MXPA00004347A - Neuronal uses of bmp-11 - Google Patents

Abstract

Purified BMP-11 proteins and processes for producing them are disclosed. Recombinant DNA molecules encoding the BMP-11 proteins are also disclosed. The proteins may be useful in regulating follicle stimulating hormone, such as for contraception. In addition, the proteins may be useful for the induction and/or maintenance of bone, cartilage and/or other connective tissue, and/or neuronal tissue.

Description

NEURONAL USES OF THE BMP-11 Field of the Invention The present invention relates, inter alia, to a novel family of purified proteins designated as BMP-11, to the DNA molecules encoding it and to processes for obtaining them.

Background of the Invention This application is a continuation-in-part of the application of the U.S.A. with serial number 08 / 452,772 filed on May 30, 1995; which is a divisional application of the E.U.A. serial number 08 / 247,907, filed May 20, 1994 and granted as the US patent. No. 5,639,638 on June 17, 1997; which is a continuation-in-part of the application of the US. serial number 08 / 061,464, filed on May 12, 1993, abandoned. The inventors have previously designated the BMP-11 proteins as Activin WC. BMP-11 proteins may be useful for inducing bone and / or cartilage formation and in wound healing and tissue repair, or to increase the activity of other bone morphogenetic proteins. BMP-11 proteins can also be useful for regulating follicle-stimulating hormone production, for contraception, for promoting neuronal cell survival, for stimulating hamatopoiesis, and for suppressing the development of tumors in the gonads. U.S. Patent No. 4,798,885 discloses a DNA encoding the inhibin a and ß prepro chains. U.S. Patent No. 5,071,834 discloses activin pharmaceutical compositions with two betas chains formulated in a pharmaceutically acceptable carrier. U.S. Patent No. 5,102,807 describes a purified inhibin protein that suppresses the production of FSH without suspending the production of luteinizing hormone. In addition, the BMP-11 proteins of the present invention are useful for modulating all aspects of neuronal cell development, particularly formation, * - > growth, differentiation and neuronal proliferation, and particularly neuronal conservation !.

Objectives of the Invention 5 The BMP-11 protein is a member of the TGF-β superfamily of proteins. The TGF-β superfamily includes the family of proteins known as bone morphogenetic proteins (BMPs), as well as a group of proteins that are cer-omidated with or mhibin-ß. As described hereinafter, when dimerized with another BMP-I I (homodirner), the BMP-11 processin is expected to demonstrate The activity of BMP-11, as described hereinafter, is measured according to the assays described in the examples presented below. When it is digested as a heterodimer with inhibin-a proteins or with other in ibir proteins. -3, the inhibin-β / BMP-11 heterodimer is expected to show effects on the production of follicle-stimulating hormone (FSH), as described below in the present. Additionally, it is expected that in a homodimeric or heterodimetic form with another member of the bone morphogenetic protein family, BKP-11 exhibits BMP activity, that is, the ability to induce the formation of bone, cartilage and / or other tissue. In this way, depending on the environment of BMP-7 1, it can formaldehyde which will show either activin or inhibin activity, or activity induction of bone, cartilage and / or other connective tissue. Accordingly, the activity of BMP-1 1 is defined as the ability to regulate the production of FSH in the assay described in Example 8, or the ability to induce the formation of bone, cartilage and / or other connective isjidc in the assays. described in Examples 5 to 7, as well as to modulate the development, particularly the formation, growth, differentiation and neuronal proliferation, and especially neuronal conservation (Example 9). The proteins called inhibins and activins are produced in the gonads and exist naturally in the follicular fluid. These proteins act at the level of the anterior piiukepa gland to inhibit (inhibins) or stimulate (activins) the release of follicle stimulating hormone (FSH) [for review see, for example, Ying, S.-Y., Endocr. Rev., 9: 257-293 (1988) or Ling, N. et al., Vitamins and Hormones, 44: 1-46 (Academic Press 1923)]. Briefly, the dimeric proteins composed of a chain of inhibin a and a chain of inhibin ß ($ AO ßß) are called inhibins and are characterized by their ability to inhibit the release of the follicle stimulating hormone (FSH), oieritras other proteins dimeric compounds composed of two chains of inhibin ß (ßA or ßB) 5 are called activins and are characterized by their ability to stimulate the release of the follicle stimulation hormone (FSH) [see, for example, Ling et al .. Nature, 321: 779-782 (1986) or Vale et al, Nalure, 371: 116-119 (1986) or Mason et al., Ncí re, 318: 659-663 (1985) or Forage et al., Proc. Nati Acad. Sci. USA 83: 3091-3095 ! 'It is recognized that FSH stimulates egg development in mammalian ovaries (Ross et al., In Textbook of Endocrine logy, ed. Williams, p.355 (1981) and that excessive ovarian stimulation with FSH leads to Multiple ovulations FSH is also important in testicular function, so BMP-11 in heterodimers with a mRNA of the inhibin a family can be useful as a contraceptive based on capacity of inhibins to decrease fertility in female mammals and to decrease spermatogenesis in male mammals. The administration of sufficient amounts of other inhibitors may induce the infertility of these mammals. BMP-11, as a homodimer or as a heterodimer with other protein subunits of the inhibin-ß group, may be useful as a fertility-inducing therapeutic, based on the canacided the activin molecules to stimulate the release of FSH from the cells of the anterior pituitary. See, for example, U.S. Patent No. 4,798,885. BMP-11 may also be useful for advancing the onset of fertility in sexually immature mammals, in order to increase the duration of reproductive performance of domestic animals such as cows, sheep and pigs.

It is further contemplated that BMP-11 may be useful in promoting the survival of neuronal cells [see, for example, Schubert et al., Nature, 334: 868-870 (1990)], in the modulation of hematopoiesis by induction of erifoid cell differentiation [see, for example, Broxmeyer et al., Proc. Nati Acad. Sci. USA, 85: 9052-9056? . 9, *. 8_? or Eío et al., Biochem. Biophys. Res. Comm., 142: 1095-1103 (1987)], for the Suppression of tumor development of the gonads [see, for example, Matzuk et al., Nanire, 360: 313-319 (1992) 1 or to increase the activity of bone morphogenetic proteins [see, for example, Ogawa et al. ., J Biol. Chem., 267: 14233-14237 (1992)]. The BMP-11 proteins can also be characterized by their ability to modulate the release of follicle-stimulating hormone (FSH) in established bioassays; vitro using rat anterior pituitary cells as described [see, for example. Vale al al., Endocrinology, 91: 562-572 (1972); Ling et al, Nature, 321: 779-782 (1986) or Vale et al., Nature, 321: 116-119 (1986)] It is contemplated that the BMP-11 protein of the invention, when it is composed as a homodimer or a Heterodimer with another chain of inhibin β will present stimulatory effects on the release of follicle stimulating hormone (FSH) from cells of the anterior pituitary as described [Ling et al., Nature, 321: 119-182 (1986) or Vale et al., Nature, 321: 776-779 (1936)]. Additionally, it is contemplated that the BMP-11 protein of the invention when compounded as a heterodimer with the inhibin chain will inhibit the release of the follicle stimulation hormone (FSH) from cells of the anterior pituitary as described [see , for example, Vale et al., Endocrinology, £ 1: 562-572 (1972). Therefore, depending on the particular composition, it is expected that the BMP-1 protein of the invention may have contrasting and opposite effects on the release of the follicle stimulating hormone (FSH) from the anterior pituitary. It has been shown that activin A (the homodimeric composition of β-inhibin) has erythropoietic stimulating activity (see, for example Eto et al., Biochem, Biophys. Res. Commun., 142: 1095-1103 (1987) and Murata et al., Proc. Nati Acad. Sci. U.S.A., 85: 2434-2438 (1988) and Yu et al., Nature, 330: 765-767 (1987)] It is contemplated that the BMP-11 protein of the invention has a similar erythropoietic stimulating activity. This activity of the BMP-11 protein can furthermore be characterized by the ability of the BMP-11 proiein to demonstrate erythropoietin activity in the biological assay performed using the human cell line K-562 as described by [Lozzio et al., Blood , 45: 321-334 (1975) and the US patent No. 5,071,834]. Previously, the structures of various proteins, designated co or BMP-1 to BMP-9, have been discovered. The only inductive activities of these proteins. together with its presence in bone, it suggests that they are important regulators in bone repair processes, and may be involved in the normal maintenance of bone tissue. The BMP-11 proiein of the present invention is related to the above BMP proteins, and is expected to share BMP activities such as the ability to induce bone, cartilage and / or other connective tissue, such as tendon or ligament, and activities of wound healing of BMPs. In addition, it is expected that the proteins of the invention may act in concert with or perhaps synergistically, with other proteins and related growth factors. Additional methods and therapeutic compositions of the invention, therefore, comprise a therapeutic amount of at least one BMMP-11 protein of the invention with a therapeutic amount of at least one of the other BMP proteins described in patents and applications described above and which They are also the property of the applicant. Such combinations may comprise separate molecules of the BMP proteins or heteromolecules composed of different fractions of BMP. In addition, BMP-11 proteins can be combined with other beneficial agents for the treatment of defects or wounds of bone and / or cartilage or of the tissue in question. These agents include several growth factors such as the epidermal growth factor (EGF), fibroblast growth factor (7GF), platelet derived growth factor (PDGF), transforming growth factors (TGF-α and TGF-β). ), and fibroblast growth factor K (KFGF), hopnone parathyroid (PTH), leukemia inhibitory factor (LIF / HILDA / DIA), insulin-like growth factors (IGF-I and IGF-II). Perfumes of these agents can also be used in compositions of the present invention. The DNA sequence of bovine BMP-11 (SEQ ID NO: 1) and the amino acid sequence (SEQ ID NO: 2) and the DNA sequence of human BMP-11 (SEQ ID NO: 10) and the sequence of amino acids (SEQ ID NO: 11) are presented in the Sequence Listing. Activin proteins are capable of regulating the production of follicle stimulating hormone (FSH), and thus BMP-11 can be useful as a contraceptive or fertility-inducing therapeutic. In homodimeric form or in hetercdfcneros with proteins of the inhibin-β group, it is expected that the purified BMP-11 proiein shows inhibin activity, and can be used to stimulate FSH.

