MXPA00002355A - Genetically modified tumor-targeted bacteria with reduced virulence - Google Patents

Abstract

The present invention is directed to mutant Salmonella sp. having a genetically modified msbB gene in which the mutant Salmonella is capable of targeting solid tumors. The invention is also directed to Salmonella sp. containing a genetically modified msbB gene as well as a genetic modification in a biosynthetic pathway gene such as the purI gene. The present invention further relates to the therapeutic use of the mutant Salmonella for growth inhibition and/or reduction in volume of solid tumors.

Description

TUMOR-DIRECTED BACTERIA, GENETICALLY MODIFIED, WITH REDUCED VIRULENCE This application is a continuation in part of the serial application No. 08 / 926,636, filed on September 10, 1997, the full description of which is incorporated herein by reference in its entirety. 1. FIELD OF THE INVENTION The present invention refers to the isolation of a Salmonella gene that, when subjected to genetic disruption, reduces its virulence and septic shock caused by this organism and increases the sensitivity to the agents that favor the eradication of the bacterium. , for example, t chelating agents. The nucleotide sequence of this gene and the means for its genetic disruption are provided, and examples of the use of the tumor-directed bacterium disrupting this gene to inhibit the growth of cancers, including, but not limited to, melanoma, cancer, colon and other solid tumors are also described. The present invention also offers the genetic disruption of this gene in combination with the disruption of an auxotropic gene. 2. BACKGROUND OF THE INVENTION The citation or identification of any reference in Section 2, or in any section of this application should not be considered as an admission that such a reference is available as a prior art for the present invention. A major problem in the chemotherapy of cancers of solid tumors is the provision of therapeutic agents, such as drugs, in concentrations sufficient to eradicate tumor cells while reducing damage to normal cells. Thus, studies in multiple laboratories are directed towards the design of biological systems for delivery, such as antibodies, cytokines and viruses for the targeted delivery of drugs, pro-drug converting enzymes and / or genes to cells. tumor Houghton and Colt, 1993, New Perspectives in Cancer Diagnosis and Management 1: 65-70; de Palazzo, et al., 1992a, Cell. Immunol. 142: 338-347; from Palazzo et al., 1992b, Cancer Res. 52: 5713-5719; Einer, et al., 1993a, J. Immunotherapy 13: 110-116; Weiner et al., 1993b, J. Immunol. 151: 2877-2886; Adams et al., 1993, Cancer Res. 53: 4026-4034; Fanger et al., 1990, FASEB J, 4: 2846-2849; Fanger et al., 1991, Immunol. Today 12: 51-54; Segal et al., 1991, Ann N. Y. Acad. Sci. 636: 288-294; Segal et al., 1992, Im unobiology 185: 390-402; Wunderlich et al., 1992; Intl. J. Clin. Lab. Res. 22: 17-20; George et al., 1994, J. Immunol. 152: 1802-1811; Huston et al., 1993, Intl. Rev. Immunol. 10: 195-217; Stafford et al., 1993, Cancer Res. 53: 4026-4034; Haber et al., 1992, Ann. N. Y. Acad. Sci. 667: 365-381; Haber, 1992, Ann. N. Y. Acad. Sci. 667: 365-381; Feloner and Rodees, 1991, Nature 349: 351-352; Sarver and Rossi, 1993, AIDS Research & Human Retroviruses 9: 483-487; Levine and Friedmann, 1993, Am. J. Dis. Child 147: 1167-1176; Friedmann, 1993, Mol. Genetic Med. 3: 1-32; Gilboa and Smith, 1994, Trends in Genetics 10: 139-144; Saito et al., 1994, Cancer Res ,. 54: 3516-3520; Li et al., 1994, Blood 83: 3403-3408; Vieweg et al., 1994, Cancer Res. 54: 1760-1765; Lin et al., 1994, Science 265: 666-669; Lu et al., 1994, Human Gene Therapy 5: 203-208; Gansbacher et al., 1992, Blood 80: 2817-2825; Gastl et al., 1992, Cancer Res. 52: 6229-623.6. 2. 1 BACTERIAL INFECTIONS AND CANCER With respect to bacteria and cancer, a historical review reveals different clinical observations in which it was reported that cancer returns in patients with bacterial infections. Nauts et al., 1953, Acta Medica.

Scandinavica 145: 1-102, (Suppl 276) states: The treatment of cancer by injections of bacterial products is based on the fact that for 200 years it has been observed that the neoplasms return after acute infections, mainly streptococcal. If these cases were not too advanced and the infections were of sufficient severity or duration, tumors disappeared completely and patients remained free of recurrence. Shear, 1950, J.A.M.A. 142: 383-390 (Shear), observed that 75 percent of spontaneous remissions in untreated leukemia in the hospital for children in Boston occurred after an acute episode of bacterial infection. Shear questions: Are pathogenic and non-pathogenic organisms one of the controls in the nature of microscopic foci of malignancies, and in making progress in the control of infectious diseases, are we eliminating one of the natural controls of cancer? Subsequent evidence from various research laboratories indicate that at least some of the anti-cancer effects are mediated by stimulation of the host's immune system, giving rise to the improved immunorechazo of the cancer cells. For example, the release of lipopolysaccharide endotoxin (LPS) by gram-negative bacteria such as Salmonella activates the release of tumor necrosis factor, TNF, by cells of the host immune system, such as macrophages, Christ et al., 1995, Science 268: 80-83. Elevated levels of TNF in turn indicate a cascade of reactions mediated by cytokines that culminate in the death of tumor cells. In this sense, Cars ell et al., 1975, Proc. Nati Acad. Sci. USA 72: 3666-3669, demonstrated that mice injected with Bacillus Calmette-Guerin (BCG) have increased levels in serum of TNF and that serum positive to TNF caused necrosis of Meth A sarcoma and other tumors transplanted into mice. In addition, Klimpel et al., 1990, J. Im unol. 145: 711-717, showed that infected fibroblasts in vi tro with Shigella or Salmonella had increased susceptibility to TNF. As a result of observations such as those described above, immunization of cancer patients with BCG injections is currently used in some cancer therapy protocols. See Sosnowski, 1994. Compr. Ther. 20: 695-701; Barth and Morton, 1995, Cancer 75 (Suppl 2): 726-734; Friberg, 1993, Med. Oncol. Tumor. Pharmacother. 10: 31-36 for reviews of BCG therapy. 2. 2 PARASITES AND CANCER CELLS Although the natural biospecificity and evolutionary adaptability of parasites has been recognized for some time, and the use of their specialized systems as models for new therapeutic procedures have been suggested, there are some reports of, or proposals for, the actual use of parasites as vectors. Lee et al., 1992, Proc. Nati Acad. Sci. USA 89: 1847-1851 (Lee et al.) And Jones et al., 1992, Infect. Immun. 60: 2475-2480 (Jones et al.) Isolated Salmonella typhimurium mutants that were able to invade HEp-2 cells (human squamous cell carcinoma) in numbers significantly higher than wild-type strains. The "hyperinvasive" mutants were isolated under conditions of aerobic growth of bacteria that normally repress the ability of wild-type strains to invade HEp-2 animal cells. However, Lee et al. and Jones et al. they did not suggest the use of these mutants as therapeutic vectors, nor did they suggest the isolation of tumor specific bacteria by selecting mutants that show preference for infection by melanoma or other cancers on normal cells of the body. Without tumor specificity or other forms of attenuation, this hyperinvasive Salmonella typhimuri um as described by Lee et al. and Jones et al. It would probably be "pan-invasive," causing widespread infection in cancer patients. 2. 3 TUMOR-DIRECTED BACTERIA It has been shown that genetically engineered Salmonella is capable of targeting tumor, has antitumor activity and is useful in the supply of effector genes such as herpes simplex thymidine kinase (HSV TK) to solid tumors (Pawelek et al. ., WO 96/40238). Two significant considerations for the in vivo use of bacteria are their virulence and their ability to induce septic shock mediated by tumor necrosis factor a (TNFa). Since TNFα-mediated septic shock is among the main aspects associated with bacteria, modifications that reduce this form of an immune response would be useful because the levels of TNFα would not be toxic, and a more effective concentration and / or duration could be used. therapeutic vector. t 2.4 BACTERIAL, MODIFIED LIPID Modifications to the lipid composition of the tumor-directed bacteria that modify the immune response as a result of decreased induction of TNFa production were suggested by Pawelek et al. (Pawelek et al., WO 96/40238). Pa elek et al. provided the methods for the isolation of Rhodobacter genes responsible for the production of monophosphoryl lipid A (MLA). MLA acts as an antagonist for septic shock. Pawelek et al. also suggested the use of genetic modifications in the biosynthetic pathway of lipid A, including the mutation firA, which codes for the third enzyme UDP-3-0 (R-30 hydroxylmiristoli) -glucosamine N-acyltransferase [sic] in lipid biosynthesis A (Kelley et al., 1993, J. Biol. Chem. 268: 19866-19874). Pawelek et al., Showed that mutations in the firA gene induce lower levels of TNFa. However, these authors do not suggest the enzymes that modify the myristate portion of the lipid molecule A. In addition, Pa elek et al. they did not suggest that modifications to the lipid content of the bacterium would modify its sensitivity to certain agents, such as chelating agents. In Escherichia coli, the msbB gene (ml t) which is responsible for the terminal crystallization of lipid A has been identified (Engel, et al., 1992, J. Bacteriol 174: 6394-6403, Karow and Georgopouos 1992, J. Bacteriol 174: 702-710; Somerville et al., 1996, J. Clin. Invest. 97: 359-365).

The genetic disruption of this gene gives rise to a non-conditional, stable mutation that reduces the induction of TNFα (Somerville et al., 1996, J. Clin.Invest.97: 359-365).

