MXPA00000820A - Wa545 compositions - Google Patents

Abstract

Purified WA545 proteins and processes for producing them are disclosed. DNA molecules encoding the WA545 proteins are also disclosed. The proteins, members of the TGF-&bgr;superfamily of growth factors, may be used to induce, enhance and/or inhibit the information, growth, proliferation, differentiation, maintenance of mesodermal tissue, including neural and muscle tissue. The proteins may also be useful for treatment of bone and cartilage and/or other connective tissue defects and in wound healing and related tissue repair.

Description

COMPOSITIONS OF WA545 Field of the invention The present invention relates to a novel family of purified proteins designated WA545 and proteins related to WA545, to the DNA that encodes them and to processes for their preparation. These proteins can be used to induce the formation of bone and / or cartilage or other connective tissue, and in the healing of wounds and in the repair of tissues. These proteins can also be used to increase the activity of bone morphogenetic proteins.

Ademées de lai Imveecióe Research on the molecule or molecules responsible for inducing activity of bone, cartilage and other connective tissue that is present in bone tissue and other tissue extracts has led to the discovery of a novel group of molecules called Bone Morphogenetic Proteins (BMPs). Previously, the structures of various proteins, designated BMP-1 to BMP-16, have been revealed. The only inductive activities of these proteins, together with their presence in the bone, suggest that these proteins are important regulators of bone repair processes, and may be involved in the normal maintenance of bone tissue. There is a need to identify if there are additional proteins that play a role in these processes. The present invention relates to the identification of such a protein, which the inventors have designated as A545.

Objectives of 1; As used herein, the term "WA545-related protein" refers to the prolein WA545 Xenopus, which has the amino acid sequence specified in SEQ ID MO: 2. as well as homologs of this protein found in mammals and other species; and to other proteins that are closely related structurally and / or functionally to WA545. Examples of "WA545-related proteins" include murine, bovine and human WA545 protein, as well as homologs in other species, particularly human. As used herein, the term "WA545 activity" refers to one or more of the activities that are exhibited by the WA545 proteins of the present invention. In particular, the "WA545 activity" includes the ability to induce, enhance and / or inhibit the formation, growth, proliferation, differentiation, maintenance of mesoderm tissue, including, but not limited to, neurons and / or neuronal tissues and cells. related, such as brain cells, Schwann cells, glial cells and astrocytes, as well as cells and tissue of muscle. The "activity of WA545" also includes the ability to induce molecular markers of mesoderm tissue, such as Xbra, gsc, brachyury, Pintallavis, Xnot and Muscle cradle, as well as the ability to induce the formation of neurons and / or related neuronal cells and tissues such as brain cells, Schwann cells, glial cells and astrocytes.The "activity of WA545" also includes the ability to regular the interaction ligands and their protein receptors. The "activity of WA545" may further include the ability to regulate the formation, differentiation, proliferation and / or maintenance of other cells and / or tissues, e.g., connective tissue, organs and wound healing. In particular, the "activity of WA545" may include the ability to improve and / or inhibit angiogenesis, and the formation and growth of capillaries, arteries and other vessels blood, as well as the formation, growth, proliferation, differentiation and / or ^^ maintenance of cells and cardiac tissue, of the spleen, liver, pancreas, stomach, kidney, lung and brain, osteoblasts and bones, chondrocytes and cartilage, tendon and epidermis. The "WA545 activity" also includes the activities of the WA545 protein in the described examples and in the present description. 25 \ W A545 Xenopas The DNA sequence of WA545 Xenopus (SEQ ID NO: 1) and the amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listing. WA545 proteins are capable of inducing cartilage formation, muscle, nerve, epidermis or other connective tissue, or combinations of them. The WA545 proteins can also be characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and / or other connective tissue formation activity in the assays described below. The WA545 Xenopus protein can be produced by culturing a transformed cell with a DNA sequence comprising a DNA sequence encoding the mature WA545 polypeptide, comprising nucleotide # 55, # 775 or # 81 1 to nucleotide # 1 1 13 or # 1 116 as shown in SEQ ID NO: 1, and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acids # -240, # 1 or # 13 to # 113 or # 114 as shown in SEQ ID NO: 2, substantially free of other proteinaceous materials with which it is co-produced. For or production in mammalian cells, the DNA sequence further comprises a DNA sequence encoding a 5 'propeptide suitable for and bound in frame to the nucleotide sequence encoding the mature WA545 polypeptide. The propeptide can be the mature WA545 polypeptide, or it can be a propeptide from another protein of the TGF-β superfamily. 5 A545 Human It is expected that other species, particularly humans, have DNA sequences homologous to the WA545 Xenopus protein. The invention, therefore, includes methods for obtaining the DNA sequences encoding the human WA545, the DNA sequences obtained by those methods, and the human protein encoded by those DNA sequences. This method involves the use of the nucleotide sequence of the WA545 Xenopus or portions thereof to design probes for screening libraries from the human gene or coding sequences or functional fragments thereof using standard techniques. In this way, the present invention includes DNA sequences from other species, particularly human, that are homologous to the WA545 Xenopus and that can be obtained using the sequence of the WA545 Xenopus. A DNA sequence encoding the mature and complete human WA545 protein, and the corresponding amino acid sequence can be obtained using the procedures set forth herein. As described herein, these sequences are isolated using a part of the sequence of the WA545 Xenopus as a probe. The sequence of the human WA545 can also be used in order to design probes to obtain the complete human WA545 gene or coding sequences through standard techniques. The WA545 Xenopus and the human WA545 sequences, or portions thereof, can also be used as probes, or to design probes, for the purpose of obtaining other related DNA sequences, such as homologs from other species. The WA545 proteins of the present invention, such as human WA545, can be produced by culturing a transformed cell with the correlation DNA sequence, such as the WA545 DNA sequence, and recovering and purifying the protein from the culture medium. . The expressed and purified protein is substantially free of other proteinaceous materials with which it is co-produced, as well as other contaminants. It is contemplated that the recovered purified protein present cartilage, bone, muscle, nerve, epidermis and / or other connective tissue formation activity. The proteins of the present invention can also be characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and / or other connective tissue formation activity in the assays described below. Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a WA545 protein, such as WA545 Xenopus or human protein, in a pharmaceutically effective carrier or vehicle. These compositions of the invention can be used in bone formation, cartilage, muscle, nerve, epidermis and / or other connective tissue, including tendon, ligament and meniscus, as well as combinations of the above, for example, regeneration of the tendon-to-bone attachment apparatus. The compositions of the present invention, such as a human WA545 composition, can also be used to heal wounds and repair tissue. The compositions of the invention may further include at least one other therapeutically useful agent such as BMP proteins, ie, BMP-1, BMP-2, BMP-3, BMP-4. BMP-5, BMP-6 and BMP-7, described by examples in US Patents. Nos. 5,108,922; 5,013,649; 5.1 16.738; 5,106,748; 5,187,076 and 5,141,905; BMP-8 described in PCT publication WO91 / 18098; and BMP-9, described in PCT Publication WO93 / 00432, BMP-10, described in PCT application W094 / 26893; BMP-1 1, described in PCT application W094 / 26892, or BMP-12 or BMP-13, described in PCT application WO95 / 16035, or BMP-15 described in PCT application WO96 / 36710 or BMP-16, described in the co-pending patent application serial number 08 / 715,202, filed on September 18, 1996.

Other compositions that may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFs], including those described in PCT applications W094 / 15965; W94 / 15949; WO95 / 01801; WO95 / 01802; W094 / 21681; W094 / 15966 and others. The BIP, which is described in WO94 / 01557, may also be useful in the present invention; and MP52, which is described in PCT application WO93 / 16099. The descriptions of all the above applications are incorporated herein by reference for the present description. The compositions of the invention may comprise, in addition to a WA545 protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF-). a and TGF-ß), wnt proteins, hedgehog proteins such as sonic, hedgehog, and desert hedgehog, activins, inlins, and insulin-like growth factor (IGF). The compositions may also include an appropriate matrix, for example, to support the composition and provide a surface for bone growth. cartilage, muscle, nerve, epidermis and / or other connective tissue. The matrix can provide a slow release of the osteoinductive protein and / or the appropriate environment for its presentation. The compositions of WA545 can be used in methods for the treatment of a number of defects in bone tissue, cartilage, muscle, nerve, epidermis and / or other connective tissue, as well as periodental disease and the healing of various types of tissues. and wounds. The tissue and wounds that can be treated include the epidermis, nerve, including the spinal cord, muscle, including cardiac, striated or soft muscle, and other tissues and wounds, and other organs such as liver, pancreas, spleen, brain, lung, cardiac and kidney tissue. These methods, in accordance with the present invention, involve administration to a patient requiring such bone tissue, cartilage formation. muscle, nerve, epidermis and / or other connective tissue, wound healing or tissue repair. an effective amount of a WA545 protein. The WA545 compositions can also be used to treat or prevent conditions such as osteoarthritis, osteoporosis and other abnormalities of the bone, cartilage muscle, nerve, epidermis or other connective tissue. organs such as liver, pancreas, spleen, lung, cardiac tissue, kidney and other tissues.

These methods may also involve the administration of a protein of the invention in conjunction with at least one other BMP protein as described above. In addition, these methods may also include the administration of a WA545 protein with other growth factors, including EGF, FGF, TGF-, TGF-β, wnt, hedgehog, activin, inhibin and IGF. Yet a further aspect of the present invention consists of DNA sequences that code for the expression of a WA545 protein. Such sequences include nucleotide sequences in a 5 'to 3' direction illustrated in SEQ ID NO: 1, as well as DNA sequences which, due to the degeneracy of the genetic code, are identical to the DNA sequence SEQ ID NO. : 1, and coding for the protein of SEQ ID NO: 2. DNA sequences that hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 and that encode a DNA sequence are also included in the present invention. proiein that has the ability to induce the formation of cartilage, bone, muscle, nerve, epidermis and / or other connective tissue, or other organs such as liver, pancreas, brain, spleen, lung, heart and kidney tissue. Preferred DNA sequences include those that hybridize under stringent conditions [see, T. Maniatis et al. Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389]. It is generally preferred that such DNA sequences encode a polypeptide that is at least about 80% homologous, and more particularly preferably at least about 90% homologous, to the amino acid sequence of the human WA545 shown in SEQ ID NO: 2. Finally, allelic variations and other variations of the SEQ ID sequences are also included in the invention. NO: 1, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has WA545 activity. The present invention also includes functional fragments of the DNA sequence of A545 shown in SEQ ID NO: 1, which code for a polypeptide that maintains the activity of the WA545 protein. The determination of whether a particular variant or a fragment of a WA545 protein of the present invention will maintain WA545 activity is routinely performed using the assays described in the examples and the present disclosure.

The DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding WA545 in a given cell population. DNA sequences may also be useful for the preparation of vectors for gene therapy applications as described below. A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence for it. These vectors can be used in a new process for the production of a WA545 protein of the invention, in which a cell line transformed with a DNA sequence encoding a WA545 protein in operative association with an expression control sequence for it , it is cultivated in a suitable culture medium and a WA545 protein is recovered and purified from there. This process can employ a number of known cells, both prokaryotic and eukaryotic, and host cells for the expression of the polypeptide. Vectors can be used in gene therapy applications. In such cases, the vectors can be transfected into the cells of an ex vivo patient, and the cells can be reintroduced into a patient. Alternatively, the vectors can be reintroduced into a patient in vivo through target transfection. Yet an aspect of the invention consists of WA545 proteins or polypeptides. Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2, variants of the amino acid sequence of SEQ ID NO: 2. including allelic variants that occur naturally, and other variants in the that the protein retains the ability to induce the formation of cartilage, bone, muscle, nerve, epidermis and / or other connective tissue, or organs such as liver, pancreas, brain, spleen, lung, heart and kidney tissue, characteristics of the WA545. Preferred polypeptides include a polypeptide that is at least about 80% homologous and, more preferably, at least about 90% homologous, to the amino acid sequence of mature VVA545 Xenopus shown in SEQ ID NO: 2. Finally, they are also included in the present invention allelic and other variations of the sequences of SEQ ID NO: 2, whether such amino acid changes are induced by mutagenesis, chemical alteration or by alteration of the DNA sequence used to produce the polypeptide, wherein the The peptide sequence will still have WA545 activity. The present invention also includes functional fragments of the amino acid sequence of WA545 shown in SEQ ID NO: 2, which maintains the activity of the WA545 protein. The purified proteins of the present invention can be used to generate antibodies, either monoclonal or polyclonal, for WA545 proteins and / or other proteins related to WA545m using methods that are known in the art of antibody production. In this way, the present invention also includes antibodies to human WA545 proteins and / or other WA545 proteins. The antibodies can be useful for the purification of WA545 and / or other WA545 proteins, or to inhibit or prevent the effects of WA55 proteins. WA545 protein and related proteins can be useful for identifying and isolating a receptor protein that binds to WA545, and to induce the growth and / or differentiation of embryonic cells and / or progenitor cells. Thus, the present invention also includes WA545 receptors, methods for the identification of receptors, and methods for the treatment of cell populations, such as populations of embryonic cells or progenitor cells, for improving or enriching growth and / or digestion of the cells. The populations of treated cells can be used for implantation and for gene therapy applications.

