AU719769B2 - Salmonella vaccines - Google Patents

Description

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Applicant(s): THE GENERAL HOSPITAL CORPORATION and PRESIDENT AND FELLOWS OF HARVARD COLLEGE Invention Title: SALMONELLA VACCINES The following statement is a full description of this invention, including the best method of performing it known to me/us: SALMONELLA VACCINES Background of the Invention The invention relates to vaccines.

This invention was made with Government support under Grant No. AI30479 and Grant No. 00917 awarded by the National Institutes of Health. The Government has certain rights in the invention.

Enteric fevers and diarrheal diseases, e.g., typhoid fever and cholera, are major causes of morbidity and mortality throughout the developing world, Hook et al., 1980, In Harrison's Principles of Internal Medicine, 9th Ed., 641-848, McGraw Hill, New York. Traditional approaches to the development of vaccines for bacterial diseases include the parenteral injection of purified components or killed organisms. These parenterally administered vaccines require technologically advanced Spreparation, are relatively expensive, and are often, 20 because of dislike for needle-based injections, resisted by patients. Live oral vaccine strains have several advantages over parenteral vaccines: low cost, ease of administration, and simple preparation.

The development of live vaccines has often been limited by a lack of understanding of the pathogenesis of the disease of interest on a molecular level. Candidate live vaccine strains require nonrevertable genetic alterations that affect the virulence of the organism, but not its induction of an immune response. Work defining the mechanisms of toxigenesis of Vibrio cholerae has made it possible to create live vaccine strains based on deletion of the toxin genes, Mekalanos et al., 1983, Nature 306:551, Levine et al., 1988, Infect. Immun.

56:161.

Recent studies have begun to define the molecular basis of Salmonella typhimurium macrophage survival and 2 virulence, Miller et al., 1989, Proc. Natl. Acad. Sci.

USA 86:5054, hereby incorporated by reference.

Salmonella typhimurium strains with mutations in the positive regulatory regulon phoP are markedly attenuated in virulence for BALB/c mice. The phoP regulon is composed of two genes present in an operon, termed phoP and phoQ. The phoP and phoQ gene products are highly similar to other members of bacterial two-component transcriptional regulators that respond to environmental stimuli and control the expression of a large number of other genes. A mutation at one of these phoP regulatory region regulated genes, pagC, confers a virulence defect.

Strains with pagC, phoP, or phoQ mutations afford partial Sprotection to subsequent challenge by wild-type S.

15 typhimurium.

*Salmonella species cause a spectrum of clinical disease that includes enteric fevers and acute gastroenteritis, Hook et al., 1980, supra. Infections with Salmonella species are more common in 20 immunosuppressed persons, Celum et al., 1987, J. Infect.

Dis. 156:998. S. typhi, the bacterium that causes typhoid fever, can only infect man, Hook et al., 1980, supra. The narrow host specificity of S. typhi has resulted in the extensive use of S. enteriditis 25 typhimurium infection of mice as a laboratory model of typhoid fever, Carter et al., 1984 J. Exp. Med. 139:1189.

S. typhimurium infects a wider range of hosts, causing acute gastroenteritis in man and a disease similar to typhoid fever in the mouse and cow.

Salmonella infections are acquired by oral ingestion. The organisms, after traversing the stomach, replicate in the small bowel, Hornik et al., 1970, N.

Eng. J. Med. 283:686. Salmonella are capable of invasion of the intestinal mucosal cells, and S. typhi can pass through this mucosal barrier and spread via the Peyer's 3 patches to the lamina propria and regional lymph nodes.

Colonization of the reticuloendothelial cells of the host then occurs after bacteremia. The ability of S. typhi to survive and replicate within the cells of the human reticuloendothelial system is essential to its pathogenesis, Hook et al., 1980, supra, Hornick et al., 1970, supra, and Carter et al., 1984, supra.

Immunity to Salmonella typhi involves humoral and cell-mediated immunity, Murphy et al., 1987, J. Infect.