These references, however, do not suggest that the disruption of the msbB gene in Salmonella vectors directed to tumor give origin to less virulent bacteria and more sensitive to chelating agents. The problems associated with the use of bacteria as gene delivery vectors focus on the general possibility of bacteria to directly kill normal mammalian cells as well as their ability to over stimulate the immune system through TNFα which may have toxic consequences for the host (Bone, 1992 JAMA 268: 3452-3455; Dinarello et al., 1993 JAMA 269: 1829-1835). In addition to these vectors, resistance to antibiotics can severely complicate copying with the presence of bacteria within the human body (Tschape, 1996, DTW Dtsch Tierarztl Wochenschr 1996 103: 273-7; Ramos et al., 1996. Enferm Infec Microbiol, Clin 14: 345-51). Hone and Powell, W097 / 18837 ("Hone and Powell"), describe the methods for producing gram negative bacteria having non-pyrogenic lipid A or LPS. Although Hone and Po ell state widely that conditional mutations in a large number of genes including msbB, kdsñ, kdsB, kdtA and h trB, etc., can be introduced into a wide variety of gram-negative bacteria including E. coli, Shigella sp., Salmonella sp., Etc., the only mutation exemplified is a mutation of htrB introduced in E. coli. Furthermore, although Hone and Powell propose the therapeutic use of non-pyrogenic Salmonella with a mutation in the msbB gene, there is no description of how such use is achieved. In addition, Hone and Powell propose using non-pyrogenic bacteria only for vaccine purposes. The purpose of a vaccine vector is significantly different from the tumor targeting vectors claimed herein. Thus, vaccine vectors have very different requirements from tumor-directed vectors. Vaccine vectors are proposed to develop an immune response. A preferred live bacterial vaccine must be immunogenic so that it develops protective immunity; however, the vaccine should not be capable of excessive growth in vivo which could give rise to adverse reactions. In accordance with the teachings of Hone and Powell, a suitable bacterial vaccine vector is sensitive to temperature having minimal replicative capacity in the physiologically normal body temperature ranges. In contrast, the preferred tumor-directed parasitic vectors, such as, but not limited to Salmonel ^ a, are safely tolerated by the normal tissues of the body so that pathogenesis is limited, but the vectors are directed to tumors and replicate freely within these. Thus, vaccine vectors that replicate minimally at normal body temperatures would not be suitable for use as vectors targeted to tumor. The preferred properties of the tumor-specific Salmonella strains include: 1) resistance in serum, allowing the parasite to pass through the vasculature and the lymphatic system in the process of looking for tumors, 2) facultative anaerobiosis, i.e. of growing under anaerobic or aerobic conditions allowing amplification in large necrotic tumors which are hypoxic, as well as small metastatic tumors that may be more aerobic, 3) susceptibility to host defensive capabilities, limiting replication in normal tissues but not within tumors where the host's defensive capabilities may be impaired, 4) virulence attenuation, which may increase the susceptibility to host defenses, and the parasite is tolerated by the host, but does not limit intratumoral replication, 5) invasive capacity towards tumor cells, helping in the location of the tumor and the anti-tumor activity, 6) mortality, aiding in permeation through the tumor, 7) sensitivity to antibiotics for control during treatment and for elimination after treatment (eg, sensitivity to ampicillin, chloramphenicol, gentamicin, ciprofloxacin), and lack of markers with resistance to antibiotics such as those used in the construction of strains, and 8) low rates of reversion of phenotypes helping in safety for the individual recipient. 3. SUMMARY OF THE INVENTION The present invention provides a means to improve the safety of tumor-directed bacteria, for example, by genetic modification of the lipid molecule A. The modified tumor-directed bacterium of the present invention induces TNFa less than wild-type bacterium and has reduced capacity to directly kill normal mammalian cells or cause systemic disease as compared to the wild-type strain. The modified tumor-directed bacteria of the present invention have increased therapeutic efficacy, ie, it is possible to use more effective doses of bacteria and for longer periods due to less toxicity in the form of less induced TNFα and systemic disease. The present invention provides the compositions and methods for the disruption or genetic disruption of the msbB gene in bacteria, such as Salmonella, which gives rise to bacteria, such as Salmonella, which have lower capacity to produce TNFa and reduced virulence compared to the type wild. In one embodiment, the invention provides improved methods for selecting genetic disruptions of the msbB gene. In addition, the genetically modified bacterium has greater sensitivity to chelating agents compared to bacteria with the wild type msbB gene. In a preferred embodiment, Salmonella having a disrupted msbB gene, which are hyperinvasive to tumor tissues, can replicate within the tumors and are useful for inhibiting the growth and / or reducing tumor volume of sarcomas, carcinomas , lymphomas and other solid tumor cancers, such as germline tumors and tumors of the central nervous system, including, but not limited to, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer, ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, glioma, pancreatic cancer, stomach cancer, liver cancer, colon cancer and melanoma. In one embodiment of the present invention, the bacteria are attenuated by other means, including but not limited to, mutations in the biosynthetic pathway giving rise to auxotroph. In a specific modality, the mutation in the biosynthetic pathway is a genetic disruption in the purl gene. In another embodiment, the bacterium expresses prodrug-converting enzymes including, but not limited to, HSV-TK, cytosine deaminase (CD), and p450 oxidoreductase. The present invention also offers a means for improving the sensitivity in the use in terminal treatment or for elimination after treatment. According to one embodiment of the present invention, the tumor-targeted bacterium having a genetically modified lipid A also has improved susceptibility to certain agents, for example, chelating agents. Another advantage is to modify the tumor-directed bacteria in this form because it increases the ability to kill bacteria with agents that have an antibiotic-like effect, such as chelating agents that include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), ethylene glycol bis (ß-aminoethyl ether) N, N, N ', N' -tetraacetic acid (PGTA), and sodium citrate. Modification to improve the ability to eliminate the bacteria by exogenous means, such as the administration of an agent to which the genetically modified bacteria are more sensitive than their wild-type counterparts, is therefore useful. The present invention further provides a Salmonella strain that contains mutations by deletion or deletion in the msbB gene, as well as an auxotrophic gene. In a specific embodiment, the auxotrophic deletion mutation affects the purl gene. In a preferred embodiment, these mutations give rise to a greater safety of the strain. In another preferred embodiment, the strain also carries other mutations that are described herein that increase the efficacy of the strain but are not essential for its safety. 4. DEFINITIONS As used herein, Salmonella comprises all Salmonella species, including: Salmonella Typhy, Salmonella Choleraesuis, and Salmonella Enteridiis. Salmonella serotypes are also included in the present f, for example, Typhimirium, a subgroup of 5 Salmonella Enteridiis, commonly known as Salmonella.

Typhimirim. Attenuation: Attenuation is a modification so that a microorganism or vector is less pathogenic. The final result of the attenuation is that it decreases the risk of toxicity as well as other side effects, when the microorganism or vector is administered to the patient. Virulence: Virulence is a relative term that describes the general ability to cause disease, including the ability to kill normal cells or the ability to develop septic shock (see specific definition below). Septic shock: Septic shock is a state of insufficiency of an internal organ due to a complex cytokine cascade, initiated by TNFa. The relative ability of a microorganism or vector to produce TNFa is used as a measure to indicate its relative ability to induce septic shock. Sensitivity to chelating agents: sensitivity to chelating agents is defined as the effective concentration at which the proliferation of a bacterium is affected, or the concentration at which the viability of the bacteria is reduced, when determined by the colony forming units. (ufc), recoverable. < • 5 5. BRIEF DESCRIPTION OF THE FIGURES The present invention can be understood in greater detail with reference to the following detailed description, the illustrative examples of the specific embodiments and the appended figures. FIGURE 1. Complete DNA sequence of the msbB gene of wild type Salmonella (TS) 14028 (SEQ ID NO: 1) and the deduced amino acid sequence of the encoded protein (SEQ ID NO: 2). FIGURES 2A-2C. Knockout construction generated using the cloned msbB gene of Salmonella TS 14028. The cloned gene was cut with Sphl and Mlul thereby separating approximately half of the coding sequence of msbB, and the tetracycline resistance gene (TET) of the cut of pBR322 with AatlI and Aval was inserted after the end blunt using the Klenow fragment of DNA polymerase I. A = knockout construct, B = copy of chromosomal msbB of Salmonella, c = chromosomal copy subjected to disruption of Salmonella of msbB after homologous recombination. The start codon (ATG) and the antisense codon are shown (TAA) and the restriction sites Asel, BamHl, Sphl, Ml ul and EcoRV. The position of the two primers, Pl and P2, which generate two PCR products of different size for wild type or disrupted msbB are shown. £ *. FIGURE 3A-3C. Southern blot analysis of msbB of 5 Salmonella ST 14028 subjected to chromosomal disruption. A) Southern blot probed with the tetracycline gene, demonstrating its presence in the construction of the plasmid and the two clones, and its absence in the bacterium WT 14028. B) Southern blot of a similar gel probed with a fragment of Asel / BamHl labeled with P from cloned msbB. The Asel enzyme cleaves upstream of msbB, and that of BamHl cuts at a location in the wild type, but at a second location in the tetracycline gene that gives rise to a higher molecular weight product. The band L (KO) shows the position of the band in the knockout construction, compared to the WT 14028 in band 2 (WT). Strips 3 and 4 show clones YS 8211 and YS 861 with a higher molecular weight product. C) Southern blot of a similar gel probed with a fragment ml ul labeled with 32P from the cloned msbB. See the text in section 7.2 for details. FIGURE 4. Induction of TNFa by live Salmonella WT 14028 in mice. 1 x 10 live bacteria in O.lcc of saline buffered with phosphates of the wild type strains or subjected to disruption msbB "were injected intravenously into the tail vein of Balb / c mice.The bar graph indicates the induction of TNFα with error bars.The clone YS 8211 induces TNFα 32% compared to ic > Salmonella WT 14028 5 FIGURE 5. Response of TNFa by Sinclair pigs for live Salmonella WT 14028 and clones YS 8212 of msbB 'The levels of TNFa were measured at 1.5 and 6.5 hours after the intravenous introduction of 1 x 109 [sic] ] ufc of Salmonella WT 14028 and YS 8212. At 1.5 hours the The TNFa response was significantly lower (p <0.011) in the msbB deletion mutant compared to the wild type. FIGURES 6A-6B. Changes in respiratory level induced by LPS of WT 14028 and clone YS 8212 of msbB '. Pigs Sinclair, were injected with A) 5 μg / kg of purified LPS, or B) 500 μg / kg of purified LPS and the respiratory rate was determined. The 500 μg / kg from Salmonella WT 14028 raised the respiration rate to more than 400% of normal, while the frequency of respiration in animals treated with LPS of msbB 'was less than 200%. FIGURE 7. Induction of TNFa by Salmonella WT 14028 alive in human monocytes. Human monocytes isolated from peripheral blood were exposed to increasing amounts of u.f.c. of Salmonella. At 1 x 105 u.f.c. , TNFa concentrations induced by WT 14028 were more than 300% higher than those induced by a number of msbB 'clones, ie, YS 8211, YS 8212, YS 8658 and YS 1170. FIGURE 8. Production of TNFa by monocytes humans. Human monocytes isolated from peripheral blood were exposed to increasing amounts of purified LPS. Only one nanogram of wild type LPS was sufficient to produce a measurable TNFa response and was maximal at 10 ng. On the other hand, 100 μg of LPS from each of a number of msbB 'clones was insufficient to generate any response. Thus, at 10 ng of LPS, the concentration of TNFα induced by Salmonella WT 14028 was at least 105 times higher than the concentration of TNFα induced by knockouts of independent msbB, ie, YS 7216 and YS 8211, and, the derivatives, is say, YS 1170, YS 8644, YS 1604, YS 8212, YS 8658, YS 1601, YS 1629. FIGURES 9A-9B. The survival of Sinclair mice and pigs injected with 2 x 10 or 1 x 10, respectively, of live bacteria. A) WT 14028 killed all the mice in 4 days, while the clone YS 862 of msbB 'left 90% of the mice alive beyond 20 days. B) In the same way, WT 14028 killed all the pigs in three days, while the clone YS 8212 of msbB 'left 100% of the pigs alive more than 20 days. FIGURE 10. Biodistribution of YS 82111 of msbB 'of Salmonella in melanoma tumors B16F10. At five days, the proportion of Salmonella with msbB 'within the tumors compared to those that exceeded 1000: 1 in the liver. FIGURE 11. Tumor delay by Salmonella msbB '. B16F10 melanoma tumors were implanted in the side of C57BL / 6 mice and allowed to progress until day eight. Mice did not receive bacteria (control) or strains YS 8211, YS8212, YS 7216, YS 1629 with msbB '. Two of the strains, YS 8211 and YS 1629 significantly delayed the progress of the tumor, while strains YS 7216 and YS8212 did not do so. FIGURES 12A-12B. Sensitivity of WT 14028 and bacteria subjected to disruption of msbB to chelating agents. Salmonella wild type and clones YS 8211 and YS 862 of Salmonel ^ a subjected to disruption of msbB were grown in LB broth lacking sodium chloride (LB-zero), in the presence or absence of 1 mM EDTA (FIGURE 12A) or in the presence or absence of 10 mM sodium citrate (FIGURE 12B). DO²oo was determined and plotted as a function of time. The msbB + strain showed little inhibition by EDTA or sodium citrate, compared to the msbB 'strains that showed almost complete cessation of growth after 3 hours by EDTA or sodium citrate. FIGURES 13A-13B. Survival of msbB bacteria within murine macrophages. Macrophages from the murine bone marrow (FIGURE 13A) and a murine macrophage cell line J774, (FIGURE 13B) were used as hosts for bacterial internalization and quantified over time. The data is presented as a percentage of the u.f.c. initials. FIGURE 14. Conversion of msbBl (?):: Tet to tet3 using the positive selection suicide vector pCVD442 carrying a second version of msbB - (msbB2 (?) AmpR sacB +).

