vector containing the nucleotide sequence coding for the constant region of the immunoglobulin molecule (see, for example, PCT publication WO 86/05807, PCT publication WO 89/01036, U.S. Patent No. 5,122,464 and Bebbington, 1991, Methods in Enzymology 2: 136-145 ). The vectors containing the complete light or heavy chain for co-expression with the nucleic acid to allow the expression of a complete antibody molecule are also available, see Id. Then, the nucleic acid encoding the immunoglobulin can be modified to introduce the nucleotide substitutions or deletions necessary to substitute (or deletion) the one or more cysteine residues of the variable region involved in a binding. Intrachain with an amino acid residue does not contain a sulfhydryl group, along with other substitutions, deletions or nucleic acid insertions desired. These modifications can be made by any of the methods known in the art for the introduction of specific mutations or deletions in a nucleotide sequence, for example, but not limited to, chemical mutagenesis, site-directed mutagenesis in vi tro, (Hutchinson et al., 1978, J. Biol. Chem. 253: 6551), PCR-based methods, et cetera. In addition, it is possible to use the techniques developed for the production of chimeric antibodies (Morrison et al., 1984, Proc. Nati. Acad. Sci. 81: 851-855; Neuberger et al., Nature 312: '604-608; Takeda et al., 1985, Nature 314: 452-454) by splicing genes from a mouse antibody molecule of suitable antigenic specificity together with genes from a human antibody molecule of suitable biological activity. As described above, a chimeric antibody is a molecule in which different portions are obtained from different animal species, such as those having a variable region from a murine monoclonal antibody and a constant region from a human immunoglobulin, by example, humanized antibodies. Otherwise, the techniques described for the production of single chain antibodies (U.S. Patent No. 4,694,778; Bird, 1988, Science 242: 423-42; Huston et al., 1988, Proc Nati. Acad. Sic. USA 85 : 5879-5883; and Ward et al., 1989, Nature 334: 544-54), can be adapted to produce single chain antibodies. The single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region through an amino acid bridge giving rise to a single chain polypeptide. Techniques for assembling functional Fv fragments in E. coli can also be used (Skerra et al., 1988, Science 242: 1038-1041). Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, these fragments include, but are not limited to: F (ab ') fragments: which can be produced by digestion with pepsins of the antibody molecule and Fab fragments that can be generated by reducing the disulfide bridges of the F fragments (ab '); Once the nucleic acid encoding the modified immunoglobulin molecule of the invention has been obtained, the vector for the production of the immunoglobulin molecule can be produced by the recombinant DNA technology using well known techniques. The modified immunoglobulin molecule can then be expressed recombinantly and isolated by any of the known methods, for example, using the method described in section 6, supra, (see, Bebbington, 1991, Methods, in Enzymology 2 : 136-145). Briefly, COS cells, or any other suitable cultured cells, can be transiently or non-transiently transfected with the expression vector encoding the modified immunoglobulin, cultured for a suitable time to allow the expression of the immunoglobulin and then the Supernatant can be harvested from COS cells, whose supernatant contains the expressed, secreted immunoglobulin. It is possible to use methods well known to those skilled in the art to construct expression vectors containing immunoglobulin molecule coding sequences and suitable transcription and translation control signals, these methods include, for example, recombinant DNA techniques in vi tro, synthetic techniques and genetic recombination in vi vo. See, for example, the techniques described in Sambrook et al., (1990, Molecular Cloning, A Laboratory Manual, 2nd Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and Ausubel et al., (Eds., 1998, Current Protocols In Molecular Biology, John Wiley &Sons, NY). The expression vector is transferred to a host cell by the conventional techniques and the transfected cells are then cultured by traditional techniques to produce the immunoglobulin of the invention. The host cells which are used to express the recombinant antibody of the invention can be bacterial cells such as Escheri chia coli, or preferably, eukaryotic cells, especially for the expression of complete recombinant immunoglobulin molecules. In particular, for immunoglobulins an effective expression system is mammalian cells such as Chinese hamster ovary (CHO) cells, together with a vector such as the promoter element of the early human cytomegalovirus major intermediate gene (Foecking et al., 198, Gene 45: 101, Cockett et al., 1990, Bio / Technology 8: 2). To express the modified immunoglobulin molecules of the invention it is possible to use a variety of host-vector expression systems. These host-expression systems represent vehicles through which the coding sequences of interest can be produced and subsequently purified, but also represent cells that can, when transformed or transfected with the appropriate nucleotide coding sequences, express the immunoglobulin molecule of the invention in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. Coli, B. subtilis) transformed with expression vectors of bacteriophage DNA, plasmid DNA or recombinant cosmid DNA containing the immunoglobulin coding sequences; yeast (for example, Sacharomyces, Pi chia) transformed with recombinant yeast expression vectors containing the immunoglobulin coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) encoding the immunoglobulin coding sequences; plant cell systems infected with recombinant virus expression vectors (eg, cauliflower mosaic virus, CaMV, tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (eg, Ti plasmid) containing the immunoglobulin coding sequences; or mammalian cell systems (eg, COS, CHO, BHK, 293, 3T3 cells) anchoring recombinant expression constructs containing promoters from the genome of mammalian cells (eg, the metallothionein or mammalian virus promoter (e.g. for example, the adenovirus late promoter, the 7.5K promoter of the vaccine virus.) In bacterial systems, it is possible to select numerous expression vectors depending on the proposed use for the immunoglobulin molecule to be expressed. example, when a large amount of such a protein is to be produced for the generation of pharmaceutical compositions of an immunoglobulin molecule, vectors that direct the expression of high concentrations of the fusion protein products that are easily purified may be desirable. These vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), and n which the immunoglobulin coding sequence can be linked individually in the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, 1985, Nucleic Acids Re's 13: 1301-3109, Van Heeke &Schuster, 1989, J. Biol. Chem. 24: 5503-5509); and similar. The pGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, these fusion proteins are soluble and can be easily purified from cells used by adsorption and binding to a glutathione-agarose beads matrix followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST portion. In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The sequence that codes (t) Immunoglobulin can be cloned individually into 5 non-essential regions (eg, the polyhedrin gene) of virus and placed under the control of an AcNPV promoter (eg, the polyhedrin promoter.) In mammalian host cells it is possible use different virus-based expression systems.

Where an adenovirus is used as an expression vector, the immunoglobulin coding sequence of interest may be linked to an adenovirus transcription / translation control complex, eg, the late promoter and the tripartite leader sequence. This gene The chimeric can then be inserted into the adenovirus genome by recombination in vi tro or in vi vo. The insertion in a non-essential region of the viral genome (for example, the El region or E3) will give rise to a recombinant virus that is viable and capable of expressing the molecule of immunoglobulin in infected hosts (for example, see Logan &Shenk, 1984, Proc. Nati, Acad. Sci. USA 81: 355-359). It is also possible to require specific initiation signals for the efficient translation of the inserted immunoglobulin coding sequences.

