MXPA00003479A - Means for qualitative and quantitative analysis of microbial populations potentially present in a sample - Google Patents

Abstract

This invention relates to means of qualitative and quantitative analysis of microbial populations potentially present in a sample. These means notably comprise the use of at least one RNA-targeted oligonucleotide probe for in situ hybridization in whole cells;followed by the extraction of those probes which have become hybridized by separation from their target and elution from the microbial cells;as well as the detection and measurement of said extracted probes.

Description

MEANS FOR THE QUALITATIVE ANALXSXS XL CLLAN.TJLTAT.iyO OF MICROBIAL POPULATIONS POTENTIALLY PRESENT IN A SAMPLE DESCRIPTION OF THE INVENTION The jSeate j_av_2mci.au can sex -describes in general as a means of qualitative and quantitative analysis of microbial populations po sentially present in a sample. More specifically, it is related to a medium d = qualitative and quantitative analysis using probes. of oligonucleotide targeted to RNA. Analysis of potentially present microbial populations is required for many types of solid and fluid samples. Some, notably, are samples obtained from a natural or biological environment such as natural water or hot springs. .. samples taken from humans or animals such as blood, vaginal and intestinal a ± re; and samples of urban, agricultural and industrial environments such as food products, industrial water, industrial effluents, municipal wastewater, industrial sludge, media, aerosols, air or air conditioning systems. Several laboratory techniques have been developed for the qualitative and quantitative analysis of microbial populations potentially present in a given sample. A family technique involves a count of the microorganisms that develop after the sample (or an extract thereof) is cultured on several selective nutrient media under standard conditions: This technique is simple but carries with it sJ.gnific risks. ti.os de arror.es and artifacts tb ja morphological criterion specificity, inability to detect viable but non-culturable microorganisms, inability to., detect slow-growing microorganisms, need to maintain the viability of bacteria between collection and enumeration) . On the other hand, this technique usually requires more than 24 hours to provide results. A second technique, which involves measuring the activity of one or more enzymes, allows a rapid quantification of populations of living microbes (arable microorganisms and / or microorganisms in a viable but not arable form). . Ks.ta. technique can be used, in particular, to monitor a set of populations, but not alcaaza. very levels. high specificity or sensitivity.

A third technique that uses immunological probes often requires a growth stage, and thus requires more than 24 hours to provide results. On the other hand, it often lacks both, sensitivity and specificity (there may be an identification error due to cross reactions). The most recent techniques are damaged in the use of specific DNA probes, which are usually marked for .p. rpi i.tir detection after hybridization with its objectives. Two major categories of oligonucleotide pathways have been developed: those targeting DNA and those targeting .aRNA (ribosamic RNA and A &N messaging) ... JSO2aá3 S targeting ADL, although potentially,. highly specific, have the disadvantage of low sensitivity due to the few .copies of the target DNA genes in each microbial cell .. Although the use of PCR (r.eaccin an polymerase chain) to amplify the DNA sequences If the objective of the detection can be due to the lack of sensitivity of the DNA probes, it has several disadvantages of its own. For example, the presence of inhibitors can give rise to false negative reactions, while the contamination by handover or the like can lead to false positive reactions. In contrast, the use of directed probes R prevents such drawbacks. In particular, due to the large number of rRNA copies that pyi sfe natuxaimente in a microorganism (cells that grow actively can contain 104 ribosomes, each one a potential target of the probe), the use of probes directed to rRNA does not require the amplification stage, surpassing by means of these rnns ri r.cínnsa and artifacts associated with this. The advantage of targeting the rRNA is that about 85-90 percent of the total RNA in a typical cell is rRNA. Hybridization of RNA-directed secrets can be achieved either after cell lysis, extraction and purification of the total samples of the sample, or in situ on whole cells, generally after fixation (permeabilization). of the membrane (or wall) of potent microorganisms present in the sample. However, cell lysis and the consequent extraction and purification of nucleic acids, particularly total RNA, are delicate and time-consuming manipulations. which require expensive apparatus, prepared preparation and experimental conditions, strict, notably the prevention of contamination by nucleases during the procedure. This technique also involves the use of a solid support, such as a membrane. On the 1st the purified nucleic acids are immobilized in such a way that one can discriminate among them (for example dot-dlot- "," slot-blot "). This also involves the use of radioactive probe marks and handling, of which special care is required.