FIGURE 15. Schematic diagram of the derivation of strain YS 1456 of Salmonella typhimuri um wild type. For details see section 8.1 of the text. FIGURE 16. Schematic diagram of the derivation of strain YS 1646 of Salmonella typhimuri um wild type. For details see the text of section 8.2. FIGURE 17. Effect of YS 1646 dose on murine melanoma tumor growth B16-B10. FIGURE 18. Antibiotic suppression of mortality induced by YF 1646 after lethal infection. 6. DETAILED DESCRIPTION OF THE INVENTION The present invention is based on the isolation of the Salmonella gene, ie, msbB, which, when present in its normal form, contributes to the induction of TNFa, general virulence, survival within macrophages of insensibility to certain compounds that favor the eradication of the bacteria. The present invention is directed to the genetic modification of the gene that gives rise to the disruption of the normal function of the gene product, and the incorporation of the genetic modification in tumor-directed bacteria, including Salmonella, for therapeutic use. In a preferred embodiment, the bacterium has a genetic modification of the msbB gene as well as genetic modification of a gene in a biosynthetic pathway, such as the purl gene, giving rise to an auxotrophic strain. In a preferred embodiment, the genetically modified bacterium is used in animals, including humans, for volume reduction and / or growth inhibition of solid tumors. In a further preferred embodiment, the bacteria useful for the present invention show preference for binding to and penetration into certain solid tumor cancer cells or have an enhanced propensity to proliferate in tumor tissues compared to normal tissues. These bacteria, including but not limited to Salmonella, have a natural ability to distinguish between tissues of cancerous or neoplastic cells and normal tissues / cells. Otherwise, the tumor cell-specific bacteria useful for the invention can be selected for and / or improved in the ability to target a tumor using the methods described in Pawelek et al., WO 96/40238 incorporated herein. as reference. Pawelek et al., Describes methods for isolating specific bacteria from tumor cells by cycling a microorganism through pre-selected target cells, preferably solid tumor cells in vi tro, or through a solid tumor in vivo, using one or more cycles of infection. 6. 1 ISOLATION AND IDENTIFICATION OF A GENE INVOLVED IN VIRULENCE It has been shown that the E. coli gene, msbB, is involved in the iristilization of lipid A (Somerville et al., 1996, J. Clin Invest. 97: 359-365 ). The chromosomal organization of the msbB gene in E. coli and the DNA sequence coding for. the msbB gene have been described (Engel et al., 1992, J. Bacteriol 174: 6394-6403, Karow and Georgopoulos 1992, J. Bacteriol 174: 702-710, Somerville et al., 1996 J. Clin Invest. 97: 359-365). As shown in the present invention, the msbB gene can be isolated from bacterial strains, in addition to E. coli, using low stringency DNA / DNA hybridization techniques known to those skilled in the art. (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, 1989). For an illustrative example of the isolation of a msbB gene from bacteria, including but not limited to Salmonella spp., See section 7.1 below. A DNA library of bacteria can be probed with a 32B-labeled msbB gene from E. coli. It is determined that the hybridizing clones are correct if they contain the DNA sequences similar to those of the msbB gene of E. coli, known. 6. 1.1 GENETIC ALTERATION OF msbB OF SALMONELLA One embodiment of the present invention provides a composition of matter that is a strain of bacteria with a genetic alteration in the msbB gene. In a preferred embodiment, the bacteria is Salmonella sp. The genetic alteration in the form of disruption or deletion can be carried out by various means known to those skilled in the art, including homologous recombination using a marker of antibiotic resistance. These methods include disruption of the plasmid-based cloned msbB gene using restriction endonucleases so that part or all of the gene is disrupted or eliminated or disrupted normal transcription and translation, and a marker of antibiotic resistance. for phenotypic selection is inserted in the region of this deletion, disruption or other alteration. The linearized DNA is transformed into Salmonella, and the bacteria carrying resistance to antibiotics are also examined for evidence of genetic alteration. Means to examine genetic alteration include PCR and Southern blot analysis. For an illustrative example of the genetic disruption of a Salmonella msbB gene see section 7.2. In another embodiment of the invention, the -usi-f / antibiotic resistance marker can be translated into a new bacterial strain. An illustrative example is provided in section 7.2. The bacteriophage P22 and a clone of msbB 'of Salmonella can be grown in Luria broth without salt and the new phages in the supernatant can be used to infect a new strain of Salmonella. Yet another embodiment of the present invention provides Salmonellas that are attenuated in more than one way, for example, a mutation in the pathway for the production of lipid A, such as the msbB mutation described herein, and one or more mutations. for auxotrophy for one or more nutrients or metabolites, such as uracil biosynthesis, purine biosynthesis and arginine biosynthesis as described in Bochner, 1980, J. Bacteriol. 143: 926-933 incorporated herein by reference. In a preferred embodiment, the ability of msbB 'Salmonella to accumulate within tumors is conserved by Salmonella msbB' having one or more mutations resulting in an auxotrophic strain. In a more preferred mode of this embodiment of the invention, the bacterial vector that selectively targets tumors and expresses a prodrug-converting enzyme is auxotrophic for uracil, aromatic amino acids, isoleucine and valine and synthesizes an altered lipid A. In a specific preferred embodiment, the msbB 'Salmonella also contains a genetic modification of the purl gene of the biosynthetic pathway resulting in decreased virulence of the strain as compared to the wild type. An illustrative example is provided in sections 7 and 8. 6. 1.2 CHARACTERISTICS OF S2MMONELLA HAVING MISFAB WITH DISRUPTION A characteristic of msbB 'Salmonella, described herein, is the decreased ability to induce a TNFa response as compared to the wild type bacterial vector. The complete bacterium and the isolated or purified lipopolysaccharide (LPS) produce a TNFa response. In one embodiment of the invention, the msbB 'Salmonella induce the expression of TNFa from about 5% to about 40% compared to Salmonella sp wild type (in other words, the msbB' of Salmonella induces the expression of TNFa of about 5% at about 40% of the level induced by wild-type Salmonella, for example WT 14028.) In a preferred embodiment of the invention, the msbB 'Salmonella induces the expression of TNFa at about 10% up to about 35% of that induced by Salmonella sp wild type . In one embodiment of the invention, the purified LPS of msbB 'Salmonella induces the expression of TNFa at a level that is less than or equal to 0.001% of the level induced by purified LPS of Salmonella sp wild type. The TNFα response induced by the whole bacterium or the isolated or purified LPS can be assessed in vitro or in vivo using commercial assay systems such as the enzyme linked immunoassay (ELISA). For some examples - see sections 7.3.1 and 7.3.2 below. The comparison of the production of TNFa based on the u.f.c. or μg / kg is used to determine the relative activity. Minor concentrations of TNFa per unit indicate decreased induction of TNFa production.

- REDUCTION OF VIRULENCE Another characteristic of the msbB 'Salmonella, described herein, is the decreased virulence towards the host cancer patient in comparison with the wild type bacterial vector. Salmonella wild type may, under some circumstances, present the ability to cause significant progressive disease. Acute lethality can be determined for living Salmonella wild type, normal and Salmonella msbB 'live using animal models. For an example, see section 7.4 and section 9, Table III. The comparison of animal survival for a fixed inoculum is used to determine the relative virulence. Strains that have a higher survival rate have decreased virulence.

DECREASED SURVIVAL WITHIN MACROPHAGES Another characteristic of the msbB "Salmonella described herein is decreased survival within macrophage cells compared to the survival of wild type bacteria." Salmonella wild type (eg, ATCC 14028) is notable for its ability to survive within macro phage (Baumler et al., 1994, Infect.Immun., 62: 1623-1630, Buchmeier and Heffron, 1989, Infect.Immun., 57: 1-7, Buchmeier and Heffron, 1990, Science 248: 730-732, Buchmeier et al., 1993, Mol. Microbiol 7: 933-936, Fields et al., 1986, Proc. Nati, Acad. Sci. USA 83: 5189-93, Fields et al., 1989 , Science 243: 1059-62, Fierer et al., 1993, Infect Immun 61: 5231-5236, Lindgren et al., 1989, Proc Nati Acad Sci USA 3197-4201, Miller et al., 1989, Proc. Nati, Acad. Sci. USA 86: 5054-5058, Sizemore et al., 1997, Infect. Immun 65: 309-312.) A comparison of survival time in macrophages can be made using an assay of cell culture in vi tro. A lower number of u.f.c. Over time it is indicative of reduced survival within macrophages. For an example, see section 8 below. As shown herein, the use of internalization assay based on gentamicin and macrophages from murine bone marrow or murine macrophage cell lines J774, a survival comparison of WT 14028 and clone YS 8211 of msbB " In one embodiment of the invention, survival occurs at about 50% to about 30%, preferably at about 30% to about 10% more preferred at about 10% to about 1% survival of the strain wild type.

INCREASE IN SENSITIVITY Another feature of a msbB modality " Salmonella, described herein, is the increase in the sensitivity of the tumor-directed bacteria to specific chemical agents, which is advantageously useful to aid in the elimination of the bacteria after in vivo administration. Bacteria are susceptible to a wide variety of classes of antibiotics. However, it has been surprisindiscovered that certain Salmonella msbB mutants comprised by the present invention are sensitive to certain chemicals that are not normally considered antibacterial compounds.In particular, certain msbB mutants "Salmonella are more sensitive than WT 14028 to the chelating agents. Previous descriptions of msbB 'E. coli have not suggested increased sensitivity to these chelating compounds. On the contrary, reports have included increased resistance to detergents such as deoxycholate (Karow and Georgopoulos 1992 J. Bacteriol 174: 702-710). To determine the sensitivity to chemical compounds, normal wild type bacteria and msbB bacteria are compared for growth in the presence or absence of a chelating compound, eg, EDTA, EGTA or sodium citrate.The comparison of growth is measured as a function of the optical density, that is, a lower optical density in the growth of the msbB 'strain in the presence of a compound, compared to when the strain is grown in its absence, indicates sensitivity, in addition, a lower optical density in the strain msbB 'grown in the presence of a compound, compared to the msbB + strain grown in its presence, indicates sensitivity specifically due to mutation of msbB For an example see section 7.7 below In one embodiment of the invention, 90% inhibition of Growth of msbB-Salmonella (compared to the growth of Salmonella sp wild type) occurs in approximately 0.25 mM EDTA to approximately 0.5 M EDTA, preferably about 99% inhibition in EDTA about 0.25 mM to EDTA above 0.5 mM, more preferably greater than 99% inhibition in EDTA about 0.25 mM to about 0.5 mM. Similar ranges of growth inhibition are observed at similar concentrations of EGTA.

DERIVATIVES OF msbB MUTANTS When grown in Luria broth (LB) containing zero salt, the msbB mutants of the present invention are stable, that is, they produce few derivatives (as defined below). mutants of msbB "in modified LB (10 g of tryptone, 5 g of yeast extract, 2 ml of 1N CaCl 2, and 2 ml of INGO MgSO 4 per liter, adjusted to pH 7 using NaOH IN) also keeps the mutants stable. On the contrary, when grown in normal LB, the msbB 'mutants can give rise to derivatives. As used in the present, "derivatives" is proposed to understand spontaneous variants of the msbB mutants characterized by a different level of virulence, tumor inhibitory activity and / or sensitivity to the chelating compounds when compared to the msbB mutant 'original. The level of virulence, the tumor inhibitory activity and the sensitivity to a chelating compound of a derivative may be greater, equivalent or lower compared to the "original" msbB mutant The derivatives of the msbB 'strains grow faster in LB not modified in comparison with the strains of msbB "originals. In addition, the derivatives can be recognized for their ability to grow on MacConkey agar (an agar containing bile salts) and for their resistance to chelating compounds, such as EGTA and EDTA. The derivatives can be stably preserved by cryopreservation at -70 ° C or by lyophilization according to methods well known in the art (Cryz et al., 1990, In New Generation Vaccines, MM Levine (ed.), Marcel Dekker , New York pp. 921-932; Adams, 1996, In Methods in Molecular Medicine: Vaccine Protocols, Robinson et al., (Eds.), Humana Press, New Jersey, pp. 167-185; Griffiths, Id. Pp. 269-288). Virulence is determined by evaluation of the dose administered at which half of the animals die (LD50). In comparison to the LD50 of the derivatives, it can be used to assess the comparative virulence. The decrease in LD50 of a spontaneous derivative when compared to its msbB "of origin indicates an increase in virulence In one example, the fastest growing derivatives present the same level of virulence, a higher level of virulence, or a lower level of virulence compared to their original mutant strains, respectively (see section 9 Table III.) In another example, the ability of a derivative to induce TNFa remains the same as the original mutant strain (see section 7.3, FIGURE 7). In one example, the derivatives can inhibit tumor growth more or less than their respective original mutant strains (see section 7.6, FIGURE 11). In section 7.6 it is shown that the original msbB 'mutant, YF 8211, significantly inhibits tumor growth while a derivative of this clone, YS 8212 has less tumor growth inhibition activity. On the contrary, the derivative, YS 1629, exhibits better tumor growth inhibition activity compared to its clone YS 7216 of msbB 'of origin. A derivative that is more virulent than its mutant of origin but that induces TNFa at a lower level when compared to the wild type, ie, at a level of about 5% to about 40% of that induced by wild-type Salmonella, can also be modified to contain one or more mutations for auxotrophy. In an illustrative example, the YS 1170 derivative is mutated so as to be auxotrophic for one or more aromatic amino acids, eg, aroA, and thus may be less virulent and is useful according to the methods of the present invention. In a further example, the genetic modifications of the purJ gene (involved in purine biosynthesis) produces Salmonella strains that are less virulent than the strain of origin. (see sections 7 and 8).