These signals include an ATG start codon and adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translation control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be improved by the inclusion of suitable transcription enhancer elements, transcription terminators, etc. (See Bittner et al., 1987, Methods in Enzymol, 153: 51-544). In addition, it is possible to choose a host cell strain that modulates the expression of the inserted sequences or modifies and processes the genetic product in the specific manner desired. These modifications (e.g., glycosylation) and processing (e.g., cleavage) of the protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Suitable cell lines or host systems can be chosen to ensure correct modification and processing of the expressed foreign protein. For this purpose, it is possible to use eukaryotic host cells that possess the cellular machinery for the proper processing of the primary transcript, glycosylation and phosphorylation of the genetic product. These mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38. For the high-yield, long-term production of the recombinant proteins, stable expression is preferred. For example, cell lines that stably express the immunoglobulin molecule can be manipulated. Instead of using expression vectors containing viral origins of replication, the host cells can be transformed with DNA controlled by suitable expression control elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. After the introduction of the foreign DNA, the manipulated cells can be allowed to grow for 1-2 days in an enriched medium and then switch to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows the cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and extended into cell lines. This method can be conveniently used to manipulate cell lines that express the immunoglobulin molecule. These manipulated cell lines may be particularly useful in the detection and evaluation of compounds that interact directly or indirectly with the immunoglobulin molecule. It is possible to use different selection systems including, but not limited to, herpes simplex virus thymidine kinase genes (Wigler et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Zsybalska and Zsybalski 192, Proc. Nati, Acad. Sci. USA 48: 202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22: 817) can be employed in tk ~, hgprt "or aprt" cells, respectively. It is also possible to use resistance to antimetabolites as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Nat. Acad. Sci. USA 7: 357; Hare et al., 1981, Proc. Nati, Sci.USA 78: 1527); gpt conferring resistance to mycophenolic acid (Mulligan and Berg, 1981, Proc Nati Acad Sci USA 78: 2072); neo, which confers resistance to the amino glucoside G-418 Clinical Pharmacy 12: 488-505; Wu and WU, 1991, Biotherapy 3: 87-95; Tolstoshev 1993, Ann. Rev. Pharmacol. Toxicol 32: 573-596; Mulligan, 1993, Science 260: 926-932; and Morgan and Aderson, 1993, Ann Rev. Biochem. 62: 191-217; May 1993, TIBTECH 11 (5): 155-215). The commonly known methods of recombinant DNA technology that can be used are described in Ausubel et al., (Eds.), 1993, Current Protocols in Molecular Biolohy, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression A Laboratory Manual, Stockton Press, NY; and in chapters 12 and 13, Dracopoli et al., (eds.), 1994, Current Protocols in Human Genetics John Wiley & Sons, NY; Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1. Otherwise, any fusion protein can be easily purified using an antibody specific for the fusion protein to be expressed. For example, a system described in Janknecht et al. Allows easy purification of non-denatured fusion proteins expressed in human cell lines.

(Janknecht et al., 1991, Proc. Nati Acad. Sci. USA 88: 8972-897). This system, the gene of interest is subcloned into a vaccine recombination plasmid so that the open reading frame of the gene is fused during translation into an amino terminal tag consisting of six histidine residues. The label serves as a matrix binding domain for the fusion protein. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2 + nitriloacetic acid-agarose columns and the histidine-tagged proteins selectively eluting are buffer solutions containing imidazole. The expression levels of the immunoglobulin molecule can be increased by amplification of the vector (for a review, see Bebbington and Hentschel, the Use of Vector Base on Gene Amplification for the Expression of Cloned Genes in Mammalian Cells in DNA Cloning, Vol. (Academic Press, New York, 1987)). When a marker in the vector system expressing immunoglobulin is amplifiable, the increase in the level of the inhibitor present in the culture of the host cells will increase the copy number of the marker gene. Since the amplified region is associated with the immunoglobulin gene, the production of immunoglobulin will also increase (Crouse et al., 1983, Mol.Cell. Biol. 3: 257). The host cells can be co-transfected with two expression vectors of the invention, the first vector encoding a polypeptide derived from the heavy chain and the second vector encoding a polypeptide derived from the light chain. The two vectors may contain identical selectable markers that allow equal expression of the heavy and light chain polypeptides. Otherwise, it is possible to use a single vector that codes for both heavy and light chain polypeptides. In these cases, the light chain must be placed before the heavy chain to avoid an excess of the heavy chain without toxic (Proudfoot, 1986, Nature 322: 52, Kohler, 1980, Proc. Nati.

Acad. Sci. USA 77: 2197). The coding sequence for the heavy and light chains may contain cDNA or genomic DNA.

Once the modified immunoglobulin molecule of the invention has been expressed recombinantly, it can be purified by any of the methods known in the art for the purification of a molecule of immunoglobulin, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after protein A, and column chromatography by size), centrifugation, differential solubility or by any of the other normal techniques for protein purification.

. DEMONSTRATION OF THE THERAPEUTIC UTILITY The modified antibodies of the invention can be detected or assayed in different ways for efficacy in the treatment or prevention of a specific disease. First, the immunopotency of a vaccine formulation containing the modified antibody of the invention can be determined by monitoring the anti-idiotypic response of 20 test animals after immunization with the vaccine. The generation of a humoral response can be taken as an indication of a generalized immune response, other components of which, particularly cell-mediated immunity, may be important for protection against a disease. The test animals may include mice, rabbits, chimpanzees and finally humans. A vaccine prepared in this invention can be prepared to infect chimpanzees experimentally. However, since chimpanzees are a protected species, the antibody response to a vaccine of the invention can be first studied in different smaller, less expensive animals, in order to find one or two of the best immunoglobulin molecules. candidate or better combinations of immunoglobulin molecules for use in efficacy studies in chimpanzees. The immune response of the test individuals can be analyzed by different methods such as the reactivity of the resulting immune serum to the antibodies, as assayed by known techniques, for example, the enzyme-linked immunosorbent assay (ELISA), immunoblots , radioimmunoprecipitations, etc.; or protection from infection and / or attenuation of disease symptoms in immunized hosts. As an example of tests on suitable animals, the vaccine composition of the invention can be tested in rabbits for the ability to induce an anti-idiotypic response to the modified immunoglobulin molecule. For example, it is possible to use New Zealand white rabbits, males, without specific pathogens (SPF), young adults. The rabbits test group each receives an effective amount of the vaccine. A control group of rabbits receives an injection in 1 mM Tris-HCl pH 9.0 of the vaccine containing a natural antibody. The blood samples can be extracted from the rabbits every one or two weeks, and the serum can be analyzed for the anti-idiotypic antibodies for the modified immunoglobulin molecule and the anti-anti-idiotypic antibodies specific for the antigen against which the modified antibody using, for example, radioimmunoassay (Abbott Laboratories). The presence of anti-idiotypic antibodies can be assayed using ELISA. Because rabbits