The technique of ü = is cellular for the hybridization of .RNA is therefore incompatible with its use in routine analysis either in the industry or in biological laboratories. Hybridization .in .s.it.u in whole cells overcomes the need for a preliminary extraction of nucleic acids. Objective by cellular analysis with all its associated disadvantages. The FISH (In Situ Jluor ^ scented Hybridization) process, which uses fluorescently labeled rARJJ probes, is an existing in situ technique.This type of technique, which generally involves fluorescence microscopy, provides a rapid and qualitative analysis. Now, the probes directed to rRNA thus hybridized in situ with their target inside complementary cells can be quantified directly on the sample (flow cytometry, microscopy), although the method It is not entirely satisfactory: the quantification directly on the sample is technically, easy, requires a long time, requires trained staff and does not allow a precise quantification of the hybridized probes = when the sample is complex and not uniform (. for example, filocles or aggregates, formed by filamentous bacteria, in drainage water treatment sludges, samples that contain microorganisms naturally fluently assent) As a result, the technique of in situ hybridization in whole cells using probes labeled oii onucleétides Flue es_cencia has remained. to date, as an essentially qualitative technique that provides reliable quantitative results. To address the need for industrial-grade efficiency on samples that may be complex and / or non-uniform, this invention provides a means to analyze, both qualitatively and quantitatively, the microbial populations potentially present in a biological sample. , the medias - overcome the disadvantages of prior art techniques. The object of this invention is, therefore, a method of qualitative and quantitative analysis of the microbial population (s) potentially present in a characteristic sample because it comprises L - contacting microorganisms presently present in the sample with at least one RNA-directed oligonucleotide probe, hereinafter called a specific probe, capable of targeting a desired microbiological population, under favorable conditions for in situ hybridization. whole cells, extract, by separation of their target and lution outside the cells,., which causes aandas that have become hybridized., - detect the extracted probes and measure the quantity of the same, or their respective amounts. The present invention thus allows the extraction of the probes without destruction of the cells. The term "microbiological population" or "microbiological domain" is used to mean the set of micro-organisms that a given path is a layer. to recognize by recognition of an ABU target sequence present in each member of the set. The approach is based on oligonucleotide hybridization probes complementary to AREL sequences that are diagnostic for selected phylogenetic groups that correspond, in varying degrees, to a typical target region of a microorganism type or a whole group of microorganisms. Any probe that allows the contact stage is appropriate for the implementation of the method according to the invention. " The selection of the specific probe (s) is directly related to the desired analysis for the sample. The probes can for example be composed of sequences of oligonucleotides that can distinguish between the primary realms (eukaryotes, eubacteria, archaebacteria) and among closely related organisms (the group of β-Proteobacteria that oxidize ammonia, the genus Nitrobacter or Acinetobacter or the species Fibrobacter intestinalis, the species Escherichia coli). Probes with finer phylogenetic resolution can be derived using existing collections of RNA sequences. Many examples of such probes targeting RNA are described in the prior art, such as patents or patent applications, scientific publications, for example. Reyes et al., 1997, Appli Environ. Microbiol. Vol »63, No. 3, pages 1107-1117; Mobarry et al., 1996, Appli. Environ. Microbiol. Vol. 62, No. 6, pages 2156-2162; Wagner et al., .1994, Appli. Hnviron ^ Microbiol .. al-60, No. 3, pages 792-800; Kane et al., Appli. Environ. Mlaroblal ^ Vol. 59, No. 3, pages 682-686-Other examples of such probes may also be designed by the person skilled in the art. Advantageous probes are those that target ribosomal RNA (rRNA). Examples of such advantageous directions include NblOOO (SEQ ID No. 1) and No. 1225 (SEQ ID Ne. 2). The method of the invention provides particularly accurate quantitative results when the numbers of cells in the sample are equal to or greater than about 10 3 or 10 4 cells per ml. If desired, the concentration of microarrays of a liquid sample can be increased by filtration or any other technique prior to implementing the syrup of the invention. In a preferred embodiment of the invention, the microorganisms potentially present in the sample are also contacted with at least one probe, hereinafter referred to as "universal probe", which serves to normalize the results obtained with probes directed to groups. phylogenetic specific microorganisms ("probes e pecificas".)., the amount of a specific probe in the sample can then be expressed as a ratio of the amount of the universal probe. Such. The universal probe can thus allow the expression of, for example, the specific target RNA as a percentage of the total rRNA. Examples of such "universal probes" include specific probes for any microorganism, or probes specific for bacteria, or for eukaryotes. .laies "universal probes" are well known in the art, and any one of them can be used, always j and when it allows the contact stage, and allows the normalization of the "specific probe". in the method of. according to the invention in a similar manner as a "specific probe" and therefore is advantageously a probe directed to rRNA. It may be advantageous to extract the microorganisms potentially present in the sample thereof, in particular by centrifugation, before proceeding with any stage of the method of the invention. One reason to proceed in this way is to eliminate the background noise that a sample of complex composition can generate. Another can be placed in a liquid, the microorganisms ... potentially present in a solid, gaseous or viscous sample. According to one embodiment of the invention, the contact stage is carried out after the cells are made to undergo a fixation step (or permeabilization step) essential to maintain their integrity. morphological, and that makes the microorganisms potentially present in the permeable sample to short probes of oligonucleotides (around 15-25"nucleotides) .This stage of fixation allows the probes to penetrate inside the microbial cells without affecting the integrity of the same, reaching through this its objective or objectives in situ.Where applicable, the sample is hogenated before the fixing stage, so that the at least one probe has access to all the microbial populations, potentially present in The fixation is advantageously broken -including the cells in a paraformaldehyde solution that is smaller than 10%, preferably around 4%, for 3 to 12 hours at 4 ° C. This fixing method is more particularly adapted. For Gram-negative bacteria For certain Gra-positive bacteria, the fixation stage can be loug-ada by concentrating the cells in a 100% ethanol solution. to the iija.tion,. Cells can be recovered for example by centrifugation and stored until use at -20 ° C in a buffered solution at a pH of about 7 (buffer solution of PBS, for example.) containing about 5Q. of ethanol. In a preferred arrangement of this modality of. the invention »the fixation is followed by a dehydration step (or drying stage) before the contact lase. The stage- of. de-hldra.tacion can thus be carried out by placing the sample in contact with at least one. ethanol solution, preferably with a series of ethanol solutions of increasing concentration for example by placing the sample in a 70%, 80% and then 95% ethanol solution. Advantageously, the phase of. contact is made by contacting the at least one probe in the presence of a solution hereinafter called "hybridization solution", comprising a denaturing agent such as sodium dodecyl sulfate (SUS) in a concentration in a range of 0.001-0.1_. . Preferred in the order of 0.01%; Tris-HCl, pH of about 8 in a concentration in the range of Q.sub.1 Q.sub.1 -Q.sub.M, preferably of the order of 0.02 M; and a ..sal. to the co.chloro of _sodium at a concentration in. a range of 0.1-1.5 M, preferably of the order of 0.9 M. Such contact is advantageously carried out for an incubation time comprised between about 1Q minutes and about 2 hours, and at a hybridization temperature, which is preferably, the. optimum temperature. For each oligonucide probe, the limitation conditions (temperature, 'salt concentration and denaturing agent) can actually be optimized to improve the specificity of the oligonucide probe for the corresponding RNA sequences found in target cells.