Before using a derivative in the methods of the invention, the derivative is titrated to determine its level of virulence, ability to induce TNFα, ability to inhibit tumor growth and sensitivity to a chelating compound. 6. 2 USE OF SALMONELLA WITH msbB SUBMITTED TO DISRUPTION TO BE DIRECTED TO TUMOR AND JN VIVID TREATMENT OF SOLID TUMORS According to the present invention, the mutant Salmonellas in msbB "are advantageously used in the methods to produce a tumor growth inhibitory or a reduction of tumor volume in an animal including a human patient having a solid tumor cancer., For such applications, it is advantageous that mutant Salmonella msbB "possess the ability to target tumor or, preferably, target cells / tissues of tumor instead of normal cells / tissues. In addition, it is advantageous that mutant Salmonella msbB "possess the ability to retard or reduce tumor growth and / or deliver a gene for a gene product that retards or reduces tumor growth." The ability to target tumor can be assessed by a series of methods known to those skilled in the art, including, but not limited to, animal models with cancer.

For example, Salmonella with a msbB 'modification are tested to determine if they have the ability to target a tumor using the subcutaneous animal model of melanoma B16F10. A positive tumor-to-liver ratio indicates that genetically modified Salmonella possesses ability to target tumor. For an example, see section 7.5. Salmonella with the modification in msbB "can be tested for antitumor ability using any of a number of normal in vivo models, for example, the subcutaneous animal model of melanoma B16F10 As an example, and not by way of limitation, the tumors are implanted in the flanks of mice and prepared for day 8 and then injected ip bacterial strains.The tumor volume is monitored over time.The antitumor activity is determined to be present if the tumors are smaller in the groups Containing bacteria compared to untreated, tumor-containing animals For an example, see section 7.6 below.The Salmonella of the present invention for in vivo treatment are genetically modified so that, when administered to a host, the bacteria are less toxic to the host and easier to eradicate from the host system Salmonella are super infective, attenuated and specific for a target tumor cell. In a more preferred embodiment, Salmonellas may be sensitive to chelating compounds having antibiotic-like activity. In addition, Salmonella used in the methods of the invention can encode "suicide genes", such as pro-drug converting enzymes or other genes, which are expressed and secreted by Salmonella at or near the target tumor. Table 2 of Pawelek et al., WO 96/40238 on pages 34-35 presents an illustrative list of drug converting enzymes that are secreted or expressed by Salmonella mutant msbB "for use in the methods of the invention. and pages 32-25 are incorporated herein by reference.The gene may be under the control of constitutive, inducible or cell-type-specific promoters, see Pawelek et al., at pages 45-43, which is incorporated. herein as a reference, for additional promoters, etc. useful for mutant Salmonella for the methods of the present invention In a preferred embodiment, a suicide gene is expressed and secreted only when a Salmonella has invaded the cytoplasm of the target tumor cell , thereby limiting the effects due to expression of the suicide gene for the target site of the tumor.In a preferred embodiment, Salmonella, administered to the host, expresses the HSV TK gene. Concurrent expression of the TK gene and administration of ganciclovir to the host, ganciclovir is phosphorylated in the periplasm of the microorganism which is freely permeable to nucleotide triphosphates. Phosphorylated ganciclovir, a false, toxic DNA precursor, easily passes out of the periplasm of the microorganism and into the cytoplasm and host cell nucleus where it is incorporated into the host cell DNA, thereby causing the death of the host cell. The method of the invention for inhibiting the growth or reducing the volume of a solid tumor consists of administering to a patient having a solid tumor, an effective amount of a mutant Salmonella sp, isolated containing a genetically modified msbB gene, the mutant being capable of target the solid tumor when administered in vivo. Salmonella msbB 'can also express a suicide gene as already described. In addition, in an embodiment the isolated Salmonella is analyzed for the sensitivity to the chelating compounds to ensure the easy eradication of Salmonella from the patient's body after successful treatment or if the patient experiences complications due to the administration of Salmonella alone. Thus, if Salmonella is used which is sensitive to a chelating agent, it is possible to administer a chelating agent such as EGTA, EDTA or sodium citrate at about 0.25 mM to about 1.0 mM to aid in the eradication of Salmonella after the effects have been achieved. antitumor. When administered to a patient, for example, an animal for veterinary use or a human for clinical use, the mutant Salmonella can be used alone or can be combined with any physiological carrier such as water, an aqueous solution, normal saline or other excipient physiologically acceptable. In general, the dosing intervals from approximately 1.0 u.f.c./kg to approximately 1 x 10 10 u.f.c./kg.; optionally from about 1.0 u.f.c. / kg to approximately 1 x 10 u.f.c. / kg, optionally from about 1 x 10 2 u.f.c./kg to about 1 xx 10 u.f.c./kg; optionally from about 1 x 10 4 u.f.c./kg approximately 1 x 108 u.f.c./kg. The mutant Salmonella of the present invention can be administered by different routes, including but not limited to: oral, topical, injection including, but not limited to intravenous, intraperitoneal, subcutaneous, intramuscular, intratumoral, i.e., direct injection into the tumor, et cetera. The following series of examples is presented by way of illustration and not as limitation of the scope of the invention. 7. EXAMPLE: LOSS OF VIRULENCE, STIMULATION OF REDUCED TNFa AND INCREASE IN SENSITIVITY TO CHELATING COMPOUNDS THROUGH DISRUPTION OF MsbB DE SALMONELLA 7. 1 ISOLATION AND COMPOSITION OF THE msbB GENE OF SALMONELLA First, a Salmonella genomic DNA library was constructed. Salmonella typhimuri um wild type (strain ATCC 14028) were grown overnight and the genomic DNA was extracted according to the methods of Sambrook et al., (Molecular Cloning: A Laboratory Manual, 2nd edition., Cold Spring Harbor PresS, Cold Spring Harbor, 1989). The fragments digested with restriction endonuclease of selected size in the range from 2 to 10 kB were generated by time-limited digestion with Sau3A and selected by agarose gel electrophoresis. These fragments were ligated into pBluescript SK- and transformed into E. coli DH5a. Random analysis of the clones revealed DNA inserts in > 87%, with average size = 5.2 Kb. The library consisted of 1.4 x 10 independent clones. To reduce the hybridization of the msbB probe originating in E. coli, to the chromosomal gene 100% homologous in E. coli, the entire library was harvested from the petri dishes by flooding them with phosphate-buffered saline and using a glass rod to dislodge the colonies, and the resulting bacterial population was subjected to large-scale plasmid isolation, giving rise to a combination of amplified Salmonella library plasmids. This combination of plasmids was then transformed into Salmonella LT2 YS 5010, thereby eliminating the background of E. coli. A probe for msbB homologs was generated using a clone of the msbB gene from E. coli (Karow and Georgopoulos 1992 J. Bacteriol 174: 702-710) digesting E. coli with BglII / HincII and isolating a corresponding 600 bp fragment to a portion of the coding sequence. This fragment was labeled using P-dCTP and was used to probe the Salmonella librarian under conditions of low severity consisting of 6X SSC, 0.1% SDS, 2X Denhardts, 0.5% dehydrated milk without fat overnight at 55 ° C. The strongly hybridizing colonies were purified, and the plasmids extracted and subjected to restriction digestion and gel hybridization in themselves under the same conditions used for colony hybridization (Ehtesham and Hasnain 1991 BioTechniques 11: 718-721). Another restriction digestion revealed a 1.5 kB fragment of DNA that hybridizes strongly with the probe and was sequenced at the Boyer center of Yale University using thermal cycle sequencing of the termination by fluorescent dye. Sequence analysis revealed that the 1.5 kb fragment contained a homolog of msbB that apparently lacks an initiation methionine corresponding to that of the E. coli gene. A probe consisting of the 5 'region of this clone was generated by performing restriction digestions using EcoRl / Xbal and hybridizing again to the library. The complete nucleotide sequence of the Salmonella msbB gene (SEQ ID NO: 1) and the deduced amino acid sequence of the encoded protein (SEQ ID NO: 2) is shown in FIGURE 1. The homology of the Salmonella msbB DNA and the putative E. coli msbB is 75%. The homology of the protein is 98%, confirming that the cloned Salmonella gene is an authentic msbB. 7. 2 GENETIC ALTERATION OF msbB OF SALMONELLA A knockout construct was produced using the msbB gene of cloned Salmonella. The cloned gene was cut with Sphl and Ml ul, thereby eliminating approximately half of the coding sequence of msbB, and the tetracycline resistance gene of pBR322, cut with AatlI and Aval, was inserted after the blunt end using the fragment of Klenow of DNA polymerase I (FIGURES 2A-2C). Knockout disruption was achieved by homologous recombination procedures (Russell et al., 1989, J. Bacteriol. 171: 2609); the construction was linearized using Sacl and Kpnl, gel purified and transfected in Salmonella LT2 YS 501 by electroporation. The bacteria of the transformation protocol were first selected on tetracycline plates and subsequently examined for the presence of contaminants not integrated into the chromosome, containing plasmid for resistance to ampicillin in the presence of plasmids as determined by the mini plasmid normal preparations (Titus, DE Ed. Promega Protocols and Applications Guide, Promega Corp, 1991). Colonies of bacteria that were resistant to tetracycline and still lacking plasmids were subjected to a PCR-based analysis of the structure of their msbB gene. The PCR was used with primers that generate an inclusive fragment of the region in which the tetracycline gene was inserted, where the forward primer was GTTGACTGGGAAGGTCTGGAG (SEQ ID NO: 3), corresponding to bases 586 to 606, and the primer inverse was CTGACCGCGCTCTATCGCGG (SEQ ID NO: 4), corresponding to bases 1465 to 1485. The wild type Salmonella msbB + gives rise to a product of approximately 900 base pairs, while the gene subjected to disruption with the tetracycline insert gives origin to a product of approximately 1850 base pairs. Some clones were obtained where only the largest PCR product was produced, indicating that the disruption in the msbB gene had occurred. The Southern blot analysis was used to confirm the disruption of the cramosomic copy of msbB of Salmonella. The knockout construct (KO) based on the plasmid was compared with genomic DNA prepared from YS82, YS86, YS8211 and YS861 clones of putative, disrupted and wild type msbB. DNA was double digested with Asel / BamHI and separated by agarose gel electrophoresis on 0.9% or 1.2% agarose. The results of YS8211 and YS861 are presented in FIGURES 3A-3C. Similar gels were subjected to three separate criteria: 3A) the presence of the tetracycline gene when probed with a fragment of the tetracycline gene tagged with 32P, 3B) length of the restriction fragment when probed with an Asel / BamHI fragment and labeled with 32P obtained from cloned msbB, and 3C) the presence or absence of the msbB ml ul fragment separated for the disruption of the msbB gene and the insertion of the tetracycline gene (FIGURES 3A-3C). Since the ml ul fragment was separated for the disruption of the msbB gene and for the insertion of the tetracycline gene, it is expected that this probe hybridizes with the wild type FIGURE 3C (2 WT band) [sic] but not with the knockout construct ( fringe 1 KO), or clones, (stripes 3 and 4 YS8211 and YS821) confirming in this way the genetic alteration of the msbB gene. Each of the preferred examined clones presented all the expected criteria for the deletion of the msbB (knockout) gene. These data further confirm that msbB exists as a single copy in wild type Salmonella, as no other hybridization bands were observed when probed with a labeled oligonucleotide from the cloned DNA. After the msbB mutation was confirmed, additional strains containing the msbB 'mutation were generated. The Salmonella strains used included WT 14028 and YS72 (hyperinvasive mutant pur "xyl" of WT 14028); Pawelek et al., WO 96/40238). P22 transduction was used to generate YS8211 (msbB:: tet) using YS82 as donor and YS861 and YS862 (msbBl:: tet) using YS86 as donor; all with WT 14028 as receiver. YS7216. { msbBl:: tet from YS72) was generated by transduction using YS82 as a donor. Some derivatives are encompassed by the present invention, including but not limited to the derivatives of YS8211 (YS8212, YS1170), YS862 (YS8644, YS8658) and YS 7216 (YS1601, YS1604, YS1629). In a preferred embodiment, the spontaneous derivatives grow somewhat faster on Luria agar compared to WT 14028 or the msbB clones "generated by transduction." The msbB + strains were grown in LB broth or in LB plates containing 1.5% agar at 37 ° C. ° C. Strains of msbB "were grown in modified LB containing 10 g of tryptone, 5 g of yeast extract, 2 ml of CaCl 2 IN and 2 ml of IN MgS0 per liter, the pH adjusted to 7 using NaOH IN. For transduction msbBl :: tet, LB was used without NaCl, with 4 mg / l of tetracycline. The liquid cultures were shaken at 225 rpm. For the tumor-directed experiments, the cells were diluted 1: 100 in LB, grown for DOβoo = 0.8 to 1.0, washed in phosphate-buffered saline (PBS), and resuspended in PBS. 7. 2.1 IMPROVED METHOD FOR SELECTING GENETIC ALTERATIONS OF msbB BY PRE-SELECTION WITH SACROSE An improved method has been discovered to select genetic alterations of msbB by preselection with sucrose. This method of pre-selection is based on the selection of colonies that conserve the sacB gene. The sacB gene is responsible for the conversion of sucrose into a toxic chemical compound, levan, which is lethal to host cells, and can therefore be used to select recombinants. Only these strains that undergo deletion of the sacB gene on live in medium containing sucrose and, therefore, have property of resistance to sucrose sucrose. As described below, the preselection of colonies that conserve the sacB gene eliminates the need for dilutions and comparison of colonies in sucrose vs. sucrose as it is done in the selection of normal sucrose.