can give a variable response due to their exogamic nature, it can also be useful to test vaccines in mice. In addition, a modified antibody of the invention can be tested first by administering the modified antibody to a test individual, animal or human, and then isolating anti-anti-idiotypic antibodies (ie, Ab3 antibodies) generated as part of the response anti-idiotype for the modified antibody, injected. The asylated Ab3 can then be tested for the ability to bind to the specific antigen (eg, a tumor antigen, an infectious disease agent antigen or by any of the immunoassays known in the art, for example, but is not limited to , radioimmunoassays, ELISA, sandwich immunoassay, gel diffusion precipitin reactions, immunodiffusion assays, western blot, precipitation reactions, agglutination assays, tf complement fixation assays, immunofluorescence, protein A assays, immunoelectrophoresis assays, etcetera. In an aspect where the modified antibody is directed against a cancer or tumor antigen, the efficacy of the isolated Ab3 to treat cancer, a tumor or other disease neoplasm is detected by culturing the cancer or tumor cells of a patient, contacting the cells with the Ab3 antibody to be tested and comparing the proliferation or survival of the cells that were put in contact with the proliferation or survival of the cells. cells that did not make contact with the Ab3 antibody, wherein the lower level of proliferation or survival of the cells that made contact indicates that the Ab3 antibody (which was produced by immunization with the modified antibody of the invention) is effective in treating the Cancer in the patient. It is possible to use different assays normal in the art to assess such survival and / or growth; for example, the proliferation of cells can be tested by measuring the incorporation of "H-thymidine, by the direct cell count, detecting the changes in the transcriptional activity of genes known as proto-oncogenes (eg, fos, myc) or cell cycle markers; cell viability can be assessed by staining with tripane blue, differentiation can be assessed visually based on changes in morphology, etc. If the modified antibody is directed against an antigen of an infectious disease agent, the isolated Ab3 can be tested for activity in any in vitro test for activity against the specific pathogen. In addition, the modified antibodies of the invention can also be tested directly in vi vo. To check the effect of a Therapeutic of the invention, the level of the antigen against which the modified antibody is directed is measured at appropriate time intervals before, during or after the treatment. Any change or absence of change in the amount of the antigen can be identified and correlated with the effect of the treatment on the individual. In particular, in the case of cancer therapeutics, the concentrations of a serum antigen have a direct relationship with the severity of a cancer, such as breast cancer, and poor prognosis. In general, a decrease in antigen concentration is associated with effective treatment. When the modified antibody is directed against an antigen of an infectious disease agent, the effectiveness of the modified antibody can be monitored by measuring the antigen concentration of the infectious disease agent at appropriate times before, during and after treatment, where a decrease in the concentrations of the antigen indicate that the modified antibody is effective. In a preferred aspect, the approach that can be taken is to determine antigen concentrations at different points in time and compare these values with an initial concentration. The initial concentration may be the concentration of the marker present in normal individuals, without disease; and / or the concentrations present before treatment or during the remission of the disease, or during periods of stability. These concentrations can then be correlated with the course of the disease or the outcome of the treatment. Antigen concentrations can be determined by any method well known in the art. For example, it is possible to quantify a certain antigen by the immuno-diagnostic methods known as immunoprecipitation with western blot using any antibody against a certain antigen. The intensity of the immune response in vi for the modified immunoglobulin can be determined by any method known in the art, for example, but not limited to, late skin hypersensitivity test and cytolytic T lymphocyte activity assays in vi tro. < r. The tests of delayed hypersensitivity in the skin are 5 of great value in the tests of global immunity of immunocompetence and cellular for an antigen. Proper skin testing techniques require antigens to be stored sterile at 4 ° C, protected from light and reconstituted shortly before use. A 25 gauge needle or 27 guarantees intradermal rather than subcutaneous administration of the antigen. 24 and 48 hours after the intradermal administration of the antigen, the larger dimensions of erythema and induration are measured with a ruler. The hypoactivity to any antigen or group of antigens The test is confirmed by testing with higher concentrations of the antigen or, in ambiguous circumstances, by a repeated test with an intermediate test. To test the activity of the cytolytic T lymphocytes, the T lymphocytes isolated from the individual immunized, for example, by the Ficoll-Hypaque centrifugation gradient technique, are restimulated with cells carrying the antigen against which the modified antibody was directed in RPMI medium 3 ml containing 10? of fetal bovine serum. In some experiments, it is included 33% of the culture supernatant of combined lymphocytes, secondary or IL-2 in the culture medium as a source of T cell growth factors. To measure the primary response of the cytolytic T lymphocytes after immunization, the T cells isolated are cultured with or without the cells carrying the antigen. After six days, the cultures are tested for cytotoxicity in a test for the release of 51 Cr in four hours. The spontaneous 51 Cr release of the targets should reach a level of less than 20% if the immunization was effective (Heike et al., J. Immunotherapy 15: 15-174). In other aspects, it is possible to test the immunoglobulins modified for efficacy by monitoring the individual for the improvement or recovery of the particular disease or condition associated with the antigen against which the modified antibody was directed. When the modified antibody is directed against a tumor or a cancer antigen, the progress of the particular tumor or cancer can be followed by any known diagnostic or detection method to monitor the cancer or a tumor. For example, but not as a limitation, the progress of the cancer or tumor can be monitored by testing the levels of the cancer antigen or particular tumor (or other antigen associated with the cancer or particular tumor) in the individual's serum or by injecting a specific labeled antibody. for the antigen. In addition, to monitor the progress of the cancer or tumor it is possible to use other imaging techniques such as scanning by computed tomography (CT) or sonograms, or any other method for image formation. Biopsies can also be done. Before performing these tests in humans, it is possible to perform tests for the efficacy of modified immunoglobulins in animal models of cancer or particular tumor. In the case of infectious diseases, the efficacy of the modified antibody can be tested by administering the modified antibody to an individual (a human individual or an animal model for the disease) and then checking the levels of the particular infectious disease agent or the symptoms of the specific infectious disease. The levels of the infectious disease agent can be determined by any method known in the art for testing the levels of an infectious disease agent, for example, the viral titer, in the case of a virus, or the amounts of bacteria (e.g. , culturing a patient sample, etc. The levels of the infectious disease agent can also be determined by measuring the levels of the antigen against which the modified immunoglobulin or other antigen of the infectious disease agent was targeted. of the infectious disease agent or an improvement in the symptoms of the infectious disease indicate that the modified antibody is effective. 