When a plurality of oligonucleotide probes are used simultaneously, these hybridization conditions can be selected to take into account the optimal conditions peculiar to each probe. It is very advantageous that the extraction of the at least one probe is carried out following the elimination of the BÍ C ^ J .0 and the unbound probe, or of the associated probe material not specifically placed in contact, notably by washing with a solution in the so-called "washing solution" »Tal "wash solution" advantageously includes a denaturing agent such as sodium dodecyl sulfate (SDS), in a concentration in a range of 0.001- Q-l%,. substantially of the order of Q.02%; Tris-HCl, pH of about 8 in a concentration in a range of 0.001-0.1 M, preferably of the order of 0.02 M and a salt such as sodium chloride in a concentration in a range of Q_.Ql-0.-9 M, preferably of the order of Q »l M > The formulation of the "wash solution" (eg, nature and / or concentration of the -sal and the denaturant) is adjusted to achieve the appropriate astringency; that is, the astringency necessary for the elimination of the probe associated specifically with it. Thanks to such a washing step, the extraction stage will be performed only on those probes that have reached TLX effectively hybridized to the desired target (s). According to a preferred embodiment of the invention.,. the. Extraction is performed by placing the microorganisms potentially present or conditions to denature, which allow the denaturation of any probe specifically associated with its target sequence, notably in the presence of a denaturing agent of the probe-objective, such. as one that will separate DNA / DNA or DNA / RNA duplex, and in particular the probe-target duplex under consideration, and at a temperature higher than the melting temperature the probe under consideration, notably at a temperature of about 100 ° C According to a particularly preferred embodiment of. In the invention, the denaturing agent is the formamide-extraction. It is then performed incubating the microorganisms in formamide at 100 ° C. for 10 minutes, using a controlled temperature incubator. The supernatant can then be recovered for quantification, for example by centrifugation. To improve detection, the extracted probes can be significantly concentrated using a Speed-VacMR before measuring the corresponding amount of cad-sonda. The detection of a probe hybridized to the target and the measurement of its quantity thus gives a qualitative and quantitative analysis of the set of target microorganisms present in the sample- üs advantageous ..- perform the detection and measurement of the quantity of, the probes extracted by Detection and measurement of the amount of a mark associated with or incorporated into each of the probes placed in contact, such as a radioactive (P, 35S,, 125 I), chemiluminescent or fluorescent label,. respective quantities of san probes then measured by quantification of the corresponding mark. It is particularly advantageous to use a fluorescent label, notably fluorine, escein, which can be easily quantified using a fluorescence spectrophotometer. Different probes, for example, specific probe (s) and / or universal probe (s), can be placed in separate samples, or in the same sample - in the latter case, it is possible to distinguish each probe used from the others during the detection step, for example by giving each its own specific mark (for example different fluorochromes). The method of the invention can be applied to a variety of samples - the samples for which the analysis is using the method of the invention is of particular interest include those taken from fluids such as natural water, industrial water, effluents industrial, municipal wastewater, industrial sludge, thermal mud, liquid or food gel, fermentation medium, air, gas, aerosol; samples of a building vent, or air conditioning duct; samples of edible solid, soil, * samples of medical devices, human or animal samples such as blood, urine, vaginal or intestinal flora. The method of the invention uses neither microbiological culture, nor microscopy, nor an amplification stage in vitro (as PCR), and does not require any stage of cell lysis. It is reproducible, simple, fast (less than 3 oras), inexpensive and does not require specially prepared personnel. The method of the invention offers the additional advantage of being easy to automate. The method of the invention nobly provides a qualitative and quantitative measurement of the microbiological or sanitary status of ± 3. shows and consequently ^ of the product from which the sample was taken- E.1 method of the invention can therefore advantageously be combined with an alarm function related to the. quality, safety and / or sanitary monitoring of the product from which the sample is taken, notably as part of an industrial production line. When the threshold value or reference point is exceeded, the method of the invention allows the quality, safety and / or corresponding alarm to be activated. It also allows the automatic or feedback control of a microbiological elimination or enrichment process. This invention also relates to the application of the method to the in vitro diagnosis of infectious diseases. Beyond the applications of the types of "state or condition measurement" and "alarm", this invention relates in particular to the application of the method for automatic or feedback control. of microdiolegieos processes such as methane fermentation of liquid fertilizer, treatment of organic effluents, treatment processes to drainage waters such as a treatment of activated sludge, or the aitomáfics or feedback control of a process aimed at eliminating or preventing the growth In this way, the method of the invention can advantageously be applied to the detection of foaming during the implementation of activated sludge processes and / or 3.1 control of the feed back of a process to eliminate or prevent the I development of such foams. Other aspects and advantages of the invention will become apparent in the following example modalities, which are given for illustrative and non-limiting purposes.