Dis. 156:1005, and is obtainable by vaccination, Edelman et al., 1986, Rev. Inf. Dis. 8:324. Recently, human field trials demonstrated significant protective efficacy *against S. typhi infection after intramuscular vaccination with partially purified Vi antigen, Lanata et 15 al., 1983, Lancet 2:441. Antibody-dependent enhancement of S. typhi killing by T cells has been demonstrated in individuals who received a live S. typhi vaccine, indicating that these antibodies may be necessary for the host to generate a cell-mediated immune response, Levine 20 et al., 1987, J. Clin. Invest. 79:888. The cell-mediated immune response is important in typhoid immunity since killed vaccines that do not induce this immune response are not protective in man, Collins et al., 1972, Infect.

Immun. 41:742.

25 Summary of the Invention The invention provides a Salmonella vaccine which does not cause transient bacteremia. In general, the invention features a bacterial cell, preferably a Salmonella cell, a S. typhi, S. enteritidis typhimurium, or S. cholerae-suis cell, the virulence of which is attenuated by a first mutation in a PhoP regulon and a second mutation in an aromatic amino acid synthetic gene. As used herein, PhoP regulon is defined as a DNA which comprises a unit of Salmonella virulence gene expression characterized by two regulatory genes, phoP 4 and phoQ, and structural genes, the expression of which is regulated by phoP and phoQ, phoP regulatory region repressed genes (prg) or phoP regulatory region activated genes (pag). Such a bacterial cell can be used as a vaccine to immunize a mammal against salmonellosis.

The Salmonella cell may be of any serotype, e.g., S. typhimurium, S. paratyphi A, S. paratyphi B, S.

paratyphi C, S. pylorum, S. dublin, S. heidelberg, S.

newport, S. minnesota, S. infantis, S. virchow, or S.

panama.

The first mutation may be a non-revertable null S* mutation in the PhoP/PhoQ locus. Preferably, the :mutation is a deletion of at least 100 nucleotides; more preferably, the mutation is a deletion of at least 500 15 nucleotides; even more preferably, the mutation is a 0 deletion of at least 750 nucleotides; and, most preferably, the mutation is a deletion of nucleotides 376 to 1322 of the PhoP/PhoQ regulatory locus.

The second mutation may be a non-revertable null 20 mutation in an aroA locus or a non-revertable null mutation in an aroC/aroD locus, or another locus involved in the biosynthesis of aromatic amino acids.

To further attenuate the virulence of the bacterial cell of the invention, the cell may contain yet 25 another mutation, a deletion, in a non-aromatic amino acid synthetic gene, a mutation which renders the cell auxotrophic for a non-aromatic amino acid, e.g., histidine. In preferred embodiments, the bacterial cell of the invention is a S. typhi cell with the genotype AroA", His", PhoP/PhoQ", TyLH445.

The invention may also include a Salmonella cell, the virulence of which is attenuated by the constitutive expression of a gene under the control of a two-component regulatory system. In preferred embodiments the constitutive expression is the result of a mutation at a 5 component of the two-component regulatory system. In preferred embodiments the bacterial cell includes a second mutation which attenuates virulence.

In yet other preferred embodiments of the vaccine the two-component regulatory system is the phoP regulatory region, and the gene under the control of the two-component system is a phoP regulatory region regulated gene, a prg gene, prgA, prgB, prgC, prgE, or prgH, or pag gene, pagC. In preferred embodiments constitutive expression is the result of a change or mutation, a deletion, (preferably a nonrevertible mutation) at the promoter of the regulated .gene or of the phoP regulatory region, a mutation Sin the phoQ or the phoP gene, the PhoPc mutation.

15 In another aspect, the invention features a vaccine including a bacterial cell which is attenuated by decrease of expression of a virulence gene under control of a phoP regulatory region, a prg gene, e.g., *prgA, prgB, prgC, prgE, or prgH.

In preferred embodiments of the vaccine the Salmonella cell includes a first mutation, a deletion, which attenuates virulence, a mutation in 5 a phoP regulatory region gene, a mutation in the phoP or phoQ gene, PhoPc, or a mutation in a phoP regulatory region regulated gene, and a second mutation which attenuates virulence, a mutation in an aromatic amino acid synthetic gene, an aro gene, a mutation in a phoP regulatory region regulated gene, a mutation in a prg gene, prgA, prgB, prgC, prgE, or prgH, or pag locus, a pagC mutation.