Description of Deposits A clone encoding the full-length WA545 Xenopus protein was deposited with the American Type Culture Collection (ATCC) 12301 Parkiawn Drive, Rockville, MD 20852, on May 9, 1997, and was granted the ATCC designation. 98428. This deposit fully meets the requirements of the Budapest Treaty.

Description of Sequences SEQ ID NO: 1 is a nucleotide sequence that encodes the complete mature WA545 Xenopus polypeptide. SEQ ID NO: 2 is the amino acid sequence containing the mature WA545 Xenopus polypeptide.

SEQ ID NO: 3 is an oligonucleotide probe for the signal sequence of WA545 Xenopus. SEQ ID NO: 4 is an oligonucleotide probe for the signal sequence of WA545 Xenopus. SEQ ID NO: 5 is a consensus amino acid sequence derived from a highly conserved region of BMP / TGF-β / Vg-1 proteins. SEQ ID NO: 6 is an oligonucleotide designed on the basis of the previously identified consensus amino acid sequence of SEQ ID NO: 5. SEQ ID NO: 7 is a consensus amino acid sequence derived from a highly conserved region of BMP / TGF-β / Vg-1 proteins. SEQ ID NO: 8 is an oligonucleotide designed on the basis of the previously identified consensus amino acid sequence of SEQ ID NO: 7. SEQ ID NO: 9 is an oligonucleotide probe for the mature peptide sequence of WA545 Xenopus . SEQ ID NO: 10 is an oligonucleotide probe for the mature peptide sequence of WA545 Xenopus.

Brief Description of the Drawings Figure 1 is the expression pattern of the WA545. The WA545 is expressed in the marginal zone (mesoderm) and plant cells, and later it becomes restricted later. Complete in situ hybridization of Xenopus embryos with an RNA probe labeled with digoxigenin for WA545, showing localization of WA545 RNA. Views from the plant pole or from the posterior (the plant pole eventually becomes posterior), (a) WA545 is first expressed during division, by medium to late blastula (stage 9). (b) expression is increased by early gastrula (stage 10+) in the entire marginal zone (mesoderm) as well as in plant cells, (c, d) This high-level expression is maintained during gastrulation. (e) The level of expression begins to decline during the final stages of gastrulation. By this stage, expression is still present in lateral and ventral tissue but is excluded from the more dorsal region that will form the notocordium. (f) By the early ncurula, the expression has declined and is still limited to a region precisely close to the closure of the blastopore. Figure 2 illustrates WA545 which is expressed during gastrulation. Time of WA545 RNA expression, using a PCR-based reverse transcriptase assay (RT-PCR). The RNA was isolated from the indicated steps and processed by RT-PCR. PCR reactions were carried out at 21 cycles for all samples using specific primers for WA545 or ornithine decarboxylase (ODC), which was used as a load control. The expression of WA545 could be detected in stage 9 (blastula) and remained at a high level until stage 13 (early neurula). Stage 8, semi-blastula; stage 10.25, early gastrula; stage 1 1.5, semi-gastrula; stage 19, terminal bud; stage 35, maturation. Reactions for three samples, unfertilized eggs, stage 8 and stage 9 were also made at 30 cycles to detect small amounts of RNA. No signal could be detected in both the sample of the eggs and in the sample of stage 8 even after 30 cycles. This indicates that the WA545 does not have a maternal transcript and is not expressed until after the semi-blastula transition. (stage 8.5). Figure 3 shows that the WA545 induces a posterior secondary axis when it is expressed incorrectly in the ventral side of embryos. The embryos were injected into a ventral blastomere in the marginal zone in the ele 4-cell stage with 50 or 100 pg of RNA transcribed in vitro from WA545, or with globin RNA as control. 80 pg of lacZ RNA were included as a lineage tracer to determine where WA545 RNA was located. The embryos were incubated until maturation (stage 35) before fixation and staining with X-gal. The heads of the arrows point to a secondary axis that is induced on the injected side, as indicated by the blue dyeing of the embryos. A secondary head was never observed. This indicates that the WA545 is able to induce posterior regions, but not previous ones. The secondary axis contains both mesoderm and neural tissue. Figure 4 illustrates that WA545 causes microcephaly when expressed incorrectly on the embryonic dorsal side.

Embryos were injected into a dorsal blastomere in the marginal zone at the 4-cell stage with 100 pg of WA545 or globin RNA together with 80 pg of lacZ RNA as a lineage tracer. The embryos were incubated until the terminal bud stage (step 22) before fixation and stained with X-gal. The heads of the arrows indicate the primordium of the chin (cement gland), an extreme anterior structure. The "control" panel shows embryo injected with globin RNA. The "WA545" panel shows embryos injected with WA545 RNA. In embryos injected with WA545, the anterior structures are suppressed, as indicated by the smaller dimensions of the cement glands. In the final stages no eyes or prosencephalon were present. This indicates that the WA545 can convert anterior tissue to more posterior tissue. Figure 5 illustrates that WA545 induces markers of the posterior mesoderm in an animal helmet test. The WA545 induces posterior mesoderm. The expression of genes from the anterior and neural mesoderm is not activated by this gene. Embryos were injected into a blastomere in the animal pole in the 2-cell stage with 400 pg of globin RNA or WA545. Animal cases were isolated as indicated and cultured until fraternal embryos reached stage 14 (neural) or 19 (terminal bud) when several marker genes are maximally expressed. Total RNA was prepared from helmets injected with globin, helmets injected with WA545 and total embryos. RT-PCR was used to test the expression of 0 marker genes. Paths 1, 2 and 3 are samples harvested in the samples of stage 14. Xhni is a marker of general mesoderm, gsc is a marker of anterior mesoderm, Pinlallavis and Xnoí are markers of later mesoderm. All the genes were induced; however, the induction of gsc was very weak, indicating that the posterior mesoderm is predominantly induced (compare lanes 1 and 2). Xvenl-1 and odc are 5-load controls. Lanes 4, 5 and 6 are samples harvested in stage 19. Muscle-specific actin is a marker of lateral mesoderm and was strongly induced. HoxB9, a marker of the posterior mesoderm was also induced. Krox20, a neuronal marker whose expression is in the metencephalon and N-CAM, a general neural marker, was not induced. Figure 6 illustrates that WA545 induces muscle in animal helmets.

At the histological level, muscle formation can be observed after the ectopic expression of WA545. Embryos were injected into a blastomere at the animal pole in the 2-cell stage with 400 pg of globin RNA or WA545. The animal helmets were isolated as indicated and cultured until fraternal embryos reached the stage of maturation (stage 35) and analyzed histologically, (a) helmets injected with globin are vesicular, observing only epidemial differentiation, (b) Injected cases with WA545 show extensive tissue formation, (c) At higher magnification, helmets injected with WA545 show muscle blocks and possibly blood formation.

Detailed Description of the Invention WA545 The nucleotide sequence of WA545 Xenopus (SEQ ID NO: 1) and the encoded amino acid sequence (SEQ ID NO: 2) are presented in the Sequence Listing. The coding sequence of the mature WA545 Xenopus protein starts at nucleotide # 55 and continues up to nucleotide # 11 16. The purified WA545 Xenopus proteins of the present invention are produced by culturing a host cell transformed with a DNA sequence comprising the sequence of DNA coding of SEQ ID NO: 1. from nucleotide # 55 to # 1116, or from nucleotide # 775 to # 11 16, and recovering and purifying from the culture medium a protein containing the amino acid sequence or substantially a homologous sequence as represented by amino acids # -240 to # 1 14 or # 1 to # 114 of SEQ ID NO: 2. Other species, in particular humans, are expected to possess DNA sequences homologous to WA545 Xenopus. The DNA sequences encoding human WA545 are isolated by various techniques known to those skilled in the art. The invention, therefore, includes methods for obtaining DNA sequences encoding human WA545. The methods use the WA545 Xenopus nucleotide sequences or portions in the design of probes to screen libraries for the human gene or coding sequences or fragments thereof using standard techniques. Regions containing amino acid sequences that are highly conserved within the WA545 family of proteins are identified, and consensus amino acid sequences from these highly conserved regions are constructed based on the similarity of the corresponding regions of individual WA545 proteins. Primers of oligonucleotides designed on the basis of the amino acid sequence of such conserved sequences allow specific amplification of the human WA545 coding sequences. Two such consensus amino acid sequences are presented in the Sequence Listing. Once a recombinant bacteriophage containing DNA encoding a portion of a human WA545 is obtained, the human coding sequence can be used as a probe to identify a human cell line or tissue that synthesizes WA545 mRNA. Alternatively, the Xenopus coding sequence can be used as a probe to identify said human or tissue cell line. Alternatively, the WA545 Xenopus coding sequence is used to design oligonucleotide primers that will specifically amplify a portion of the WA545 coding sequence located in the region located between the primaries used to perform the specific amplification reaction. Using sequences from WA545 Xenopus and human one can specifically amplify corresponding coding sequences of human A5 from models of mRNA, cDNA or genomic DNA. Once a positive source has been identified by one of the methods described above, mRNA is selected by oligo (dT) cellulose chromatography and cDNA was synthesized and cloned into XgtlO or other bacteriophage vectors known to those skilled in the art, by example, ZAP. by established techniques. It is also possible to perform the directed amplification reaction of the oligonucleotide primer, as described above, directly on a pre-established human or genomic cDNA library, which has been cloned into a bacteriophage vector. In such cases, a library that produces a specifically amplified DNA product that codes for a portion of human WA545 protein is screened directly using the amplified WA545 coding DNA fragment as a probe. The human WA545 sequence of the present invention is obtained using all or fragments of the WA545 Xenopus DNA sequence, or a partial human WA545 sequence, as a probe. In this way, it is expected that the human W? 545 DNA sequence comprises a DNA sequence highly homologous to nucleotides # 55 or # 775 to # 1116 of the DNA sequence of WA545 Xenopus shown in SEQ ID NO:] . It is expected that the amino acid sequence of the human WA545 protein comprises amino acids highly homologous to amino acid sequence # -240 or # 1 to # 114 of SEQ JD NO: 2. The WA545 protein is expected, as expressed by mammalian cells such as CHO cells, exists as a heterologous population of active species of VA545 protein with N-termini variants. It is expected that the active species will comprise an amino acid sequence beginning with the cistern residue at amino acid # 13 of SEQ ID NO: 2, or will comprise an additional amino acid sequence in addition in the direction of termination N. In this way, DNA sequences encoding active WA545 proteins are expected to include those comprising nucleotides # 775 or # 81 1 to # 1 1 13 or # 1 1 16 of SEQ ID NO: 1, as well as those that include nucleotides additional at the end with 5 'termination. Accordingly, it is expected that active WA545 species include those comprising amino acids # 1 or # 13 to # 1 13 or # 1 14 of SEQ ID NO: 2, as well as those including additional amino acids at the terminus with N-terminus. Host cell can be transformed with a coding sequence encoding a propeptide suitable for protein secretion by the host cell bound in reading frame appropriate to the coding sequence for the mature WA545 protein. For example, see U.S. Patent No. 5,168,050, in which a DNA encoding a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA encoding a mature BMP-2 protein. . See also the description of PCT application WO95 / 16035, in which the BMP-2 propeptide is fused to DNA encoding a mature BMP-12 protein. Thus, the present invention includes chimeric DNA molecules comprising a DNA sequence encoding a propeptide or a regulatory sequence from a protein, such as a TGF-β protein, different from WA545, bound in reading frame correct to a DNA sequence that encodes a WA545 protein. The term "chimeric" is used to indicate that the propeptide originates from a polypeptide different from prolein WA545. A host cell that naturally expresses native WA545 can be transfected with a highly expressed expression control sequence or regulatory expression capable of recombination for the purpose of increasing or altering the expression of WA545.