EXAMPLE 1: qualitative analysis and jejoanti ta.ti JO of an effluent sample from a dye water treatment reactor a) Fixation stage Effluent samples from activated sludge reactors were mixed from wastewater treatment, and then washed three times using a phosphate buffer solution (phosphate buffered saline, PJ3S) at pH 7- The sample was then incorporated into three volumes of a 4% paraformaldehyde solution, and incubated for 3 to 12 hours at 4 ° C. C. following a. the. centrifugation, the supernatant was removed, and the sample was again mixed with phosphate buffered saline (PBS) at pH 7. An equal volume of ethanol was added, and the sample can be stored at -20 ° C until its. use. b) Dehydration step The fixed sample was subjected to centrifugation after adding 1 ml of 70% ethanol on the residue and the cells were resuspended - the mixture was subjected to. centrifugation for 5 minutes, and then the supernatant was removed. Jvl procedure was repeated with 80% ethanol, and then again using 35% ethanol. c) Hybridization step A water bath was prepared at the hybridization temperature required by the probe being used (the temperature depends on the length and sequence of the probe). In the example reported here, the following probes were used: Probe Jtfb 10 Q 0 specifies for the genus Nitrobacter, with .. la. sequence. SEQ ID No. 1: 5 'TGCGACCGGTCATGG3' Probe Nso 1225, specifies for proteobacteria that oxidizes. ammonia., with. the. sequence SEQ ID No. 2: 5 'CG.CCAITGTATIACGTGTGA3' Probe S Univ-1390, a universal probe for any microorganism, with the sequence SEQ ID No. 3: 5 'GACGJ3GCG.G? G.TGTACAA3' and Probe S Bac338, specific for bacteria, with the sequence SEQ ID No-4 5 'GCT £ CC? £ CCGTAG.GAG13'. These probes were synthesized, purified by High Performance Liquids Chromatography.