6. EXAMPLE: INDUCTOR OF THE ANTI-IDIOTYPIC VACCINE FOR COLON CANCER This example describes the construction of a modified antibody from the monoclonal antibody MAb31.1 (the MAb31.1 secretory hybridoma is available to the American Type Tissue Collection as access No. HB12314). Mab31.1 recognizes an antigen expressed by human colon carcinomas. The modified antibody of the invention, based on Mab31.1, was manipulated to have cysteine residues in the variable region of the variable regions of the heavy and light chain substituted with alanine. Thus, the resulting modified antibody had no intrachain chain disulfide linkages in the variable regions of the heavy and light chain. 6. 1. CONSTRUCTION OF A MODIFIED ANTIBODY The strategy for the construction of the modified antibody was to construct two manipulated genes that codified for the heavy and light chain variable regions where the specific cysteine residues, known to be important in the intrachain disulfide bond, they were altered with alanine. The alanine residues were substituted for the cysteine residues at positions 22 and 92 of the variable region of the heavy chain of the antibody from Mab31.1 or at positions 23 and 88 of the variable region of the Mab31 light chain. 1 of the antibody from Mab31.1. To construct these manipulated genes, the oligonucleotide groups were assembled (as described below) and inserted into a suitable vector that provides the constant regions. To construct the variable region genes coding for CDRs lacking intrachain disulfide bonds, the following strategy was performed. First, the single-stranded oligonucleotides were annealed to create cohesive double-stranded DNA fragments (as seen in the diagram of Figure 10, step 1). Specifically, oligonucleotides of approximately 80 bases in length corresponding to the sequences of interest with overlapping 20 base regions were synthesized using the automated techniques of GenoSys Biotech Inc. The specific sequences of each of these oligonucleotides are presented in Figures 9A and 9B . Figure 9A lists the group of 10 oligos used in the manipulation of a variable heavy chain gene called 2CAVHCOL1. Compared to the variable consensus heavy chain gene, 2CAVHCOL1 lacks two cysteine residues. Figure 9B lists the group of 12 oligos used in the manipulation of the variable region gene of the light chain called 2CAVHCOL1. The ff '2CAVHCOL1 gene lacks two cysteine residues when compared to the gene of the variable region of the consensus light chain. To combine the oligos into the desired gene, groups of 10 or 12 oligos were combined as described below and as presented in Figure 10, where the identities of oligos 1 to 10 indicated in Figure 10 are given in Table 5. Prior to the combination, each oligonucleotide was phosphorylated at the 5 'position as follows: 25 μl of each oligo was incubated for one hour in the presence of T4 oligonucleotide kinase and 50 mM ATP at 37 ° C. The reactions were interrupted heated for five minutes at 70 ° C followed by ethanol precipitation. Once phosphorylated, the complementary oligonucleotides (oligo 1 + oligo 10, oligo 2 + oligo 9, oligo 3 + oligo 8, oligo 4 + oligo 7, oligo 5, + oligo 6), as shown in Figure 10, were then combined in microcentrifuge tubes sterile and annealed by heating in a tube in a 65 ° C water bath for five minutes followed by cooling to room temperature for 30 minutes. Annealing gave rise to short fragments of double DNA .Head with cohesive ends. Next, the cohesive double-stranded DNA fragments were ligated into longer strands (Figure 10, steps 2-4), until the manipulated variable region gene was assembled. Specifically, the cohesive double-stranded DNA fragments were ligated in the presence of T4 DNA ligase and 10 mM ATP for two hours in a water bath maintained at 16 ° C. The oligo 1/10 annealed was mixed with oligo 2/9 annealed and the oligo 3/8 annealed was mixed with the oligo 4/7 annealed. The resulting oligos were the oligo 1/10/2/19 and oligo 3/8/4/7 marked. Then, the oligo 3/8/4/7 - was linked to the oligo 5/6. The resulting oligo 3/8/4/7/5/6 was then ligated to oligo 1/10/2/9 giving rise to a full length variable region gene. Otherwise ', when 12 oligos were used, the order of addition was: 1 + 12 = 1/12, 2 + 11 = 2/11, 3 + 10 = 3/10, 4 + 9 = 4/9, 5 + 8 = 5/8, 6 + 7 = 6/7, 1/12 + 2/11 = 1/12/2/11, 3/10 + 4/9 = 3 / 10/4/9, 5/8 + 6/7 = 5/8/6/7, 1/12/2/11 + 3/10/4/9 = 1/12/2/11/3/10 / 4/9. 1/12/2/11/3/10/4/9 + 5/8/6/7 = the full-length variable region gene. The names of the oligonucleotides used in the construction of the manipulated genes are mentioned in Table 5. The variable region gene of the modified heavy chain was determined as 2CAVHCOL1. The variable region gene of the modified light chain was designated as 2CAVLCOL1. The resulting modified variable region genes were then 'purified by gel electrophoresis. To remove the unbound excess of the oligos and other incomplete fragments of DNA, the product ligated running on 1% agarose gel with low melting point at constant 110V for two hours. The main band containing the full-length DNA product was cut and placed in a sterile 1.5 ml centrifuge tube. To release the DNA from the agarose silica gel was digested with F3-agrase I at 40 ° C for three hours. The DNA was recovered by precipitation with 0.3 M NaOAc and isopropanol at -20 ° C for one hour followed by centrifugation at 12,000 rpm for 15 minutes. The purified DNA package was resuspended in 50 μl of TE buffer, pH 8.0. The manipulated variable region gene was then amplified by PCR. Specifically, 100 ng of the manipulated variable region gene were combined with 25 mM dNTP, 200 ng of the primers and 5 U of high fidelity Pfu DNA polymerase, thermostable in buffer. The resulting PCR product was analyzed on a 1% agarose gel. Each purified DNA corresponding to the manipulated variable region gene was subsequently inserted into the bacterial vector Pucl9. Pucl9 is a plasmid vector of E. coli with a high copy number of 2686 base pairs containing a polylinker cloning site of 54 base pairs in lac Z and an Amp selection marker. To prepare the vector for insertion of the manipulated variable region gene, 100 μg of pUC19 were linearized with Hinc II (50 U) for three hours at 37 ° C originating a vector with blunt end sequences 5 'GTC. To avoid self-ligation again, the linear vector DNA was dephosphorylated with 25 U of bovine intestine alkaline phosphatase (CIP) for one hour at 37 ° C. To insert the manipulated variable region gene into the pUC19 vector, approximately 0.5 μg of the dephosphorylated linear vector DNA was mixed with 3 μg of the phosphorylated variable region gene in the presence of T4 DNA ligase (1000 U), and incubated at 16 ° C for 12 hours. The bacterial vector containing the manipulated variable region gene was then used to transform bacterial cells. 'Specifically, freshly prepared competent DH-5-a cells, 50 μl were mixed with I μg of pUC19 containing the manipulated variable region gene and transferred to an electroporation tube (0.2 cm of space).; Bio-Rad). Each tube was pulsed at 2.5 kV / 200 ohms / 25 μF in an electroporator (Bio-Rad Gene Pulser). Immediately afterwards, 1 ml of SOC medium was added to each tube and the cells were allowed to recover for one hour at 37 ° C in the centrifuge tubes. An aliquot of cells from each transformation was separated, diluted 1: 100, then 100 microliters plated on LB plates containing ampicillin (Amp 40 μg / ml). the plates were incubated at 37 ° C overnight by the presence of the Amp marker. Only the transformants containing the pUC19 vector grew in LB / Amp plates. ff A single colof transformants was chosen and incubated overnight in a 3 mm sterile glass tube with LB / Amp, with shaking, at 37 ° C. The plasmid DNA was isolated using Easy prep columns. (Pharmacia Biotech.) And suspended in 100 μl of TE buffer, pH 7.5. To confirm the presence of the gene insert in pUC19, 25 μl of plasmid DNA of each colony was digested with a restriction endonuclease for one hour at 37 ° C, and analyzed on agarose gel. 1%. By this method the plasmid DNA containing the gene insert was resistant to enzymatic cleavage due to the loss of the site of restriction (5 '... GTCGAC..3') and migrated as closed circular DNA (CC), whereas the plasmids without insert were split and migrated on the gel as a linear, double-stranded DNA fragment (L). To confirm the correct gene sequences of the genes of variable region manipulated and eliminate the possibility of unwanted mutations generated during the construction procedure, DNA sequencing was performed using a reverse primer M13 / pUC (5? ACAGCTATGACCATG3 ') (SEQ ID NO: 3) for clones as well as for the PCR gene products using 20 base primer at the 5 'end (5' GAATTCATGGCTTGGGTGTG3 ') (SEQ ID NO: 4) on an ABI377 automated DNA sequencer. All clones were confirmed containing the correct sequences.