In yet other preferred embodiments the bacterial cell includes a first mutation in a phoP regulatory region gene and a second mutation in an aromatic amino acid synthetic gene, e.g, an aro gene.

In another aspect, the invention features a 6 vaccine, preferably a live vaccine, including a bacterial cell, the virulence of which is attenuated by a mutation, a deletion, in a gene under the control of a twocomponent regulatory system. In preferred embodiments the bacterial cell includes a virulence attenuating mutation in a second gene, in an aromatic amino acid synthetic gene, an aro gene.

In yet other preferred embodiments of the vaccine the bacterial cell is a Salmonella cell, the twocomponent regulatory system is the phoP regulatory region, and the gene under its control is a prg gene, e.g. prgA, prgB, prgC, prgE, or prgH, or a pag gene, the pagC gene.

In another aspect the invention features a 15 vaccine, preferably a live vaccine, including a Salmonella cell a S. typhi, S. enteritidis Styphimurium, or S. cholerae-suis cell, including a first virulence attenuating mutation in an aromatic amino acid biosynthetic gene, an aro gene, and a second 20 virulence attenuating mutation in a phoP regulatory region gene, a phoP" mutation.

In another aspect the invention features a bacterial cell, or a substantially purified preparation thereof, preferably a Salmonella cell, a S. typhi, 25 S. enteritidis typhimurium, or S. cholerae-suis cell, which constitutively expresses a gene under the control of a two-component regulatory system and which includes a virulence attenuating mutation, a deletion, which does not result in constitutive expression of a gene under the control of the two-component regulatory system.

In preferred embodiments the bacterial cell includes a mutation in a component of the two-component regulatory system.

In preferred embodiments the bacterial cell is a Salmonella cell which expresses a phoP regulatory region 7 regulated gene constitutively (the constitutive expression preferably caused by a mutation, preferably a non-revertible mutation, a deletion in the phoP regulatory region, a mutation in the phoQ or phoP gene, phoPc), and which includes a virulence attenuating mutation, preferably a non-revertible mutation, a deletion, preferably in an aromatic amino acid synthetic gene, an aro gene, or in a phoP regulatory region regulated gene, a prg gene, prgA, prgB, prgC, prgE, or prgH or pag gene, e.g., pagC which does not result in the constitutive expression "of a gene under the control of the phoP regulatory region.

9@ In another aspect, the invention features a 15 bacterial cell, or a substantially purified preparation thereof, a Salmonella cell, a S. typhi cell, an S. enteritidis typhimurium or a S. cholerae-suis cell, including a virulence attenuating mutation in a gene regulated by a two-component regulatory system. In 20 preferred embodiments the virulence attenuating mutation is in a phoP regulatory region regulated gene, a prg gene, prgA, prgB, prgC, prgE, or prgH or pag gene, pagC.

In preferred embodiments the bacterial cell 25 includes a second mutation, in an aromatic amino acid synthetic gene, an aro gene, in a phoP regulatory region gene, the phoP or phoQ genes, or in a phoP regulating region regulated gene, a prg gene, prgA, prgB, prgC, prgE, or prgH or a pag gene, pagC, which attenuates virulence but which does not result in constitutive expression of a phoP regulatory region regulated gene.

The invention also features a live Salmonella cell, or a substantially purified preparation thereof, a S. typhi, S. enteriditis typhimurium, or 8 S. cholerae-suis cell, in which there is inserted into a virulence gene, a gene in the phoP regulating region, or a phoP regulating region regulated gene, e.g., a prg gene, prgA, prgB, prgC, prgE, or prgH or a pag locus, pagC, a gene encoding a heterologous protein, or a regulatory element thereof.

In preferred embodiments the live Salmonella cell carries a second mutation, an aro mutation, e.g., an aroA mutation, aroA' or aroADEL407, that attenuates virulence.

In preferred embodiments the DNA encoding a heterologous protein is under the control of an ic environmentally regulated promoter. In other preferred g*O* embodiments the live Salmonella cell further includes a 15 DNA sequence encoding T7 polymerase under the control of an environmentally regulated promoter and a T7 transcriptionally sensitive promoter, the T7 transcriptionally sensitive promoter controlling the f. expression of the heterologous antigen.