(CLAR), then marked, with fluorescein at the 5 'end. They are available from Operen lechnelogies of Alameda, California (USA) or in France, of the company Genset based in Paris (among others) - The cells obtained from the dehydration step were resuspended in μl of a hybridization solution comprising (for 10 ml): 15 M NaCl 1.8 ml; Tris-HCl 1 .M 200 μl; SD.S (sodium dodecyl sulfate) 5 μl; distilled water as excipient 8 ml, for ten ml .. After each probe is marked by a fluoracrome, the necessary quantity of each probe is added (here, 1.5 nanomoles). The cells in the hybridization solution in contact with the probes were incubated for 10 minutes to 2 hours at the annealing temperature. The hybridization samples were subjected to centrifugation and spiking. eliminated, the supernatants. d) Washing step Following the hybridization, the cells will be washed for 1.5 minutes each time at the annealing temperature, in a buffered washing solution, which, for 50 ml, contained 5 M NaCl. 1 ml; 1 M Tris-HCl 9 ml; 20% SDS 50 μl. The formulation of the "solution of ..." (for example salt and denatured) was adjusted according to the need to achieve an appropriate astringency, that is, the elimination of. Probe associated not specifically. e) Extraction of the fluorescence by elution 300 .μl of heated formamide was added to the 100 ° C to the samples obtained from the washing step, and the residue was gently resuspended. Each tube was placed at ... 1 ° C per. 10 minutes, preferably using a contibuted temperature incubator. They underwent cent.i.fngation for 10 minutes. The supernatant was recovered and stored in the dark until it could be. anal iz do., by fluorescence spectroscopy. Fluorescence was quantified using a spectrofluorometer. The quantities measured in probes NblOOO and Nso 1225 correspond to the relative amounts of bacteria Nitrobacter and ß-proteobacteria that oxidize ammonia contained in XThe sample- -It is s quantities, were compared with those measurements for the universal probe,! S .Univ-1330 and 1.a probe for .bacteria .2S _aac 33S- This gives a percentage ratio to relative proportion) of the microorganisms contained in the sample, which are respectively Jsüirobacter and _ß- proteobacf ri. that oxidize ammonia. It is understood that this invention is not limited to the modalities described and illustrated herein, but that it covers all variants thereof.