Table 5. Construction of the gene that codes for the antibodies containing the CDRs of Mab 31.1 6. 3 INSERTING THE VARIABLE REGION GENE, MANIPULATED INTO A MAMMER EXPRESSION VECTOR A complete antibody light chain has a variable region and a constant region. The modified variable region genes 2CAVHCOL1 or 2CAVLCOL1 were inserted into vectors containing suitable constant regions. Variable region genes manipulated lacking cysteine residues in the light chain were inserted into vector pMRROlO.l of Figure 6A. The pMRROlO.l vector contained a constant region of the human kappa light chain. The insertion of the light chain variable region manipulated in this vector produced a complete sequence of the light chain. Otherwise, the manipulated variable region gene devoid of cysteine residues in the heavy chain was inserted into the vector pGAMMA 1, Figure 6B. The vector pGAMMA 1 contained sequences of constant region and hinge region 'of human IgGl. The insertion of the variable region gene of the heavy chain, manipulated in this vector, produced a complete sequence of the heavy chain. To manipulate a mammalian vector containing the heavy chain and light chain genes, the complete light chain sequence and the complete heavy chain sequence were inserted into the mammalian expression vector pNEPuDGV as shown in Figure 6 (Bebbington, CR, 1991 in METHODS: A Companion to Methods in Enzymology, vdl., 2, pp. 136-145). The resulting vector codes for the light chain and for the heavy chain of the modified antibody. 6. 4 EXPRESSION OF MODIFIED, SYNTHETIC ANTIBODIES, IN MAMMALI CELLS To examine the production of assembled antibodies, the mammalian expression vector was transfected into COS cells. COS cells (a line of African green monkey kidney cells, CV - 1, were transformed with a defective SV40 virus of origin). They were used for the short-term transient expression of synthetic antibodies for their ability to replicate circular plasmids containing an SV40 origin of replication for a very high copy number. The antibody expression vector was transferred to COS 7 cells (obtained from the ff American Type Culture Collection). Transfected cells 5 were grown in Dubelcco's modified Eagle's medium and transfected with the expression vectors using calcium precipitation (Sullivan et al., FEBS lett 285: 120-123, 1991). The transfected cells were cultured for 72 hours after which collected the supernatants. The supernatants of the transfected COS cells were assayed with the ELISA method for assembled IgG. The ELISA analysis includes the capture of samples and standards in 96-well plates coated with an anti-human IgG Fc. The assembled IgG, linked with an anti-human kappa chain linked to horseradish peroxidase (HRP) and the substrate tetramethylbenzidine (TMB). The color development was proportional to the amount of the assembled antibody ___. present in the sample. 20 6.5 MODIFIED ANTIBODY IMMUNOSPECCIFICATIVELY UNITED TO CELLS OF HUMAN COLON CARCINOMA AND ANTIGENS PRODUCED FOR THESE CELLS The modified antibody was expressed and isolated as indicated in section 6.4 above. Binding capacity and specificity were then assayed using LS-174T cells, WiDR cells (a human colon cancer cell line) and an antigen from these cells. To examine the potency of the binding as well as the binding specificity of Mab31.1, a band analysis was performed (see Figure 11). Membrane preparations from LS-174T cells were applied to a nitrocellulose membrane using a Bio-Blot apparatus (Bio-Rad). The wells were blocked for non-specific binding using skimmed milk. The biotinylated antibodies obtained from Mab31.1 were incubated in all the wells. Unlabeled antibodies in concentrations of 0.003 to 20 nM were then applied to the nitrocellulose membrane and incubated. The unbound antibody was separated from the membrane by washing and an antibody was added, anti-human IgG labeled with alkaline phosphatase. Finally, an alkaline phosphatase substrate was added which generated a dark purple precipitate indicating the presence of bound labeled antibody. Figure 11 gives the results of the analysis of the bands. The figure demonstrates that the labeled antibody bound to the LS-174T cells. In addition, the unlabeled antibody competed with the binding of the biotinylated antibody indicating specificity of the binding of the antibody derived from Mab31.1 to the antigens of the tumor cells. 6. 6 ANTI-IDIOTIPO ANSWER In a competition binding assay the effect on the binding of the modified antibody to the LS-174T cells was examined. LS-174T cells are human colon carcinoma cells that express the antigen recognized by the Mab31.1 antibody. Peptides containing the sequence of one of the CDRs of the Mab31.1 antibody were generated. These peptides, the modified antibody and the control antibody derived from Mab31.1 were administered to mice to generate antisera against the CDR regions of Mab31.1 and the antibodies. The blood samples of the mice were taken two weeks and four weeks after the injection. The antisera from the immunized mice were used in the binding competition assays presented in Figures 12A and B. The antisera and biotinylated antibodies were tested for their ability to bind to the LS-174T cells. As demonstrated in Figures 12A and B, the antisera raised for the CDR3 and CDR4 peptides competed drastically for the binding of the control antibody (antibody from Mab31.1) to the LS-174T cells.

In addition, the antisera raised against CDR1 and CDR2 also competed significantly for the binding of the control antibody to the LS-174T cells. In addition, antisera from mice injected with the 2CAVHC0L1 and 2CAVLC0L1 antibodies (ie, the modified antibodies having the change from cysteine to alanine in the variable region) competed for the tf binding with the biotinylated antibody from Mab31.1 better than the antisera of mice injected with the antibody from Mab31.1 (Figure 12B). This result indicates that the administration of the antibodies having the change of cysteine to alanine in the variable region produces anti-idiotype antibodies that recognize the antigen of the colon carcinoma cells better than the antibodies with intrachain disulfide bonds of the variable region.

Table 6 PEPTIDES MARKED WITH BIOTIN FROM THE 15 CDR SEQUENCES OF MAb31.1 IR peptide sequence COL311L1 biotin-N-Thr-Ala-Lys-Ala-Ser-Gln-Ser-Val-Ser-Asn-Asp-Vai-Ala 20 COL311L2 biotin-N-Ile-Tyr-Tyr-Ala-Ser- Asn-Arg-Tyr-Thr COL311L3 Biotin-N-Phe-Ala-Gln-Gln-Asp-Tyr-Ser-Ser-Pro-Leu-Thr COL311H1 Biotin-N-Phe-Thr-Asn-Tyr-Gly-Met- Asn COL311H2 Biotin-N-Ala-Gly-Trp-Ile-Asn-Thr-Tyr-Thr-Gly-Glu-Pro-Thr-Tyr-Ala-Asp-Asp-Phe-Lys-Gly 25 COL311H3 Biotin-N-Ala -Arg-Ala-Tyr-Tyr-Gly-Lys-Tyr-Phe-Asp-Tyr EXAMPLE 7: PRODUCTION OF AN AMENDED, SYNTHETIC ANTIBODY, CONTAINING THE SEQUENCE HMFG-1 Anti-idiotype antibodies were constructed that immunospecifically bind to the HMFG antibody -1. It is known that the HMFG-1 antibody binds to the polymorphic epithelial mucin (<PEM) (Stewart et al., 1990, J. Clin Oncol 8: 1941-50, Kos as et al., 1994, Cancer 73: 3000 -3010). The antigenic determinant of PEM with the sequence ProAspThrArgPro was inserted into the region of the variable chain by the methods of the invention. This short sequence is a highly immunogenic region of human polymorphic epithelial mucin (Gendler et al., 1988, J. Biol. Chem. 263: 12820-12823). Residues 27A-27E (SerLeuLeuTyrSer) of HMFG-1 (Table 7) were substituted with ProAspThrArgPro using the oligonucleotide method described in section 6, supra, also in Figure 10. Synthetic HMFG-1 antibodies, anti- Idiotype were produced which bind immunospecifically to HMFG-1 using the sequences known for the variable regions of the light and heavy chains of HMFG-1. The oligos were added in the order 1 + 8 = 1/8, 2 + 7 = 2/7, 3 + 6 = 3/6, 4 + 5 = 4/5, 1/8 + 2/7 = 1/8 / 2/7, 3/6 + 4/5 = 3/6/4/5, 1/8/2/7 + 3/6/4/5 = 1/8/2/3/6/4/5 . Table 7 shows the comparison of the sequences between HMFG-1 and different consensus CDR sequences. Information related to HMFG-1 and related monoclonal antibodies is set forth in WO 09/05142 (Imperial Cancer Research Technology, Ltd.) and humanized HMDG-1 is set forth in WO 92/04380 (Unilever). ff The polymerase chain reaction (PCR) 5 was used to amplify the assembled sequence as shown in Figure 13. The manipulated variable region gene was inserted into vectors suitable for the production of antibodies, such as the vector pNEPuDGV, as described in section 6, above. It is possible to use others methods for constructing manipulated genes, including but not limited to those methods described in Jayaraman et al., 1989, Nucleic Acids Res. 17: 4403; Sandhu et al., 1992, BioTechniques 12.14; Barnett and Erfie, 1990, H. Nucleic Acids Res 18_: 3094; Ciccarelli et al., 1991, Nucleic Acids Res 1_9: 6007; Michaels et al., 1992, Biotechniques 12: 45, which are incorporated herein by reference.