In addition, it is expected that the purified BMP-11 protein may be useful for the induction of bone, cartilage and / or other connective tissue. Bovine BMP-11 can be produced by culturing a transformed cell with a DNA sequence comprising nucleotides # 375 to 704 as shown in SEQ ID NO: 1 and recovering and purifying from the culture medium a protein characterized by the sequence of amino acids comprising amino acid # 1 to amino acid # 109 as shown in SEQ ID NO: 2 substantially free of other protein materials with which it is co-produced. It is expected that human BMP-11 is homologous to bovine BMP-11. The invention, therefore, includes methods for obtaining DNA sequences encoding human BMP-11, the DNA sequences obtained by these methods, and the human protein encoded by these DNA sequences. This method involves the use of the nucleotide sequence of bovine BMP-11 or portions thereof to design probes to screen libraries for the human gene or fragments thereof using standard techniques. A DNA sequence encoding part of the human BMP-11 protein (SEQ ID NO: 3) and the corresponding amino acid sequence (SEQ ID NO: 4) are presented in the Sequence Listing. These sequences can also be used in order to design probes to obtain the complete human BMP-11 gene through standard techniques. Human BMP-11 can be produced by culturing a cell transformed with the DNA sequence of BMP-11 and recovering and purifying BMP-1 from the culture site. The expressed and purified protein is substantially liberated from other proteinaceous materials with which it is co-produced, as well as other pollutants. It is contemplated that the purified and recovered protein shows the ability to regulate the production of FSH. The proteins of the invention can furthermore be characterized by the ability to regulate the production of follicle stimulating hormone (FSH) in bioassays established in vitro using cells from the anterior pituitary of raia. The BMP-11 proteins may also be characterized by the ability to induce the formation of bone, cartilage and / or other connective tissue, for example, in the bone-bone formation assay described below. They are also useful for modulating cellular development, particularly neuron formation, growth, differentiation and proliferation, and especially neuronal conservation. Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a BMP-11 protein in a pharmaceutically effective carrier or vehicle. These BMP-11 compositions of the invention may be useful for the regulation of the follicle-stimulating hormone, and may be useful in contraception. The compositions of the invention may further include at least one other therapeutically useful agent such as BMP proteins, ie BMP-1, BMP-2, BMP-3, B P-4, 3MP-5, BMP-6 and BMP- 7, described by examples in the US patents Nos. 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076 and 5,141,905; BMP-8 described in PCT publication WO91 / 18098; and BMP-9, described in PCT Publication WO93 / 00432. and BMP-10, described in co-pending patent application serial number 08 / 061,695, filed on May 12, 1993. The compositions of BMP-11 may also be useful for a large number of uses involving the regulation of the production of the follicle-stimulating hormone, including contraception. These methods according to the invention involve the administration to a patient requiring such treatment of the effective amount of BMP-11. The compositions of the invention may comprise, in addition to a BMP-11 pro tein, other members of the inhibin-β protein group or inhibin-a proteins, as well as other therapeutically useful agents including growth factors such as factor of epidermal growth (EGF), fibroblast growth factor (FG7), transformation growth factor (TGF-a and TGF-β), and insulin-like growth factor (IGF). The BMP-11 compositions of the present invention may also be useful for the treatment of a number of defects in bone and / or cartilage tissue, pericdental disease and the healing of various types of wounds. These methods, in accordance with the present invention, involve administering to a patient requiring such bone and / or cartilage tissue formation, wound healing or tissue repair, an effective amount of a BMP-11 protein. These methods may also involve the administration of a protein of the invention in conjunction with at least one of the novel BMP proteins as described above in the patents and applications owned by the applicant. In addition, these methods may also include the administration of a BMP-11 protein with other growth factors, including EGF, FGF, TGF-, TGF-β and IGF. Yet a further aspect of the present invention consists of DNA sequences which code for the expression of a BMP-11 protein. Such sequences include the nucleotide sequences in a 5 'to 3' direction illustrated in SEQ ID NO: 1 or DNA sequences which hybridize under stringent conditions to the DNA sequence of an NO: 1 ID and which code for a protein that has BMP-11 activity. Finally, allelic variations or other variations of the sequences of SEQ ID NO: 1 are also included in the invention, whether such nucleotide changes result in changes in the sequence of the peptide or not. Yet a further aspect of the invention consists of DNA sequences that encode the expression of a BMP-11 protein. Such sequences include nucleotide sequences in a 5 'to 3' direction illustrated in SEQ ID NO: 1 or SEQ ID NO: 10, as well as DNA sequences which, due to the degeneracy of the genetic code, are identical to the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 10, and coding for the protein of SEQ ID NO: 2 or SEQ ID NO: 11. DNA sequences are also included in the present invention which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 10 and which code for a protein having BMP-11 activity. Finally, allelic variations or other variations of the sequences of the SEO ID NO: 1 or the SEQ ID NO: 10 are also included in the invention, whether such nucleotide changes result in changes in the sequence of the peptide or not, but in wherein the peptide sequence still has BMP-11 activity. A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence for it. These vectors can be used in a new process for the production of a BMP-11 protein of the invention, in which a cell line transformed with a DNA sequence coding for a BMP-1 1 protein in operative association with a sequence of expression control for her, it is cultivated in a suitable culture medium and a BMP-11 proiein is recovered and purified from there. This process can employ a number of known cells, either prokaryotic or eukaryotic, as host cells for the expression of the polypeptide. The present invention also includes the use of the DNA sequences and vectors of the invention in gene therapy applications. In such use, the vectors can be transfected into the cells of a patient in vitro, and the cells can be re-introduced into a patient. Alternatively, the vectors can be introduced into a patient in vivo through target transfection. Other aspects and advantages of the present invention will be clear from the consideration of the following detailed description and preferred embodiments thereof.

Description of Sequences SEQ ID NO: 1 is a partial nucleotide sequence of bovine BMP-1 1 which codes for the mature bovine BMP-11 polypeptide. SEQ ID NO: 2 is the amino acid sequence of a partial propeptide and the mature and complete bovine BMP-11 pclippeid, encoded by SEQ ID NO: 1. SEQ ID NO: 3 is a nucleotide sequence partial of human BMP-1 1. SEQ ID NO: 4 is a partial amino acid sequence for the human BM-11 polypeptide encoded by SEQ ID NO: 3. SEQ ID NO: 5 and SEQ ID NO: 6 are primary for BMP-1 1 of bovine used to isolate human BMP-1 1 and other BMP-1 proteins 1. The S? Q ID NO: 7 is a DNA sequence that is inserted into pMT2 CXM to add a nearby Xhol recognition site of the SV40 origin of replication. SEQ ID NO: 8 is a DNA sequence inserted into pMT21 to insert an Xhol recognition site upstream of the DHFR gene. SEQ ID NO: 9 is a DNA sequence comprising a portion of the EMC virus leader sequence. SEQ ID NO: 10 is a DNA sequence encoding a partial propeptide and the complete and mature human BMP-11 protein.

SEQ LD NO: 11. is the amino acid sequence of a partial propeptide and the complete and mature human BMP-11 protein encoded by SEQ ID NO: 10.

Detailed Description of the Invention BMP-11 The nucleotide sequence of bovine BMP-11 (SEQ ID NO: 1) and the encoded amino acid sequence (SEQ ID NO: 2) and the nucleotide sequence of human BMP-11 (SEQ ID NO: 10) and the encoded amino acid sequence (SEQ ID NO: 11) are described in the Sequence Listing. The purified bovine BMP-11 proteins of the present invention are produced by culturing a host cell transformed with a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide # 375 to nucleotide # 704 or the DNA coding sequence of SEQ ID NO: 10 from nucleotide # 760 to nucleotide # 1086, and recovering and purifying from the culture medium a protein containing the amino acid sequence or a sub-sequence homologously homologous to it is represented by amino acids # 1 to # 109 of SEQ ID NO: 2 or amino acids 1 to 109 of GEO ID NO: 11. For the production of BMP-11 proteins in mammalian cells, the sequence of DNA further comprises a propeptide suitably linked in frame with the above DNA coding sequences for BMP-11. The propépido can be a natural propeptide of BMP-11 or a propeptide from another member of the TGF-β superfamily. The sequence of human BMP-11 of the present invention is obtained using all or fragments of the DNA sequence of bovine BMP-11, or the partial sequence of human BMP-11 of SEQ ID NO: 3 as probe. Thus, the DNA sequence of human BMP-11 comprises the DNA sequence of nucleotides # 28 to # 185 of the SEO ID NO: 3. The human BMP-11 protein comprises the amino acid sequence of the amino acids # 1 to # 52 of SEQ ID NO: 4. It is expected that BMP-11, as expressed by mammalian cells such as CHO cells, exists as a heterogeneous population of active BMP-11 proiein species with N-termini. variants. It is expected that the active species will comprise an amino acid sequence beginning at least with the cis-amino residue at amino acid # 6 of SEQ LO NO: 1 or SEQ ID NO: 10, or in addition in the direction of termination N. Thus, it is expected that the DNA sequences encoding BMP-11 a? iva proteins will comprise nucleotides # 375 or # 390 to # 701 of SEQ ID NO: I or nucleotides # 760 or # 775 to # 1086 of the SEQ ID NO: 10, and may comprise additional nucleotide sequence in the 5 'direction of SEQ ID NO: 1 or SEQ ID NO: 10. It has been determined experimentally by expression in E. coli that the N human BMP-11 is as follows: [M] NLGLDXDEHSSE, where X y designates an amino acid residue without a clear signal, consistent with a cisine location at that position. Thus, it is expected that this species of BMP-11 will have an N-terminus at amino acid # 1 of SEQ ID NO: 1 or SEQ ID NO: 10, and in the DNA sequences encoding pere this species will comprise nucleotides # 375 to # 701 of SEQ ID NO: 1 (bovine) or nucleotides # 760 to # 1086 of SEQ ID NO: 10 (human). The eparert molecular weight of the human BMP-11 monomer was determined by SDS-PAGE which was approximately 12 kd. The human BMP-11 protein exists as a ciara solution, without color in 0.1% trifluoroacetic acid. The BMP-11 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials with which they are co-produced and from other contaminants present. The BMP-11 proteins can be characterized by the ability to regulate the production of FSH. The BMP-11 proteins may also be characterized by the ability to modulate the release of follicle stimulating hormone (FSH) in bioassays established in vitro using rat anterior pituitary cells as described [see, for example, Vale et al. ., Endocrinology, £ 1: 562-572 (1972); Ling ei ai., Naív.re, 321: 779-782 (1986) or Vale eí al, Nature, 321: 116-119 (1986)]. The BMP-11 proteins can also be characterized by the ability to induce the formation of bone and / or cartilage and / or other connective tissue. Such an inductive activity of the BMP-11 molecule is also characterized by the ability to induce the formation of bone, cartilage and / or other connective tissue in the assays described in the examples that follow more closely.

The BMP-11 proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1 or SEQ ID NO: 10, but within which modifications have been provided in natural form (e.g., allelic variants). in the sequence of nucleotides that can result in amino acid changes in the polypeptide) or deliberately designed. For example, synthetic polypeptides can totally or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2 or SEQ ID NO: 17. These sequences, by virtue of sharing primary, secondary and tertiary conformational and conformational characteristics with polypeptides of inhibin-ß of SEQ IE NO: 2 or SEQ ID NO: 11 may possess BMP-11 activity in common with them. In this way, they can be used as biologically active substitutes for BMP-11 polypeptides that occur naturally in therapeutic processes. Other specific mutations of the BMP-11 protein sequences described herein involve modifications of the glycosylation sites. Such modifications may involve O-linked or N-linked glycosylation sites. For example, the absence of glycosylation or only partial glycosylation results from the substitution or deletion of amino acids at the glycosylation recognition sites linked to aspanagine. The asparagine-linked glycosylation recognition sites comprise epiphyse sequences that are specifically recognized by appropriate cell glycosylation enzymes. These tripeptide sequences are either asparagine-X-ireinine or asparragma-X-serine, where X is usually any amino acid. A variety of substitutions or deletions of amino acids in one or both of the first and third amino acid positions of a glycosylation recognition site (and / or amino acid deletion in the second position) results in null glycosylation in the modified tripeptide sequence. Adie: locally, the expression of the BMP-11 protein in bacterial cells results in non-glycosylated protein, without alteration of the glycosylation recognition sites. The present invention also encompasses the new DNA sequences, free of association with DNA sequences that code for other pro-ininaceous materials, and which code for the expression of BMP-11 proteins. These DNA sequences include those described in SEQ ID NO: 1 or SEQ LD NO: 10 in a 5 'to 3' direction and those sequences that hybridize them under astringent hybridization conditions, eg, 0.1X SSC, 01% SDS at 65 ° C [see, Maniatis et al., Molecular Cloning (A Laboraíorv Manual). Cold Sppng Harbor Laboratory (1982), pages 387 to 389] and which code for a protein that has activity of BMP-11. These DNA sequences also include those which comprise the DNA sequence of SEQ ID NO: 3 and those that hybridize them under stringent hybridization conditions and which code for a protein possessing BMP-1 i activity. Similarly, the DNA sequences encoding BMP-11 proteins encoded by the sequences of SEQ ID NO: 1 or SEQ ID NO: 10, but which differ in codon sequence due to degenerations of the genetic code or fencing allyic (base changes that occur naturally in the species population that may or may not result in an amino acid change) also encode the new factors described here. Also included in the invention are variations in the DNA sequences of SEQ ID NO: 1 or SEQ ID NO: 10, which are caused by point mutations or induced modifications (including insertion, deletion and substitution) to improve the activity, half-life or production of the encoded polypeptides. Another aspect of the present invention provides a new method for the production of BMP-I proteins I. The method of the present invention involves the cultivation of a suitable cell line, which has been phosphonated with a DNA sequence encoding a BMP-11 protein of the invention, under the control of known regulatory sequences. Transfected host cells are cultured and BMP-1 1 proteins recovered and purified from the culture medium. The purified proteins are substantially free of the proteins with which they are co-produced, as well as of contaminants. Appropriate cells or cell lines can be mammalian cells, such as Chinese hamster ovary (CHO) cells. Selection of appropriate mammalian host cells 3 'methods for transformation, culture, amplification, migration. Product production and purification are known in the art. See, for example, Gething and Sambrook, Nature, 2 £ 3: 620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol .. 5 (7): i75C-1759 (1985) or Howley et al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line, which is described in the accompanying drawings, is the COS-1 monkey cell line. The mammalian cell CV-1 may also be suitable.