20 The invention also features a vector capable of integrating into the chromosome of Salmonella including: •a first DNA sequence encoding a heterologous protein; a second (optional) DNA sequence encoding a marker a selective marker, a gene that confers resistance 25 for a heavy metal resistance or a gene that complements an auxotrophic mutation carried by the strain to be transformed; and a third DNA sequence, a phoP regulon encoded gene, a prg gene, prgA, prgB, prgC, prgE, or prgH or a pag locus, pagC, encoding a phoP regulatory region regulated gene product necessary for virulence, the third DNA sequence being mutationally inactivated.

In other preferred embodiments: the first DNA sequence is disposed on the vector so as to mutationally inactivate the third DNA sequence; the vector cannot 9 replicate in a wild-type Salmonella strain; the heterologous protein is under the control of an environmentally regulated promoter; and thevector further includes a DNA sequence encoding T7 polymerase under the control of an environmentally regulated promoter and a T7 transcriptionally sensitive promoter, the T7 transcriptionally sensitive promoter controlling the expression of the heterologous antigen.

In another aspect the invention includes a method of vaccinating an animal, a mammal, a human, against a disease caused by a bacterium, e.g., Salmonella, including administering a vaccine of the invention.

The invention also includes a vector including DNA 15 which encodes the pagC gene product; a cell transformed 0 with the vector; a method of producing the pagC gene product including culturing the transformed cell and purifying the pagC gene product from the cell or culture medium; and a purified preparation of the pagC gene 20 product.

In another aspect the invention includes a method of detecting the presence of Salmonella in a sample including contacting the sample with pagC encoding DNA and detecting the hybridization of the pagC encoding DNA 25 to nucleic acid in the sample.

The invention also includes a vector including DNA which encodes the prgH gene product; a cell transformed with the vector; a method of producing the prgH gene product including culturing the transformed cell and purifying the prgH gene product from the cell or culture medium; and a purified preparation of the prgH gene product.

In another aspect the invention includes a method of detecting the presence of Salmonella in a sample including contacting the sample with prgH encoding DNA 10 and detecting the hybridization of the prgH encoding DNA to nucleic acid in the sample.

In another aspect the invention features a method of attenuating the virulence of a bacterium, the bacterium including a two-component regulatory system, including causing a gene under the control of the twocomponent system to be expressed constitutively. In preferred embodiments the bacterium is Salmonella, e.g., S. typhi, S. enteritidis typhimurium, or S. choleraesuis, and the two-component system is the phoP regulatory region.

In yet another aspect, the invention features a substantially pure DNA which includes the sequence given in SEQ ID NO:5 or a fragment thereof.

15 The invention also includes a substantially pure DNA which includes a sequence encoding pagD, e.g., nucleotides 91 to 354 of SEQ ID NO:5 (pagD open reading frame (ORF)) and degenerate variants thereof that encode a product with essentially the amino acid sequence given 0 20 in SEQ ID NO:6, as well as the pagD ORF and its 5' noncoding region, nucleotides 4 to 814 of SEQ ID which contains the pagD promoter. DNA in the region 0 between the pagC ORF and the pagD ORF (nucleotides 4 to 814 of SEQ ID NO:15), DNA which includes the pagC 25 promoter (nucleotides 562 to 814 of SEQ ID NO:15), and DNA which includes the pagD promoter alone (nucleotides 4 to 776 of SEQ ID NO:15) are also within the claimed invention.

The invention also includes a substantially pure DNA which includes a sequence encoding envE, e.g., nucleotides 1114 to 1650 of SEQ ID NO:5 (envE ORF) and degenerate variants thereof that encode a product with essentially the amino acid sequence given in SEQ ID NO:7.

Another aspect of the invention features a substantially pure DNA which includes a sequence encoding 11 msgA, nucleotides 1825 to 2064 of SEQ ID NO:5 (msgA ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID NO:8, as well as the msgA ORF with its 5' noncoding region, nucleotides 1510 to 1824 of SEQ ID containing the msgA promoter. Also within the invention is a substantially pure DNA comprising the msgA promoter alone (nucleotides 1510 to 1760 of SEQ ID In yet another aspect, the invention features a substantially pure DNA which includes a sequence encoding envF, nucleotides 2554 to 3294 of SEQ ID NO:5 (envF ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID NO:9, as well as the envF ORF with its 5' non- 15 coding region, nucleotides 2304 to 2553 of SEQ ID which contains the envF promoter.