Normal selection procedure for the sucrose system: SM10? Pir from E. coli was used as a donor carrying a plasmid with the msbB (?) Bla and sacB genes. The bla gene for beta-lactamase confers resistance to ampicillin. In the normal selection procedure, the donor strain was coupled using normal coupling procedures, with a strain of Salmonella in which the plasmid with msbB (?) Bla sacB was to be introduced. Since the Salmonella strain contained a second marker of antibiotic resistance (e.g., resistance to streptomycin), the recombinant Salmonella clones were then selected for double resistance to ampicillin and streptomycin. To test the resolution of an individual clone, dilutions of each clone were plated on LB lacking sucrose, or LB containing 5% sucrose. Only those strains that underwent deletion or alteration of the sacB gene survive in sucrose. The comparison of the numbers of clones on sucrose or sucrose (-) plates indicates the fraction of the bacterial cells that were subjected to resolution. The sucrose-resistant colonies were then further tested for sensitivity to ampicillin and tetracycline. Tets and amp3 indicate cleavage of the sacB and bla genes during crossing with the partial msbB gene region. Then PCR was used to confirm the isoform of msbB present in the tet amps clones.

Pre-selection protocol for the sucrose system: A variation in the normal sucrose protocol allowed the detection of increasing numbers of colonies, by preselecting colonies that conserved the sacB gene. This method of pre-selection eliminates the need for examination and comparison of sucrose (+) vs sucrose (-) from a large number of colonies, after the conjugation procedure described above, the colonies (impure at this stage) were cross-linked directly onto LB plates containing 5% sucrose and grown at 30 ° C. The resulting impure colonies, which continued to grow, gave rise to survivors in sucrose. Of the sucrose-resistant colonies, those that presented phenotypic variation of "fluffy edges" were then subjected to dilution and plaqueated on plates of sucrose (+) or sucrose (-). The colonies were then tested for sensitivity to tetracycline and ampicillin as indicated, and the isoform of msbB was confirmed by PCR. This improved method was used to generate strains for P22 phage transduction of the chromosomal element msbB (?) Jbla sacB.

These strains were then used to generate strains YS 1456 and YS 1647, which represent the preferred modalities of the novel msbB mutations of the present invention (see FIGS. 15 and 16). 7. 3 DISSOLUTION OF msbB FROM SALMONELLA REDUCES INDUCTION OF TNFa 7.3.1 INDUCTION OF TNFa IN MOUSE WT 14028 and clone YS 8211, msbB "were first grown to saturation in LB 37 ° C medium with shaking at 225 rpm. : 100 of these bacterial strains were then transferred to fresh LB and grown at OD OD0o = 1-0 at 37 ° C with shaking at 225 rpm.The bacteria were diluted in phosphate-buffered saline and 1.0 × 10 8 μf "c. approximately 5 x 109 cfu / kg) were injected into the tail vein of Balb / C mice (n = 4 / strain), with PBS as a negative control. After 1.5 hours the serum was harvested in triplicate samples by cardiac puncture, centrifuged to remove cellular content, and analyzed for TNFα using an ELISA plate from Biosource International Cytoscreen that was read on a Molecular Devices Emax microplate reader. The results are presented in FIGURE 4 and are expressed as a percentage of the level of TNFα induced by wild-type Salmonella.

As shown in FIGURE 4, YS8211 induced TNFa significantly lower than WT 14028. Thus, as shown in FIGURE 4, the msbB strain "induced TNFa approximately 33% (ie, 300% less) than the msbB + strain of wild type. 7. 3.2 INDUCTION OF TNFa IN PIGS A msbB strain "of Salmonella, YS8212, and WT 14028, were first grown to saturation in LB medium at 37 ° C with shaking at 225 rpm.Dilutions 1: 100 of these bacterial strains were then transferred to LB fresh and grown at an OD600 - 0.8 at 37 ° C with 225 rpm.The bacteria were washed in phosphate buffered saline and 1.0 x 10 pfu (approximately 1 x 10) cfu / kg were injected into the ear vein of pigs Sinclair (n = 6 / strain) After 1.5 and 6.0 hours, the serum was harvested, centrifuged to remove the cell contents and frozen for further analysis.The analysis for TNFa used an ELISA plate of Genzyme Predicta, which was read using a Wilson spectrophotometer The results are presented in FIGURE 1 and expressed as picograms of TNFa / ml of serum.As shown in FIGURE 5, at 90 minutes the level of TNFa induced by the strain msbB "was significantly less than the ind ucido by Salmonella WT 14028. 7. 3.3 INDUCED BREATHING BY SALMONELLA LPS IN PIGS The lipopolysaccharide (LPS) of Salmonella WT 14028 and the clone YS8212 of -j.s.b.8 ~ was prepared using the procedure described in Galanos et al. (1969, Eur. J. Biochem. 9: 245-249). In short, the LPS was extracted from bacteria that had been grown to DOdoo = 1.0. The bacteria were packed by centrifugation, washed twice with distilled water and frozen at -20 ° C. The LPS was purified by extraction with a mixture of 18.3 ml of H20: 15 ml of phenol in a water bath with stirring for one hour at 70 ° C. The mixture was cooled on ice, centrifuged at 20,000 per g for 15 minutes, and the aqueous phase was separated. The LPS was precipitated from the aqueous phase by the addition of 0.05 M NaCl and 2 volumes of ethanol and incubation on ice, followed by centrifugation at 2,000 per g for 10 minutes, the precipitation was repeated after the redissolution of the package in 0.05 M NaCl, and the lyophilized package. The LPS was dissolved in sterile distilled water, and 5 μg / kg or 500 μg / kg of LSP were injected into the ear vein of Sinclair pigs that had been anesthetized with Isoflurane. After 1.5 and 6.0 hours, the respiratory rate was determined and recorded. The results presented in FIGURE 6 are expressed as a percentage of respiration at time zero (to).

As shown in FIGURE 6, respiration was significantly greater in pigs administered wild type LPS compared to those administered with LPS from strain msbB ~. Thus, the disruption of the msbB gene in Salmonella produces a modification in the lipid A which gives rise to reduced ability to increase respiration. 7. 3.4 INDUCTION OF TNFa IN HUMAN MONOCYTES Human monocytes were prepared from peripheral blood by centrifugation through Isolymph (Pharmacia) and they were allowed to adhere to 24-well plates containing RPMI 1640. Salmonella WT 14028 and some strains of msbB '14028 (YS8211, YS8212, YS8658 and YS1170) were first, grown to saturation in LB medium, at 37 ° C , with stirring at 225 rpm. A 1: 100 dilution of these bacterial strains was then transferred to fresh LB and grown to DOgoo = 0.8, at 37 ° C, with 225 rpm. The bacteria were added to wells of cell cultures and the culture medium was harvested after 2.0 hours, centrifuged to separate the cell contents and analyzed for TNFa using an ELISA plate of Genzyme Predicta, which was read using a Gilson photometer spectrum. The data are presented in FIGURE 7 and are expressed as picograms of TNFa / ml of serum.

As demonstrated in FIGURE 7, the msbB ~ strains induced significantly less TNFa than the wild-type strain. 7. 3.5 INDUCTION OF TNFa BY LPS FROM msbB ~ SAZMONELLA Human peripheral blood monocytes were prepared by centrifugation through Isolymph (Pharmacia) and allowed to adhere to 24-well plates containing RPMI 1640. The wild type lipopolysaccharide (LPS) and a number of msbB 'mutants of Salmonella, is say, (YS8211, YS8212, YS8658 and YS1170) was prepared using the procedure described in Galanos et al., (1969 Eur. J. Biochem. 9: 245-249) (see section 7.3.43 for a brief description ). The LPS was dissolved in sterile distilled water, and quantities in the range of 0.001 to 100 ng / ml of LPS were added to the cell culture wells. After 15 hours the culture medium was harvested, centrifuged to separate the cell contents and analyzed for TNFa using an ELISA plate of Genzyme Predicta, which was read using a Gilson spectrophotometer. The data are presented in FIGURE 8 and are expressed as picograms of TNFa / ml of serum. As demonstrated in FIGURE 8, the purified LPS of the msbB ~ strains induce significantly less TNFa than the LPS of the wild-type strain. 7. 4 THE DISSOLUTION OF SAIMONELLA MSJB REDUCES VIRULENCE 7.4.1 IN MICE A culture of Salmonella 14028 wild type and one of Salmonella clones msbB ~, YS862, were grown in medium LB lacking sodium chloride at 37 ° C, with agitation at 250 rpm until the cultures reached a DOβoo of 0.8. Bacteria were diluted in phosphate buffered saline 7 (PBS) at a ratio of 1.10 and the equivalent of 2 x 10 u.f.c were injected i.p. in C57BL / 6 mice carrying melanomas B16F10. Survival was determined daily or at intervals of 2 to 4 days. The results are presented in FIGURE 9A and are expressed as a percentage of survival. As shown in FIGURE 9A, WT 14028 killed all mice in four days, while the msbB mutant left 90% of the mice alive for more than 20 days, demonstrating a significant reduction in virulence by the msbB mutant. 7. 4.2 IN PIGS A crop of 14028 and one of its clones msbB ~ Salmonella, YS8212, were grown in LB medium lacking sodium chloride at 37 ° C, with agitation at 250 rpm until the cultures reached an OD 600 of 0.8. The bacteria were washed in phosphate buffered saline and 1.0 by Q 10 were injected into the ear vein of Sinclair pigs (N = 4 / strain). Survival was determined at '• daily, or at intervals of 2 to 4 days. 5 The results are presented in FIGURE 9B and are expressed as a percentage of survival. As shown in FIGURE 9B, WT 14028 killed all the pigs in three days, while the msbB mutant left 100% of the mice alive [sic] more than 20 days, demonstrating a significant reduction in virulence. 7. 5 ORI.MENTATION TO TUMOR OF CLONES msbB Salmonella WT 14028 with the modification msbB, they were tested to determine if these possess capacity of tumor orientation using a subcutaneous animal model of melanoma B16F10. The clone msbB ~, YS8211, was grown in LB medium lacking sodium chloride at 37 ° C with agitation at 250 rpm up to a DOβoo of 0.8. An aliquot of 2.0 x 10 u.f.c. was injected i.v. in C57BL / 6 mice that had been implanted with 2 x 10 B16 melanoma cells [sic] 16 days before bacterial incubation. Two days and five days after the bacterial infection, the mice were sacrificed and the tumors and livers tested for the presence of the bacteria by homogenization and plating. series of dilutions.