Bacterial cells can also be appropriate hosts. For example, the various strains of E. coli. (for example, HB101, MCI 061) are basic and known as host cells in the field of biotechnology. Several strains of B. subtilis, Pseudomonas, other bacilli and the like can be employed in this method. Many strains of yeast cells known to those skilled in the art may also be available as host cells for the expression of the peptides of the present invention. Additionally, where desired, insect cells may be used as host cells in the method of the present invention. See, for example, Miller et al., Genetic Engineering, 8: 277-298 (Plenum Press 1986) and the references cited there. Another aspect of the present invention provides vectors for use in the method of expression of these novel BMP-11 polypeptides. Preferably the vectors contain the new complete DNA sequences that were described above and which code for the novel factors of the invention. In addition, the vectors contain appropriate expression sequences COIIÚ? I that allow the expression of the BMP-11 protein sequences. In alternative form, vectors incorporating modified sequences of incorporation as described above are also embodiments of the present invention. Additionally, the sequences of SEQ ID NO: 1 or SEQ ID NO: 10 or other sequences encoding BMP-11 proteins could be manipulated to express a mature BMP-11 protein by deletion of propeptide sequences encoding BMP- 11 and replacing them with sequences encoding the complete propeptides of other BMP proteins, acivivin proteins or other members of the TGF-β superfamily. The vectors can be used in the method of transforming cell lines and contain selected regulatory sequences in operative association with the coding sequences of the DNA of the invention, which are capable of directing the replication and expression of this in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and can be selected depending on the host cells. Said selection is routine and does not form part of the present invention.

For expression in mammalian host cells, the vector may comprise a coding sequence that encodes a propeptide suitable for protein secretion by the host cell bound in reading frame appropriate to the coding sequence for mature BMP-11 protein. Suitable propeptide coding sequences can be obtained from DNA encoding proteins of the TGF-β superfamily of proteins, for example, including BMP-2 to BMP-9. For example, see U.S. Patent No. 5,168,150, the description of which is incorporated herein by reference, in which a DNA encoding a precursor portion of a mammalian protein other than BMP- 2 is fused to the DNA encoding a mature BMP-2 proiein. In this form, the present invention includes chimeric DNA molecules comprising a DNA sequence encoding a propeptide from a member of the TGF-β superfamily of proteins bound in correct reading frame to a DNA sequence encoding a BMP-1 polypeptide 1. The term "chimeric" is used to indicate that the propeptide originates from a polypeptide different from the BMP-11 protein. A proiein of the present invention, which regulates the production of FSH, has possible application in the increase of fertility, when it is expressed in a composition as a homo dimer or as a heterodimer with other proteins of the family of in-liibin-β . The proteins of the present invention may also be useful for contraception, when they are expressed in a composition as a heterodimer with proteins of the inhibin-a family. A protein of the present invention, which induces the formation of cartilage and / or bone in circumstances in which bone is not normally formed, has application in the healing of bone fractures and cartilage defects in humans and other animals. Such preparation employing a BMP-11 protein may have prophylactic use in the reduction of both open and closed fractures and also in the improved fixation of artificial joints. The formation of new bone induced by an osteogenic agent contributes to the repair of congenital defects, induced by trauma or craniofacial defects induced by oncological resection, and is also useful in cosmetic plastic surgery. A BMP-1 1 protein can be used in the treatment of periodental disease, and in other processes of dental repair. Such agents can provide an environment for attracting bone-building cells, stimulating the growth of bone-forming cells or inducing the differentiation of progenitors of bone-forming cells. The BMP-11 polypeptides of the invention may also be useful in the treatment of osteoporosis. A variety of osteogeric factors, cartilage inducers and bone inducers have been described. See, for example, European patent applications numbers 148,155 and 169,016 for descriptions thereof. The proteins of the present invention may also be useful in wound healing and related tissue repair. Wound types include, but are not limited to burns, incisions and ulcers. (See, for example, PCT Publication WO84 / 01106 for a description of wound healing and related tissue repair). In addition, the BMP-11 proteins of the present invention are useful for modulating all aspects of the messiness of neuronal cells, particularly the formation, growth, differentiation and neuronal proliferation, and especially neuronal conservation. The BMP-11 proteins of the invention induce neuronal cell formation and have application in the healing, protection, maintenance and / or repair of neuron tissue !. BMP-11 proteins are useful for a variety of neuronal defects including, for example, neuropathies, neurodegenerations, and nerve resection. These disorders can be associated with the cell body of the neuron (which can receive signals directly), with the axons of the neuron (which usually conducts signals away from the cell body), and / or with dendrites of the neuron (which receive signals of the axons of other neurons). The branching of the axon allows the passage of a signal to many target cells simultaneously. Similarly, dendrites can be so extensively branched as to receive as many as 100,000 input pulses in a single neuron. The immense variety in the branching pattern of the axons and dendrites is characteristic of the different functional classes of neurons. Neuronal tissue is classified as peripheral or central. The central nervous system (CNS) comprises the brain and spinal cord that is linked through nerves to a large number of peripheral structures such as sensory organs for input signals, and muscles and glands for output signals. The nerve cell clusters of the peripheral nervous system (PNS) are referred to as ganglia and nerves are also connected to the central nervous system. All neural tissue, both peripheral and central, is made up of two main classes of cells: neurons and glial cells. Generally, once a neuron has reached maturity, it does not divide. As a result, when a neuron dies, the resulting functional deficit is typically not repaired, and the resulting pathology is irreversible. The death of neuronal cells can occur in neurodegenerative diseases, neuropathies and nervous resection. The death of neuronal cells occurs in neurodegenerative diseases such as Alzheimer's, Huntington's, Parkinson's and amyotrophic lateral sclerosis (ALS). These neurodegenerative diseases are each characterized by neuronal cell death in different areas of the CNS and may involve one or more types of neurons. For example, Parkinson's disease is characterized by the loss of dopaminergic neurons within ia nigra and caeruleus, whereas ALS is associated with the death of motor neurons. Strategies for the treatment of neurodegenerative diseases include the prevention of neuronal death with neurotrophic agents, the induction of neuronal regeneration in vivo with agents that affect endogenous stem cells, and cell replacement therapy with ex vivo manipulation of neural stem cells. . BMP-11 may have applications in all these therapy strategies in the prevention of neuronal death. Peripheral neuropathy, including nerve resection, results from damage to neurons in the PNS. In this case, the neurons, once damaged, may or may not die. Typically, axons of neurons are affected, with the destruction of the axon itself or of the myelin sheath surrounding the axon. If the cell body of the neuron remains alive after the degeneration of the axon and / or the demyelination, the neuron can sometimes repair itself. However, if the cell body dies, functional repair requires growth of the collateral nerve to compensate for the damage. Common causes of peripheral neuropathy include, for example, diabetes mellitus, chronic alcohol abuse, nutritional deficiencies (such as from violins B and E), chronic renal failure, radiation therapy, HIV infection, and trauma or eniramment. (similar to carpal tunnel syndrome). The entrapment of neurons can occur when surrounding structures hit neurons, for example, as a result of inflammation in the area.Peripheral neuropathy can be treated by agents that accelerate axonal repair, prevent neuronal death and induce collateral nerve growth. BMP-11 can be used in all these treatments. Nerve resection may occur during injury or trauma to the body and may occur during surgical procedures such as when the nerve is cut accidentally. BMP-11 can be used to repair rottira. Alone, or in combination with other factors, that portion of the nerve that is cut is maintained (preventing its death) until the interrupted connection has been restored. BMP-11 can be used to promote the differentiation of stem cells into neuronal cells and can also be used to stimulate the production of axons and dendrites in both neurons that have not yet developed into neurites, as well as in neurons that have lost these processes as a result of the aforementioned disorders. A neural stem cell is a cell that gives rise to a variety of neuronal and glial cells. Certain neurological diseases can be treated through ex vivo manipulation of neural stem cells for transplantation or in vivo activation of quiescent neural stem cells to produce healing from within. Regional differences in the nervous system can be exploited to affect the behavior of neural stem cells in this way. Neurogenesis can be induced by 3MP-1I, scia or in combination with other factors, and can convert neural stem cells into differentiated progeny. Similarly, other appropriate factors may be provided in conjunction with BMP-11 for a stem cell to produce a particular type of glial neural cell. Clinical tests show that neuron replacement therapies are possible for neurodegenerative diseases, such as Parkinson's and Huntington's diseases. The primary cells expanded in vitro can be used in neural grafting and result in the complete integration of the grafted cells. In vitro expansion and manipulation of cells from the neural epithelium provides a well-characterized range of cells for transplant-based strategies for neurodegenerative diseases. A further aspect of the invention comprises methods for the treatment of neuronal tissue defects comprising the application of a pharmaceutical composition comprising a BMP-11 protein, alone, or in combination with other factors, to a patient at a site of such defects. , as well as methods for inducing the production of neuronal tissue comprising the application of a pharmaceutical composition comprising BMP-11 protein to a patient that requires such neuronal tissue production. The application of the composition can be by means of injection at the site, as well as implantation during surgery, or other application that will result in the BMP-11 exhibiting the desired effects. Such compositions may find use in the protection or repair of neuronal tissue in several neuropathies, neurodegenerations and nerve resection. For example, a method involves the administration of a BMP-11 proininone immediately at the time of the trauma to prevent cell death in this way. Still another method involves the prophylactic administration of BMP-11 to patients who have a genetic predisposition to neurodegenerative disorders. A further aspect of the invention is a therapeutic method and a composition for the repair of fractures and other conditions related to cartilage and / or bone defects or periodental diseases. The invention further comprises therapeutic methods and compositions for healing wounds and for tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the BMP-11 proteins of the invention in admixture with a pharmaceutically acceptable carrier, vehicle or matrix. Said preparation employing a BMP-11 protein may also increase neuronal survival and, therefore, it is useful in the transplant and treatment of conditions that present a decrease in neuronal survival. It is expected that the BMP-11 proteins of the invention may act in concert with or perhaps in synergistic fashion with other related proteins and growth factors. Further methods and therapeutic compositions of the invention therefore comprise a therapeutic amount of at least one BMP-11 protein of the invention with a therapeutic amount of at least one of the BMP proteins or other growth factors described in the patents and proprietary claims. the applicant and that were described above. Such combinations may comprise separate molecules or heiomeromolecules composed of different fractions. For example, a method and composition of the invention may comprise a disulfide-linked dimer comprising a subunit of BMP-11 protein and a subunit from one of a pr inhibin of inhibin-a, an inhibin-β protein or a BMP protein, such as BMP-1 to BMP-10. Agents useful with BMP-11 can include various growth factors such as whether epidermal growth factor (EGF), platelet derived growth factor (PDGF), growth factors of transformation (TGF-a and TGF-β), and insulin-like growth factor (IGF). Additional methods and therapeutic compositions of the invention comprise a therapeutic amount of at least one BMP-11 proiein of the invention with a therapeutic amount of at least one of the BMP proteins described in the patents and applications owned by the applicant and which were described above. . Such combinations may comprise separate molecules of the BMP proteins or heteromolecules composed of different fractions of BMP. For example, a method and composition of the invention may comprise a disulfide-linked dimer comprising a subunit of BMP-11 protein and a subunit derived from the "BMP" proteins described above. Thus, the present invention includes a purified BMP-11 polypeptide which is a heterodimer wherein a subunit comprises at least the amino acid sequence from amino acid # 1 to amino acid # 109 ele ia SEQ ID NO: 2 or SEQ ID NO: 11, and a subunit comprises an amino acid sequence for a morphogenetic protein of bone selected from the staple consisting of BMP-1. 3MP-2, 3MP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8 and BMP-9. An additional embodiment may comprise a heterodimer of BMP-11 fractions. In addition, the BMP-i 1 proteins can be combined with other beneficial agents for the irradiation of defects, wounds or bone and / or cartilage tissue or other tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-β ), fibroblast growth factor k (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF / HILDA / DIA), insulin-like growth factors (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the present invention. The BMP-11 proteins of the present invention can also be used in compositions combusted with bone morphogenetic proteins. See for example Ogawa ei el., WO 92/14481 (1992); Ogawa e al al, J Biol. Chem., 267: 14233-14237 (1992). Morphogenetic bone proteins useful in such compositions include BMP-1, BMP-2, BMP-3, 3MP-4, BMP-5, BMP-6 and BMP-7, described by way of example in U.S. Pat. Nos. 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076 and 5,141,905; BMP-8 described in PCT publication W091 / 18098; and BMP-9, described in PCT Publication WO93 / 00432, and BMP-10, described in co-pending patent application serial number 08 / 061,695, filed May 12, 1993. The preparation and formulation of the same compositions of physiologically acceptable proteins, having due regard to pH, iso-ionicity, stability and the like, is within the skill of the art. Therapeutic compositions are also currently valuable for veterinary applications due to their lack of species specificity in BMP and TGF proteins. Particularly domestic animals and thoroughbred horses, in addition to humans, are desirable patients for those treatments with the BMP-11 proteins of the present invention. The therapeutic method includes the administration of the composition topically, systemically or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in more physiologically acceptable and pyrogen-free form. In addition, the composition may desirably be encapsulated or injected in a viscous form for release to the site of the year to bone, cartilage or tissue. Topical administration may be suitable for wound healing and tissue repair. As described above, other therapeutically useful agents other than BMP-11 proteins can also be incited in the composition, optionally, which alternatively or additionally can be administered simultaneously or sequentially with the composition of BMP-11 in the methods of the invention. Preferably for the formation of bone, cartilage or other connective tissue, the composition includes a matrix capable of delivering BMP-11 or other BMP proteins to the site of tissue damage and which requires repair, providing my structure for the desol bone and cartilage and that is optimally capable of being reabsorbed in the body. The matrix can provide the release of the BMP-11 and / or other inductive bone protein, as well as an adequate presentation and an appropriate environment for cellular infiltration.