LIST OF SEQUENCES (1) GE.NERAL INFORMATION: (i) APPLICANT: (a) LName Suez lyanna ise ds _Eaux (b) Address: 72 Avenue de la Liberté (c) City: Nanferre Cedex Ce) Country: .France (f) ) Roslal Code: 92753 (ii) TITLE. FROM. THE INVENTION: MEANS FOR THE QUALITATIVE AND QUANTITATIVE ANALYSIS OF MICROBIAL POPULATIONS PQTENTIALLY PRESENT IN A SAMPLE (iii) NUMBER OF SUCULENCIAS: 4 (v) LEGIBLE FORM IN COMPUTER: la) Type of storage medium.- Di co flexible (b) Computer : IBM PC compatible (c) PC-JDOS / MS-JDCLS operating system (d) Programming elements: Patentln Reléase # 1.0, Version # 1.30 (OEB) (2) INFORMA TION PARA- SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (a) Length: 15 .. pairs of bases (b) Type: nucleotide ^ ic) Number of threads: one (d) Configuration: linear (ii) Type of molecule: another nucleic acid (iii) Hypothetical : yes (iv) Antisense: no (vii) Euente. Immediate: (B) Clone: NblOOO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: TGCGACCGGT CATGG (3.) TNFCRMACT.CN FOR SEQ ID NO: 2: (i) Characteristics of the sequences (a) Length: 20 base pairs (b) Type: nucleotide (c) Number of strands: one (d) Configuration .: 1 i nea 1 (ii) T-ipo. from. molecule: another nucleic acid (iii) Hypothetical: yes (iv) Antisenti? : no (vii) Immediate source: LB.) Clone Nbl225 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5.'CGCCATTGTATTACGTGTGA3 '(4) INFORMATION FOR SE.Q ID NO: 3: (i) Characteristics, of the sequence: (a) Length: 18 base pairs _ (- b-) Type: nucleotide (c) Number of threads: one (d) Configuration: linear (ii) Type of molecule-: other nucleic acid (iii) Hypothetical : yes (iv) fl "nf i sense- -.no (vii). Immediate source: (B) Clone: ß Univ-1390 (xi) DESCRIPCIQN.DE. THE SEQUENCE .: SEQ ID NO: 5 'ÜAC.GHGCGGTGTGTACAA3' (5) INFORMATION FOR SEQ. ID NO: 4: (i) Characteristics -of .the .. sequence: (a) Length: L8. base pairs (b) Type: nucleotide (c) Number of threads: a td) Config.uraei? n.1 1 i.neal _ (ü) Type of. molecule: other nucleic acid (iii) Hypothetical:, yes (iv) Antisense: no (vii) Immediate source _ÍBJ Clone: S Bac338 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 5 'GCTGCCTCCCGTAGGAGT3'

Claims (3)