Table 7. Comparison of sequences between the HMFG-1 antibody and different CDR sequences with Sequences VIII CDRI Residual 31 32 33 34 35 35? 35R Human 1 Ser Tyr Wing He Human Being II Being Tyr Scr Tyr Trp Being TF? Sn Human III Being Tyr? The Met Being Human I? Be Gly Tyr. T'P? Sn? Sn Ser Mouse IB Ser Tyr Gly Val His Val Ser Mouse II? ? sp / Ser Tyr Tyr Met? sn? sn Mouse I ID Ser Tyr Trp Met His Mouse IIC? sp / Ser Tlvr Tyr Met ilis Mouse III? ? sp / Ser Phc / Tyr Tyr Mcl Glu Mouse IHB Arg Tyr T Met Ser Mouse IHC? rn Tyr Trp Met? sn Mouse III D Ser Tyr? the Met Be Mouse V? Ser Tyr Gly Ue? Sn Mouse VB Ser Tyr Gly Leu Tyr IIMFG-1? Tyr • í rp lie Glu Sequences VIII CDR2 SEQ ID NO Residual i 50 51 52 52? 5211 52C 53 54 55 56 57 5S 59 60 1 62 63 64 65 Human 1 Trp 11c? Sp Pro Tyr Gly? Sn Gly? Sp llir? n Tyr Ala Gln Lys e Gln Gly 92 Human II? rg He l > r IV? rg? l.i l > r Ser Gly Ser I r? sp / • ¡> r? sn Pro Ser Leu Lys Ser 93? sn 94 Human W Val lie Ser Gly l.ys 1 hr? sp Gly Gly Ser 1 hr Ur Ivr? la? sp Ser Val l.) s Gly Mouse 95 Í? Tyr lie Ser l >; r Ser Gly Ser Ihr 1 > r lyr? sn Pro Ser Leu Lys Ser Mouse in Val lie? Gly Gly Ser llir? sn Tjr? sn Ser? la Leu Met Ser 96 Mouse II? ? sp lie? sn Pto Gly? sn (and Gly rain Ser Mouse lll)? rg lie? sp Pro? MI Ser Gly Gly A? sn Mouse IIC? rg I le? sp Pro Ala? sn (• ¡ly? sn Ilir Lys Mouse II1?? La Ser? Rg? Sn lys? La? Sn? Sp I 'll ll llir Giu Mouse pip Glu lie? S Pro Lys? Lt? ^ P Ser Ser llir lie Mouse IIIC Glu lie ? rg leu L > s Ser? «? sn T > r? la llir llis Mouse mu I r lie Ser Ser Lys Ser (¡ly and Gly (¡ly lyr I rl &rt; r 10 Mouse V? Tyr lie? sn Pro Gly? Ui Gly ly, I r Lys Mouse VR lyr He Ser Ser Ser? La '' &'Pro? I 105 11MFG-1 Glu He Leu Pro Gly Ser? Sn? Sn Ser? I I &rt? sn Glu Lys l'hc Lys Cily 106 Sequences HIV CDR3 SEQ ID NO Residue 95 96 97 98 99 100 I00? 100B 100C 1001) 100F. I00F 100G 10011 mol 100J I00 101 102 107 Human I? Pro Gly Tyr Gly Ser Gly Gly Gly Cys Tyr? Rg Gly? Sp Tyr + Phe? Sp Tyr 108 Human H Glu eu Pro Gly Gly lr • 1 Gly? Sp? Sp ? > r lyr Tyr 1 + Gty Phe? sp Val 109 Human 111 +? rg + • t Ser l u Ser Gly t l > r lyr lyr and His Tyr Phe Asp Tyr 15 110 Mouse I? Gly Gly Tyr Gly l > r Gly lyr lyr Tyr Tyr Asp 1 lyr Tyr Tyr Tyr Phe? sp lyr Mouse IB? sp? rg Gly Arg Tyr Tyr 1 t + 111 lyr t- Ser Gly lyr Tyr Ala Mcl Asp l > r Mouse HA Gly + Tyr Tyr Ser Ser Ser lyr Met ^? la + 1 lyr lyr? la Phc? sp lyr 112 SEQ ID NO Residue 95 96 97 98 99 100 100? 100B 100C 1001) 100F. I 00F I00G 10011 1001 100J 100K 101 102 1 13 Mouse II B Tyr Tyr r Gly Gly Ser Ser -1 + Val T > r H Tyr Tf Tyr Phc? sp Tyr 1 14 Mouse I1C Gly l yr Tyr Tyr T > r? sp Ser i Val Gly l yr Tyr Ala Met Asp Tyr 1 15 Mouse 111 A? sp Tyr Tyr l yr Glv Ser Ser Tyr Tyr Glu Gly Pro Val Tyr Trp Tyr Phc Asp Val 1 16 Mouse Hip Leu Gly Glv Tyr Gly l yr hc Gly Ser Ser l yr Tyr? la Met? sp Tyr Mouse 1HC Gly Gly Ty'r Gly Gly 1? ig? rg Ser t Tf Phe? the Tyr 117 Mouse lili) Gly Gly T yr Tyr 1 yr l eu 1 Gly Sei? La Pío Phe? Sp Tyr? La Mcl? Sp l yr 118 Mouse VA Ser? Sn Tyr Tyr Gly Gly Ser T > Tyr Tyr + Phe? Tyr Tyr Tyr Phe Asp Tyr 1 19 Mouse VU? Rg Val lie Ser? If. Tyt Plie Asp Gly 120 HMFG-I Ser yr? Sp Phe? La I rp Plie? Tyr 121 SEQ ID NO Sequences VL CUItl 122 Residue 24 25 26 27 27? 27 »27G 271) 27IÍ 27F 2S 29 30 31 32 33 34 Human kappa I? Rp? La Ser (In Ser Leu Val 1 -I Ser He Ser Asn Ser Tyr Leu? The 123 Human kappa II? R? Ser Ser ln Ser Leu Leu l fis Ser t-? Sp Gly? Sn / Asp? Sn / Thr Tyr Leu + 124 Human kappa III? Rg? The Self (Ip Ser Val Ser Ser Ser T Leu? 125 Human kappa IV Lys Ser Ser Glu Ser Val Leu Tyr Ser Ser? Sn? Sn Lys Asp Tyr Leu? La 126 Kappa Mouse I Lys Ser Ser Glu Ser Leu eu? Sn Ser Gly? Sn Gln Lys? Sn Tyr Leu 127 Kappa II Mouse Arg Ser Ser (your Being Leu Val I lis Ser? Sn Gly? Sn Thr Tyr Leu Gln Mouse kappa lll? Rg? Ser Glu Ser Val? Sp Ser Tyr Gly? Sn Ser Fhe Met llis 128 Kappa IV Mouse Ser? Ser Ser Ser Val Val Ser Ser Tyr Leu His 129 Ral? N kappa V? Rg? La Ser Gln? Sp? Sp He Ser? Sn Tyr Leu Asn 130 Ralon kappa VI Being? Ser? Being? Being Val? Being Tyr Met l lis 131 Kappa Mouse VII I IMFG-I Lys Being Gln Ser Leu Leu Tyr Ser Ser? Sn Gln Lys Tic Tyr Leu Wing 132 ? t? - Sequences VL CDR2 Residues i 50 51 52 53 51 55 56 SEQ ID NO Human kappa I? La? L.? Being Ser Leu (li Human Being kappa II Leu Val Ser? Sn? Rg? The Being 134 Human kappa lll Gly Ala Being Being? .g? La lir 1 5 Human kappa IV Irp? La Ser I r? IJ: (Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat Rat???????????????? ? rg Thr Ser? sn Leu? the Ser 140 Kappa Mouse V Tyr? the Ser? rg Leu ITis Ser 141 Kappa Mouse VI? sp Thr Ser l > s Leu? the Ser Kappa Mouse VII IIMIG-I Tf? The Ser II? Rg Glu Ser Sequences VF.CDR3 residues 89 90 91 92 93 94 95 95? 9511 95C 951) 95E 95F 96 97 SEQ ID NO 1 lump kappa 1 Gln Gln Tyr + Ser Leu Pro Glu TF Ihr 142 Human kappa II Mel Gln Ala Leu Gln Pro? Rg + 1 tu143 Human kappa III Gln Gln Tyr Gly Ser Pro Pro Leu llir 144 Human kappa IV Gln Gln lyr Tyi Ser I r Pio + llir 145 Kappa mouse I Gln? Sn? Sp l > r Ser lyr Pro Leu Ihr 146 Kappa II Mouse Phc Ciln Gly l¡? r llis Val Pro Pro lyr Ihr 15 147 Kappa lll Mouse Gln Glu Ser? sp Glu? sp Pro Pro Irp ll.r 148 Kappa IV Mouse Glp Gln Irp Be Ser T > r Pro + Glv Leu 1 tu149 Kappa Mouse V din Gln Gly? sp Ihr Leu Pro Pio? rg llir 150 Kappa Mouse VI Gln Gln Irp Ser Ser? sn Pro Pro Mel Pro Leu Thr 151 SEQ ID NO waste 89 90 91 92 93 94 95 95? 95B 95C 951) 9SE 95F 96 97 Kappa Mouse VII Leu Gln Tyr? Sp Glu Phc? La Tyr T r 152 1IMFG-I Gln GIn Tyr l i? Rg I yr Pio Arg Thr 153 The present invention should not be limited in scope by the specific embodiments described herein. Actually, various modifications of the invention in addition to those described herein will be apparent to those skilled in the art from the aforementioned description and the accompanying figures. These modifications are intended to be within the scope of the attached clauses. Various references are mentioned in the present, the descriptions of which are incorporated as a reference in their strengths.