These matrices can be made of materials currently in use for hearing medical implant applications. The selection of matrix material is based on biocompatability, biodegradability, mechanical properties, cosmetic appearance and metaphase properties. The particular application of the compositions of BMP-11 will define the appropriate formulation. Potential matrices for the compositions of the invention may be calcium sulfate, tricalcium phosphate, hydroxyapay, polylactic acid, and chemically defined biodegradable polyanhydrides. Other potential materials are also biodegradable and biologically well defined bone or dermal collagen. Additional mairices are formed by pure proteins or components of exíracelular maírices. You will hear potential matrices that are also non-biodegradable and chemically defined, such as sintered hydroxyapatites, biocrystals, alumina, or ceramic objects. The mayrices can be composed of combinations of any of the above-mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. Bioceramics may have alterations in their composition, such as calcium-aluminate-phosphate and be processed to alter the pore size, particle size, shape of the particles and biodegradability. Progress can be monitored by periodic evaluation of bone growth and / or repair. Progress can be monitored, for example, by X-rays, histomorphometric tests and tetracycline labeling. The dosage regimen will be determined by the attending physician, considering several factors that modify the action of the BMP-11 protein, for example, the age, sex and diet of the patient, the severity of any infection, time of administration and other factors. clinical The dose may vary with the type of pro-BMP or growth factor present in the composition. The dose may vary with the type of matrix used. The following examples illustrate the practice of the present invention in the recovery and characterization of bovine BMP-11 protein and employing it to recover human BMP-11 protein and other proteins, obtaining human proteins and expressing the proteins via recombinant techniques. Neuronal uses of BMP-11 proieins are also detailed.

Example 1 Bovine BMP-71 800,000 recombinans from a bovine genomic library constructed in the vector EMBL3 are plated at a density of 8,000 reclosing bacteriophages per plate on 100 plates. Duplicate replicates of nitrocellulose are made from the recombinant bacteriophage plaques from these plates and amplified. A DNA fragment of BMP-7 corresponding to nucleotides # 1,081 to # 1,403 (Figure 4, United States Patent No. 5,141,905) was labeled with j2P by the random priming procedure of Feinberg et al. [Anal. Biochem. 132: 6-13 (1983)] and hibridc a ur. group of filters in standard hybridization regulator (SHB) (5X SSC, 0.170 SDS, 5x Detihardt's, 100 μg / ml of salmon sperm DNA) at 60 ° C for 2 to 3 days. The filters were washed under conditions of reduced astringency (4X SSC, 0.1% SDS at 6C ° C). Multiple recombinants of positive hybridization were noted. 52 plaques of bacteriophages of multiple positive hybridisation recombinants are selected and plated for secondary. Duplicate replicates of nitrocellulose from the recombinant plates are prepared from the 52 secondary plates and amplified. A group of nitrocellulose filters is hybridized to the human BMP-7 DNA probe described above and is washed under the same reduced stringency conditions. The other filter group is hybridized to a mixed probe of BMP-5, BMP-6 and BMP-7 at 31-13 at 65 ° C overnight and washed with 0.1X SSC, 0.1% SDS at 65 ° C ( astringent hybridization and washing conditions). The mixed probe consists of relatively equal amounts of DNA fragments labeled with J ~ P and which comprise, nucleotides # 1,452 to # 2,060 (Figure 4, United States of America patent No. 5,106,748) of the sequence of human BMP-5, nucleotides # 1,395 to # 1,698 (Figure 4, United States of America patent No. 5,187,076) of the human BMF-6 sequence, and nucleotides # 1,081 to # 1,403 (Figure 4, United States of America No. 5,141,905) of the human BMP-7 sequence. The DNA fragments of BMP-5, BMP-6 and BIvIP-7 are labeled with 32P by the random priming procedure and equal numbers of counts per minute (cpms) of each probe are combined and added to the SHB containing the other group of replicas of nitrocellulose filters of the 52 secondary plates. Fourteen recombinants that positively hybridized to the human BMP-7 probe under the conditions of reduced stringency and that showed weak or no hybridization to the mixed BMP-5/6/7 probe under conditions of high stringency were selected for further analysis. All of the 14 recombinants that exhibited these hybridization characteristics are plaque purified and the bacteriophage DNA is prepared from each one. The positive hybridization region of one of the 14 binders exhibiting the hybridization characteristics described above, designated as? 7r-30, is localized to a Sacl restriction fragment of 0.5 kb. This fragment is subcloned into a plasmid vector (pGEM-3) and the DNA sequence analysis is performed. The partial DNA sequence (SEQ ID NO: 1) and the derived amino acid sequence (SEQ ID NO: 2) of clone? 7r-30 are shown in the Sequence Listing. The bacteriophage? 7r-30 has been deposited with the ATCC on April 7, 1993, and assigned the accession number ATCC 75439. This deposit satisfies the requirements of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for Purposes of Patent Procedures and the rules for this. This clone 7R-30 encodes for at least my portion of the bovine BMP-11 protein of the present invention. The nucleotide sequence of clone? 7r-30 contains an open reading frame of 456 nucleotides # 246-701 of SEQ ID NO: 1. The nucleotide sequence of # 324 to # 701 of SEQ ID NO: 1 defines an open reading frame of 378 nucleotides, coding for at least 126 amino acids from the C-terminal portion of a bovine BMP-11 protein, as determined by alignment with other BMP proteins and other denitr proteins of the TGF-β family. The sequence of r.ucieotides # 246 to # 323 defines my open reading frame contiguous with the sequence encoding the predicted peptide of BMP-11 of 126 amino acids, however a reduced degree of amino acid identity of the peptide deduced from this region of the DNA sequence (# 246 to # 323) with other BMP proteins and other proteins of the TGF-β family, as well as the presence of multiple potential consensus consensus splicing sequences make it difficult to define the 5 'boundary of this exon of the bovine BMP-11 gene. The presence of a stop codon within frames at nucleotide positions # 243 to # 245 indicates that the nucleotide sequence of clone? 7r-30 contains at least one exon / intron boundary of the bovine BMP-11 gene . Based on the knowledge of other denitr proteins of the TGF-β family, it is predicted that the polypepide precursor of BMP-11 will be separated into the muiiibasic sequence ARG-SER-ARG-ARG according to a proposed consensus proteolytic processing sequence of ARG-XX-ARG. It is expected that the separation of the polypipe precursor of BMP-11 will generate a mature peptide of 109 amino acids starting with the amino acid ASN at position # 1. The processing of BMP-11 in the mature form is expected to involve dimerization and removal of the N-terminus region in a manner analogous to the processing of the related TGF-β protein [Gentry et al., Molec. & Cell. Biol .. 8: 4162 (1988); Derynck went to, Nature. 316: 701 (1935)]. It is therefore contemplated that the active and mature species of BMP-1 1 comprise a homodimer of two polypeptide subunits, each subunit comprising amino acids # 1 to # 109 with a predicted molecular weight of about 12,000 dalions. It is agreed that additional acyl species comprise amino acids # 6 to # 109, including in this manner the first conserved cysteine residue. As with other members of the TGF-β family of proteins, the carboxy-terminated region of the BMP-11 protein shows greater sequence conservation than the portion with higher amino terminus. The percentage of amino acid identity of the BMP-11 protein in the C-terminated domain and cysteine-rich (amino acids # 6 to # 109) with the corresponding region of other proteins within the TGF-β family is as follows: BMP -2, 39%; BMP-3, 37%; BMP-4, 37%; BMP-5, 42%; BMP-6, 45%; BMP-7, 42%; BMF-3, 39%; BMP-9, 40%; Vgl, 39%; GDF-1, 34%, TGF-ßl, 36%; TGF-ß2, 38%; TGF-ß3, 38%, inhibin ß (B), 41% and inhibin ß (A), 39%.