The results are presented in FIGURE 10 and are expressed as u.f.c. of bacteria / g of tissue. As shown in FIGURE 10, a positive tumor-to-liver ratio (700: 1) was found at two days, and at five days it increased to a positive ratio of 2000: 1. Thus, the msbB mutant retained the ability to target a solid cancer tumor. 7. 6 USE OF SALMONELLA WITH msbB SUBMITTED TO DISRUPTION FOR IN VIVO ANTITUMOR ACTIVITY Clones YS8211, YS8212, YS7216 and YS1629 of msbB ~ of Salmonella typhimurium 14028 and WT 14028 (control) were grown in LB medium lacking sodium chloride at 37 ° C, with agitation at 250 rpm, up to a DOgoo of 0.8. An aliquot of 2.0 x, 10 u.f.c. It was injected i.p. in C57BL / 6 mice that had been implanted with 2 x 10 B16 melanoma cells 8 days before bacterial infection. The tumor volume was revised over time. The results are presented in FIGURE 11. Two of strains YS 8211 and YS 1629 showed significant tumor delay, ie, inhibition of tumor growth. 7. 7 INCREASED SENSITIVITY TO CHELATING COMPOUNDS To test the sensitivity of bacterial strains to chelating compounds, bacteria with or without the msbB mutation were grown in the presence or absence of 1 mM EDTA or 10 mM sodium citrate in Luria broth (LB) lacking sodium chloride. An overnight culture of each of the bacterial strains was diluted 1 to 100 in fresh medium, and grown at 37 ° C with shaking at 250 rpm. The effect on growth was determined by spectrophotometric readings at a DOßoo. WT 14028 and clone msbB ~ YS 8211 were grown in the presence or absence of 1 mM EDTA (FIGURE 12A). EDTA did not inhibit the growth of WT 14028. In contrast, the msbB 'clone showed almost complete cessation of growth after 3 hours in the presence of EDTA. WT 14028 and clone YS 862 of msbB 'were grown in the presence and absence of 10 mM sodium citrate (FIGURE 12B). Strain WT 14028 msbB showed little inhibition by sodium citrate compared to strain msbB 'which showed almost complete cessation of growth after 3 hours in the presence of sodium citrate. Thus, the Salmonella mutants msbB ~ showed sensitivity to the chelating agents that favor the eradication of bacteria, a characteristic that is similar to an antibiotic effect. It is considered that such a feature should be advantageous for use of the Salmonella msbB 'mutants for in vivo treatment.

In addition, in order to assess the sensitivity of the Salmonella strains to the chelating compounds, the hyperinvasive strain YS72, its strain msbB ', YS7216 and a derivative of YS7216, were grown in the presence of increasing concentrations of EDTA. A fresh culture of YS72, its strain msbB 'YS7216 and its derivative with faster growth YS1629 were diluted 1 to 100 in LB medium without salt, fresh containing EDTA 0, 0.25, 0.5, 1.0 or 2.0 mM and grown at 37 ° C with 225 rpm for 4 hours, and the cfu were determined by plating serial dilutions on LB plates (Table I). Inhibition greater than 99% was obtained for strain msbB ~ YS7216 at EDTA concentrations greater than 0.25 mM and its derivative YS1629 was inhibited greater than 90% at 0.5 mM and greater than 99% at 2.0 mM. On the contrary, although clone YS72 showed some sensitivity to EDTA, it was not inhibited at the 90% level even at 2.0 mM.

Table I.

Strain u.f.c. without EDTA [0.25 mM] u.f.c. + EDTA. { % inhibition} [0.5 pM] [1.0 mM] [2.0 M] YS72 3.0 x 109 2.4 x 109 1.5 x 109 7.3 x 108 4.8 x 108. { twenty% } . { fifty%} . { 75% } . { 84%} YS7216 6.3 x 108 2.1 X 106 1.1 X 106 3.2 X 106 4.3 X 106. { 99. 6%} . { 99.8%} . { 99.4%} . { 99.3} YS1629 1.3 X 109 6.0 x 108 1.0 x 108 2.9 x 107 7.5 x 106. { 54% } . { 92% } . { 97%} . { 99.4%} 7.8 BACTERIAL MACROFAGOS SURVIVAL To determine the sensitivity of msbB ~ Salmonella to macrophages, two types of macrophages were used: (A) Macrophages from bone marrow obtained from the femurs and tibias of C57BL / 6 mice, which were replicated by the addition of the supernatant of the LADMAC cell line that secretes the macrophage colony stimulating factor (Sklar et al., 1985. J. Cell Physiol. 125: 403-412) and (B) J774 cells (a cell line of macrophages. of murine (obtained from America Type Culture Collection (ATCC).) Salmonella strains used were WT 14018 and its derivatives msbB ~ YS8211 and YS1170. Bacteria were grown until the last logarithmic phase DOβoo = 0.8 and 1 x 10 were used to infect a confluent layer of mammalian cells within a 24-well plate for 30 minutes, after which the extracellular bacteria were separated by washing with culture medium and adding 50 μg / ml gentamicin (Elsinghorst, 1994, Methods Enzymol. 236: 405-420). They were counted by plating serial dilutions of the separated cell layer using 0.01% deoxycholate, and expressed as the percentage of the u.f.c. initials with time. The results are presented in FIGURE 13 and are expressed as the percentage of u.f.c per time. The msbB strains show significantly lower survival in macrophages. 7. 9 LD50 OF DERIVATIVES OF msbB (• Spontaneous derivatives of strains YS8211 and YS7216 of msbB 'were selected from in vitro culture on unmodified LB medium based on the best growth characteristics. These bacterial strains were grown to DOgoo of 0.8 and u.f.c. in the range of 1 p p x 10 a l x lO were injected i.v into the vein of the tail of C57B1 / 6 mice. acute lethality was determined at three days, and LD50 was determined as described in Welkos and O'Brien in (Methods in Enzymology 235: 29-39, 1994). These results are presented in Table II. This way although all msbB ~ strains have reduced ability to induce, TNFa (see section 7.3.5), the results demonstrate that strain YS1170 is significantly less attenuated than other msbB ~ strains and, therefore, not all msbB 'strains are useful to provide reduced induction of TNFa and virulence reduced. twenty Table II.

Strain LD50 '. WT 14028 1 x 103 YS 8211 4 x 106 YS 8212 3.9 x 107 YS 1629 1 x 107 YS 1170 1 x 106 8. MUTATION OF msbB IN COMBINATION WITH A MUTATION IN 5 THE BIOSINTETIC ROUTE To assess the compatibility with auxotrophic mutations, as measured by the retention of the ability to target and replicate within tumors, combinations of the msbB mutation with mutations were produced auxotrophic. The msbB strains were grown in LB broth or LB plates containing 1.5% agar at 37 ° C. The msbB 'strains were grown in modified LB containing 10 g of tryptone, 5 g of yeast extract, 2 ml of 1N CaCl and 2 ml of M S? 4 IN per liter, adjusted to pH 7 using INOH NaOH.

For the transduction of msbBl:: tet, LB lacking NaCl was used, with 4 mg / l of tetracycline. The liquid cultures were shaken at 225 rpm. The msbBl:: tet was transduced into auxotrophic strains to generate YS1604 (msbB ~, purl ~, hyperinvasive), YS7232 msbB ', purl', hyperinvasive), YS7244 (msbB ~, purl ~, aroA ~, hyperinvasive), YS1482 (msbB ', purl ~, purA ~). For the tumor targeting experiments, the cells were diluted 1: 100 in LB grown, up to ODß0 - 0.8 to 1.0, washed in phosphate buffered saline (PBS), resuspended g in PBS, and 2 × 10 injected into the vein of the tail of C57BL / 6 mice. At seven days the tumors were excised, weighed, homogenized and determined the u.f.c. plating serial dilutions on modified ML described above. The results are presented in Table III and are expressed as u.f.c per gram of tumor tissue. Some of the strains, YS8211, YS1604 and YS7232 show high concentrations of u.f.c. within tumors, while YS7244 and YS1482 are approximately 500 to 5000 times less.

Table III. 8. 1 YA1456 YIELD PRODUCTION CONTAINING DELETIONS IN MUSJiB AND PURI In FIGURE 15 the production of the strain is delineated YS1456 of Salmonella from Salmonella typhimuri um wild type. Salmonella typhimuri um wild type was transduced with 1 757:: Tnl O purl that conferred resistance to tetracycline, giving rise to strain YS1451. Strain YS1451 was then subjected to Bochner selection to return the sensitive tet strain and introduce the tets gene and introduce a purl deletion (Bochner et al., 1980, J. Bacteriol, 143: 926-933), producing strain YS1452. Strain YS1452 was tets and purl ~. Strain 1452 was then transduced with msbBl :: tet through bacteriophage P22, using strain YS8211 (jps-bBl:: tet) as the donor. The resulting strain, YS1453, was initially sensitive to ethylene glycol bis ((b-aminoethyl ether) -N, N, N ', N' -tetraacetic acid 10 mM (EGTA), simultaneously reverted to an EGTA-resistant phenotype. This reverted, named YS 1454, was selected by plating YS1453 on EGTA (2 mM on Luria agar) .The strain YS1454 was then transduced with the chromosomal element _psbB2 (?) bla sacB, selecting for resistance to ampicillin. a second version of the msbB gene subjected to disruption, called msbB2 (?) as well as the blaBuB genes. The bla gene is responsible for the transcription of the enzyme β-lactamase, which metabolizes ampicillin, and was used to select transductants resistant to ampicillin. The sacB gene is responsible for the conversion of sucrose to a toxic chemical compound, levan that is lethal to host cells, and subsequently used to select recombinants that lose or have mutations in sacB (see section 7.2.1 for methods of pre-selection improved with sucrose). The presence of the bla and sacB genes allows the selection of the ampr and sucs strain (defined as strain YS1455), which contained the msbBl :: et and msbB2 (?) Genes. Strain YS1455 was then plated on Luria Bertani (LB) sucrose to select a derivative suc amp tets to separate msbBl:: tet and restore sensitivity to antibiotics. The derivative was designated as strains YS1456. In summary, YS1456 has deletion mutations in purl and msbBl. It is also tets amps and EGTAr. 8. 2. PRODUCTION OF YA1646 CEPA CONTAINING DELETIONS IN MESBB AND PURSE The production of Salmonella strain YS1646 from Salmonella typhimuri um wild type (wild type strain ATCC 14028) is outlined in FIGURE 16. Salmonella typhimuri um wild type was mutagenized with nitrosoguanidine and ultraviolet light (UV) and selected for hyperinvasiveness in melanoma cells. The resistant strain, defined as YS72 was confirmed with pur ~ y xyl properties of tumor hyperinvasiveness (Pawelek et al., 1997, Cancer Res 57: 4537-4544). To replace the chromosomal purl gene in strain YS72 with a purl deletion, strain YS72 was transduced with the purX 1757 :: TnlO gene, which conferred resistance to tetracycline. The donor of the 1757 :: TnlO purl gene was the strain of Salmonella TT11 (purl 1757 :: TnlO). The donor strain was originally obtained from the Salmonella Genetic Stock Center (Department of Biological Sciences, Calgary University, Calgary, Alberta, Canada T2N 1N4). Transduction was performed using bacteriophage P22 (mutant HT105 / 1 int-201). The transductant, defined as YS1641, was isolated after selection in tetracycline. Strain YS1641 was then subjected to Bochner selection to separate the tet gene and introduce a deletion of the purl gene (Bochner et al., 1980, J. Bacteriol, 143: 926-933), producing strain YS1642. Strain YS1642 was tets and purl ~. The selection of the tet deletion strain also allowed genetic modification (eg, disruption of the msbB gene, see next paragraph) using transduction of the tet gene.The YS1642 strain has a severe purine requirement due to purJ ~ (?), and has been shown to coat purl at a frequency of less than 1 in 10 cells.