Claims (38)

1. CLAIMS 1. A vaccine composition containing an amount of a first immunoglobulin molecule sufficient to induce an anti-idiotype response, the first immunoglobulin molecule containing a variable region and being identical in the amino acid sequence, except for one or more amino acid substitutions in the variable region and optionally, the substitution of one or more regions of the non-human structure, with one or more regions of the human structure, and optionally the replacement of a non-human constant domain with a human constant domain, to a second immunoglobulin molecule , the second immunoglobulin molecule being able to bind immuno-specifically to an antigen, the one or more amino acid substitutions being the substitution of one or more amino acid residues that do not have a sulfhydryl group in one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the second molecule of immunoglobulin, wherein the first immunoglobulin molecule is a humanized antibody or the second immunoglobulin molecule is a human antibody; and a pharmaceutically acceptable carrier. 2. The vaccine composition according to claim 1, wherein the antigen is a tumor antigen. 3. The vaccine composition according to claim 2, wherein the antigen is a cancer antigen. 4. The vaccine composition according to claim 3, wherein the antigen is a polymorphic epithelial mucin antigen. 5. The vaccine composition according to claim 3, wherein the antigen is a protein antigen associated with human colon carcinoma. 6. The vaccine composition according to claim 3, wherein the antigen is a carbohydrate antigen associated with human colon carcinoma. The vaccine composition according to claim 1, wherein the variable region is a light chain variable region and the amino acid residue having no sulfhydryl group is in a position corresponding to position 23 or 88 of the variable region of the light chain of the second immunoglobulin molecule. 8. The vaccine composition according to claim 1, wherein the variable region is a variable region of the heavy chain and the amino acid residue that does not have a sulfhydryl group is in a position corresponding to position 22 or 92 of the region variable of the heavy chain of the second immunoglobulin molecule. 9. The vaccine composition according to claim 1, 7 or 8, wherein the amino acid residue that does not have a sulfhydryl group is alanine. The vaccine composition according to claim 1, wherein the second immunoglobulin molecule is Mab31.1, Mab33.28 or Mab HMFG-1, and wherein the one or more amino acid substitutions include a substitution with alanine in position 23 and / or 88 of the variable region of the light chain. The vaccine composition according to claim 1, wherein the second immunoglobulin molecule is Mab31.1, Mab33.28 or Mab HMFG-1 and wherein the one or more amino acid substitutions include a substitution with alanine in the position 22 and / or 92 of the variable region of the heavy chain. The vaccine composition according to claim 3, wherein the antigen is a human milk fat globule antigen. The vaccine composition according to claim 3, wherein the antigen is an antigen from a breast, ovarian, uterine, prostate, bladder, lung, skin, colon, pancreas, gastrointestinal, B-cell or T-cell cancer. 14. The vaccine composition according to claim 3, wherein the antigen is selected from the group consisting of pan-carcinoma KS antigen, ovarian carcinoma antigen, prostatic acid phosphate, prostate specific antigen, p97 antigen associated to melanoma, melanoma gp75 antigen, high molecular weight melanoma antigen, prostate-specific membrane antigen, carcinoembryonic antigen, polymorphic epithelial mucin antigen, human milk fat globule antigen, TAG-72 antigen, associated with colorectal tumor, C017-IA, GICA 19-9 , CTA-1, LEA, antigen 38.13 of Bur itt lymphoma, CD19, CD20 antigen of human B-cell lymphoma, CD33, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, cell-surface antigen type of tumor-specific transplantation, oncofetal antigen-alpha-fetoprotein L6, L20 antigen of human lung carcinoma, Gp37 antigen of T cells of human leukemia, neoglucoprotein, sphingolipids, EGFR, HER2 antigen, polymorphic epithelial mucin, malignant human lymphocyte APO-1 antigen, M18 antigen, M39, SSEA-1, VEP8, VEP9, Myl, VIM-D5, Dj.56-22, TRA-1-85, C14, F3, AH6, hapten Y, Law, TL5, FC10.2, gastric adenocarcinoma antigen, C0-514, NS-10, CO-43, MH2, 19.9 found in colon cancer, mucins of gastric cancer, T5A7; R24, 4.