Example 2 Human BMP-11 It is presumed that the genes of human and bovine BMP-11 are significant homologues, therefore the bovine coding sequence or a portion of it is used as a probe to screen a human or human genomic library. as a probe to identify a human cell line or tissue that synthesizes the analogous human protein. A human genomic library, such as # 944201 from the Stratagene catalog, can be screened with said probe, and probable isolated positives and DNA sequence obtained. The evidence that this recombinant codes for a part of human BMP-11 rests on the bovine / human protein and the homology of the gene structure. Once the recombinant bacteriophage containing DNA encoding a part of the human BMP-11 molecule is obtained, the human coding sequence can be used as a probe to identify a human cell line or tissue that synthesizes BMP-11 mRNA. Alternatively, the coding sequence of bovine BMP-1 1 can be used as a probe to identify said human or tissue cell line. Briefly described, RNA is extracted from a selected cell or tissue source and either subjected to electrophoresis in a formaldehyde agarose gel and transferred to itrc cellulose, or reacted with formaldehyde and splashed on nitroceluose directly. The nitrocellulose is then hybridized to a probe from a coding sequence of bovine or human BMP-11. Alternatively, the coding sequence of bovine BMP-11 is used to design oligonucleotide primers that will specifically amplify a portion of the 3MP-11 coding sequence located in the region located in the primaries used to perform the specific amplification reaction. . It is contemplated that BMP-11 sequences of boo and human will allow mine to specifically amplify con-spondies encoding sequences of human BMP-11 from mRNA, cDNA or genomic DNA models. Once a positive source has been identified by one of the previously described methods, mRNA is selected by oligo (dT) cellulose chromatography and the cDNA is synthesized and cloned into? GtlO or other bacteriophage vectors? known by those trained in the art, (for example? ZAP) by established techniques (Toóle eí al., supra). It is also possible to perform the oligonucleotide-directed primer amplification reaction, described above, directly on a pre-established human or genomic cDNA library, which has been cloned into my bacteriophage vector?. In such cases, a library that produces a specifically produced DNA product that encodes a portion of the human BMP-1 1 protein could be screened directly, using the amplified BMP-11 protein fragment encoding DNA as a probe. Oligonucleotide primers designed on the basis of the DNA sequence of the BMP-11 genomic clone of bovine? R-30 are predicted to allow the specific amplification of human BMP-11 coding sequences. The next oligonucleotide primer is designed on the basis of nucleotides # 501 to # 521 of the DNA sequence set forth in SEQ ID NO: 1 and is synthesized in an automated ABN synthesizer. 1 Primary C: TAGTCTAGATGCTCCGGCCAGTGCGAGTAC The first nine nucleotides of primary C (underlined) comprise the recognition sequence for the restriction endonuclease Xbal that can be used to facilitate the manipulation of a specifically amplified DNA sequence encoding the BMP-11 protein of the invention and are not derived from the DNA sequence presented in SEQ ID NO: 1. The following oligonucleotide primer is designed on the basis of the nucleotides # 701 to # 678 of the DNA sequence established in SEQ ID NO: 1 and is synthesized in an automated DNA synthesizer. Primary D: TGCGGATCCGGAGCAGCCACAGCGATCCAC 20 The first nine nucleotides of the D primary (underlined) comprise the recognition sequence for the restriction BamHI endonuclease that can be used to facilitate the manipulation of a specifically amplified DNA sequence encoding the BMP-11 protein of the invention and are therefore not derivatives of the DNA sequence presented in SEQ ID NO: 1. - >; The standard nucleotide symbols in the primaries previously identified are as follows: A, adenosine; C, cytosine; G, guanine and T, thymine. The C and D primaries identified above are used as primaries to allow the amplification of a specific nucleoide from human genomic DNA. The amplification reaction is performed as follows: Human genomic DNA (source: peripheral blood lymphocytes) is denatured at 100 ° C for five minutes and then cooled on ice before addition to a reaction mixture containing 200 μM each of deoxyr-ucleotide triphosphates (dATP) , dGTP, dCTP and dTTP), 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM gCI2, 0.001% gelatin, 1.25 units of Taq DNA polymerase, 100 pM of primary C of oligonucleotide and 100 pM of primary Oligonucleotide D This reaction mixture is then subjected to thermal cyclization in the following manner: 3 minutes at 94 ° C, 1 minute at 50 ° C, 1 minute at 72 ° C for one cycle, preferably 1 minute at 94 ° C. , 1 minute at 50 ° C, 1 minute at 72 ° C for thirty-nine cycles, DNA that is specifically amplified by this reaction is separated from the excess of the C and D primers of oligonucleotide and used to initiate the amplification by use of a purification resin from DNA based on protocol under the conditions suggested by the manufacturer. The resulting product DNA is digested with restriction endonucleases Xbai and BamHI, extracted with phenol and extracted with chloroform. Regulator exchange and removal of the small DNA fragments resulting from restriction digestion with Xbal / BaHI are carried out by dilution of the digested DNA product in 10 mM Tris-HCl, 1 mM EDTA followed by centrifugation through a centricon ™ 30 micro concentrator (WR Grace &Co., Beverly, MA; Product # 4209). The product DNA amplified and digested with Xbal / BamHI that resulted is subcloned into a plasmid vector (pBluescript) between the Xba restriction sites? and BamHI of the polylinker region. Analysis of the DNA sequence of the resulting subclones indicates that the product of the specifically amplified DNA sequence codes for a portion of the human BMP-11 protein of this invention. The DNA sequence (SEQ ID NO: 3) and the derivative ainino acid sequence (SEQ ID NO: 4) of this specifically amplified DNA fragment are presented in the Sequenced Labeled. Nucleotides # 1 to # 27 of this sequence comprise a part of the cligu mononucleotide O and nucleotides # 186 to # 213 comprise a part of the oligonucleotide primer D used to perform the specific amplification reaction. Due to the function of oligonucleotide primers C and D (designed on the basis of the DNA sequence of bovine 3MP-11) at the initiation of the amplification reaction, they may not correspond exactly to the actual sequence coding for a human BMP-1 1 and are therefore not translated into the derivation of the previous amino acid sequence. The DNA sequence, from nucleotide # 28 to # 185 of SEQ ID NO: 3, or portions thereof, specifically amplified from the human genomic DNA model can be used as a probe to identify additional coding sequences of BMP- 11 hmnana from human or human genomic cDNA libraries using standard hybridization / screening techniques known to those skilled in the art. One million two hundred thousand recombinants from a human fetal brain cDNA library (Stratagene catalog # 936206) constructed in the vector? ZAPII are plated at a density of 24,000 recombinant bacteriophage plaques per plate on 50 plates. Duplicate replicates of nitrocellulose are made from the plates of bacteriophage recombinant from these plates. An oligonucleotide probe designed on the basis of nucleotides # 53 to # 82 of SEQ ID NO: 3 is synthesized in my automated DNA synthesizer. This oligonucleotide probe is radioactively labeled with? J ~ P-ATF and is hybridized to both groups of replicates of nitrocellulose duplicates in SEB at 65 ° C. Nine recombinants of positive hybridization were noted. One of the positive hybridization recembinants called? FB30.5, it is purified on plate. Bacteriophage plate patterns of the? FB30.5 cDNA clone are prepared and the bacteriophage DNA is isolated. A bacterial plasmid called FB30.5, generated by the in vivo extirpation protocol described by the supplier (Stratagene) and containing the complete insert of the bacteriophage cDNA clone? FB30.5, has been deposited with the ATCC, 12301 Parklawn Drive , Rockville, Maryland, USA, under the requirements of the Budapest Treaty and designated as ATCC # 69619. A part of the clone DNA sequence FB30.5 is presented in SEQ ID NO: 10. One million recombinants from a human genomic library (Stratagene catalog # 944201) constructed in the vector FIX are plated at a density of 20, C0C plates of recombinant bacteriophages per plate on 50 plates. Duplicates of nitrocellulose replicas are made from the plates of recombinant bacíeriophage from these plates. An oligonucleotide probe designed on the basis of nucleotides # 57 to # 86 of SEQ ID NO: 10, with the exception of an inadvertent substitution of CAC by GCG in nucleotides # 59- # 61 of SEQ ID NO: 10 , it is synthesized in a synthesized! ' Automated DNA This oligonucleotide probe is radioactively labeled with? 32 P-ATP and is hybridized to both groups of the replicates of the nitrocellulose replicates in SHB at 65 ° C. Five recombinants of positive hybridization were detected. One of the positive hybridization recombinants called 30GEN.4 is purified on plate. Patterns of the bacteriophage plaque of the purified 30GEN-4 genomic clone are prepared and the bacteriophage DNA is isolated. A bacteriophage pattern of this genomic clone has been deposited with the ATCC, 12301 Parklawn Drive, Rockville, Maryland, E.U.A., under the requirements of the Budapest Treaty and designated as ATCC # 75775. A part of the sequence of A-DN of clone 30GEN.4 is shown in SEQ ID NO: 10. It was determined that a part of the DNA sequence of genomic clone 30GEN.4 was identical to a part of the sequence of DNA from the cDNA clone FBS 0.5. The extent of this overlap (nucleotides # 1 to # 198) of SEQ ID NO: 10 was used as a basis for compiling the partial coding sequence of the BMP-10 protein. The genomic clone 30GEN.4 is expected to contain sequences Additional coding of the human BMP-11 protein, which is expected to code for the rest of the precursor polypeptide of BMP-11, including the initiating methionine. The partial sequence of human BMP-11 is presented in SEQ ID NO: 10 and it should be noted that it has been determined that nucleotides # 1 to # 198 are present both in genomic clone 30GEN.4 and in cDNA clone of FB30.5, while nucleotides # 199 to # 1270 are derived entirely from the FB30.5 cDNA clone. SEQ ID NO: 10 predicts a human BMP-1 1 precursor protein of at least 362 amino acids. On the basis of knowledge of other BMPs and other proteins within the TGF-β family, it is predicted that the precursor polypeptide would be separated into the multibasic sequence ARG-SER-ARG-ARG (amino acids # -4 to # -1 of SEQ. ID NO: 11) according to the consensus proteolytic processing sequence that was proposed ARG-XX-ARG. The cleavage of the human BMP-1 1 precursor polypeptide at this location would generate a mature peptide of 109 amino acids beginning with the amino acid ASN at position # 1 of SEQ ID NO: 11. The processing of BIvIP-11 is expected Human in the mature form involves the dimerization and removal of the N-terminus region in a manner analogous to the processing of the related TGF-β pro'-eine [L. E.Gentry eí al, Molec. & Cell. Biol., 8: 4162 (1988); R.