It is expected that the N-terminus of an active species of WA545 is experimentally determined by expression in E. coli to be as follows: [M] STHSSPPTP. Thus, it appears that the N-terminus of this species of WA545 is in amino acid # 1 of SEQ ID NO: 1, and a DNA sequence encoding said species of WA545 would comprise nucleotides # 775 to # 1116 of the SEQ ID NO: 1. The apparent molecular weight of the WA545 monomer is expected to be experimentally determined by SDS-PAGE to be about 10-15 kd, more particularly about 13 kd, on a 16% Novex tricine gel. The WA545 protein is expected to exist as a clear and colorless solution in 0.1% trifluoroacetic acid. The dimer is expected to have a molecular weight of approximately 20-30 kd. It is expected that other WA545 proteins, as expressed by mammalian cells such as CHO cells, also exist as a heterogeneous population of active WA545 protein species with N-termini variants. For example, it is expected that active species of WA545 will comprise an amino acid sequence that starts with the cysteine residue at amino acid # 13 of SEQ ID NO: 2, or that will comprise an additional amino acid sequence further in the direction of termination. N. In this way, DNA sequences encoding active WA545 proteins are expected to include those comprising a nucleotide sequence comprising nucleotides # 55, # 775, # 81 1 to # 1 1 13 or # 1 1 16 of SEQ ID NO: 1. Accordingly, active WA545 proteins include those comprising those amino acids # -240, # 1 or # 13 to # 113 or # 1 14. The WA545 proteins of the present invention include polypeptides having a molecular weight of approximately 10-15 kd in monomeric form, said polypeptide comprising the amino acid sequence of SEQ ID NO: 2 and having the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerv io, epidemic and / or other connective tissue in trials such as the Sampath-Reddi ectopic implant trial modified by Rosen, or in the other trials described below. The WA545 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. WA545 proteins can be characterized by the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue, for example, in the assays described below. The WA545 proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1, but within which modifications or deletions have been provided in natural form (eg, allelic variants in the nucleotide sequence that can be result in amino acid changes in the polypeptide) or deliberately designed. For example, synthetic polypeptides can totally or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2. These sequences, by virtue of sharing primary, secondary and tertiary conformational and structural characteristics with the polypeptide sequence of SEQ ID NO: 2 may possess biological properties in common with them. Thus, these modifications and deletions of native WA545 can be used as biologically active substituents for WA545 polypeptides that occur naturally in therapeutic processes. It can be easily determined if a given variant of WA545 maintains the biological activity of WA545 by replacing both WA545 and variant WA545 in the assays described in the examples and the present disclosure. Other specific mutations of the sequences of the WA545 proteins described herein involve modifications of the glycosylation sites. These modifications may involve glycosylation sites linked to O or linked to N. For example, the absence of glycosylation or only partial glycosylation results from the substitution or deletion of amino acids at the glycosylation sites linked to asparagine. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences that are specifically recognized by appropriate cell glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of substitutions or deletions of amino acids at one or both of the first or third amino acid positions of a glycosylation recognition site (and / or amino acid deletion at the second position) results in null glycosylation at the modified tripeptide sequence. Additionally, bacterial expression of the WA545 protein will also result in the production of a non-glycosylated protein, even if the glycosylation sites are left unmodified. The present invention also encompasses the new DNA sequences, free of association with DNA sequences encoding other proieinaceous materials, and which code for the expression of WA545 protein. These DNA sequences include those described in SEQ ID NO: 1 in a 5 'to 3' direction and those sequences that hybridize them under stringent hybridization conditions [eg, O.lx SSC, 01% SDS at 65 ° C.; see, T. Maniatis et al., Molecular Cloning (A Laboratory Manual). Cold Spring Harbor Laboratory (1982), pages 387 to 389] and coding for a protein that has β-induction activity. cartilage, bone, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue. As used herein, the term "stringent hybridization conditions" also refers to the use of initially low stringency hybridization conditions (such as 6X SSC, 0.5% SDS, at about 60 ° C, overnight, followed by washes of higher astringency (such as 2X SSC, 0.1% SDS, at approximately 20 ° C) or even astringency of washings Much higher (such as 0.1X SSC, 0.1% SDS, at about 65 ° C, for less than one hour) The DNA sequences of the present invention also include those comprising the DNA sequence of SEQ ID NO: 1 and those that hybridize under conditions of astringent hybridization and that encode a protein that has cartilage, bone, tendon, ligament, nerve, epidermis and / or other connective tissue induction activity. coding for WA545 protein encoded by the sequences of SEQ ID NO: 1 or which code for the amino acid sequence of SEQ ID NO: 2, but which differ in codon sequence due to degenerations of the genetic code or allelic variants (base changes that occur naturally in the species population that may or may not result in an amino acid change) 5 also encode the new factors described here. n the invention the variations in the DNA sequences of SEQ ID NO: 1, which are caused by point mutations or by induced modifications (including insertion, deletion and substitution) to improve the activity, half-life or production of the encoded polypeptides . Another aspect of the present invention provides a new method for the production of WA545 protein. The method of the present invention involves the cultivation of a suitable cell line, which has been transformed with a DNA sequence encoding a WA545 protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the WA545 proteins recovered and purified from the culture medium. The purified proteins are substantially free of other proteins with which they are co-produced, as well as other contaminants. Appropriate cells or cell lines can be mammalian cells, such as Chinese hamster ovary (CHO) cells. The selection of the appropriate mammalian host cells and the methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, for example, Gething and Sambrook, Nature, 293: 620-625 (1981), or alternatively, Kaufman et al., Mol. Cell. Biol., 5 (7): 1750-1759 (1985) or Flowley et al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line, which is described in the accompanying drawings, is the COS-1 monkey cell line. The mammalian cell CV-1 may also be suitable. Bacterial cells can also be appropriate hosts. For example, the various strains of E. coli. (for example, HB101, MC1061) are well known as host cells in the field of biotechnology. Several strains of B. subtilis, Pseudomonas, other bacilli and the like can be employed in this method. For the expression of the protein in bacterial cells, DNA encoding the propeptide of WA545 is generally not necessary. Many strains of yeast cells known to those skilled in the art may also be available as host cells for the expression of the polypeptides of the present invention. In additional form, where desired, insect cells can be used as host cells in the method of the present invention. See, for example, Miller et al. Genetic Engineering, 8: 277-298 (Plenum Press 1986) and the references cited there. Another aspect of the present invention provides vectors for use in the expression method of these novel WA545 polypeptides. Preferably the vectors contain the new complete DNA sequences that were described above and which code for the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences that allow the expression of the WA545 protein sequences. Alternatively, vectors incorporating modified sequences of incorporation as described above are also embodiments of the present invention. Additionally, sequences of SEQ ID NO: 1 or other sequences encoding WA545 proteins could be manipulated to express a mature WA545 protein by deleting WA545 propeptide sequences and replacing them with sequences encoding the complete propeptides of the other BMP proteins or members of the TGF-β superfamily. In this manner, the present invention includes chimeric DNA molecules that encode a propeptide from a member of the TGF-β superfamily bound in correct reading frame to a DNA sequence encoding a WA545 polypeptide. The vectors can be used in the method of transforming cell lines and contain regulatory sequences selected in operative association with the DNA coding sequences of the invention, which are capable of directing the specific or susceptible replication of tissue and expression of it in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and can be selected depending on the host cells. In this way, such specialized vectors constitute part of the present invention. A proiein of the present invention, which induces the formation of cartilage, bone. tendon, ligament, muscle, nerve, epidermis and / or other connective tissue in circumstances in which the tissue is not normally formed, has application in the healing of wounds or fractures of bones and cartilage or other connective tissue defects in humans and others animals. Such preparation employing a WA545 protein may have prophylactic use in the reduction of both open and closed fractures and also in the improved fixation of artificial joints. The formation of new bone induced by an osteogenic agent contributes to the repair of congenital defects, induced by trauma or craniofacial defects induced by oncological resection, and is also useful in cosmetic plastic surgery. A WA545 protein can be used in the treatment of periodental disease, and in other dental repair processes. Such agents can provide an environment for attracting bone-forming cells, stimulating the growth of bone-forming cells or inducing the differentiation of bone-forming cell progenitors, and also supporting regeneration of the periodental ligament and attachment devices, which connect bone and denture. The WA545 polypeptides of the invention may also be useful in the treatment of osteoporosis. A variety of osteogenic factors, cartilage inducers and bone inducers have been described. See, for example, European patent applications numbers 148,155 and 169,016 for descriptions thereof. The proteins of the present invention may also be useful in wound healing and related tissue repair. Wound types include, but are not limited to burns, incisions and ulcers. (See, for example, PCT Publication WO84 / 01 106 for a description of wound healing and repair of related tissue). It is also contemplated that proteins of the invention may increase the survival of neuronal and glial cells and therefore be useful in the transplantation and treatment of conditions that present a decrease in neuronal survival and repair. The proteins of the invention can also be useful for the treatment of conditions related to other types of tissue, such as nerve, including spinal cord, epidermis, muscle, including cardiac, smooth and striated muscle, and other organs such as liver, pancreas, brain, spleen, lung, heart and kidney tissue. The proteins of the present invention may also have value as a nutritional or dietary supplement. For this use, the proteins can be used intact, or can be pre-digested to provide a more easily absorbed supplement. The proteins of the invention may also have other useful properties and characteristics of the TGF-β superfamily of proteins. Such proteins include angiogenic properties, chemotactic and / or chemoattractants, and effects on cells including the induction of collagen synthesis, fibrosis, differentiation responses, cell proliferation responses and responses that involve cell adhesion, migration and extracellular matrices. These properties make the proteins of the invention potential agents for wound healing, reduction of fibrosis and reduction of scar tissue formation. When dimerized as a homodimer or as a heterodimer with other BMPs. with other members of the TGF-β superfamily of proteins, or with α-inhibin proteins or β-inhibin proteins, the heterodimer of WA545 is expected to demonstrate effects on the production of follicle stimulating hormone (FSH), as describe later here. It is recognized that FSH stimulates egg development in mammalian ovaries (Ross et al., In Textbook of Endocrinology, ed Williams, p.355 (1981)) and that excessive stimulation of the ovaries with FSH will lead to multiple ovulations. FSH is also important in testicular function, so WA545 can be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and to decrease spermatogenesis in male mammals. inhibins may induce infertility in mammals.The WA545 may also be useful as a fertility-inducing therapeutic, based on the ability of activin molecules to stimulate the release of FSH from cells of the anterior pituitary. , US Patent No. 4,798,885.The WA545 could also be useful for advancing the appearance of fertility in mammals sexually and immature, in order to increase the duration of reproductive performance of domestic animals such as cows, sheep and pigs. It is further contemplated that WA545 may be useful in the modulation of hematopoiesis by induction of erythroid cell differentiation [see, for example, Broxmeyer et al., Proc. Nati Acad. Sel, USA, 85: 9052-9056 (1989) or Eto et al. Biochem, Biophys, Res. Comm., 142: 1095-1103 (1987)], for the suppression of tumor development of the gonads [see, for example, Matzuk et al., Nature, 360: 313-319 (1992)] or to increase the activity of bone morphogenetic proteins [see, for example, Ogawa et al., J. Biol. Chem., 267: 14233 -14237 (1992)]. The WA545 proteins may also be characterized by their ability to modulate the release of follicle stimulating hormone (FSH) in bioassays stabilized in vitro using rat anterior pituitary cells as described [see, for example, Vale et al.£ p.n11d 'oc ?? nology, 91: 562-572 (1972); Ling et al., Nature, 321: 779-782 (1986) or Vale et al., Nature, 321: 776-779 (1986)] It is contemplated that the WA545 protein of the invention, when composed as a heterodimer within inhibin β chains will present stimulating effects on the release of follicle stimulating hormone (FSH) from the anterior pituitary cells as described [Ling et al., Nature, 321: 779-782 (1986) or Vale et al., Nature, 321: 776-779 (1986)]. Additionally, it is contemplated that the WA545 protein of the invention when it is composed as a heterodimer within the inhibin chain will inhibit the release of the follicle stimulation hormone (FSH) from cells of the anterior pituitary as described [see, for example, Vale et al., Endocrinology. 91: 562-572 (1972). Therefore, depending on the particular composition, it is expected that the WA545 protein of the invention may have contrasting and opposite effects on the release of the follicle stimulating hormone (FSH) from the anterior pituitary. Activin A (the homodimeric composition of inhibin βA) has been shown to have erythropoietic stimulating activity (see, for example Eto et al., Biochem, Biophys, 5 Res. Comm., J_42: 1095-1103 (1987) and Murara et al., Proc. Nati, Acad. Sci. USA, 85: 2434-2438 (1988) and Yu et al., Nature, 330: 765-767 (1987)] It is contemplated that the proteins of the invention have a Similar erythropoietic stimulating activity This activity of the WA545 protein can furthermore be characterized by the ability of the WA545 protein to demonstrate erythropoietin activity in the biological assay performed using the human K- or 562 cell line as described by [Lozzio et al. ., Blood, 45: 321-334 (1975) and U.S. Patent No. 5,071, 834.] As a further aspect of the invention there is a therapeutic method and a composition for the repair of fractures and other conditions related to cartilage, bone, tendon, ligament, muscle, nerve, epid ermis and / or other connective tissue defects or periodental diseases. The invention further comprises therapeutic methods and compositions for healing wounds and for tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the WA545 proteins of the invention in admixture with a pharmaceutically acceptable carrier, vehicle or matrix. It is further contemplated that the compositions of the invention may increase neuronal survival and, therefore, be useful in the transplantation and treatment of conditions that exhibit a decrease in neuronal survival. The compositions of the invention may further include at least one other therapeutically useful agent, such as members of the TGF-.β superfamily of proteins, which includes the BMP proteins: BMP-1, BMP-2, BMP-3, BMP-4. , BMP-5, BMP-6 and BMP-7 described by examples in the US 5 patents Nos. 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076 and 5,141,905; BMP-8 described in PCT publication WO91 / 18098; and BMP-9, described in PCT Publication WO93 / 00432, BMP-10, described in PCT application W094 / 26893; BMP-1 1, described in PCT application W094 / 26892, or BMP-12 or BMP-13, described in PCT application WO95 / 16035, or BMP-15, described in PCT application WO96 / 36710 or BMP-16, described in the application? patent co-pending with serial number 08 / 715,202, filed on September 18, 1996.