2. 2, GD3, DI .1. OFA-1, GM2, OFA-2, GD2, Ml: 22: 25: 8, SSEA-3, SEA-4 and peptides derived from the T cell receptor. 15. The vaccine composition according to claim 1, wherein the antigen is an antigen of an infectious disease agent. 16. The vaccine composition according to claim 15, wherein the antigen is selected from the group consisting of influenza virus hemagglutinin, human respiratory syncytial virus glycoprotein G, dengue virus core protein, virus protein matrix dengue, measles virus hemagglutinin, herpes simplex virus type 2 glycoprotein, poliovirus IVP1, envelope glycoproteins of HIV1 hepatitis B surface antigen, diphtheria toxin, streptococcal 24M epitope, gonococcal pilin [sic], g50 virus pseudorabies (gpD), pseudorabies virus glycoprotein H, pseudorabies virus glycoprotein E, transmissible gastroenteritis glycoprotein 195, transmissible gastroenteritis matrix protein, pig rotavirus 38 glycoprotein, pig parvovirus capsid protein, protective antigen Serpulina hydrodisenteriae, bovine viral diarrhea glycoprotein 55, hemagglutinin-neuraminidase of Newcastle disease virus, swine influenza hemagglutinin, swine influenza neuraminidase, infectious bovine rhinotracheitis virus glycoprotein E, glycoprotein G or infectious laryngotracheitis virus glycoprotein I, a la Crosse virus glycoprotein , neonatal bovine diarrhea virus, hepatitis B virus core protein and / or hepatitis B virus surface antigen, equine influenza A virus / neuraminidase Alaska 91, equine influenza A virus / Miami neuraminidase 63, equine influenza virus type A / neuraminidase Kentucky 81, glycoprotein B equine herpes virus type 1, glycoprotein D equine herpes virus type 1, bovine respiratory syncytial virus binding protein, bovine respiratory syncytial virus fusion protein, nucleocapsid protein bovine respiratory syncytial virus, bovine parainfluenza virus type 3 fusion protein, and hemaglutinin neuraminidase d bovine parainfluenza virus type 3, bovine viral diarrhea virus glycoprotein 48 and bovine viral diarrhea virus glycoprotein 53. 17. The vaccine composition according to claim 1, wherein the antigen is a cellular receptor for an infectious disease agent. 18. The vaccine composition according to claim 17, wherein the cellular receptor is selected from the group consisting of LPV receptor, adenylate cyclase, BDV surface glycoproteins, N-acetyl-9-O-acetylneuraminic acid receptor, CD4T , highly sulfated type heparin sulfate, p65, Isoreceptors containing 1-4-Gal-Gal-Alfa, CD16b, Integrine Receptor VLA-2, EV Receptor, CD14, Glucoconjugate Receptors, T cell alpha / beta receptor, Factor Receptor decay-acceleration, extracellular envelope glycoprotein receptor, immunoglobulin receptor Fc poxvirus M-T7, GALV receptor, CD14 receptor, Lewis blood group antigen receptor (b), T cell receptor, heparin glucoaminoglycan sulfate receptor , Fibroblast growth factor receptor, CDlla, CD2, G protein-coupled receptor, Cd4, heparin proteoglycan sulfate, Annexin II, CD13 (aminopeptidase N), N-amino peptidase receptor mana, Hemagglutinin Receptor, CR3 Receptor, Protein Kinase Receptor, Galactose N-acetylgalactosamine-Lecithin Receptor that can be inhid, Chemokine Receptor, Annexin I, ActA Protein, CD46 Receptor, Opa Receptors Associated with Meningococcal Virulence, CD46 Receptor, Receptors of the family of carcinoembryonic antigens, Bgla receptor of the family of carcinoembryonic antigens, Interferon gamma receptor, Gp70 glycoprotein, Rmc-1 receptor, Human integrin receptor alpha v beta 3, Proteoglycan heparin sulfate receptor, CD66 receptor, Receptor of integrin, Protein of the membrane cofactor, CD46, GM1, GM2, GM3, CD3, Ceramide, Hemagluti protein ina-neuraminidase, P-erythrocyte antigen receptor, Receiver CD36, Receiver of glycophorin A, Interferon gamma receptor KDEL receptor, mucosal homing receptor alfa4beta7 [sic], epidermal growth factor receptor, alpha5betal integrin protein, non-glycosylated J774 receptor, CXCR1-4 receptor, CCRl-5 receptor, CXCR3 receptor, CCR5 receptor, gp46 surface glycoprotein, TNFRp55 receptor, TNFRp75 receptor, soluble beta interleukin-1 receptor. 19. The vaccine composition according to claim 15 or 17, wherein the infectious disease agent is a bacterium. The vaccine composition according to claim 19, wherein the bacterium is selected from the group consisting of mycobacteria rickettsia, mycoplasma, neisseria spp. , legionella, shigella, spp. , vibrio cholerae, Stroptococci, diphtheriae corynebacteria, tetanus clastridum, bodetella pertussis, Haemophilus spp. , Chlamydia spp. , and Escherichia coli d Syphilis or Ly disease. 21. The vaccine composition according to claim 15 or 17, wherein the infectious disease agent is a virus. The vaccine composition according to claim 21, wherein the virus is selected from the group consisting of hepatitis type A, hepatitis B, hepatitis C, influenza, varicella, adenovirus, herpes simplex type I, herpes simplex type II, rinderpest, rhinovirus, ecovirus, rotavirus, respiratory syncytial virus, papillomavirus, papovavirus, cytomegalovirus, equinovirus, arbovirus, hantavirus, coxsachie virus, mumps virus, measles virus, rubella virus, poliovirus, human immunodeficiency virus Type I, human immunodeficiency virus type II, picornavirus, enterovirus, calicivirus, Norwalk virus group, togavirus, alphavirus, flavivirus, coronavirus, rabies virus, Marbug virus, ebola virus, parainfluenza virus, orthomyxovirus, bunyavirus, arenavirus, reovirus, rotavirus, orbivirus, human T cell leukemia virus type I, human T cell leukemia virus type II, simian immunodeficiency virus, lentivirus , polyomavirus, parvovirus, Epstein-Barr virus, herpes virus human-6, herpes virus of cercopitecos 1 and poxvirus. 23. The vaccine composition according to claim 15 or 17, wherein the infectious disease agent is a parasite. The vaccine composition according to claim 23, wherein the parasite is selected from a group consisting of plasmodium, eimeria, leishmania, kokzidioa, and trypanosome and fungi. 25. The vaccine composition according to claim 1, wherein the first immunoglobulin molecule is of a type selected from the group consisting of IgG, IgE, IgM, IgD and IgA. 26. A vaccine composition containing an amount of a fragment of a first immunoglobulin molecule sufficient to induce an anti-idiotype response, the fragment contains a variable region and is identical in the amino acid sequence, except for one or more substitutions of amino acids in the variable region and optionally the replacement of one or more regions of the non-human structure with one or more regions of the human structure, and optionally the replacement of a non-human constant domain with a human constant domain, for the corresponding fragment of a second immunoglobulin molecule, the fragment of the second immunoglobulin molecule being capable of immunospecifically binding an antigen, the one or more amino acid substitutions being the substitution of an amino acid residue that does not have a sulfhydryl group at one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the s second immunoglobulin molecule, wherein the first immunoglobulin molecule is a humanized antibody or the second immunoglobulin molecule is a human antibody; and a pharmaceutically acceptable carrier. 27. The vaccine composition according to claim 26, wherein the fragment is a single chain immunoglobulin. 28. The vaccine composition according to claim 26, wherein the fragment is a Fab fragment, a fragment (Fab ') 2 / a heavy chain dimer, a light chain dimer or a Fv fragment. 29. The vaccine composition according to claim 26, wherein the fragment further contains a constant region. 30. The vaccine composition according to claim 26, wherein the variable region is from a mouse immunoglobulin, and the constant region is from a human immunoglobulin. The vaccine composition according to claim 1, wherein the variable region has regions of the human antibody backbone and complementary determinant regions (CDRs) of a mouse immunoglobulin. 32. The vaccine composition according to claim 1, wherein the first immunoglobulin molecule is linked by a covalent bond to an amino acid sequence of a protein selected from the group consisting of 11-2, 11-4, 11. -5, II- [sic], 11-7, II-10, interferon-? or peptide derived from MHC, G-CSF, TNF, porin, NK cell antigen or cellular endocytosis receptor. The vaccine composition according to claim 26, wherein the fragment of the first immunoglobulin molecule is linked by a covalent bond to an amino acid sequence of a protein selected from the group consisting of 11-2, 11- 4, 11-5, II- [sic], 11-7, 11-10, interferon-? or peptide derived from MHC, G-CSF, TNF, porin, NK cell antigen or cellular endocytosis receptor. 34. A method for generating an anti-idiotype response in an individual is to administer to an individual an amount of a first immunoglobulin molecule sufficient to induce an anti-idiotype response, the first immunoglobulin molecule containing a variable region and being identical, except for one or more substitutions of amino acids in the variable region, to a second immunoglobulin molecule, the second immunoglobulin molecule being capable of immunospecifically binding to an antigen, the one or more amino acid substitutions being the substitution of an amino acid residue that it does not have a sulfhydryl group in one or more positions corresponding to one or more cysteine residues that form a disulfide bond in the second immunoglobulin molecule. 35. The method according to claim 34, wherein further it consists in isolating an antibody from the individual, the antibody recognizing the idiotype of the second immunoglobulin molecule and administering the antibody to a second individual. 36. The method according to claim 34, wherein the antigen is a tumor antigen. 37. The method according to claim 34, wherein the antigen is a cancer antigen 38. The method according to claim 36, wherein the antigen is a polymorphic epithelial mucin antigen.