Also within the invention is a substantially pure DNA which includes the sequence given in SEQ ID NO:10 or S* a fragment thereof.

20 The invention also includes a substantially pure DNA which includes a sequence encoding prgH, e.g., nucleotides 688 to 1866 of SEQ ID NO:10 (prgH ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID 25 NO:11, as well as the prgH ORF with its promoter region (nucleotides 1 to 689 of SEQ ID The invention also includes a substantially pure DNA which includes a sequence encoding prgI, e.g., nucleotides 1891 to 2133 of SEQ ID NO:10 (prgI ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID NO:12, as well as the prgI ORF with its promoter region (nucleotides 1 to 689 of SEQ ID In another aspect, the invention features a substantially pure DNA which includes a sequence encoding 12 prgJ nucleotides 2152 to 2457 of SEQ ID NO:10 (prgJ ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID NO:13, as well as the prgJ ORF and its promoter region (nucleotides 1 to 689 of SEQ ID In yet another aspect, the invention features a substantially pure DNA which includes a sequence encoding prgK, nucleotides 2456 to 3212 of SEQ ID (prgK ORF) and degenerate variants thereof which encode a product with essentially the amino acid sequence given in SEQ ID NO:14, as well as the prgK ORF with its promoter region (nucleotides 1 to 689 of SEQ ID The invention also encompasses a bacterial cell the virulence of which is attenuated by a mutation, e.g., 15 a deletion, in one or more genes selected from the group consisting of pagD, pagE, pagF, pagG, pagH, pagI, pagJ, S pagK, pagL, pagM, pagN, pagP, envE, and envF. Also included is a bacterial cell which is attenuated by a mutation, e.g, a deletion, in one or more genes selected 20 from the group consisting of pagC, pagD, pagJ, pagK, pagM, and msgA. A bacterial cell, the virulence of which is attenuated by a mutation, a deletion, in one or more genes selected from the group consisting of prgH, prgI, prgJ, and prgK is also within the claimed 25 invention.

Two-component regulatory system, as used herein, refers to a bacterial regulatory system that controls the expression of multiple proteins in response to environmental signals. The two-components referred to in the term are a sensor, which may, sense an environmental parameter and in response thereto promote the activation, e.g. by promoting the phosphorylation, of the second component, the activator. The activator affects the expression of genes under the control of the two-component system. A two-component system can 13 include, a histidine protein kinase and a phosphorylated response regulator, as is seen in both gram positive and gram negative bacteria. In E. coli, 10 kinases and 11 response regulators have been identified. They control chemotaxis, nitrogen regulation, phosphate regulation, osmoregulation, sporulation, and many other cellular functions, Stock et al., 1989 Microbiol. Rev. 53:450-490, hereby incorporated by reference. A two-component system also controls the virulence of Agrobacterium tumefasciens plant tumor formation, Leroux et al. EMBO J 6:849-856, hereby incorporated by reference). Similar virulence regulators are involved in the virulence of Bordetella pertussis Arico et al., 1989, Proc. Natl. Acad. Sci. USA 86:6671- 15 6675, hereby incorporated by reference, and Shigella flexneri, Bernardini et al., 1990, J. Bact. 172:6274- 6281, hereby incorporated by reference.

Environmentally regulated, as used herein refers to a pattern of expression wherein the expression of a 20 gene in a cell depends on the levels of some characteristic or component of the environment in which the cell resides. Examples include promoters in biosynthetic pathways which are turned on or off by the level of a specific component or components, iron, 25 temperature responsive promoters, or promoters which are expressed more actively in specific cellular compartments, in macrophages or vacuoles.

A vaccine, as used herein, is a preparation including materials that evoke a desired biological response, an immune response, in combination with a suitable carrier. The vaccine may include live organism, in which case it is usually administered orally, or killed organisms or components thereof, in which case it is usually administered parenterally. The cells used for the vaccine of the invention are preferably alive and 14 thus capable of colonizing the intestines of the inoculated animal.