Strain YS 1642 was then transduced with msbBl:: tet by bacteriophage P22, using strain YS8211 (msbB:: tet) as donor. The DNA sequence for the msbB gene is shown in FIGURE 1. The gene tet in the gene Bl:: tet confers resistance to 5 mg / L of traciclin. The resulting strain thus obtained was YS1643. Strain YS1643 was initially sensitive to ethylene glycol bis (b-aminoethyl ether) -N, N, N ', N' -tetraacetic acid (EGTA) 10 mM, spontaneously reverted to an EGTA-resistant phenotype. One of these reverted phenotypes, designated YS1644, was selected by plating YS1643 on EGTA (2 mM on Luria agar). Strain YS1644 was then transduced with the chromosomal element -t¡s £ > B2 (?) Bla sacB. This transduction process led to a second version of the msbB gene subjected to disruption, called? R.st > B -? (?) As well as the bla and sacB genes. The bla gene is responsible for the transcription of the β-lactamase enzyme, which metabolizes ampicillin, and was subsequently used to select transductants. The sacB gene is responsible for the conversion of sucrose into a toxic chemical compound, levan, which is lethal to host cells, and was used to select recombinants. The presence of the Ma and sacB gene allows the selection of the ampr and sucs strain (defined as strain YS1645), which contained the msbBl:: tet and msbB2 (?) Genes. Strain YS1645 was plated on Luria-Bertani (LB) sucrose to select a sucr derivative amp3 tets to separate the zpsbB :: tet gene and reestablish antibiotic sensitivity (ie, a derivative with msbBl deletion:: tet bla sacB) . This derivative was designated as strain YS1646. In summary, YS1646 has deletion mutations in purl, and msbB. It is also tets, amps, and EGTAr. 8. 3 INHIBITION OF TUMOR GROWTH WITH CEPA YS1646 Intravenous (IV) administration of YS1646, an attenuated strain of Salmonella typhimurium, gave rise to selective replication within tumors, and concomitant inhibition of tumor growth (see FIGURE 17 and Table IV). In all cases, a tumor model was used in stages in which the establishment of the tumors was allowed after the inoculation of tumor cells and before the administration of YS1646. As a result, the ability of YS1646 to replicate within the tumor was determined, a low dose-response relationship over the effective dose range by means of which the degree of tumor inhibition, exerted by the low doses of YS4646, approximated the level of tumor inhibition achieved at higher doses.

This suggests that, even at low doses, it is possible to obtain significant clinical efficacy as long as the bacteria reaches the tumor and accumulates within it. Dose below 1 x 10 u.f.c. / mouse provide inconsistent results, possibly due to competition between the ability of YS1646 to arrive and colonize the tumor compared to the ability of animals to eliminate YS1646. The efficacy of YS1646 was evaluated in mice previously implanted with B16-F10 melanoma. In this study a single IV dose of YS1646 at 104, 105 or 106 u.f.c. / mouse significantly reduced tumor size when compared to control treatment, and the degree of tumor size reduction was dose related. The efficacy observed with the highest dose of YS1646 was higher than with the positive control, CYTOXAN ™ (also known as cyclophosphamide), while the efficacy with the average TM dose of YS1646 was equivalent to that of CYTOXAN. It is important to note that the efficacy induced by YS1646 was induced by a single IV dose, whereas that induced by CYTOXAN TM was multiple IV doses (administered weekly for 3 weeks). The ability of YS1646 to inhibit tumor growth, as a function of dose, was examined over a range of doses administered from 1 x 10 to 1 x 10 u. f.c. /mouse. Each dosage group was composed of 10 tumor-bearing animals, which were chosen at random before the administration of the bacteria. Mice were administered with bacteria on day 7, and tumor volumes were measured on days 10, TM 13, 17, 20 and 24. By comparison, CYTOXAN (cyclophosphamide) was administered once a week in a dose of 200 mg / kg, starting on day 7 as well. The average tumor volumes for each group on day 24 are presented in Table IV.

Table IV.

The differences observed between individual groups were considered significant when analyzed by the analysis of the Wilcoxon sign classification test, or by a two-tailed t-test. As indicated in Table IV, the increase in tumor inhibition was observed with increasing doses of YS1646. We found that all doses produced significant antitumor activity (T / C less than or equal to 42%), as defined by the Drug Evaluation Branch of the Division of Cancer Treatment, National Cancer Institute (Bethesda, MD) (Vendetti, JM , Preclinical drug evaluation: rationale and methods, Semin. Oncol., 8: 349-361; (1981), and doses of 1 x 105 cfu / mouse gave equivalent or better results than cyclophosphamide. YS1646 and tumor inhibition due to the ability of YS1646 to replicate preferentially within the tumor, which gives rise to greater than expected potency at lower doses.Intravenous administration of YS1646, an attenuated strain of Salmonella typhimurium, gave rise to selective replication within tumors, and concomitant inhibition of tumor growth Between the doses of inoculum from 1 x 10 to 1 x 10 cfu / mouse, a dose-response was obtained for growth inhibition d e tumor in the range from 78% to 94% inhibition of tumor growth. At the highest inoculum doses, the level of inhibition of tumor growth was comparable or better than that achieved by the optimal treatment with cyclophosphamide. 8. 4 VIRULENCE At a dose of 1 x 106 u. f.c. / mouse, YS1646 does not cause lethality, in contrast to the wild-type strain of ATCC 14028 origin, which causes 100% mortality at a 2 Ho i io dose. f.c./r? t t .. This indicates cue YS1646 is more than 10,000% less virulent than the wild type strain of 4 origin. The antitumor efficacy was observed in doses of 10 to 10 u. f.c. / mouse, while the lethality was not observed until the dose was > 10 u.f.c. /mouse. The dose that induces mortality from 1 to 100% greater than the dose that induces antitumor efficacy (see FIGURE 18). 8. 5 ANTIBIOTIC SUPPRESSION OF MORTALITY INDUCED BY YS1646 AFTER LETHAL INFECTION The ability of ampicillin and ciprofoxacin to suppress infection by YS1646 was evaluated by determining the ability of antibiotics to prevent mortality in C57BL / 6 mice inoculated with 5 x 10 u.f.c. (LD50 equivalent). The groups were divided into the following treatment categories: 1) untreated control, 2) treated with ampicillin, 3) treated with ciprofloxacin and 4) treated with ciprofloxacin and ampicillin. The antibiotic treatment was started 3 days after the administration of the bacteria and the animals were observed daily for appearance and mortality for 14 days. The results presented show that the use of antibiotics was able to suppress mortality after lethal bacterial infections (see FIGURE 18). 9. DEPOSIT OF MICROORGANISMS The following microorganisms were deposited with the American Type Culture Collection (ATCC), 10801 University Blvd. Manassas, VA 20110-2209, on September 9, 1997, and have been assigned with the access numbers indicated: Microorganisms Access ATCC No. YS8211 202026 YS1629 202025 YS1170 202024 The following microorganisms were deposited with the American Type Culture Collection (ATCC), 10801 University Blvd. Mauassas, VA 20110-2209, on August 25, 1998, and have been assigned with the access numbers indicated: Microorganisms Access ATCC No. YS1646 202165 YS1456 202164 The invention claimed and described herein is not limited in the scope by the specific modalities, it is included but not limited to the modalities of the deposited microorganism, here described since these modalities are proposed as illustrations of the different aspects of the invention. invention. In fact, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the aforementioned description. These modifications are also intended to fall within the scope of the appended claims. In the present, numerous references are cited, the complete descriptions of which are incorporated in their completeness as reference.

You MICROORGANISMS Optional sheet in connection with the microorganism mentioned on page 4_5. lines 10-22 of description1. T. IDENTIFICATION OF DEPOSIT2 5 Other deposits are identified on an additional sheet3 Name of depository institution American Type Culture Collection Address of depository institution (including zip code and country) 10 10801 University Blvd. Manassas, VA 20110-2209" EU Deposit date September 9, 1997 Access number 202026 15 B ADDITIONAL INDICATIONS (leave blank if not applicable.) This information continues on an attached sheet.

C DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not all designated States) 20 D SEPARATE PRESENTATION OF THE INDICATIONS (leave blank if it is not applicable) The indications shown below will be subsequently presented to the International Bureau (specify the general nature of the indications, for example, "deposit access number"). E. [x] this sheet was received with the International application when it was submitted (to be marked by the receiving office) signed Authorized Official [] the date of receipt (of the applicant) by the International Bureau was authorized Officer International application No .: PCT / / Form PCT / RO / 134 (continued) American Type Culture Collection 10801 University Blvd. Manassas, VA 20110-2209 EU Access no. : date of deposit 202025 September 9, 1997 202024 September 9, 1997 202465 August 25, 1998 202464 August 25, 1998 ~! C LIST OF SEQUENCES < 110 > VION PHARMACEUTICALS, INC. YALE UNIVERSITY < 120 > BACTERIA DIRECTED TO TUMOR. GENETICALLY MODIFIED, WITH REDUCED VIRULENCE < 130 > 8002-042 < 140 > PCT / US98 / < 141 > 1998-09-09 / < 160 > 4 < 170 > Patentln Ver. 2.0 < 210 > 1 < 211 > 2019 < 212 > DNA < 213 > SALMONELLA < 220 > < 221 > CDS < 222 > (244) .. (1212) < 400 > 1 gatcaaccag caagccgtta accctctgac agcaaaattg ccgcgcacgg aagatctaac 60 ggggtcagat cgtcgtgaat acctggcaca ggtgaaagag gttctgccgc aactgcgctt 120 cgattaacaa atgcgctgac agagccggta cgcgatgtgt gccggctttt ttgttttgtg 180 tgagacgcag acgtcgctac actattcaca attccttttc gcgtcagcag accctggaaa 240 age atg gaa acc aaa aaa aat aat agat gag tat atc cct gaa ttc gaa 288 Met Glu Thr Lys Lys Asn Asn Ser Glu Tyr lie Pro Glu Phe Glu 1 5 10 15 aaa tcc ttt cgc tat cea cag tat tgg ggc gcc tgg ttg ggc gcg gcg 336 Lys Ser Phe Arg Tyr Pro Gln Tyr Trp Gly Wing Trp Leu Gly Allah Wing 20 25 30 gca atg gcg ggg ate, gca tta here ccg gca tea tcc cgc gac cct ttg 384 Wing Met Wing Gly lie Wing Leu Thr Pro Wing Being Phe Arg Asp Pro Leu 35 40 45 ctg gcg acg ctg ggg cgt ttt gcc gga cgg ctg ggg aag agt tet cgt 432 Leu Ala Thr Leu Gly Arg Phe Ala Gly Arg Leu Gly Lys Ser Ser Arg 50 55 60 cgc cgg gcg cta att aat ctg tcg ttg tgc ttt ccg cag cgt age gaa 480 Arg Arg Ala Leu lie Asn Leu Ser Leu Cys Phe Pro Gln Arg Ser Glu 65 70 75 gct gag cgc gaa gcg att gtc gat gag atg tcc gcc acc gcg cea cag 528 Wing Glu Arg Glu Wing lie Val Asp Glu Met Phe Wing Thr Wing Pro Gln 80 85 90 95 gca atg gcg atg atg gct gag ttg gcg atg cgc ggt ccg aaa aaa att 576 Wing Met Wing Met Met Wing Glu Leu Wing Met Arg Gly Pro Lys Lys He 100 105 HO caá cag cgt gtt gac tgg gaa ggt ctg gag att atc gag gag atg cgt 624 Glr. Gln Arg Val Asp Trp Glu Gly Leu Glu He He flulu Glu Met Arg 115 X20 125 (, cgt aac gac gaa aaa gtc att ttt ctc gta ccg cat ggc tgg ggc gtc 672 Arg Asn Asp Glu Lys Val He Phe Leu Val Pro His Gly Trp Gly Val 5 130 135 140 gac att cea gcc atg ctg atg gcc tet cag ggg caaaa atg gcg gcg Asp He Pro Wing Met Leu Met Wing Gln Gly Gln Lys Met Wing Wing 145 150 155 atg ttt cat aat cag ggt aat ccg gtt ttt gac tat atc tgg aac here 768 Met Phe His Asn Gln Gly Asn Pro Val Phe Asp Tyr He Trp Asn Thr 160 165 170 175 10 gtg cgt cgg cgt tgc ggc gg cgt tgg cat ggg cgt aat gac ggg att Val Arg Arg Arg Phe Gly Gly Arg Leu His Wing Arg Asn Asp Gly He 180, 185 190 aaa ccc ttt att cag tet gtt cgt cag ggc tac tgg ggt tac tac ctg Lys Pro Phe He Gln Ser Val Arg Gln Gly Tyr Trp Gly Tyr Tyr Leu 195 200 205 15 ccg gac cag gat cac ggc ccg gag cat agt gaa ttc gtt gat ttc ttt Pro Asp Gln Asp His Gly Pro Glu His Ser Glu Phe Val Asp Phe Phe .. 210 215 220 gcg here tac aaa gcg acg ctg cct gca att ggt cgg ctg atg aaa gtg 960 Wing Thr Tyr Lys Wing Thr Leu Pro Wing He Gly Arg Leu Met Lys Val 225 230 235 20 tgc cgc gca cgc gtg ata ccg ctt ttc ccg gtg tat aat ggt aaa acg 1008 Cys Arg Ala Arg Val He Pro Leu Phé Pro Val Tyr Asn Gly Lys Thr 240 245 250 255 cat cgc ctg act atc cag att cgc ccg cea atg gac gat ctg ctc acg 1056 His Arg Leu Thr He Gln He Arg Pro Pro Met Asp Asp Leu Leu Thr 260 265 270 gct gac gac cac act ate gcc aga cgg atg aac gaa gag gtc gaa att 1104 Wing Asp Asp His Thr He Wing Arg Arg Met Asn Glu Glu Val Glu He 275 280 285 ttt gtc ggc ecg cat ccg gaa cag tac acc tgg atc ctg aag ctg ctc 1152 Phe Val Gly Pro His Pro Glu Gln Tyr Thr Trp He Leu Lys Leu Leu 290 295 300 aaa acc cgc aag cea ggc gag att cag ccg tat aag cgt aaa gat ctt 1200 Ly- Thr Arg Lys Pro Gly Glu lln Gln Pro Tyr Lys Arg ys > Asp leu 305 310 315 tat ecc atc aaa taaataaagc ctctcgtaag agaggcttta tgctgacaaa 1252 Tyr Pro He Lys 320 t ccctgtacta cctgatgaac aggcgtgggg gagttttaet caacggtcaa aatacgcgtg 1312 gtattggttg aaccgacggt getcatgaea tcgccctggg teaegataac caggtcgccg 1372 gaaaccagat accetttate gegeageaga ttaacagctt catgtgccgc gacaacgcca 1432 tcagccgcgc tatcaaaatg caccggcgtt actccgcgat agagcgcggt caggttcagc 1492 gtgcgttcat ggcgcgacat ggcgaaaatc ggcaggccgg agctgatacg ggaagtcatt agcgeg tac accggattc cgtcatggtg atgatcgcgg taacgccttt cagatggttt 1612 gccgcataca ctgeagacat ggcaatggct tcttcaacgt tgtcgaactg cacgtcgaga 1672 cggtgtttag acacattgat gctggggatt ttttctgcgc ccaggcacac gcgcgccatt gcggcaacgg tttcagaagg atactgaccg gctgcggttt cggcagacag cataaccgca tecgtgccat ecaggacggc gttcgccacg tccatcactt ccgcacgggt cggcatcggg 1852 ttggtgatca tcgactceat catttgcgtt geggtgatga ctgcgcggtt tagctgacgc gcacggcgaa tcagcgcttt ctggatacca accagctccg gatcgccgat ttcaacgccc agatcgccac gtgcgaccat cacaacgtca gaggceagaa tgatatc < 210 > 2 < 211 > 323 < 212 > PRT < 213 > SALMONELLA / < 400 > 2 Met Glu Thr Lys Lys Asn Asn Ser Glu Tyr He Pro Glu Phe Glu Lys 1 5 10 15 Ser Phé Arg Tyr Pro Gln Tyr Trp Gly Wing Trp Leu Gly Wing Wing Wing 20 25 30 Met Wing Gly He Wing Leu Thr Pro Wing Being Phe Arg Asp Pro Leu Leu 35 40 45 Wing Thr Leu Gly Arg Phe Wing Gly Arg Leu Gly Lys Being Ser Arg Arg 50 55 60 Arg Ala Leu He Asn Leu Ser Leu Cys Phe Pro Gli? Arg Ser Glu Ala 65 70 75 80 Glu Arg Glu Wing He Val Asp Glu Met Phe Ale Thr ALa Pro Gin Wing 85 90 95 Met Wing Met Met Wing Glu Leu Wing Met Arg Gly Pro Lys Lys He Gln 100 105 110 ot Gln Arg Val Asp Trp Glu Gly Leu Glu He He Glu Glu Met Arg Arg 115 120 125 A = n Asp Glu Lys Val He Phe Leu Val Pro Hís Gly Trp Gly Val Asp 130 135 140 (< He Pro Wing Met Leu Met Wing Wing Gln Gly Gln Lys Met Wing Wing Met 5 145 150 155 160 Phe His Asn Gln Gly Asn Pro Val Phe Asp Tyr He Trp Asn Thr Val 165 170 175 Arg Arg Arg Phe Gly Gly Arg Leu His Wing Arg Asn Asp Gly He Lys 180 185 190 10 Pro Phe He Gln Ser Val Arg Gln Gly Tyr Trp Gly Tyr Tyr Leu Pro 195 200 205 Asp Gln Asp His Gly Pro Glu His Ser Glu Phe Val Asp phe Phe Ala 210 215 220 Thr Tyr Lys Wing Thr Leu Pro Wing He Gly Arg Leu Met Lys Val Cys 15 225, 230 235 240 Arg Ala Arg Val He Pro Leu Phe Pro Val Tyr Asn Gly Lys Thr His 245 250 255 Arg Leu Thr He Gln He Arg Pro Pro Met Asp Asp Leu Leu Thr Ala 260 265 270 Asp Asp His Thr He Wing Arg Arg Met Asn Glu Glu Val Glu He Phe 275 280 285 Val Gly Pro His Pro Glu Gln Tyr Thr Trp He Leu Lys Leu Leu Lys 0 295 300 Thr Arg Lys Pro Gly Glu He Gln Pro Tyr Lys Arg Lys Asp Leu Tyr 305 310 315 - 3 0 Pro He Lys < 210 > 3 < 211 > 21 < 212 > DNA (»<213> Artificial sequence 5 <220> <223> Description of the artificial sequence: primer < 400 > 3 10 gttgactggg aaggtctgga g 21 < 210 > 4 < 211 > 20 < 212 > DNA 15 < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: primer < 400 > 4 ctgaccgcgc tctatcgcgg 20

Claims (10)

1. A mutant of Salmonella sp containing a genetically modified msbB gene in which the mutant Salmonella is capable of targeting a solid tumor when administered in vivo.

2 . A mutant Salmonella of claim 1, which is designated YS1629 and has ATCC accession No. 202025 or is designated YS1170 and has ATCC accession No. 202024 or is designated YS8211 and has ATCC accession No. 202026.

3. Salmonella mutant of the claim 1, which is selected from the group consisting of Salmonella typhi, Salmonella choleraeusis, and Salmonella enteri tidis.

4. The mutant Salmonella of claim 1, which expresses an altered lipid A molecule.

5. The mutant Salmonella of claim 1, which includes expression of TNFa at about 5% to about 40% of that induced by Salmonella sp wild type.

6. The mutant Salmonella of claim 1 which induces TNFa expression at about 10% up to about 35% of that induced by a wild-type Salmonella sp.

7. A purified lipopolysaccharide from mutant Salmonella of claim 1 that induces TNFα expression to less than or equal to 0.001 percent of that induced by Salmonella sp wild type.

8. The mutant Salmonella of claim 1, wherein a chelating compound inhibits growth by about 90% compared to the growth of a wild-type Salmonella sp.

9. The mutant Salmonella of claim 1, wherein a chelating compound inhibits growth by about 99% compared to the growth of a wild type Salmonella sp. The mutant Salmonella of claim 1, wherein a chelating compound inhibits growth more than 99% compared to the growth of the wild type Salmonella sp. 11. The mutant Salmonella of claim 8, 9 or 10, wherein the chelating compound is selected from the group consisting of ethylenediaminetetraacetic acid (EDTA), ethylene glycol-bis (ß-aminoethyl ether) N, N, N ', N -tetraacetic (EGTA) and sodium citrate. 12. The mutant Salmonella of claim 1 which survives in macrophages in about 50% to about 30% of the survival level of a Salmonella sp wild type. 13. The mutant Salmonella of claim 1 which survives in macrophages at about 30% to about 10% of the survival level of a Salmonella sp wild type. The mutant Salmonella of claim 1, which survives in macrophages at about 10% to about 1% of the survival level of a Salmonella sp wild type. 15. A method for inhibiting the growth or reducing the volume of a solid tumor cancer, consists of administering an effective amount of the mutant Salmonella sp of claim 1 to a patient having a solid tumor cancer. 16. The method according to claim 15, wherein the mutant Salmonella is selected from the group consisting of Salmonella typhi, Salmonella choleraeusis, and Salmonella J-a enteri tidis. 17. The method according to claim 15, wherein the mutant Salmonella expresses an altered lipid A molecule. 18. The method according to claim 15, wherein the mutant Salmonella induces the expression of TNFa in about 5% to about 40% of that induced by Salmonella sp wild type. 19. The method according to claim 15, wherein the mutant Salmonella induces TNFa expression in about 10% to about 35% of that induced by a Salmonella sp wild type. 20. The method according to claim 15, wherein the lipopolysaccharide of the mutant Salmonella that (• induces the expression of TNFa unless or equal to 0.001 per 5 percent of the one that is induced by a Salmonella sp wild type. The method according to claim 15, wherein a chelating compound inhibits the growth of mutant Salmonella by approximately 90% compared to 10 the growth of wild type Salmonella sp. 22. The method according to claim 15, wherein a chelating compound inhibits the growth of mutant Salmonella by approximately 99% compared to the growth of a wild-type Salmonella sp. 23. The method according to claim 15, wherein a chelating compound inhibits the growth of mutant Salmonella by more than 99% compared to the growth of a wild-type Salmonella sp. 24. The method according to claim 21, 22 or 20 23, wherein the chelating compound is selected from the group consisting of EDTA, EGTA and sodium citrate. 25. The method according to claim 15, wherein the mutant Salmonella survives in macrophages by approximately 50% at 25 approximately 30% of the survival level of a Salmonella sp wild type. 26. The method according to claim 15, wherein the mutant Salmonella survives in macrophages in about 30% to about 10% of the survival level of a Salmonella sp wild type. 27. The method according to claim 15, wherein mutant Salmonella survives in macrophages at about 10% to about 1% of the survival level of wild-type Salmonella sp. 28. The method according to claim 15, wherein the solid tumor cancer is melanoma. 29. The method according to claim 15, wherein the solid tumor cancer is colon carcinoma. 30. The method according to claim 15, wherein, solid tumor cancer is selected from the group consisting of lung cancer, liver cancer, kidney cancer, prostate cancer, and breast cancer. 31. A pharmaceutical composition containing an amount of mutant Salmonella of claim 1 effective to inhibit the growth or reduce the volume of a solid tumor cancer; and a pharmaceutically acceptable carrier. 32. A mutant Salmonella sp containing a genetically modified _t¡s-_3 gene and a genetically modified gene in which Salmonella sp mutant is capable of