Other compositions that may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFs], including those described in PCT applications W094 / 15965; W94 / 15949; WO95 / 01801; WO95 / 01802; W094 / 21681: W094 / 15966 and others. The BIP, which is described in WO94 / 01557, may also be useful in the present invention; and MP52, which is described in PCT application WO93 / 16099. The descriptions of all the above applications are incorporated herein by reference for the present description. It is expected that WA545 proteins may exist in nature as homodimers or heterodimers. To promote the formation of WA545 dimers with increased stability, one can genetically engineer the DNA sequence of SEQ ID NO: 1 to provide one or more additional cysteine residues to increase potential dimer formation. The resulting DNA sequence would be capable of producing an "added cysteine variant" of the WA545 protein. Alternatively, one can produce "aggregated cysteine variants" of WA545 proteins by altering the sequence of the proteins at the amino acid level, for example by altering the amino acid sequences Of one or more amino acid residues for Cys. The production of "added cysteine variants" of proteins is described in U.S. Pat. No. 5,166,322, the description of which is incorporated herein by reference. It is expected that the proteins of the invention may act in concert with or perhaps in synergistic fashion with other related proteins and growth factors. Further methods and therapeutic compositions of the invention therefore comprise a therapeutic amount of at least one WA545 protein of the invention with a therapeutic amount of another member of the TGF-β superfamily of proteins, such as the proteins described in the applications described above. . Such combinations may comprise separate molecules of the BMP proteins or heteromolecules composed of different fractions of BMP. For example, a method and composition of the invention may comprise a disulfide-linked dimer comprising a protein subunit WA545 and Lina subunit from one of the "BMP" proteins described above. Thus. the present invention includes a purified WA545 polypeptide which is a heterodimer wherein a subunit comprises an amino acid sequence of SEQ ID NO: 2, and a subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8. BMP-9. BMP-10, BMP-11, BMP-12 or BMP-13, described in PCT application WO95 / 16035 or BMP-15, described in PCT application WO96 / 36710 or BMP-16, described in the co-pending patent application. pending serial number 08 / 715,202, filed September 18, 1996. A further embodiment may comprise a heterodimer of WA545 fractions, for example, of WA545 Xenopus and the human homologue of the WA545 Xenopus protein. In addition, WA545 may be combined with other beneficial agents for the treatment of defects, wounds or bone tissue, cartilage, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue in question. These agents include various growth factors such as the epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transformation growth factors (TGF- and TGF-β). , wnt proteins, hedgehog proteins, such as sonic, hedgehog, and desert hedgehog, fortune-telling, inhibins and fibroblast growth factor k (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF / HILDA DIA), insulin-like growth (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the present invention. The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pF1, isotonicity, stability and the like, is well within the skill in the art. Therapeutic compositions are also currently valuable for veterinary applications due to their lack of species specificity in BMP proteins. Particularly domestic animals and thoroughbred horses, in addition to humans, are the desirable patients for such treatments with the WA545 proteins of the present invention. The therapeutic method includes administration of the composition topically, systemically or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a physiologically acceptable and pyrogen-free form. In addition, the composition may desirably be encapsulated or injected in a viscous form for release to the site of damage to bone tissue, cartilage, tendon, ligament, muscle, nerve, epidermis or other connective tissue or tissue in general. Topical administration may be suitable for wound healing and tissue repair. As described above they can also be included in the composition, optionally, other therapeutically useful agents and different to the WA545 proteins, which alternatively or additionally can be administered simultaneously or sequentially with the BMP composition in the methods of the invention. Preferably for the formation of bone, cartilage, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue, the composition includes a matrix capable of delivering WA545 or other BMP proteins to the site of damage to bone, cartilage, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue, providing a structure for the development of bone, cartilage, tendon, ligament, muscle, nerve, epidermis and / or other connective tissue, and which is optimally capable of being reabsorbed inside the body. The matrix can provide slow release of the WA545 and / or other inductive protein, as well as an adequate presentation and an appropriate environment for cell infiltration. Said matrices may be formed of materials currently in use for other medical implant applications. The selection of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the compositions of the WA545 will define the appropriate formulation. Potential matrices for the compositions may be calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, and chemically defined biodegradable polyanhydrides. Other potential materials are also biodegradable and biologically well defined bone or dermal collagen. Additional matrices are made up of pure proteins or components of extracellular matrices. Other potential matrices are also non-biodegradable and chemically defined as sintered hydroxyapatites, biocrystal, aluminates or other ceramics. The matrices may be composed of combinations of any of the aforementioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. Bioceramics can be altered in their composition, such as calcium-aluminate-phosphate and processed to alter pore size, particle size, particle shape and biodegradability.

The dosing regimen will be determined by the treating physician, considering several factors that modify the action of the WA545, for example, amount of tissue weight that is desired to be developed, site of damage, condition of damaged tissue, Size of the wound, type of damaged tissue, age, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. The dose may vary with the type of matrix used in the reconstitution and with the types of BMP proteins in the composition. The addition of other known growth factors, such as IGF-I (insulin-like growth factor I), to the final composition, may also affect the dosage. Progress can be monitored by periodic evaluation of the growth and / or repair of the tissue / bone, for example, X-rays, histomorphometric determinations and tetracycline labeling. The following examples illustrate the practice of the present invention in the recovery and characterization of WA545 Xenopus protein and using DNA to recover human WA545 proteins, obtaining human proteins and expressing the proteins via recombinant techniques. The examples are not limiting, and the invention includes many variants as described herein, or will be expensive for those skilled in the art to consider the detailed description of the invention and the preferred embodiments thereof. Techniques and tools for such variants are known to those skilled in the art, and such variations constitute part of the present invention.

EXAMPLES Example 1. Isolation of Xenopus cDNA The full length cDNA of WA545 Xenopus was isolated from a cD library primed with dT, which was constructed in the plasvector CS2 +. The cDNA was made from Xenopus embryos (stage 1 1.5-12). The sequences of the probe used to isolate the clone were derived from a sEST, an EST used to allow the secretion of invertase in the signal sequence trap, which is described in the patent of the E.U.A. No. 5,536,637, the disclosure of which is incorporated herein by reference. The sequences of the probes for WA545 were as follows: 5'-GAAAGTGATAGCCACAACTCTGCCATG-3 '(SEQ ID NO: 3) and 5'-GATTTAGGTACAGGAGCTGGAGCAATG-3' (SEQ ID NO: 4). Both probes were antisense sequence for SEST. The DNA probes were radioactively labeled with 32P and used to screen the primed cDNA library with Xenopus clone, under highly stringent hybridization / wash conditions, to identify clones containing sequences of the WA545 gene. Approximately 61,000 library transformants were plated at a density of approximately 4350 transformants per plate on selective plates for screening WA545. Replicas of nitrocellulose from the transformed colonies were hybridized to the 32P-labeled DNA probe in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denharct, 10 mM EDTA, pH8, 100 mg / ml Bakers yeast ribonucleic acid) under conditions of high astringency (65 ° C for 2 hours). After hybridization for 2 hours, the filters were removed from the hybridization solution and washed under conditions of high stringency (2X SSC, 0.5% SDS, 21 ° C for 5 minutes, followed by 2X SSC, 0.1% SDS, 21 ° C for 15 minutes, followed by a second 2X SSC, 0.1% SDS, 21 ° C for 15 minutes, followed by 2X SSC, 0.1% SDS, 65 ° C for 10 minutes). The filters were wrapped in Saran wrap and exposed to X-ray film overnight for 3 days at room temperature. Autoradiographs were developed and positive hybridization transformants of various signal intensities were identified. These positive clones were collected, grown for 5 hours in selective medium and plated at a low density (approximately 100 colonies per plate). Replicas of nitrocellulose from the colonies were hybridized to the probe labeled with "P in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denhardt, 10 mM EDTA, pH8, 100 mg / ml ribonucleic acid Lev adura Bakers) under High stringency conditions (65 ° C for 2 hours) After hybridization for 2 hours, the filters were removed from the hybridization solution and washed under conditions of high stringency (for example 2X SSC, 0.5%) SDS, 21 ° C for 5 minutes; followed by 2X SSC, 0.1% SDS, 21 ° C for 15 minutes; followed by a second 2X SSC, 0.1% SDS, 21 ° C for 15 minutes; followed by a second wash at 2X SSC, 0.1% SDS, 65 ° C for 10 minutes). The filters were wrapped in Sar n wrap and exposed to X-ray film overnight for up to 3 days at room temperature. Autoradiographies were developed and positive hybridization transformants were identified. Bacterial patterns of purified hybridization clones were prepared and plasmid DNA was isolated. The sequence of the cDNA insert was determined. The cDNA insert contained the sequences of the DNA probe used in the hybridization.

Example 2. Homologous Isolation of WA545 Using the DNA sequence reported here for the newly isolated WA545 protein, DNA sequences encoding WA545 homologs and related proteins, such as the murine and human WA545 protein, can be isolated by several techniques known to those skilled in the art. As described below, oligonucleotide primers can be designed based on the amino acid sequences present in other BMP proteins, Vg-1 related proteins and other proteins of the TGF-β superfamily. Regions containing amino acid sequences that are highly conserved within the BMP family of proteins and within other members of the TGF-ß superfamily can be identified proteins and consensus amino acid sequences of these highly conserved regions can be constructed on the basis of the similarities of the corresponding regions of individual BMP / TGF-β / Vg-1 proteins. It is contemplated that the WA545 protein of the invention and other proteins related to BMP / TGF-β / Vg-1 may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a prolein WA545 or other new related proteins would correspond to relative locations in the proteins from which they were derived. It is further contemplated that this positional information derived from the structure of other BMP / TGF-β / Vg-1 proteins and oligonucleotide sequences that have been derived from consensus amino acid sequences could be used to specifically amplify DNA sequences encoding the corresponding amino acids of a WA545 protein or other proteins related to BMP / TGF-β / Vg-1. An example of such consensus amino acid sequences is indicated below. Consensus amino acid sequence: Trp Xaa Xaa Trp He Xaa Ala (SEQ ID NO: 5) wherein the first Xaa is Glu, Asn or Asp; the second Xaa is Asp, Glu or Asn; and the third Xaa is Val or He. Where X / Y indicates that any amino acid residue can appear in that position. The following oligonucleotide is designed on the basis of the previously identified consensus amino acid sequence (1): # 1: GCGGATCCTGGVANGABTGGATHRTNGC (SEQ IDNO: 6) This oligonucleotide sequence is synthesized in an automated DNA synthesizer. The standard nucleotide symbols in the previously identified primary oligonucleotide are as follows: A, adenosine; C, cytosine; G, guanine; t, thymine; N, adenosine or cytosine or guanine or thymine; R, adenosine or cytosine; And, cytosine or thymine; H, adenosine or cytosine or thymine; V, adenosine or cytosine or guanine; D, adenosine or guanine or thymine. The first eight nucleotides of oligonucleotide # 1 (underlined) contain the recognition sequence for the restriction endonuclease BamHI in order to facilitate the manipulation of a specifically amplified DNA sequence encoding ia WA545 or WA545-related proteins and, therefore, therefore, they are not derivatives of the consensus amino acid sequence (1) presented above. A second consensus amino acid sequence is derived from another highly conserved region of BMP / TGF-β / Vg-1 proteins as described below: Asn His Ala He Xaa Gln Thr (SEQ ID NO: 7) where Xaa is the same to Val or Leu. The following oligonucleotide is designed on the basis of the previously identified consensus amino acid sequence (2): # 2: GCTCTAGAGTYTGNAYNATNGCRTGRTT (SEQ ID NO: 8) This oligonucleotide sequence is synthesized on an automated DNA synthesizer. The same symbols that were described above are used. The first eight nucleotides of oligonucleotide # 2 (underlined) contain the recognition sequence for restriction endonuclease Xbal in order to facilitate the manipulation of a specifically amplified DNA sequence coding for WA545 or WA545-related proteins and, therefore, therefore, they are not derived from the consensus amino acid sequence (2) presented above.

It is contemplated that the WA545 or WA545 related proteins of the invention and other proteins related to BMP / TGF-β / Vg-1 may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within of the WA545 or related proteins with the WA545 or other new related proteins would correspond to the relative locations in the proteins from which these were derived. It is further contemplated that this position information derived from the structure of other BMP / TGF-β / Vg-1 proteins and oligonucleotide sequences # 1 and # 2 that have been derived from consensus amino acid sequences (1) and ( 2), respectively, can be used to specifically amplify sequences of DNA encoding the corresponding amino acids of a WA545 or WA545-related protein or other BMP / TGF-β / Vg-1 proteins. ^} Based on the knowledge of the protein gene structures BMP / TGF-β / Vg-1. it is further contemplated that human or murine genomic DNA, Xenopus, can be used as a model to perform specific amplification reactions that would result in the identification of WA545 coding sequences and WA545 proteins. Such specific amplification reactions of a human or murine genomic DNA model can be initiated with the use of oligonucleotide primers as described above. Oligonucleotides such as those set forth in SEQ ID NO: 6 and SEQ ID NO: 8 are used as primers to allow specific amplification of a specific nucleotide sequence from Xenopus, human, murine or other genomic DNA. The amplification reaction is performed as follows: Genomic DNA is cut by repeated passage through a 25 gauge needle denatured at 100 ° C for 5 minutes and then cooled on ice before adding it to a reaction mixture containing 200 μM each one of triphosphates deoxynucleotide (dATP, dGTP, dCTP and dTTP), 10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCL, 0.001% gelatin, 1.25 units of Taq DNA polymerase, 50 pM of each oligonucleotide, such as established in SEQ ID NO: 6 and SEQ ID NO: 8, to the consensus sequence, in a total reaction volume of 50 μl. This reaction mixture is subjected to thermal cyclization in the following manner: 1 minute at 94 ° C, 1 minute at 37 ° C. 2 minutes at 72 ° C for thirty cycles; followed by incubation for 7 minutes at 72 ° C.