A mutation, as used herein, is any change (in comparison with the appropriate parental strain) in the DNA sequence of an organism. These changes can arise spontaneously, by chemical, energy X-ray, or other forms of mutagenesis, by genetic engineering, or as a result of mating or other forms of exchange of genetic information. Mutations include base changes, deletions, insertions, inversions, translocations or *u *duplications.

A mutation attenuates virulence if, as a result of r% the mutation, the level of virulence of the mutant cell «a is decreased in comparison with the level in a cell of 15 the parental strain, as measured by a significant at least 50%) decrease in virulence in the mutant strain compared to the parental strain, or a significant at least 50%) decrease in the amount of the polypeptide identified as the virulence factor in 20 the mutant strain compared to the parental strain.

A non-revertible mutation, as used herein, is a .mutation which cannot revert by a single base pair change, deletion or insertion mutations and mutations that include more than one lesion, a 25 mutation composed of two separate point mutations.

The phoP regulatory region, as used herein, is a two-component regulatory system that controls the expression of pag and prg genes. It includes the phoP locus and the phoQ locus.

phoP regulatory region regulated genes, as used herein, refer to genes such as pag and prg genes.

pag, as used herein, refers to a gene which is positively regulated by the phoP regulatory region.

prg, as used herein, refers to a gene which is negatively regulated by the phoP regulatory region.

15 An aromatic amino acid synthetic gene, as used herein, is a gene which encodes an enzyme which catalyzes a step in the synthesis of an aromatic amino acid. aroA, aroC, and aroD are examples of such genes in Salmonella.

Mutations in these genes can attenuate virulence without the total loss of immunogenicity.

Abnormal expressions, as used herein, means expression which is higher or lower than that seen in wild type.

Heterologous protein, as used herein, is a protein that in wild type, is not expressed or is expressed from a different chromosomal site, a heterologous oooo protein is one encoded by a gene that has been inserted S" into a second gene.

15 Virulence gene, as used herein, is a gene the inactivation of which results in a Salmonella cell with less virulence than that of a similar Salmonella cell in which the gene is not inactivated. Examples include the Se phoP, pagC, prgH genes.

A marker, as used herein, is gene product the presence of which is easily determined, a gene eoe product that confers resistance to a heavy metal or a gene product which allows or inhibits growth under a given set of conditions.

Purified preparation, as used herein, is a preparation, of a protein, which is purified from the proteins, lipids, and other material with which it is associated. The preparation is preferably at least 2-10 fold purified.

Constitutive expression, as used herein, refers to gene expression which is modulated or regulated to a lesser extent than the expression of the same gene in an appropriate control strain, a parental or in wildtype strain. For example, if a gene is normally repressed under a first set of conditions and derepressed 16 under a second set of conditions constitutive expression would be expression at the same level, the repressed level, the derepressed level, or an intermediate level, regardless of conditions. Partial constitutive expression is included within the definition of constitutive expression and occurs when the difference between two levels of expression is reduced in comparison in what is seen in an appropriate control strain, a wild-type or parental strain.

A substantially purified preparation of a S. bacterial cell is a preparation of cells wherein contaminating cells without the desired mutant genotype ooo *constitute less than 10%, preferably less than and S more preferably less than 0.1% of the total number of 15 cells in the preparation.

The invention allows for the attenuation of virulence of bacteria and of vaccines that include bacteria, especially vaccines that include live bacteria, by mutations in two-component regulatory systems and/or 20 in genes regulated by these systems. The vaccines of the invention are highly attenuated for virulence but retain o•••o immunogenicity, thus they are both safe and effective.