DeryncR et al., Natire, 316: 701 (1985)]. It is contemplated that the active and mature species of humpna BMP-11 comprise a homodimer of two polypeptide subunits, each sublimity comprising amino acids # 1 to # 108 of SEQ ID NO: 11, with a predicted molecular weight of 12,000 daltons. It is further contemplated that additional active species comprise amino acids # 7 to # 108 of SEQ ID NO: 11, thus including the first conserved cysteine residue. Heterodyrrhenic molecules comprising a subunit of BMP-1 1 and another of another member of the BMP / TGF-β superfamily were also contained. g'sir.pIo S expression of BMP-11 In order to produce BMP-11 proteins from bovine, human or other mammals, the coding DNA is transferred into my appropriate expression vector and introduced into mammalian cells or other preferred prokaryotic or eukaryotic hosts by conventional genetic engineering techniques. It is contemplated that the preferred expression system for recombinant and biologically active human BMP-11 are stably transformed mammalian cells. One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1 or SEQ ID NO: 10, or you will hear DNA sequences encoding BMP-11 proteins or other modified sequences and vectors. copcids, such as pCD [Okayama et al., Mol. Cell Biol., 2: 161-170 (1982)], pJL3, pJL4, Oough et al., EIBBO J. 4: 645-653 (1985) and pMT2 CXM. The mammalian expression vector pMT2 CXM is a derivative of p91023 (b) (Wong et al., Science 228: 810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene instead of the resistance gene to ietracycline and in that it also contains an Xhol site for the insertion of cDNA clones. The functional elements of pMT CXM have been described (ICaufman, RJ, 1985, Proc. Nati, Acad. Sci. USA 82: 689- «i, 693) and include the VA adenovirus genes, the SV40 origin of replication including the enhancer 72 bp, the adenovirus major late promoter including a 5 'splice site and the majority of the adenovirus triparhey leader sequence present in late adenovirus mRNAs, a splice acceptor site 3 a DHFR insert, the site of early polyaddition of SV40 (SV40), and sequences of pBR322 required for propagation in E. Coli. Plasmid pMT CXM is obtained by digestion with EcoRI of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATTC), Rockville, ME (USA) under accession number ATTC 67122. Digestion with EcoRI starts at cDNA insert present in pMT2-VWF, producing pMT2 in a linear form that can be light and used to transform E. coli HB 101 or DH-5 for resistance to ampicillin. Plasmid DNA? MT2 can be prepared by conventional methods. PMT2 CXM is then constructed using off / inside circuit mutagenesis (loopoui / in) [Morinaga, et al., Biotechnology 84: 636 (1984)]. This removes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and improved sequences of pMT2. In addition, insert the following sequence: 5 'PO-CATGGGCAGCTCGAG-3' in nucleotide 1145. This sequence contains the recognition site for the Xhol restriction endonuclease. A derivative of pMT2CXM, designated pMT23, contains recognition sites for the restriction endonucleases Psil, EcoRI, SalI and Xhol. Plasmid DNA pMT2 CXM and pMT23 can be prepared by conventional methods. The? EMC2bl derived from pMT21 may also be appropriate in the practice of the invention. PMT21 is derived from pMT2, which is derived from pMT2-VWF. As described above, digestion with EcoRI paite the cDNA insert present in pMT-VWF, producing pMT2 in linear form, which can be ligated and used to transform E. coli HB 101 or DH-5 for resistance to ampicillin. Plasmid DNA pMT2 can be prepared by conventional methods. PMT21 is derived from pMT2 through the following two modifications. First, 76 bp of the 5 'region without translation of the DHFR cDNA including an extension of 19 G residues from the G / C tail for cloning of cDNA is removed. In this process, an Xhol site is inserted to obtain the following sequence immediately upstream of DFIFR: 5 '_ r • go-to JkC' AGGCGAGCCTGAATTCCTCGAGCCATCATG-3 'Psi EcoRI Xhol Second, a single Clal site is introduced by digestion with EcoRV and Xbaí, tretamienío with Klenow fragment of DNA polymerase I, and ligated to a Cla? Linker (CATCGATG) .This eliminates a 250 bp segment of the RNA region (VAI) associated with aaenovirus, but does not interfere with the expression or VAL RNA Gene Function pMT21 is digested with EcoRI and Xhol and used to derive vector pEMC2Bl A portion of the EMCV leader is obtained from pMT2-ECATl [SK Jung et al., J Virol 63: 1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a fragment 2752 bp.This fragment is digested with Taql producing a? CoPJ-Taql fragment of 508 bp which is purified by electrophoresis on low melting point agarose gel. A 68 b adapter p and its complementary chain are synthesized cor. a 5 'Taql projection end and an Xhol 3' projection end having the following sequence: "-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTT Taql 3AAAAACACGATTGC-3 'Xhol This sequence matches the EMC virus leader sequence from nucleotide 763 to nucleotide 827. It also changes the ATG at position 10 within the virus leader MC and an ATT and is followed by an Xhol site. A three-way linkage of the EcoRI-Xhol fragment of pMT21, the EcoRI-Taql fragment of the EMC virus, and the Taql-Xhol adapter of the 68 bp oligonucleotide adapter resulting in the vector pEMC2β 1. This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the sequence of the tripartite leader of adsnovirus, my small hybrid intervention sequence, a SV40 polyadenylation signal and the adenovirus VAI gene, DHFR and β markers -laciamase and an EMC sequence, in appropriate relationships to direct the expression of all the level of the desired cDNA in mammalian cells. The construction of the vectors may involve the modification of the DNA sequences of BMP-11. For example, the BMP-11 cDNA can be modified by removing the non-coding nucleotides at the 5 'and 3' ends of the coding region. The deleted non-coding nucleoids may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of bmp-1 1 proteins. Additionally, the sequence of SEQ ID NO: 1 or SEQ ID NO: 10 or other sequences encoding BMP-11 proteins could be manipulated to express a Mature BMP-11 protein is removed by removing the propeptide sequences encoding BMP-II and replacing them with sequences encoding the complete propeptides of the BMP proteins, activins, proteins or other members of the TGF-β superfamily. Someone skilled in the art can manipulate the sequences of SEQ ID NO: 1 or SEQ ID NO: 10 by removing or replacing mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (eg, linked to other known or modified linkers by removing non-coding sequence from them or by altering nucleotides found there by other known techniques). The modified BMP-11 coding sequence could then be inserted into a known bacterial vector using methods such as that described in T. Taniguchi et al., Proc. Nati Acad. Sci. USA. 77: 5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a BMP-11 proiein expressed in this manner. For a strategy for the production of extracellular expression of BMP-11 proteins in bacterial cells, see, for example, European patent application EPA 177,343. Similar manipulations can be made for the construction of an insect vector [See, for example, the methods described in European patent application no. 155,476] for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for the intracellular or extracellular expression of the factors of the present invention by yeast cells [See, for example, the methods described in published PCT application WO86 / 00639 and the application European Patent No. 123,289]. A MeOH for the production of high levels of a BMP-11 proiein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous BMP-11 gene. The heterologous gene is linked to an amplifiable marker, for example, the dihydrofolate reductase gene (DHFR) for which cells containing incremental gene copies can be selected for propagation at increasing concentrations of methotrexate (MTX) according to the methods of Kaufman and Sharp, J. Mol. Biol. 159: 601-629 (1982). This approach can be employed with a number of different cell types. For example, a plasmid containing a DNA sequence for a BMP-11 protein of the invention in operative association with other plasmid sequences to be made, possible expression of it and the expression plasmid pAdA26SV (A) 3 of DHFR [Keufman and Sharp, Mol. Cell Biol., 2: 1304 (1982)] can be co-introduced into CIIF-IC cells deficient in DFIFR, DUKX-BII, by various methods including calcium phosphate coprecipiation and transfection, electrophoresis or propoplast fusion. Transformants expressing DHFR are selected to grow in alpha media with dialysate fetal serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (eg, sequential steps in 0.02, 0.2, 1.0 and 5 uM of MTX) as is described in Kaufman et al., Mol Ceil 3i., 5 .: 1750 (1983). The transformants are cloned and the expression of biologically active BMP-11 is monitored by one or more of the assays described in Examples 5 to 8 below. Expression of BMP-11 proiein should increase with increasing levels of MTX resistance. The BMP-11 polypeptides are characterized using standard techniques known in the art, such as pulse labeling with [35S] methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to obtain other related BMP-11 proteins.

EXAMPLE 4 Biological Acivity of Expressed BMP-11 To measure the biological activity of the expressed BMP-11 proteins that were obtained in Example 3 above, proteins are recovered from cell culture and purified by isolating BMP-11 proteins from other proteinaceous materials with those that are co-produced, as well as other coni-Malayan. The purified protein can be tested according to the assays for BMP-11 activity described in Examples 5 to 8.

Example 5 W-20 Bioassays A. Description of W-20 Cells The use of W-20 bone marrow stromal cells as a staging cell line is based on the conversion of these cells to osteoblast cell cells after treatment with a BMP protein [Thies et al., Journal of Bone and Mineral Eesearch, 5: 305 (1990); and Thies et al., Endocrinology, 130: 1318 (1992)], Specifically, W-20 cells are my stromal cell line of clonal bone marrow derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Childreifis Hospital, Boston, MA. The treatment of W-20 cells with certain BMP proteins results in (1) increased alkaline phosphaase production, (2) induction of AMPc stimulated by PTI7, and (3) induction of osteocalcin synthesis by the cells. Although (1) and (2) represent features associated with the osteoblasse phenotype, the ability to synthesize osteocalcin is a phenotypic property only displayed by mature osteoblasts. In addition, to date we have observed conversion of W-20 stromal cells to osteoblast cells only with treatment with BMPs. In this form, the in vitro activities displayed by BMP-treated W-20 cells correlate with the in vivo bone formation activity known for BMPs. Two in vitro assays useful in comparing BMP activities of new osteoinductive molecules are described below. B. W-20 Alkaline Phosphatase Assay Protocol W-20 cells are plated into 96-well tissue culture plates at a density of 10,000 cells per well in 200 μl medium (DME with 10% serum). of inactivated heat reagents with heat, 2 mM of glutamine and 100 Units / ml of penicillin -r 130 μg / ml of streptomycin). The cells were allowed to bind overnight in my incubator with 95% air, 5% C02, at 37 ° C. The 200 μl of medium was reigned from each well with a multichannel pipette and replaced with an equal volume of the test sample delivered in DME with 10% heat inactivated fetal serum, 2 mM glutamine and 1% penicillin. -streptomycin. The test substances are tested in triplicate. The test samples and standards are left for an incubation period of 24 years with the W-20 indicator cells. After 24 hours, the plates are removed from the 37 ° C incubator and the test medium is removed from the cells. The W-20 cell layers are washed three times with 200 μl per well of phosphate regulated with phosphate and free of calcium / magnesium and these washes are discarded. 50 μl of distilled water in glass are added to each well and the test plates are then placed on my dry ice bath for a quick freeze. Once frozen, the test plates are removed from the dry ice / ethanol bath or thawed at 37 ° C. This stage is repeated twice more for a total period of three freeze-thaw procedures. Once finished, the membrane-bound alkaline phospharose is available for measurements. 50 μl of the assay mixture (50 mM glycine, 0.05% Triton X-100, 4 mM MgCL, 5 μM p-nitrophenol phosphate, pH = 10.3) are added to each test well and the test plates are then incubated for 30 minutes at 37 ° C in a shaking water bath at 60 oscillations per minute. At the end of the 30 minute incubation, the reaction is stopped by adding 100 μl of 0.2 N NaOH to each well and placing the test plates on ice. The spectrophotometric absorbance for each well is read at a wavelength of 405 nanometers. These values are then compared with known standards to give an estimate of the alkaline phosphatase activity in each sample. For example, using known amounts of p-nitrophenol phosphate a standard curve of absorbance values was generated.

The absorbance values for known amounts of BMPs are determined and converted to μmol of p-nitrophenol phosphate cut per unit time. These values are then used to compare the activities of known quantities of BMP-11 for BMP-2. C. Osoriacalcin RIA Protocol W-20 cells are plated at 10 cells per well in 24-well multi-well tissue culture dishes in 2 mis of DME containing 10% > of heat inactivated fetal serum, 2 mM glutamine. The cells were allowed to bind overnight in an atmosphere of 95% air and 5% CO at 37 ° C. The next day the medium is changed to DME containing 10% heat-inactivated fetal serum, 2 mM glutamine and the test substance in a total volume of 2 ml. Ceda test substance is administered for wells in triplicate. The test substances are incubated with the W-20 cells for a 96-hour day with replacement at 48 hours by the same test means. At the end of 96 hours, 50 μl of the test medium from each well was harvested and tested for osteocalcin production using my mouse radioimit assay for osteocalcin. The details of the assay are described in the equipment manufactured by Biomedical Technologies, Inc., 378 Page Streeí, Stoughíon, MA 02072. Reagents for the assay were found as product numbers BT-431 (standard for mouse osteocalcin), BT- 432 (goat anti-mouse osteocalcin), BT-431R (iodeda mouse osteocaine), BT-415 (normal goat serum) and BT-414 (goat animal IgG). The RIA for csteocalcin synthesized by W-20 cells in response to treatment with BMP is carried out as described in the protocol provided by the manufacturer. The values obtained for these test samples, for example, BMP-1 1, are compared with values for known standards of mouse osteocalcin and the amount of osocalcin produced by W-20 cells in response to challenge with known amounts of BMP-2. . The values for the synthesis of osteocalcin induced by BMP-2 by W-20 cells are shown in Table I.

Table I Example 6 Sampath-Reddi Test Modified by Rosen A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Nati Acad. Sci., USA. 80: 6591-6595 (1983) is used to evaluate the activity of BMP proteins for the formation of bone and / or cartilage and / or other connective tissue. This modified test is referred to here as the Sampath-Reddi test modified by Rosen. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialysis (if the composition is a solution) or diafiltration (if the composition is a suspension) of the fraction to be tested against water. The solution or suspension is then equilibrated at 0.1% TFA. The resulting solution is added to 20 g of a rat matrix. A sample of simulated ray matrix, not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in # 5 gelatin capsules. The capsules are implanted subcutaneously in the abdominal thoracic area of male Long Evans rats 21-49 days old. The implants are removed after 7-14 days. Half of each implant is used for alkaline phosphatase analysis [see, Reddi et al .. Proc. Nati Acad. Sci., 69: 1601 (1972)].

The hearing of each implant is fixed and processed for histological analysis. 1 μm of giicomeiacrilaio sections are stained with acid fuscin and Von Kossa to record the amount of induced formation of bone and cartilage present in each implant. The terms +1 to +5 represented the area of each histological section of an implant occupied by new cells of bone and / or cartilage and matrix. A record of +5 indicates that more than 50% of the implant is bone and / or new cartilage produced as a direct result of the protein in the implant. A record of +4, +3, +2 and +1 would indicate that more than 40%, 30%, 20% and 10% respectively of the implant contains new cartilage and / or bone. The BMP-11 proteins of this invention can be evaluated for their activity in this assay.