The DNA that is specifically amplified by this reaction is precipitated in ethanol, digested with BamHI and Xbal restriction endonucleases and subjected to agarose gel electrophoresis. A region of the gel, corresponding to the predicted size of the DNA fragment encoding human or murine WA545 or related to WA545 is separated • 5 and specifically amplified DNA fragments that are contained therein are electroeluted and subcloned into an appropriate vector, for example, the plasmid vector pGEM-3 between the Xbal and BamHI sites of the polylinker. The DNA sequence analysis of human or murine WA545 subclones or related to WA545 is carried out to determine whether the product of the DNA sequence specifically amplified and which is contained therein encodes a portion of the WA545 human or murine or WA545 related protein of the invention. Oligonucleotide probes, preferably 30-50 nucleotides in length, can • be designed on the basis of the specifically amplified DNA sequence of human WA545 or murine or related to WA545 as described above. The probes of Oligonucleotide are radioactively labeled with P and used to screen a murine or human genomic library constructed in the vector FIXII (Stratagene catalog # 946309) or a comparable substitute. 500,000 recombinants from the human genomic library are plated at a density of approximately 10,000 recombinants per plate on 50 plates. Duplicate replicates of nitrocellulose are made from the plates recombinant bacteriophage, a group of nitrocellulose filters is hybridized to an oligonucleotide probe and a duplicate group of nitrocellulose filters is hybridized to a • second oligonucleotide probe, both in a hybridization buffer (consisting of 5X SSC, 1% SDS, 10% > dextran sulfate, 2X Denliardt's, 100 μg / ml herring salmon sperm DNA) at 60 ° C All night long. The next day the labeled oligonucleotide radioactively containing the hybridization solution is removed and the filters are washed with 5X SSC, 0.1% or SDS at 60 ° C. The recombinants that hybridized to both oligonucleotide probes are identified and plaque purified. The plaque-purified recombinant bacteriophage clones that hybridized to the oligonucleotide probes of WA545 Xenopiis are analyzed to confirm that they encode a WA545 protein from the invention using sequence analysis and the assays described herein. Bacteriophage plaque patterns are made and the bacteriophage DNA is isolated from the murine or human genomic clone. The complete insert of the murine or human genomic recombinant is divided with restriction endonucleases, subcloned into a plasmid vector (pBluescript) and the DNA sequence analysis is carried out. Based on the knowledge of other BMP proteins and other proteins within the TGF-β family, it is predicted that the precursor polypeptide of WA545 Xenopus would be divided into the multibasic sequence Arg-Ala-Lys-Arg according to a sequence of proteolytic processing of proposed consensus of Arg-XX-Arg. It is expected that the cleavage of the WA545 Xenopus precursor polypeptide will generate a mature peptide of 114 amino acids, starting with the amino acid Ser at position # 1 of SEQ ID NO: 2. The processing of the WA545 Xenopus and mammalian is expected. WA545-related proteins within the mature form involve dimerization and elimination of the N-terminus region in a manner analogous to the processing of the related TGF-β protein [Gentry et al., Molec & Cell. Biol., 8: 4162 (1988); Derynck et al., Nature, 316: 701 (1985)]. It is therefore contemplated that the mature active species of mammalian WA545 proteins will comprise a homodimer of two polypeptide subunits, each subunit comprising an amino acid sequence that correlates with a portion of SEQ ID NO: 2, such as amino acids # 1 to # 114. Additional active species comprising at least amino acids # 13 to # 114 of SEQ ID NO: 2 are contemplated, thereby including the first conserved cysteine residue. As with other members of the TGF-β / BMP family of proteins, the carboxy-terminated portion of the murine WA545 protein exhibits greater sequence conservation than the amino-terminated portion. The percent amino acid identity of the WA545 Xenopus protein in the cysteine-rich C-termination domain (amino acids # 24- # 125) for the corresponding region of human BMP proteins and other proteins within the TGF-a family is as follows : BMP-2, 60%; BMP-3, 43%; BMP-4, 57%; BMP-5, 57%; BMP-6, 59%; BMP-7, 57%; BMP-8, 55%; BMP-9, 49%, BMP-10, 51%, BMP-11, 41%; BMP-12, 51%; Vg-1, 82%; GDF-1, 63%; TGF-β1, 39%; TGF-β2, 40%; TGF-β3, 43%; Inhibin ß (B), 42%, inhibin ß (A), 43%. The DNA sequence of WA545 Xenopus (SEQ ID NO: 1) or a portion thereof, such as the portion of the sequence of WA545 Xenopus corresponding to the coding region of the mature peptide, can be used as a probe to identify corresponding homologs or related proteins, such as human or murine WA545 or A545 related proteins. Nucleotides # 775 to # 1116 of SEQ ID NO: 1 can be specifically amplified with oligonucleotide primers designed on the basis of the sequence of WA545 Xenopus (SEQ ID NO: 1). The next oligonucleotide primer is designed on the basis of the nucleotides # 775 to # 794 of the DNA sequence presented in SEQ ID NO: 1 and synthesized in an automated DNA synthesizer: AGTACTCATTCATCACCTCC (SEQ ID NO: 9) The next oligonucleotide primer is designed on the basis of the complement Inverse of nucleotides # 1116 to # 1097 of the DNA sequence presented in SEQ ID NO: 1 and synthesized in an automated DNA synthesizer: CTTGCAACCACACTCATCCA (SEQ ID NO: 10) The amplification reaction was carried as follows: 10 ng of a bacterial plasmid DNA containing the full-length WA545 Xenopus cDNA is added to a reaction mixture containing 200 μM each of deoxynucleotide triphosphates (dATP), dGTP, dCTP and dTTP), 10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001% gelatin, 1.25 units of Taq DNA polymerase, and 100 pM of each oligonucleotide primer. The reaction mixture is then subjected to thermal cyclization in the following manner: 1 minute at 94 ° C3 1 minute at 55 ° C, 1 minute at 72 ° C for thirty cycles. It would be expected that the amplification reaction would generate a DNA fragment of approximately 344 base pairs that encode the complete mature peptide of the WA545 Xenopus protein of the invention. The resultant 344 bp DNA product is visualized immediately after electrophoresis of the reaction products through a 2% agarose gel. The region of the gel containing the WA445 Xenopus fragment of 344 base pairs is divided and the DNA fragments specifically amplified and which are contained therein are extracted (by electroelution or by other methods known to those trained in the art). The 344 base pair DNA amplification product extracted by gel was radioactively labeled with 32P and used to screen a human genomic library conserved in the EDASH II vector (Syriagene # 945203). The same probe can be used to screen a murine genomic library constructed in the eFIX II vector (Síraíagene catalog # 946309). Murine or human WA545 genes or genes related to WA545 One million recombinants from the human or murine genomic library are plated at a density of approximately 20,000 recombinanids per plate on 50 plates. Duplicates of nitrocellulose replicas of the recombinant bacteriophage plaques are hybridized, under reduced stringency conditions, to the 344 bp probe specifically amplified and labeled with 32 P in standard hybridization buffer (SHB = 5X SSC, 0.1% SDS, 5X Denhardí's, 100 μg / ml of salmon sperm DNA) at 60 ° C during the night. The day Next, the labeled radioaclivalent oligonucleotide and containing hybridization solution is removed and the filters are washed, under conditions of reduced stringency, with 2X SSC, 0.1% SDS at 60 ° C. Multiple recombinant hybridization can be positively identified and plaque purified. These plaque-purified recombinant bacteriophages are used to prepare bacteriophage plaque patterns from which recombinant bacteriophage DNA can be isolated and purified. The resulting recombinant bacteriophage DNA, isolated either from the murine or human genomic clones that were originally identified by hybridization to the WA545 Xenopus probe is analyzed for the presence of sequences from either human or murine WA545 or related sequences. with WA545 by characterization of the DNA sequence. The DNA sequence of the WA545 Xenopus (SEQ ID NO: 1), or a portion thereof, can be used as a probe to identify a human cell or tissue line that synthesizes WA545 mRNA. Briefly described, the RNA is extracted from a selected source of cells or tissue and either subjected to electrophoresis on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and staining directly on nitrocellulose. The nitrocellulose is then hybridized to a probe derived from the DNA coding sequence of WA545 Xenopus. Alternatively, the sequence of WA545 Xenopus is used to design oligonucleotide primers that will specifically amplify a portion of the human or murine WA.545 coding sequence or of a sequence related to WA545, located in the region between the human and primary primaries. of murine used to perform the specific amplification reaction. It is contemplated that primary stem cells derived from WA545 Xenopus would allow one to specifically amplify corresponding human A545 or other mammalian WA545 coding sequences from mRNA, cDNA and genomic DNA models. Once a positive source has been identified by one of the methods described above, mRNA is selected by oligo (dT) cellulose chromatography and the cDNA is syntheiZed and cloned in? GilO or other bacteriophage vectors? known by those trained in the technique, for example, ZAP by means of technically sound techniques (Toóle eí al., supra). It is also possible to perform the oligonucleotide-directed priming amplification reaction, described above, in a directed manner on a cDNA library human or genomic pre-isoenzyme, which has been cloned deniro of a bacteriophage neighbor? In these cases, a library that produces a specifically amplified product DNA and that encodes a portion of the human WA545 protein could be ^^ directly sifted, using the amplified human WA545 protein fragment encoding DNA as a probe. It is predicted that oligonucleotide primers designed on the basis of the DNA sequence of the genomic clone of WA545 Xenopus allow the specific amplification of DNA sequences encoding human WA545 from pre-established human cDNA libraries, which are commercially available (ie, Síraíagene, La Joila, CA or Cloneíech Laboratories, Inc., Palo Alto, CA). The oligonucleotide primaries are designed on the basis of the DNA sequence set forth in SEQ ID NO: 1 and are synthesized in an automated DNA synthesizer. P Approximately 1 x 108 pfu (plaque-forming units) of bacteriophage libraries? containing inserts of human cDNA corresponding to the primaries are denatured at 90 ° C for 5 minutes before adding them to a reaction mixture containing 200 μM each of deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001% gelatin, 1.25 units of Taq DNA polymerase, 100 pM of oligonucleotide primaries. The reaction mixture is subsequently subjected to thermal cyclization in the following manner: 1 minute at 94 ° C, 1 minute at 50 ° C, 1 minute at 72 ° C for 1 hour and 9 cycles; followed by 10 minutes to 72 ° C.

The resulting product DNA that is specifically amplified by this reaction is then visualized by electrophoresis of the reaction products through a 2% agarose gel. Once a positive cDNA source has been identified in this form, the corresponding cDNA library from which the specific sequence of the WA545 was amplified could be screened directly with the other WA545-specific probes in order to identify and isolate the cDNA clones that code for the full length WA545 protein of the invention. Additional methods known to those skilled in the art can be used to isolate other full-length cDNAs encoding human WA545 proteins, or full-length cDNA clones that encode WA545 proteins of the invention from species other than human, particularly other mammal species. Alternatively, the oligonucleotides are used as primers to allow the specific amplification of sequences of specific human or murine WA545 nucleotides from plasmids encoding WA545 Xenopus. The amplification reaction is carried out as follows: approximately 25 ng of WA545 Xenopus DNA is added to a reaction mixture containing 200 μM each of deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 10 mM Tris-HCl , pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001%) gelatin, 1.25 units of Taq DNA polymerase, 100 pM of each oligonucleotide primer to the DNA sense of WA545 Xenopus and complementary orientations. The reaction mixture is then subjected to thermal cyclization in the following manner: 1 minute at 94 ° C, 1 minute at 53 ° C, 1 minute at 72 ° C for thirty cycles. It is expected that the DNA that is specifically amplified by this reaction will generate a WA545 coding product. The resulting product DNA is visualized immediately after the elecrophoresis of the reaction products through a 2% agarose gel. The region of the gel containing the WA545 DNA fragment is split and the DNA fragments specifically amplified and contained therein are extracted (by electroelution or by other methods known to those skilled in the art). The amplification product of DNA extracted by gel is radioactively labeled with 32P and used to screen a human genomic library constructed in the vector? DASH II (catalog Stratege # 945203).

Additional methods known to those skilled in the art may also be used to isolate human and other species that are homologous to the WA545 and related proteins using the DNA and amino acid sequences of the present invention. ^ fc 5 Example 3. Bioassays of W-20 A. Description of W-20 cells The use of W-20 bone marrow stromal cells as an indicator cell line is based on the conversion of these cells to osteoblast type cells after of treatment with a BMP protein [Thies et al., Journal of Bone and Mineral Research, 5: 305 (1990); and Thies eí al, Endocrinology. 130: 1318 (1992)], Specifically, W-20 cells are a scintigraphic bone marrow cell line derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA.

• The treatment of W-20 cells with certain BMP proteins resulted in (1) increased production of alkaline phosphatase, (2) induction of cAMP-stimulated cAMP, and (3) Induction of osteocalcin synthesis by cells. Although (1) and (2) represented features associated with the osteoblast phenotype, the ability to synthesize osteocalcin is a phenotypic property only displayed by mature osteoblasts. In addition, until the date we have observed conversion of stromal W-20 cells to osteoblasic cells only with the irradiation with BMPs. In this form, the activities in vitro deployed by BMP-enrobed W-20 cells correlate with known in vivo bone formation activity for BMPs. Two in vitro assays useful in comparing BMP activities of new osteoinductive molecules, such as WA545 are described below. B. W-20 Alkaline Phosphatase Assay Protocol 25 W-20 cells are plated into 96-well tissue culture plates at a density of 10,000 cells per well in 200 μl medium (DME with 10% heat inactivated fetal serum, 2 mM glutamine and 100 Units / ml penicillin + 100 μg / ml streptomycin). The cells were allowed to bind overnight in an incubator with 95% air, 5% C02, at 37 ° C.