CLAIMS 1. A_ method. of qualitative and quantitative analysis of laís) population (s) microb.i. potential present (s) in a sample characterized in that it comprises: - contacting the microorganisms present in the sample with at least one RNA-directed oligonucleotide probe, hereinafter referred to as lZlasaa A specific probe, capable of targeting a desired microbiological population, lacks favorable conditions for in-hybridization. if you. In whole cells, extract, by separation of their target and elution outside the cells, those probes that have become hybridized, - detect the extracted probes and measure the quantity thereof, or their respective amounts. 2. A method of conformance with the claim!. Wherein additionally the at least one specific probe is selected from the group consisting of NB 1000 (SEQ ID No. 1) and No. 1225 (SEQ ID No. 2). 3. A method according to claim 1 .. or the. 2, where in addition the microorganisms potentially present in the sample are put in contact with another probe, hereinafter called universal probe, which serves to normalize results obtained with probes that target specific phylogenetic groups of microorganisms. 4. the JZ compliance method? O. XLa. claim 3, wherein in addition the universal probe is selected from the group consisting of S Univ-1390 (SEQ ID No. 3) and S Bac 338 (SEQ ID No. 4). 5. A method according to any one of the preceding claims, wherein in addition the specific and / or universal probe (s) is a directed probe (s) (s) to rRNA. 6. A method of compliance as claimed in any one of the preceding claims, wherein also the microorganisms poemcially present in the sample san extracted from the sample, notably by centrifugation. 7. A method according to any of the preceding claims, wherein further contact is made following XLa. sanding of the cells. 8. A method of compliance with claim 7, wherein further fixing of the cells is achieved by incubating the cells in a solution of less than 10% paraformaldehyde, and preferably about 4%, for 3 to 12 hours at 4 hours. ° C. 9. A. method according to claim 7 or 8, wherein in addition the fixation is followed by a dehydration step, before the contacting step. 10. A method according to claim 9, wherein further the dehydration step is performed by placing the sample in contact with at least one ethanol solution, and preferably with a series of ethanol solutions of increasing concentrations. 11. A method according to any of the preceding claims, wherein further contact is made by placing the sample in contact with the at least one probe in the presence of a solution, hereinafter called a hybridization solution, which notably comprises a denaturing agent such as sodium dodecyl sulfate (SDS) in a concentration in a range of 0.001-0.1%, preferably of the order of. 0.01%; Tris-HCl, pH of about 8 in zana concentration in the range of 0.001-0.1 Mr preferably of the order of 0.02 M; and a salt such as sodium chloride in a concentration in a range of Q-L-L_.5 M, preferably of the order of 0.9 M. 12. A method according to any of the preceding claims, wherein in addition the counted phase is carried out for an incubation time of about L0_ minutes to about 2 hours, and at the optimum hybridization temperature. 13. A method according to any of the preceding claims, wherein in addition the extraction of 1 a .. al. less a probe is made following the removal of the excess and the unbound probe or associated probe material not specifically contacted, notably by washing with a solution, hereinafter washing solution, which natableraent-e comprises a denaturing people such as sodium dodecyl sulfate (SDS) and a salt such as sodium chloride at appropriate concentrations to achieve the astringency necessary for the removal of non-specifically associated probe. 14- A method according to any of the preceding claims, wherein also the extraction is carried out by placing the microorganisms potentially present under conditions that allow denaturation of each probe specifically associated with its. target sequence, notably in the presence of an agent capable of denaturing the probe-abiotic duplex, and at a temperature higher than the melting temperature of the probe under consideration, notably at a temperature of about 100 ° C. 15. A method according to claim 14, wherein the denaturing agent is formamide.

1. 6._ Un. method according to any of the preceding claims, wherein in addition the extracted probes are concentrated, notably using the Speed-Vac ™, before measuring the amount thereof or. of their respective amounts. 17. A method according to any of the preceding claims, wherein the detection and the. measurement of. the quantity of the probes extracted is carried out by detection and measurement, of Xa. amount of a label associated or incorporated in each of the probes contacted, such as a radioactive label or chemiluminescent or fluorescent, notably such as fluorescein. 18. A method according to any of the preceding claims, wherein Xa sample is taken from fluids such as natural water, industrial water, industrial effluents, municipal wastewater, industrial sludge, thermal sludge, liquid or food gel, medium of f rmentation, air, gas, aerosol; or. is . one, sample taken from a ventilation duct of a building, or air conditioning duct; samples of edible solid, soil sample; sample of medical devices, or it is a human or animal sample ta 1 such as amgre / urine, vaginal or intestinal flora. 19. A method according to any of the preceding claims, wherein it is also used in combination with a process to activate an alarm in connection with the quality, safety and / or sanitary monitoring of the product from which the sample was obtained. 2Q. A.add.adQ according to any of the preceding claims, wherein it is also used in the in vitro diagnosis of an infectious disease. 21. A method according to any of the preceding claims, wherein it is further used in the automatic or backhaul control of a microhyalogic process such as fermentation of methane or liquid fertilizer, treatment of organic effluents, water treatment process, drainage such as activated sludge treatment. 22. A method according to any of the preceding claims, wherein it is also used in the automatic control or feedback of a process that is related to the elimination or prevention of the development of microorganisms.

2.

3. A method of compliance with any of the preceding claims, wherein it also applies to the detection of foam formation during the im- activated sludge processes and / or for the control by feedback of a method that is related to the elimination or prevention of foams.