Example 7 Biological Activity of Expressed BMP-11 To measure the biological activity of the expressed BMP-11 proteins that are obtained in Example 3 above, the proteins are recovered from the cell culture and purified by isolating the BMP-11 proteins from other proteinaceous materials with which they are co-produced, as well as from other conaminamines. The purified protein can be tested according to the rat bone formation assay described in Example 6. The purification is carried out using standard techniques known to those skilled in the art. trained in the technique. The analysis of the protein is carried out using standard techniques such as SD3-PAGE acrylamide [Laemmli, Nature 227: 680 (1970)] stained with silver [Oakíey, et al., / Mal. Biochgm 105: 361, (1980)] and by immunoblot [Towbin, et al., Proc. Nati Acad. Sci .. USA 76: 4350 (1979)]. -) i Ejsrnple 8 Tests for. determine activin activity of BMP-11 Purification is carried out using standard techniques known to those skilled in the art. It is contemplated that with other proteins of the TGF-β 30 superfamily that purification may include the use of heparin sepharose (Heparin sepharose).

The analysis of the protein is carried out using standard techniques such as SDS-PAGE acrylamide [Laemmli, Nature 227: 680 (1970)] stained with silver [Oakley, et al. Anal. Biochem 105: 361 (1980)] and by immunoblot [Towbin, et al., Proc. Natl.Acad. Sci., USA 76: 4350 (1979)]. The BMP-11 proteins can further be characterized by their ability to modulate the release of follicle-stimulating hormone (FSF?) In bioassays established in vitro using cells from the rat anterior pituitary as described, for example. Vale et al., Endocrinology, 91: 562-572 (1972); Ling et al., Nature, 321: 779-782 (1986) or Vale ei al., Nature, 321: 776-779 (1986), the descriptions of which are incorporated herein by reference. Alternatively, BMP-11 can be characterized by its ability to stimulate erythropoietin activity in the human cell line K-562 as described by [Lozzio et al., Blood, 45: 321-334 (1975) and the patent of the USA No. 5,071,834, in column 15; the descriptions of which are incorporated herein by reference. Furthermore, BMP-11 can be characterized by its activity in cell survival assays described in Schubert et al., Nature, 344: 868-870 (1990), the disclosure of which is incorporated herein by reference.

Example 9 Use of BMP-11 as a Differential Factor, Growth and Neural Conservation.

BMP-11 can be used to modulate all aspects of the development of neuronal cells, particularly neuronal formation, growth, differentiation and proliferation, and especially neuronal conservation. The survival of primary neurons or neuronal cell lines in culture, such as a PC12 neuronal cell line, is frequently used as an in vitro assay for the identification of neurotropic factors. PC 12 cells are derived from a rat adrenal pheochromocytoma tumor, and are frequently used in culture to model peripheral sympathetic neurons. BMP-11 promotes the survival of PC 12 cells under serum-free conditions. PC 12 cells are plated in sub-confluence in 96-well plates with 10% fetal bovine serum for 24 hours, subsequently changed to serum-free medium with or without 200 ng / ml of BMP-11, and cultured for 3-6 days. Cell survival is estimated by the addition of "Celliier 96 Aqueous One Solution", an MTS base product from Promega Corporation, to the PC 12 cells treated during the last 3 hours on the day of the final treatment. The MTS is reduced to my formazan product colored by NADH and cellular NADPH from living cells. The fornazan product is measured spectrophotometrically by absorbance at 490 nm using my standard microplate reader. As shown in Table II below, BMP-1 1 promulgates cell survival of PC 12.

Table II MTS reduction (Abs, 4w90u). Experiment Days of Treatment Reduction of MTS (Abs49?) Control 200 ng / ml BMP- 1 1 1 3 0.543 ± 0.022 0.828 ± 0.049 2 4 0.143 ± 0.012 0.276 ± 0.021 3 6 0.039 ± 0.006 0.196 ± 0.019 (Values are sample replicates ± S.E.) In addition to being used to characterize neuron conservation / survival factors !, PC 12 cells have also been used to identify neuronal differentiation factors based on morphological changes in the cells. When cultured under serum-free conditions, untreated PC12 cells appear in a spherical form, while nerve growth factor (NGF) treated with FC12 cells show formation of neuronal or neurite processes. Thus, in another assay, C12 cells are treated for 3 days with BMP-11, which results in the formation of neurites, as detected by phase contrast microscopy. BMP-11 therefore induces neuronal differentiation. In addition, when PC 12 cells are co-treated with BMP-11 NGF for 2 days, BMP-11 synergistically increases the formation of neurites induced by NGF.

BMP-11 also stimulates the proliferation of PC12 cells. Under serum-free conditions, PC 12 cells are plated in sub-confluence in 96-well plates with 10% fetal bovine serum for 24 hours, then switched to a serum-free medium containing [3H] Thymidine with or without BMP - 11 for 24 hours. JH] Thymidine incorporated into DNA is separated from [3 H] thymidine which is not incorporated by ethanol precipitation and is quantified by liquid flash count as an indicator of cell proliferation. As shown in Table III below, BMP-11 stimulates the incorporation of [3 H] Thymidine in a form that responds to the dose. 10 Table III Incorporation of r3H] Thymidine (cpm) N = 7, ± S.E. * P < 0.05 To further characterize the neuronal activities of BMP-11, BMP-11 is administered in vivo in animal models of peripheral neuropathy (Eliasson, "Nerve Conduction Changes in Experimental Diabetes," J. Clin. Invest. 43: 2353 -2358 (1954)), CNS neuro-degradation (Mitsumoio and Bradley, "Murine Motor Neuron 0 Disease (the Wobbler Mouse)." Degeneration and Regeneration of the Lower Motor Neuron, "Brain 105: 811-834 (1982) (Steiner et al. al, "Neurotrophic Immunophilin Ligands Stiinulaie Sirucíural and Functional Recovery in Neurodegenerative Animal Models," Proc. Acad. Sci. USA 94: 2019-2024 (1997), peripheral nerve resection (Erikkson et al., • '3DNF and NT -3 Rescue Sensory But Not Motor Neurons Following Axotomy in the 5 Neonate, "Neuroreport 5: 1445-1448 (1994), and Spinal Nerve Resection (Ouclega and Plagg," Nerve Growth Factor Promotes Regeneration of Sensory Axons into Adult Rat Spinai Cordl "Exp. Neurol. 140: 218-229 (1996). The BMP-11 theins of the invention induce the formation of neuronal cells and protect, maintain, cure and repair neuronal tissue in these disorders. The foregoing descriptions detail embodiments of the present invention that are currently preferred. Numerous modifications and variations in the practice that are expected to occur to those skilled in the art when considering these descriptions. Those modifications and variants are believed to be contained by the appended claims to the present.