The 200 μl of medium was removed from each well with a multichannel pipette and replaced with an equal volume of the test sample delivered in DME with 10% heat inactivated fetal serum, 2 mM glutamine and 1% penicillin. -streptomycin. The test substances are tested in triplicate. The test samples and standards are left for an incubation period of 24 hours with the W-20 indicator cells. After 24 hours, the plates are removed from the 37 ° C incubator and the test medium is removed from the cells. The W-20 cell layers are washed three times with 200 μl per well of phosphate regulated with phosphate and free of calcium / magnesium and these washes are discarded. 50 μi of distilled water in glass are added to each well and the test plates are then placed on a dry ice / ethanol bath for rapid freezing. Once frozen, the test plates are removed from the dry ice / ethanol bath or thawed at 37 ° C. This is repeated twice more for a total period of freeze-thaw procedures. Once finished, the membrane-bound alkaline phosphatase is available for measurements. 50 μi of the assay mixture (50 mM glycine, 0.05% Triton X-100, 4 mM MgCl2, 5 mM p-nitrophenol phosphate, pH = 10.3) are added to each test well and the test plates are then incubated for 30 minutes at 37 ° C in a shaking water bath at 60 oscillations per minute. At the end of the 30 minute incubation, the reaction is stopped by adding 100 μl of 0.2 N NaOH to each well and placing the test plates on ice. The spectrophotometric absorbance for each well is read at a wavelength of 405 nanometers. These values are then compared with known standards to give an estimate of the alkaline phosphase activity in each sample. For example, absorbance values are generated using known amounts of p-niiophenol phosphate. Esío will be shown in Table I.

Table I Absorbance Values for Known Standards of P-Nitrophenol Phosphate Umoles of o-nitrophenol phosphate Average absorbance (405 nm) 0.000 0 0.006 0.261 +/- 0.024 0.012 0.521 +/- 0.031 0.018 0.797 +/- 0.063 0.024 1.074 +/- 0.061 0.030 1.305 +/- 0.083 The absorbance values for known amounts of BMPs can be determined and converted to μmol of p-nitrophenol phosphate cut per unit time as shown in Table II. Table II Alkaline Phosphatase Values for Treatment of W-20 Cells with BMP-2 Absorbance Reading Concentration Umoles of substrate BMP-2 fne mn ≤405 nanometers (or hour) 0. 00 0.645 0.024 1.56 0.696 0.026 3.12 0.765 0.029 6.25 0.923 0.036 12.50 1.121 0.044 25.00 1.457 0.058 50.00 1.662 0.067 100.00 1.977 0.080 These values are then used to compare the activities of known quantities of WA5 5 for BMP-2. C. RIA Protocol of Osteocalcin W-20 cells are plated at 10 6 cells per well in tissue dishes of 5-fold tissue of 24 wells in 2 mis of DME containing 10% heat-inactivated fetal res beef serum, 2 mM glutamine. . The cells were allowed to bind overnight in an atmosphere of 95%) air and 5% CO2 at 37 ° C. The next day the medium is changed to DME containing 10% »of heat-inactivated fetal serum, 2 mM glutamine and the test substance in a total volume of 2 ml.

Cade test substance is administered for wells in triplicate. The test substances are incubated with the W-20 cells for a total of 96 hours with replacement at 48 hours by the same test means. ^^ At the end of 96 hours, 50 μl of the test medium from each well was removed and tested for osteocalcin production using a radioimmunoassay for mouse osteocalcin. The details of the assay are described in the equipment manufactured by the supplier, Biomedical Technologies, Inc., 378 Page Street, Stoughton, MA 02072. Reagents for the assay were found as product numbers BT-431 (standard for mouse osteocalcin) , BT-432 (goat anti-mouse osteocalcin), BT-431R (iodated mouse osieocalcin), BT-415 (normal goat serum) and BT-414 (goat ani-goat IgG). He RI, paraos teocalcin synthesized by W-20 cells in response to treatment with BMP is carried out as described in the protocol provided by the manufacturer. The values obtained for these test samples are compared with known standards of mouse osteocalcin and the amount of osteocalcin produced by W-20 cells in response to challenge with known amounts of BMP-2. The values for the synthesis of The eocalcin induced by BMP-2 by W-20 cells are shown in Table III.

Table III Synthesis of Osteocalcin by W-20 Cells Concentration of BMP-2 íng / mD Synthesis of Osteocalcin (ng / well) 0 0.8 2 0.9 4 0.8 O 2.2 16 2.7 31 3.2 62 5.1 125 6.5 250 8.2 500 9.4 1000 10.0 Ejepaplo 4. Sampath-Reddi test Modified by Rosen A modified version of the ray bone formation test described in Sampaíh and Reddi, Proc. Nail Acad. Sci .. USA. 80: 6591-6595 (1983) is used to evaluate the activity of BMP proteins for the formation of bone and / or cartilage and / or conecíivo eíjido. This modified test is referred to here as the Sampaíh-Reddi test modified by Rosen. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialysis (if the composition is a solution) or diafiliration (if the 0 composition is a suspension) of the fraction to be tested with water. The solution or suspension is then equilibrated at 0.1% TFA. The resulting solution is added to 20 mg of a rat matrix. A sample of simulated rat mars, not treated with the protein serves as a control. That material is frozen and lyophilized and the resulting powder enclosed in # 5 gelatin capsules. The capsules are implanted subcutaneously in the thoracic area ! 5 abdominal of long male Evans Evans 21-49 days old. The implants are removed after 7-14 days. The size of each implant is used for the analysis of alkaline phosphatases [see, Reddi et al., Proc. Nati Acad. Sci., 69: 1601 (1972)]. The other eye of each implant is fixed and processed for histological analysis. 1 μm of glycidic acid sections are stained with acid fusin and Von Kossa to record the amount of induced formation of bone and cartilage and other connective tissue present in each implant. The terms +1 to +5 represent the area of each histological section of an implant occupied by new bone and / or cartilage cells and matrix. A record of +5 indicates that more than 50% of the implant is new bone and / or cartilage produced as a direct result of the protein in the implant. A record of +4, +3, +2 and +1 would indicate that more than 40%, 30%), 20% > and 10%) respectively of the implant contains new cartilage and / or bone. Alternatively, the implants are inspected to determine the appearance of the embryonic tendon-like appearance, which is easily recognized by the presence of dense bundles of fibroblasts oriented in the same plane and tightly packed together, [tissue similar to tendon-ligament is described, for example, in Ham and Cormack, Hisology (JB Lippincoíí Co. (1979), pp. 367-369, the description of which is incorporated herein by reference.] These findings can be reproduced in additional assays in which tissues Tendon / ligament similarities are observed in implants with the WA545 proiein, WA545 proteins of this invention can be evaluated for their activity in this assay.

EXAMPLE 5 Expression of WA545 In order to produce murine, human or other mammalian WA545 proteins, the encoding DNA is denoted from a suitable and introduced expression vector of mammalian cells or other preferred prokaryotic or eukaryotic hosts mediating conventional techniques of genetic engineering. The preferred expression system for recombinant and biologically active human WA545 is contemplated to be stably transformed mammalian cells. One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1, or other DNA sequences encoding WA545 proteins or other modified sequences and known vectors, such as pCD [okayama et al. ., Mol. Cell Biol., 2: 161-170 (1982)],? JL3, pJL4 [Gough et al., EMBO J. 4M5-653 (1985) and pMT2 CXM. The mammalian expression vector pMT2 CXM is a derivative of p91023 (b) (Wong et al, Science 228: 810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene instead of the resistance gene. tetracycline and also contains an XhoI site for the insertion of cDNA clones. The functional elements of pMT CXM have been described (Kaufman, RJ, 1985, Proc. Nati, Acad. Sci. USA 82: 689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer. , the adenovirus major late promoter including a 5 'splice site and the majority of the adenovirus urinary leader sequence present in adenovirus DNA mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site ( SV40), and pBR322 sequences required for propagation in E. Coli. Plasmid pMT CXM is obtained by digestion with EcoRI of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATTC), Rockville, MD (USA) under accession number ATTC 67122. Digestion with EcoRI part the DNA insert present in pMT2-VWF, producing pMT2 in a linear form that can be ligated and used to transform E. Coli HB 101 or DH-5 for ampicillin resistance. Plasmid DNA pMT2 can be prepared by conventional methods. The pMT2 CXM is then constructed using off / inside circuit mutagenesis (loopoui / in) [Morinaga, et al., Bioiechnology 84: 636 (1984)] this removes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. In addition, the following sequence is inserted: 5 'PO-CATGGGCAGCTCGAG-3' in nucleotide 1145. This sequence contains the recognition site for the Xhol restriction endonuclease. A derivative of pMT2CXM, designated pMT23, contains recognition sites for the restriction endonucleases PstI, EcoRI, SalI and Xhol. Plasmid DNA? MT2 CXM and pMT23 can be prepared by conventional methods. PEMC2ßl derived from pMT21 may also be appropriate in the practice of the invention. PMT21 is derived from pMT2, which is derived from pMT2-VWF. As described above, digestion with EcoRI leaves the cDNA insert present in pMT-VWF, producing pMT2 in linear form, which can be ligated and used to transform E. coli HB 10Í or DH-5 for ampicillin resistance. Plasmid DNA pMT2 can be prepared by conventional methods.

PMT21 is derived from pMT2 through the following two modifications. First, 76 bp of the 5 'region without extraction of the DHFR cDNA including an exage of 19 G residues from the G / C tail for cloning of cDNA is eliminated. In this process, an Xhol site is inserted to obtain the following sequence immediately above of DHFR: '- CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' Psíl EcoRI Xhol i? Second, a single Clal site is produced by digestion with EcoRV and Xbal, irradiation with Klenow fragment of DNA polymerase I, and ligated to a Clal linker (CATCGATG). This removes a 250 bp segment from the RNA region (VAI) associated with adenovirus, but does not interfere with the expression or function of the VAI RNA gene. PMT21 is digested with EcoRI and Xhol and used to derive vector pEMC2B 1.! 5 A portion of the leader EMCV is obtained from pMT2-ECATl [S.K. Jung et al., J.

Viro! 63: 1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 bp fragment. This fragment is digested with Taql producing an EcoRI-Taql fragment of 508 bp that is purified by electrophoresis on a low melting point agarose gel. A 68 bp adapter and its complementary chain are sintered with an exirate of Taql 5 'projection and an Xhol 3' projection ejector that has the following sequence: '-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT Taql GAAAAACACGATTGC-3 '25 Xhol This sequence matches the EMC virus leader sequence from nucleotide 763 to nucleotide 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a Xhol site. A three-way ligand of the EcoRI-XhoI fragment of pMT21, the EcoRI-TaqI fragment of the EMC virus, and the TaqI-XhoI adapter of the 68 bp oligonucleotide adapter resulting in the pEMC2β 1 vector.

This vector contains the replication and enhancer SV40 origin, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripariary leader sequence, a small hybrid intervention sequence, an SV40 polyadenylation signal and the VAI gene of adenoviruses, DHFR and β-lacimamase markers and an EMC sequence, in appropriate ratios to direct the high level expression of the desired cDNA in mammalian cells. The construction of the vectors may involve the modification of the WA545 DNA sequences. For example, the WA545 cDNA can be modified by removing the non-coding nucleoids at the 5 'and 3' ends of the coding region. The deleted non-coding nucleoids may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into host cells suitable for expression of WA545 proteins. Additionally, the sequence of SEQ ID NO: 1 or other sequences encoding WA545 proteins can be engineered to express a mature WA545 protein by removing the pro-peptide sequences encoding WA545 and replacing them with sequences encoding the complete propeptides of other proteins. BMP One skilled in the art can manipulate the sequences of SEQ ID NO: 1 by eliminating or replacing mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (for example, linked to other known or modified linkers by eliminating non-coding sequence from them or by altering nucleoids that are there by means of known techniques). The modified WA545 coding sequence could then be inserted into a known bacterial vector using methods such as that described in T. Taniguchi et al., Proc. Nati Acad. Sci. USA, 77: 5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a WA545 protein expressed in this manner. For a strategy for the production of extracellular expression of WA545 proteins in bacterial cells, see, for example, the European patent application EPA 177,343.

Similar manipulations can be made for the construction of an insect vector [See, for example, the procedures described in the European patent application no. 155,476] for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for the intracellular or extracellular expression of the favors of the present invention by means of yeast cells [See, for example, the methods described in published PCT application WO86 / 00639 and the application European Patent No. 123, 289]. A method for producing high levels of a WA545 protein of the invention in mammalian cells can involve the construction of cells containing multiple copies of the heterologous WA545 gene. The heterologous gene is linked to an amplifiable marker, for example, the dihydrofolate reductase gene (DHFR) for which cells conferring increased gene copies can be selected for propagation at increasing concentrations of methotrexate (MTX) according to the methods of Kaufman and Sharp, J. Mol. Biol. 159: 601-629 (1982). This approach can be employed with a number of different cell types. For example, a plasmid containing a DNA sequence for an A545 proiein of the invention in operative association with other plasmid sequences that make it possible to express it and the expression plasmid pAdA26SV (A) 3 of DHFR [Kaufman and Sharp, Mol . Cell Biol., 2: 1304 (1982)] can be co-introduced with CHO cells deficient in DHFR, DUKX-BII, by various methods including calcium phosphate coprecipiation and transfection, electrophoresis or protoplasm fusion. Iransformanis expressing DHFR are selected to grow in alpha medium with dialyzed fetal serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (eg, sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as described in Kaufman et al., Mol Cell Biol., 5: 1750 (1983). The transformants are cloned and expression of WA545 biologically active is monitored by the rat bone formation assay of Sampath-Reddi modified by Rosen, which was described in Example 4. The expression of the WA545 protein should increase with increasing levels of MTX resistance. WA545 polypeptides are characterized using standard techniques known in the art, such as pulse labeling with [35S] meyionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can. Follow it to get you hear related WA545 proteins.

Ejesmp? O 6. WA545 Biological Activity Expressed 5 To measure the biological activity of the expressed WA545 proteins that were obtained in Example 5 above, the proteins are recovered from the cell culture and purified by isolating the WA545 proteins from other proieinaceous materials with the that they are co-produced, as well as other conies. The purified protein can be tested according to the rat bone formation assay described in Example 4. The purification is carried out using standard techniques known to those skilled in the art. Prolein analysis is carried out using standard techniques such as SDS-F GE acrylamide [Laemmli, Nature 227: 680 (1970)] stained with silver [Oakley, et al., Anal. Biochem 105: 361 (1980)] and by immunoblot [Towbin, et al, Proc. Naíl.Acad. Sci .. USA 76: 4350 (1979)].

Axes plo 7. Northern Analysis of WA545 Using the Northern analysis, WA545 proteins can be tested for their effects on several cell lines. Suitable cell lines include cell lines 0 derived from roots of E13 root. After 10 days of treatment with WA545 protein the cell phenotype is examined histologically to identify indications of tissue differentiation. In addition, Northern blot analysis of mRNAs from WA545 proiein cells can be performed for several markers including one or more of the following markers for bone, cartilage and / or tendon / ligament, as described in Table IV. 25 C Table IV Marker Bone Cartilage Tendon / Ligament Osteocalcin + - - Alkaline Phosphagia + - - Prolein Core Proteoglycan +/- 1 + +/- 2 Collagen Type I + + + Collagen Type II +/- '+ +/- 2 Decorin + + + Elasina +/- 3-? + 1- Marker seen early, marker not seen as mature bone tissue forms 2- Marker depends on the tendon site; stronger at the bone interface 3- Marker seen at low levels.

Example 8. Embryonic Progenitor Cell Assay In order to test the additional effects of the WA545 proteins of the present invention, it is possible to test the effects of in vitro growth and differentiation on a number of available embryonic progenitor cell lines. One such cell line is ES-E14TG2, which is available from the American Type Culture Collection in Rockville, Md. To perform the assay, the cells can be propagated in the presence of 100 units of L? F to preserve them in a state without differentiation The tests are initiated by first eliminating the LIF and adding the cells in suspension, in what is known as embryoid bodies. After 3 days the embryoid bodies are plated on gelatin-coated plates (12-well plates for PCR analysis, 24-well plates for immunocytochemistry) and treated with the proteins to be tested. The cells are supplied with nutrients and treated with the protein factor every 2-3 days. The cells can be adapted so that the assays can be carried out in medium supplemented with 15% Fetal Bovine Serum (FBS) or with defined CDM medium containing much lower amounts of FBS. At the end of the treatment period (ranging from 7 to 21 days) the RNA is harvested from the cells and analyzed by quantitative multiplex PCR for the following markers: Brachury, a marker of mesoderm, AP-2, a marker of ectoderm, and HNF -3a, a marker of the endoderm. Through immunocytochemistry, it is also possible to detect the differentiation of neuronal cells (glia and neurons), muscle cells (cardiomyocytes, skeletal and soft muscle), and several other types of phenotype markers such as proteoglycan core protein (cartilage). ), and cyclokeratins (epidermis). Since these cells have a tendency to differentiate autonomously when the LIF is eliminated, the results are always quantified by comparison to a non-irrational control.

Example 9. In situ Hybridization of WA545 with Xenopus laevis embryos Albino embryos were harvested in several stages for fixation, permeabilized with proieinase K and pre-hybridized. The embryos were then hybridized overnight with riboprobes labeled with digoxigenin. The embryos were washed, irrigated with Rnasa A and TI to remove the background and blocked with Boehringer Mannheim Block Reagent. The embryos were incubated with ani-digoxigenin antibodies conjugated with alkaline phosphatase for four hours at room temperature, washed thoroughly before the chromogenic reaction with alkaline phosphatase subtraction. The embryos were then re-fixed and faded to remove the background for photography. Results: Expression profile The results of the in situ hybridization (Fig. 1) and the development RT-PCR (Fig. 2) show that the WA545 does not have a maternal transcript and is first expressed in late blastula in the complete marginal zone. and in some of the plant cells. The level of expression increases at the beginning of gastrulation. This level of expression is maintained during gasirulation and begins to decline during the last stages of gastrulation. Around the final gásíruia, the expression of WA545 is still present in the lateral and ventral mesoderm but is excluded from the more dorsal region that will form the notocordio. The early expression of this gene in the complete marginal zone and the subsequent posterior restriction correlates well with the conclusion that WA545 is involved in the induction of mesoderm with subsequent characteristics and modifications of neuronal tissue formation.

Example 10. Testing of complex embryos of WA545 Frog embryos were microinjected with 50 pg or 100 pg of inked RNA in vitro, synthesized, in the stages of 2 cells or 4 cells. Β-galactosidase RNA was included as a lineage tracer to determine the extent of diffusion of the injected RNA. IF product of β-galactosidase RNA was visualized hisiochemically, medium dyed X-gal. The objective area of these micro-injections was the marginal dorsal zone or the marginal ventral zone of one of the 2 or 4 cells. The embryos were allowed to develop to desired stages before harvesting for fixation, staining with X-gal and photography. Results: WA545 gain-of-function phenotype in complete embryos 10 Ventral microinjection of early embryos resulted in the formation of a secondary axis in late stages (Figure 3). This secondary axis does not contain a head, implying that the WA545 is an inducer of the posterior mesoderm. The dorsal microinjection of early embryos results in a loss of anterior structures (Figure 4) including cementum gland (chin), incubation gland, eyes and prosencephalon. This observation i 5 indicates that the WA545 can convert aniiorior tissue to more posterior tissue.

Ej enripio II. Animal helmet test Embryos were injected with 50 to 400 pg of RNA encasquillado in the animal pole of a cell in stage of 2 cells. Globin RNA was used as control. The 2C embryos will be developed until stage 8. Embryonic animal pole cells were microdisecaclos (animal helmets) and cultured until embryos without injection, intact and fraternal reached stages 14 or 19. 15 animal helmets microinjected with the same RNA (experimental globin) were accumulated for the preparation of total RNA. 5 intact embryos were used for the preparation of embryo control RNA complete. These RNA samples were reverse transcribed using random hexamer as primers for cDNA. These DNA samples were subjected to PCR using pairs of gene-specific primaries in the presence of 32P-dCTP for assay for the purpose of determining the presence of corresponding mRNAs in the original RNA samples. The pairs of used primaries and the number of cycles for each pair were previously optimized. The products of these PCR reactions were subsequently resolved on polyacrylamide gels. Results: Animal hull function gain test Examination of a panel of molecular markers indicates that most markers of mesoderm are induced in animal helmet tests (Figure 5). These markers include brachyury, Pintallavism Xnot and muscle actin. Histologically, large blocks of muscle are formed. Of the neural markers examined, Krox20 is not induced whereas HoxB9 is. Krox20 is normally expressed in rhombomeres 3 and 5 and HoxB9 is expressed in the posterior spinal cord. These results indicate that WA545 induces posterior mesoderm, whereas the anterior mesoderm (goosecoid) and neural genes (NCAM) are not activated. This, again, leads to support the idea that the WA545 is an inducer of the mesoderm of later characteristics, and can modify the neural destinies of the brain towards the spinal cord.

Example 12. Summary of Results for WA545 The WA545 is expressed from the tardy blastula through the entire mesoderm and endoderm. It is expressed later in the later mesoderm. It is able to efficiently induce the posterior and lateral mesoderm, including muscle. In this way, WA545 may be involved in the formation of posterior regions and may be useful for the ecyopic activation of muscle and spinal cord development.

The foregoing description details currently preferred embodiments of the present invention. Numerous modifications and variations in the practice of it are expected to occur to those skilled in the art when considering this description. Those modifications and variations are part of the present invention and are believed to fall within the appended claims thereto.

The description of all publications and patent applications that are cited in this description by means of the present are incorporated as references for the description herein contained.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: Racie, Lisa A. LaVallie, Edward R. Sive, Hazel Sun, Benjamin (ii) TITLE OF THE INVENTION: Compositions of WA545 (iii) NUMBER OF SEQUENCES: 10 (iv) ADDRESS FOR CORRESPONDENCE: (A) SENDER: GENETICS INSTITUTE, INC. (B) STREET: 87 CAMBRIDGEPARK DRIVE (C) CITY: CAMBRIDGE (D) STATE: Massachusetts (E) COUNTRY: USA (F) POSTAL CODE: 02140 (v) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIA: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (vi) DATA OF THE CURRENT APPLICATION: (A) NUMBER OF APPLICATION: US TBD (B) DATE OF SUBMISSION: July 10, 1997 (C) CLASSIFICATION: (viii) INFORMATION OF THE APPORTER / AGENT: (A) NAME: Lazar, Steven R. (B) REGISTRATION NUMBER: 32,618 (C) REFERENCE NUMBER / RECORD Gl 5292 (ix) INFORMATION FOR TELECOMMUNICATIONS: (A) TELEPHONE: (617) 498-8260 (B) TELEFAX: (617) 876-5851 ( 2) INFORMATION FOR SEQ ID NO.:l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1554 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 55 ... 1119 (ix) CHARACTERISTICS: (A) NAME / KEY: sig_peptide (B) LOCATION: 55 ... 774 (ix) FEATURES: (A) NAME / KEY: mat_peptid? (B) LOCATION: 775 ... 1119 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l: GAATTCCCAT AGCAACAAAC AGTACCCATA GCAACAAACA GTAGAGAAGT CAAC ATG 57 Met -240 GCA GG TTG TGG CTA TCA CTT TCT TGC ATG TTC TCC TTG CTT CTA CTG 105 Wing Glu Leu Trp Leu Ser Leu Ser Cys Met Phe Ser Leu Leu Leu Leu -235 -230-225 ACÁ AAT TCA TCT CCA CTT ACC TTC CAG GAA AGA ATG CTC CTT AAA GCC 153 Thr Asn Ser Pro Leu Thr Phe Gln Glu Arg Met Leu Leu Lys Wing -220 -215 -210 TTG GGG CTG AAC ACC AGA CCA AAC CCC ATT GCT CCA GCT CCT GTA CCT 201 Leu Gly Leu Asn Thr Arg Pro Asn Pro lie Pro Wing Pro Val Pro -205 -200 -195 AAA TCT TTA AGA GAC ATT TTT GAG AAG GGG ATA AAC CAG GAC AAT CCC 249 Lys Ser Leu Arg Asp lie Phe Glu Lys Gly lie Asn Gln Asp Asn Pro -190 -185 -180 TGC ATG ATG GAA GGT TTC GGA GTA CCT GGA AAT ATT GTC CGC TCA TAT 297 Cys Met Met Glu Gly Phe Gly Val Pro Gly Asn lie Val Arg Ser Tyr -175 -170 -165 -160 CGA GAT CAGA GGA ACC ATA GCA GCC ATA GAG GAG CCA CAGA GGA TCT CTG 345 Arg Asp Gln Gly Thr lie Ala Ala lie Glu Glu Pro Gln Gly Ser Leu -155 -150 -145 TGC TTA AAG AAA TTT CTC TTT TTAC GAC CTA TCA GCA GTG GAG AAC AAG 393 Cys Leu Lys Lys Phe Leu Phe Phe Asp Leu Ser Wing Val Glu Asn Lys -140 -135 -130 GAG CA TTG ACC CTA GGC CAÁ CTG GAA ATT AAG TTC AAG CAC AAC ACÁ 441 Glu Gln Leu Thr Leu Gly Gln Leu Glu lie Lys Phe Lys His Asn Thr -125 -120 -115 TAT TAT GGA CA CAG TTC CAT CTC CGC CTC TAC CGC ACC CTT CAG CTA 489 Tyr Tyr Gly Gln Gln Phe His Leu Arg Leu Tyr Arg Thr Leu Gln Leu -110 -105 -100 TCT CTA AAA GGG ATG AGA GAC AGC AAG ATG AAC AGG AAG CTC CTG GTG 537 Ser Leu Lys Gly Met Arg Asp Ser Lys Met Asn Arg Lys Leu Leu Val -95 -90 -85 -80 D.