LIST OF SEQUENCES ) GENERAL INFORMATION: (i) APPLICANT: WOZNEY, John, CELESTIAL, Anthony J. THIES, R. Scott (ii) TITLE OF THE INVENTION: COMPOSITIONS OF BMP-11, iii) NUMBER OF SEQUENCES: 11 (iv) ADDRESS FOR CORRESPONDENCE: (A) SENDER: GENETICS INSTITUTE, INC. (B) STREET: 87 CAMBRIDGEPARK DRIVE (C) CITY: CAMBRIDGE (D) STATE: Massachusetts (E) COUNTRY: USA (F) POSTAL CODE: 02140 (v) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIA: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.25 (vi) DATA FROM THE AC UAL APPLICATION: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) INFORMATION OF THE APPORTER / AGENT: (A) NAME: LAZAR, STEVEN R. (B) ) REGISTRATION NUMBER: 32,618 (C) RETURN NUMBER / FILE: GI5205B-PCT (ix) INFORMATION FOR TELECOMMUNICATIONS: (A) PHONE: (617) 498-8260 (B) TELEFAX: (617) 876-5851 (2) INFORMATION FOR SEQ ID NO. : 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 789 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear '..i) TYPE OF MOLECULE: DNA (genomic) 'v) ORIGINAL SOURCE: (A) ORGANISMS: Bos Taurus (B) CEPA: Bovine Activin WC (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 324..704 (ix) ) FEATURE: (A) NAME / KEY: misc-feature (B) LOCATION: 322..323 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l: AAACTGTATT TTGGGGTGAA GGTGTGAGTT AATAGATTCA CGGGACAACA AAGATGGGCT 60 GTTGTTGAGA CCTTGGGCCA AGGGGCTGAT GAGGGTCAGG TTGCCAAGAG AGAGAGAATT 120 AGGGAAGGTG AGTTTAGGGA GACATGGCTA GCTGGCAAGA AAAGTGGGTA GAAAACAGGG 180 GTTGGGGAGG GGAGCACTGG AGAAGCTCAG AAATCACTTG GTCTCTGTTC TCCTGCCCCT 240 ACTGAGGGGC AGGTGAGAAG AAACAGGGAG TAGGAGCTCC TCGAGGCTCT ATTACATCTC 300 TTTCTCCTCT CCCTCACCCC CAG CAT CCT TTT ATG GAG CTT CGA GTC CTA 350 His Pro Phe Met Glu Leu Arg Val Leu -17 -15 -10 GAG AAC AA AAA CGG TCC CGG AAC CTG GGC CTG GAC TGC GAT GAA 398 Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly Leu Asp Cys Asp Glu -5 1 5 CAT TCA AGT GAG TCC CGC TGT TGC CGC TAC CCC CTC ACT GTG GAC TTT 446 His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe 10 15 20 GAG GCT TTT GGC TGG GAC TGG ATC ATC GCT CCT AAA CGC TAC AAG GCC 494 Gla Wing Phe Gly Trp Asp Trp lie lie Wing Pro Lys Arg Tyr Lys Wing 25 30 35 40 AAC TAC TGC TCC GGC CAG TGC GAG TAC ATG TTT ATG CAA AAG TAT CCG 542 Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe Met Gln Lys Tyr Pro 45 50 55 CAC ACC CAC TTG GTG CAA CAG GCT AAC CCA AGA GGC TCT GCG GGG CCC 590 His Thr His Leu Val Gln Gln Ala Asn Pro Arg Gly Pro Wing Gly Pro 60 65 70 TGC TGC ACA CCC ACC AAG ATG TCC CCA ATC AAC ATG CTC TAC TTC AAT 638 Cys Cys Thr Pro Thr Lys Met Ser Pro lie Asn Met Leu Tyr Phe Asn 75 80 85 GAC AAG CAG CAG ATT ATC TAC GGC AAG ATC CCT GGC ATG GTG GTG GAT 586 Asp Lys Gln Gln lie lie Tyr Gly Lys lie Pro Gly Met Val Val Asp 90 95 100 CGC TGT GGC TGC TCC TAAGGTGGG GGACAGCGGAT GCCTCCCCAA CAGACCCTGC 741 Arg Cys Gly Cys Ser 105 110 CCCTAGACTC CCCCAGCCCT GACCCCCTGC TCCCCGGCCC TAGAGCTC 789 (2) INFORMATION FOR SEO ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 126 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION FROM THE SEQUENCE: SEQ ID NO: 2: His Pro Phe Met Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg -17 -15 -10 -5 Arg Asn Leu Gly Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys 1 5 10 15 Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Wing Phe Gly Trp Asp Trp 20 25 30 lie lie Wing Pro Lys Arg Tyr Lys Wing Asn Tyr Cys Ser Gly Gln Cys 35 40 45 Glu Tyr Met Phe Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln 50 55 60 Wing Asn Pro Arg Gly Be Wing Gly Pro Cys Cys Thr Pro Thr Lys Met 65 70 75 Pro Pro lie Asn Met Leu Tyr Phe Asn Asp Lys Gln Gln He He Tyr 80 85 90 95 Gly Lys He Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser 100 105 .2; INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 213 base pairs (B) TYPE: nucleic acid (C) CHAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) CEPA: Human WC Activin (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 28.183 ( ix) CHARACTERISTICS: (A) NAME / KEY: misc-feature (B) LOCATION: 184..185 (D) OTHER INFORMATION: / note = "two thirds of codon at the end of the partial clone" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: TCTAGATGCT CCGGCCAGTG CGAGTAC ATG TTC ATG CAA AAA TAT CCG CAT 51 Met Phe Met Gln Lys Tyr Pro His 1 5 ACC CAT TTG GTG CAG CAG GCC AAT CCA AGA GGC TCT GCT GGG CCC TGT 99 Thr His Leu Val Gln Gln Wing Asn Pro Arg Gly Wing Wing Gly Pro Cys 10 15 20 TGT ACC CCC ACC AAG ATG TCC CCA ATC AAC ATG CTC TAC TTC AAT GAC 147 Cys Thr Pro Thr Lys Met Pro Pro He Asn Met Leu Tyr Phe Asn Asp 25 30 35 40 AAG CAG CAG ATT ATC TAC GGC AAG ATC CCT GGC ATG GTG GTGGATC 193 Lys Gln Gln He He Tyr Gly Lys He Pro Gly Met 45 50 GCTGTGGCTG CTCCGGATCC! 13 [2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 52 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear iii. TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 4: Met Phe Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Wing Asn 1 5 10 15 Pro Arg Gly Ser Wing Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro 20 25 30 He Asn Met Leu Tyr Phe Asn Asp Lys Gln Gln He He Tyr Gly Lys 35 40 45 He Pro Gly Met 5.0 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 30 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Primary C for Bovine Activin WC (ix) FEATURE: (A) NAME / KEY: misc-feature (B) LOCATION: 1..9 (D) OTHER INFORMATION: / note = "Restriction site for Xbaí" (xi) DESCRIPTION OF THE SEQUENCE: SEO ID NO: 5: TAGTCTAGAT GCTCCGGCCA GTGCGAGTAC 30 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 30 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Primary D for Bovine Activin WC;? X) CHARACTERISTICS: (A) NAME / KEY: misc-feature (B) LOCATION: 1. .9 (D) OTHER INFORMATION: / note = "BamHI restriction site" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 6: TGCGGATCCG GAGCAGCCAC AGCGATCCAC 30 (2) INFORMATION FOR SEO ID NO: 7: CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 15 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA inserted into pMT2 CXM (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 7: CATGGGCAGC TCGAG 15 ; 2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 34 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA inserted in pMT21 (ix) CHARACTERISTICS: (A) NAME / KEY: misc-feature (B) LOCATION: 1..6 (D) ) OTHER INFORMATION: / note = "Pst restriction site"; ix) FEATURE: (A) NAME / KEY: mise- feature (B) LOCATION: 15..26 (D) OTHER INFORMATION: / note = "Sites of Eco Rl and Xhol restriction "(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: CTGCAGGCGA GCCTGAATTC CTCGAGCCAT CATG 34 (2) INFORMATION FOR SEQ ID NO: 9: CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 68 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear 11, TYPE OF MOLECULE : DNA (genomic) (i) ORIGINAL SOURCE: (A) ORGANISM: Portion of the leader sequence of the EMC virus (x) PUBLICATION INFORMATION: (A) AUTHORS Jung, SK (C) REVISTA J. Virol. (D) VOLUME 63 (F) PAGES 1651-1660 (G) DATE: 1989; u DESCRIPTION OF SEQUENCE: SEQ ID NO: 9: CGAGGTTAAA AAACGTCTAG GCCCCCCGAA CCACGGGGAC GTGGTTTTCC TTTGAAAAAC 60 ACGATTGC 68 (2) INFORMATION FOR SEQ ID NO: 10:; D CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 1270 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear 11 TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Human BMP-11 VI IMMEDIATE SOURCE: (B) CLONA: FB30. 5. '? X) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1..1086 (ix) FEATURE: (A) NAME / KEY: mat_peptide (B) LOCATION: 760..1086 [xi] DESCRIPTION OF SEQUENCE: SEQ ID NO: 10: GAG CGC TCC AGC CGG CCA GCC CCG TCC GTG GCG CCC GAG CCG GAC GGC 48 Glu Arg Ser Ser Arg Pro Pro Wing Pro Val Wing Pro Glu Pro Asp Gly -253 -250 -245 -240 TGC CCC GTG TGC GTT TGG CGG CAG CAC AGC CGC GAG CTG CGC CTA GAG 96 Cys Pro Val Cys Val Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu -235 -230-225 AGC ATC AAG TCG CAG ATC TTG AGC AAA CTG CGG CTC AAG GAG GCG CCC 144 Ser lie Lys Ser Gln He Leu Ser Lys Leu Arg Leu Lys Glu Wing Pro -220 -215 -210 AAC ATC AGC CGC GAG GTG AAG CAG CTG CTG CCC AAG GCG CCG CCG 192 Asn He Ser Arg Glu Val Val Lys Gln Leu Leu Pro Lys Pro Pro Wing -205 -200 -195 -190 CTG CAG CAG ATC CTG GAC CTA CAC GAC TTC CAG GGC GAC GCG CTG CAG 240 Leu Gln Gln He Leu Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln -185 -180 -175 CCC GAG GAC TTC CTG GAG GAG GAC GAC TAC CAC GCC ACC ACC GAG ACC 288 Ero Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Wing Thr Thr Glu Thr -170 -165 -160 GTC ATT AGC ATG GCC CAG GAG ACG GAC CCA GCA GTA CAG ACA GAT GGC 336 Val He Ser Met Ala Gln Glu Thr Asp Pro Ala Val Gln Thr Asp Gly -155 -150 -145 AGC CCT CTC TGC TGC CAT TTT CAC TTC AGC CCC AAG GTG ATG TTC ACA 384 Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr -140 -135 -130 AAG GTA CTG AAG GCC CAG CTG TGG GTG TAC CTA CGG CCT GTA CCC CGC 432 Lys Val Leu Lys Wing Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg -125 -120 -115 -110 CCA GCC AC GTC TAC CTG CAG ATC TTG CGA CTA AAA CCC CTA ACT GGG 480 Pro Wing Thr Val Tyr Leu Gln He Leu Arg Leu Lys Pro Leu Thr Gly -105 -100 -95 GAA GGG ACC GCA GGG GGG GGG GGC GGA GGC CGG CGT CAC ATC CGT ATC 528 Giu Gly Thr Wing "Gly Gly Gly Gly Gly Gly Arg Arg His He Arg He -90 -85 -80 TCA CTG AAG ATT GAG CTG CAC TCA CGC TCA GGC CAT TGG CAG AGC 575 Arg Ser Leu Lys He Glu Leu His Ser Arg Ser Gly His Trp Gln Ser -75 -70 -65 ATC GAC TTC AAG CAA GTG CTA CAC AGC TGG TTC CGC CAG CCA CAG AGC 624 He Asp Phe Lys Gln Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser -60 -55 -50 AAC TGG GGC ATC GAG ATC AAC GCC TTT GAT CCC AGT GGC AC GAC CTG 672 Asn Trp Gly He Glu He Asn Wing Phe Asp Pro Ser Gly Thr Asp Leu -45 -40 -35 -30 GCT GTC ACC TCC CTG GGG CCG GGA GCC GAG GGG CTG CAT CCA TTC ATG 720 Wing Val Thr Ser Leu Gly Pro Gly Wing Glu Gly Leu His Pro Phe Met -25 -20 -15 GAG CTT CGA GTC CTA GAG AAC AA AAA CGT TCC CGG CGG AAC CTG GGT 768 Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly -10 -5 1 CTG GAC TGC GAC GAC CAC TCA AGC GAG TCC CGC TGC TGC CGA TAT CCC 816 Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro 5 10 15 CTC ACÁ GTG GAC TTT GAG GCT TTC GGC TGG GAC TGG 'ATC ATC GCA CCT 864 Leu Thr Val Asp Phe Glu Wing Phe Gly Trp Asp Trp He He Ala Pro 20 25 30 35 AAG CGC TAC AAG GCC AAC TAC TGC TCC GGC CAG TGC GAG TAC ATG TTC 912 Lys Arg Tyr Lys Wing Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe 40 45 50 ATG CAA AAA TAT CCG CAT ACC CAT TTG GTG CAG CAG GCC AAT CCA AGA 960 Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Wing Asn Pro Arg 55 60 65 GGC TCT GCT GGG CCC TGT TGT ACC CCC ACC AAG ATG TCC CCA ATC AAC 1008 Gly Be Wing Gly Pro Cys Cys Thr Pro Thr Lys Met Pro Ser He Asn 70 75 80 ATG CTC TAC TC AAT GAC AAG CAG CAG ATT ATC TAC GGC AAG ATC CCT 1056 Met Leu Tyr Phe Asn Asp Lys Gln Gln He He Tyr Gly Lys He Pro 85 90 95 GGC ATG GTG GTG GAT CGC TGT GGC TGC TCT TAAGGTGGGG GATAGAGGAT11 Gly Met Val Val Asp Arg Cys Gly Cys Ser 100 105 GCCTCCCCCA CAGACCCTAC CCCAAGACCCCTAGCCCTGC CCCCATCCCC CCAAGCCCTA 1166 GAGCTCCCTC CACTCTTCCC GCGAACATCACACCGTTCCC CGACCAAGCC GTGTGCAATA 1226 CAACAGAGGG AGGCAGGTGG GAATTGAGGGTGAGGGGTTT GGGG 1270 • 2) INFORMATION FOR SEQ ID NO: ll:;?) CHARACTERISTICS OF THE SEQUENCE: (A) LOMGITUDE: 362 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION FROM THE SEQUENCE: SEQ ID NO: 11: Glu Arg Ser Ser Arg Pro Ala Pro Ser Val Ala Pro Pro Glu Asp Gly -253 -250 -245 -240 Cys Pro Val Cys Val Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu -235 -230 -225 Ser He Lys Ser Gln He Leu Ser Lys Leu Arg Leu Lys Glu Pro Wing -220 -215 -210 Asn He Ser Arg Glu Val Val Lys Gln Leu Leu Pro Lys Ala Pro Pro -205 -200 -195 -190 Leu Gln Gln He Leu Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln -185 -180 -175 Pro Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Wing Thr Thr Glu Thr -170 -165 -160 Val He Ser Met Wing Gln Glu Thx Asp Pro Wing Val Gln Thr Asp Gly -155 -150 -145 Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr -140 -135 -130 Lys Val Leu Lys Wing Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg -125 -120 -115 -110 Pro Ala Thr Val Tyr Leu Gln He Leu Arg Leu Lys Pro Leu Thr Gly -105 -100 -95 Glu Gly Thr Wing Gly Gly Gly Gly Gly Arg Arg His He Arg He -90 -85 -80 Arg Ser Leu Lys He Glu Leu His Ser Arg Ser Gly His Trp Gln Ser -75 -70 -65 He Asp Phe Lys Gln Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser -60 -55 -50 Asn Trp Gly He Glu He Asn Wing Phe Asp Pro Ser Gly Thr Asp Leu -45 -40 -35 -30 Wing Val Thr Ser Leu Gly Pro Gly Wing Glu Gly Leu His Pro Phe Met -25 -20 -15 Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly -10 -5 1 Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro 5 10 15 Leu Thr Val Asp Phe Glu Wing Phe Gly Trp Asp Trp He He Ala Pro 20 - 25 30 35 Lys Arg Tyr Lys Wing Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe 40 45 50 Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Wing Asn Pro Arg 55 60 65 Gly Be Wing Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro He Asn 70 75 80 Met Leu Tyr Phe Asn Asp Lys Gln Gln He He Tyr Gly Lys He Pro 85 90 95 Gly Met Val Val Asp Arg Cys Gly Cys Ser 130 105

Claims (5)

1. Novelty of the Invention 1. A method for the modulation of cell neuron development, which comprises the step of administering purified BMP-11 polypeptide comprising an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 11
2. 2. A method for inducing the formation, growth, differentiation, proliferation and conservation of neuronal cells, which comprises the step of administering a polypeptide of claim 1.
3. 3. A method for inducing neural cell formation, which comprises the step of administering a composition comprising a polypeptide of claim 1.
4. 4. The method of claim 3, wherein said method comprises the steps of administering my composition comprising a polypeptide of claim 1 to in vitro p in vitro cells. and recovering said tissue.
5. 5. A method for preserving neural tissue, which comprises the step of administering my composition comprising BMP-11.