ACT CAG TCT TTC CGT CTC CTT CAC AAG TCC CTC TAT TTC AAC TTG ACC 585 Thr Gln Ser Phe Arg Leu Leu His Lys Ser Leu Tyr Phe Asn Leu Thr -75 -70 -65 AAG GTG GCA GAG GAC TGG AAA AAC CCT GAG AAG AAT ATG GGT CTG ATA 633 Lys Val Wing Glu Asp Trp Lys Asn Pro Glu Lys Asn Met Gly Leu lie -60 -55 -50 CTG GAA ATA TAT GCA AGC AGT GAA CTT GCA GGA GGC AAT CGA TCA TTT 681 Leu Glu He Tyr Ala Be Ser Glu Leu Wing Gly Gly Asn Arg Ser Phe -45 -40 -35 GTA GTA TGTA GAA CCA ATA CAG TCT TTC ATT TAC ACT TCT CTG CTC ACT 729 Val Val Cys Glu Pro He Gln Ser Phe He Tyr Thr Ser Leu Leu Thr -30 -25 -20 GTG TCC CTA GAC CCA TCC AAT TGC AAA ACT CAG CGA GCC AAG AGG AGT 777 Val Ser Leu Asp Pro Ser Asn Cys Lys Thr Gln Arg Ala Lys Arg Ser -15 -10 -5 1 ACT CAT TCA TCA CCT CCA ACC CCA AGC AAT ATC TGC AAG AAA AGG AGA 825 Thr His Ser Ser Pro Pro Pro Ser Asn He Cys Lys Arge Arg 5 10 15 TTG TAC ATT GAC TTC AAG GAT GTT GGA TGG CAG AAC TGG GTC ATT GCA 873 Leu Tyr He Asp Phe Lys Asp Val Gly Trp Gln Asn Trp Val He Wing 20 25 30 CCC CGT GGT TAC ATG GCA AAC TAC TGC CAT GGA GAG TGC CCC TAT CCA 921 Pro Arg Gly Tyr Met Wing Asn Tyr Cys His Gly Glu Cys Pro Tyr Pro 35 40 45 CTG ACG GAA ATG CTA AGG GGC ACA AAT CAT GCT GTT TTA CAG ACT CTG 969 Leu Thr Glu Met Leu Arg Gly Thr Asn His Wing Val Leu Gln Thr Leu 50 55 60 65 GTG CAT TCT GTA GAA CCA GAA AAC ACC CCA TTG CCT TGC TGT GCC CCC 1017 Val His Ser Val Glu Pro Glu Asn Thr Pro Leu Pro Cys Ala Pro 70 75 80 ACT AAG CTG TCT CCT ATC TCC ATG CTA TAT TAT GAC AAC AAT GAC AAT 1065 Thr Lys Leu Ser Pro He Met Met Leu Tyr Tyr Asp Asn Asn Asp Asn 85 90 95 GTG GTA CTG AGG CAC TAT GAA GAT ATG GTA GTG GAT TGG GGT TGC 1113 Val Val Leu Arg His Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys 100 105 110 AAG TGA GTTTGCTTTG GAGATTGTTC TCATTCCCTT ATCTAAGCCT TAAACTTATC 1169 Lys * 115 CTCTAAAGGG ACTGCTGCCA ACCTAGTTAT GAAGCCTCGC GCCTCGTGCG ACAGTGACTT 1229 TAACCATCTT ACATAACATT AATTGATAAG ACTATATTTA TTTTGGGGTG TACTTGCCCT 1289 TTAGGTGGTT TGGCAAATGC CATGCGTGGC TCTTAACAGA GCTGCTGGAT GAAACACATT 1349 TTTAAAAAAG TATATTGTTG TCAATAAATG TTTTTATCTT TATATATTGG GCATAGAGCT 1409 AGGTTGGTGC CTGAAAATTG CCTAGCACTT GCAAGTACAG CTGATTGTTG GAAATAAATG 1469 TGATTTAACC CAAAAAAAAA AAAAAAAAAA AAAAAAAAAAA AAAAAAAAAAA AAAAAAAAAA 1529 AAAAAAAAAA AAAAAAAAAA TCGAG 1554 (2) INFORMATION FOR SEQ ID NO.:2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 355 amino acids (B) TYPE: amino acids (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) ) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: Met Wing Glu Leu Trp Leu Ser Leu Ser Cys Met Phe Ser Leu Leu Leu -240 -235 -230 -225 Leu Thr Asn Ser Ser Pro Leu Thr Phe Gln Glu Arg Met Leu Leu Lys -220 -215 -210 Wing Leu Gly Leu Asn Thr Arg Pro Asn Pro He Wing Pro Wing Pro Val -205 -200 -195 Pro Lys Ser Leu Arg Asp He Phe Glu Lys Gly He Asn Gln Asp Asn -190 -185 -180 Pro Cys Met Met Glu Gly Phe Gly Val Pro Gly Asn He Val Arg Ser -175 -170 -165 Tyr Arg Asp Gln Gly Thr He Ala Wing He Glu Glu Pro Gln Gly Ser -160 -155 -150 -145 Leu Cys Leu Lys Lys Phe Leu Phe Phe Asp Leu Ser Wing Val Glu Asn -140 -135 -130 Lys Glu Gln Leu Thr Leu Gly Gln Leu Glu He Lys Phe Lys His Asn -125 -120 -115 Thr Tyr Tyr Gly Gln Gln Phe His Leu Arg Leu Tyr Arg Thr Leu Gln -110 -105 -100 Leu Ser Leu Lys Gly Met Arg Asp Ser Lys Met Asn Arg Lys Leu Leu -95 -90 -85 Val Thr Gln Ser Phe Arg Leu Leu His Lys Ser Leu Tyr Phe Asn Leu -80 -75 -70 -65 Thr Lys Val Wing Glu Asp Trp Lys Asn Pro Glu Lys Asn Met Gly Leu -60 -55 -50 • He Leu Glu He Tyr Wing Being Ser Glu Leu Wing Gly Gly Asn Arg Being -45 -40 -35 Phe Val Val Cys Glu Pro He Gln Ser Phe He Tyr Thr Ser Leu Leu -30 -25 -20 Thr Val Ser Leu Asp Pro Ser Asn Cys Lys Thr Gln Arg Wing Lys Arg -15 -10 -5 Ser Thr His Ser Ser Pro Pro Thr Pro Ser Asn He Cys Lys Arg 1 5 10 15 Arg Leu Tyr He Asp Phe Lys Asp Val Gly Trp Gln Asn Trp Val He • 20 25 30 Wing Pro Arg Gly Tyr Met Wing Asn Tyr Cys His Gly Glu Cys Pro Tyr 35 40 45 Pro Leu Thr Glu Met Leu Arg Gly Thr Asn His Wing Val Leu Gln Thr 50 55 60 Leu Val His Ser Val Glu Pro Glu Asn Thr Pro Leu Pro Cys Cys Wing 65 70 75 80 Pro Thr Lys Leu Ser Pro He Met Met Leu Tyr Tyr Asp Asn Asn Asp 85 90 95 Asn Val Val Leu Arg His Tyr Glu Asp Met Val Val Asp Glu Cys Gly 100 105 110 • Cys Lys' •• 115 (2) INFORMATION SEQ ID N0.:3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: GAAAGTGATA GCCACAACTC TGCCATG 27 (2) INFORMATION FOR SEQ ID NO.:4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs F (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO:: GATTTAGGTA CAGGAGCTGG AGCAATG 27 (2) INFORMATION FOR SEQ ID NO .: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 7 amino acids ^ (B) TYPE: amino acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: Trp Xaa Xaa Trp He Xaa Wing 1 5 (2) INFORMATION FOR SEQ ID NO .: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: GCGGATCCTG GVANGABTGG ATHRTNGC 2 ( (2) INFORMATION FOR SEQ ID N0.:7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: sn His Ala He Xaa Gln Thr 1 5 (2) INFORMATION FOR SEQ ID NO.:8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) TYPE CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 8: GCTCTAGAGT YTGNAYNATN GCRTGRTT 28 (2) INFORMATION FOR SEQ ID NO.:9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEO ID NO: 9: AGTACTCATT CATCACCTCC 20 (2) INFORMATION FOR SEQ ID NO.:10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEO ID NO: 10: CTTGCAACCA CACTCATCCA 20

Claims (29)

1. Novelty of the ñmvemcñón 1. An isolated DNA sequence that codes for a WA545-related protein that comprises a DNA sequence selected from the group consisting of: (a) nucleotides # 55, # 775 or # 811 to nucleotide # 1113 or # 1116 as shown in SEQ ID NO: 1; (b) sequences that hybridize to (a) under hybridization conditions astringents and that code for a prolein that exhibits WA545 activity. 2. An isolated DNA sequence encoding WA545 protein comprising a DNA sequence selected from the group consisting of: (a) nucleotides encoding amino acids # -240, # 1 or # 13 to the nucleoid # 113 or # 114 as shown in SEQ ID NO: 2; (b) sequences that hybridize to (a) under hybridization conditions that are thus enriched and that code for a prolein that exhibits WA545 activity. 3. A neighbor comprising a DNA molecule of claim 1, in operative association with an expression control sequence for it. 4. A vector comprising a DNA molecule of claim 2, in operative association with an expression control sequence for it. 5. A host cell transformed with the vector of claim 3. 6. A host cell transformed with the vector of claim 4. 7. An isolated DNA molecule having a coding sequence for a protein that is characterized by the ability to induce the formation of mesoderm or related entity, said DNA molecule comprising a DNA sequence selected from the group consisting of: (a) nucleotides # 55, # 775 or # 811 to nucleotide # 1116 as shown in SEQ. ID NO: I; and (b) allelic sequences that occur naturally and equivalent degenerative codon sequences. C. A vector comprising a DNA molecule of claim 7, in operative association with an expression control sequence for it. 9. A host cell transformed with the vector of claim 8. 10. An isolated DNA molecule encoding WA545 protein, said DNA molecule comprising nucleotides encoding an amino acid sequence comprising amino acids # -240, # 1 or # 13 to # 114 as shown in SEQ ID NO: 2 . 11. An isolated DNA molecule according to claim 10, further comprising a nucleotide sequence encoding a propeptide suitable 5 'for and ligated in frame to the DNA coding sequence. 12. A vector comprising a DNA molecule of claim 1 in operative association with an expression control sequence for it. 13. A host cell transformed with the vector of claim 12. 14. A method for producing purified WA545 protein, said method comprising the steps of: (a) culturing a transformed host cell with a DNA sequence according to claim 1 , comprising the nucleotide sequence encoding WA545 protein; and (b) recovering and purifying said WA545 protein from the culture medium. 15. A method for producing purified WA545 protein, said method comprising the steps of: (a) culturing a transformed host cell with a DNA sequence according to claim 2, comprising the nucleotide sequence coding for proiein WA545; and (b) recovering and purifying said WA545 protein from the culture medium. the. A method for producing purified WA545 protein, said method comprising the steps of: (a) culturing a transformed host cell with a DNA sequence according to claim 7, comprising the nucleotide sequence coding for proiein WA545; and (b) recovering and purifying said WA545 protein from the culture medium. 17. A purified WA545 polypeptide, which comprises an amino acid sequence, consists essentially of the amino acids encoded by the DNA sequence of SEQ ID NO: 1, wherein said DNA polypeptide exhibits WA545 activity. 18. An WA545 polypeptide of claim 17, wherein said amino acid sequence comprises a functional fragment of the DNA sequence of SEQ ID NO: 2, wherein said DNA polypeptide exhibits WA545 activity. 19. A purified DNA polypeptide of claim 17, wherein said polypeptide is a dimer in which each subunit comprises an amino acid sequence consisting essentially of the amino acid sequence from amino acid # 1 to # 1 14 of SEQ ID NO.
2. 2. A purified DNA polypeptide of claim 17, wherein said polypeptide is a dimer in which a subunit comprises an amino acid sequence from amino acid # 1 to # 114 of SEQ ID NO: 2, and a subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, BMP-8, BMP-9, BMP -10, BMP-1 1, BMP-12, BMP-13, BMP-14, BMP-15 and BMP-16. 21. A purified WA545 protein, produced by the steps of: (a) culturing a transformed cell with a DNA comprising the nucleoid sequence from nucleotide # 775 to nucleotide # 1116 as shown in SEQ ID NO: i; and (b) recovering and purifying from the culture medium a protein comprising the amino acid sequence from amino acid # 1 to # 114, as shown in SEQ ID NO: 2. 22. A composition comprising a therapeutic amount of when less a WA545 protein according to claim 17. 23. The composition of claim 22, further comprising a matrix for supporting said composition and providing a surface for the induction of tissue growth. The composition of claim 23, wherein said matrix comprises a material selected from the group consisting of hydroxyapatite, hyaluronic acid, collagen, dolinactic acid and tricalcium phosphate. 25. A method for induction of tissue formation in a patient that requires it, which comprises administering to said patient an effective amount of the composition of claim 22. 26. A chimeric DNA molecule, which comprises a sequence of DNA encoding a propeptide from a member of the protein TGF-β superfamily, ligated in correct reading frame to a DNA sequence encoding a WA545 polypeptide. 27. A purified WA545 protein comprising the amino acid sequence from amino acid # 1 to amino acid # 114 of SEQ ID NO: 2. 28. A purified WA545 protein having an average molecular weight of about 10-15 kd in form monomer, said protein comprising the amino acid sequence of SEQ ID NO: 2 and possessing the ability to induce the formation of mesoderm. 29. Antibodies for a purified WA545 protein according to claim 17.