The vectors of the invention allow the rapid construction 00of strains containing DNA encoding heterologous proteins, 25 antigens. The heterologous protein encoding DNA is chromosomally integrated, and thus stable, unlike plasmid systems which are dependent on antibiotic resistance or other selection pressure for stability. Live Salmonella cells of the invention in which the expression of heterologous protein is under the control of an environmentally responsive promoter do not express the heterologous protein at times when such expression would be undesirable during culture, vaccine preparation, or storage, contributing to the viability of the cells, but when administered to humans or animals, express large 17 amounts of the protein. This is desirable because high expression of many heterologous proteins in Salmonella can be associated with toxicity to the bacterium. The use of only a single integrated copy of the DNA encoding the heterologous protein also contributes to minimal expression of the heterologous protein at times when expression is not desired. In embodiments where a virulence gene, the pagC gene or the prgH gene, contains the site of integration for the DNA encoding the heterologous protein the virulence of the organism is attenuated.

A substantially pure DNA, as used herein, refers to a nucleic acid sequence, segment, or fragment, which has been purified from the sequences which flank it in a naturally occurring state, a DNA which has been removed from the sequences which are normally adjacent to the fragment, the sequences adjacent to the fragment i in the genome in which it naturally occurs. The term also applies to DNA which has been substantially purified from "other components which naturally accompany the DNA, e.g., DNA which has been purified from proteins which naturally accompany it in a cell.

Other features and advantages of the invention will be apparent from the following description of the preferred embodiments and from the claims.

25 For the purposes of this specification it will be clearly understood that the word "comprising" means "including but not limited to", and that the word "comprises" has a corresponding meaning.

30 Description of the Preferred Embodiments The drawings will first be described.

Drawings Fig. 1 is a graph of the survival of Salmonella strains within macrophages.

Fig.2 is a map of the restriction endonuclease sites of the pagC locus.

Fig.3 is a map of the DNA sequence of the pag C region (SEQ ID NO:1).

Fig. 4 is a map of the location of prgH within ,AL\ the H:\Emma\Kep\Specis\91365.98-2.doc 20/03/00 18 hil locus. The arrows indicate the direction of orientation of the neomycin promoter of Tn5B50 insertions within the hil locus and the direction of transcription of the prgHl::TnphoA fusion protein. Restriction endonuclease sites are represented by B, BamHl; H, HindIII; X, XhoI; S, Sacl; V, EcoRV.

Fig. 5 is a DNA sequence from the prgH gene (plasmid pIBO1) (SEQ ID NO:3).

Fig. 6 is a bar graph showing a comparison of the sensitivity of wild type (ATCC 14028), PhoP-null mutant (CS015), and pag::TnphoA mutant strains to NP-1 defensin.

The y-axis represents the Defensin Killing Index (DKI) which is a measure of bacteria killed on exposure to NP- 1. The DKI is defined as the logarithmic function of the 15 ratio of control bacteria to surviving bacteria incubated with NP-1 [DKI=log (CFU without NP-1/CFU with NP-1)].

The individual bars represent the mean and standard error of five separate experiments. The x-axis indicates the allele mutated. The mean DKI for each of the pag::TnphoA 20 strains tested was determined not be different from that of wild type Salmonella. In contrast, the phoP mutant was significantly different (P<0.0001).

Fig. 7 is a diagram showing a partial physical map 2 of the restriction endonuclease sites of the pagC 25 chromosomal region. The mouse 50% lethal doses (LD 50 for strains with transposon insertions in pagD, envE, msgA, and pagC are shown above each gene. Horizontal arrows demonstrate the direction of transcription. Vertical arrows denote TnphoA insertions and the hollow triangle denotes a MudJ insertion. Below the chromosomal map is a representation of the DNA insert in plasmid pCAA9, which was mutagenized with TnphoA and MudJ. Letter designations: A, AccI; C, ClaI; E, EcoRI; H, HpaI; P, PstI; and V, EcoRV.

19 Fig. 8 is a DNA sequence of the region upstream of pagC and the translation of each ORF. The HpaI and Clal sites at the beginning and end of the region are indicated. Shine-Delgarno regions are underlined and stem loop structures (potential Rho-independent terminators) are indicated with a line below and above the sequence. Arrow heads denote the location of the representative transposon insertion within each gene.

Horizontal arrows in the pagD and msgA promoter regions mark the transcriptional start sites, and asterisks mark the -10 and -35 sequences. The consensus lipid attachment site in EnvF is enclosed in brackets. The pagD ORF begins at nucleotide.91 and ends at nucleotide 354 of SEQ ID NO:5; the envE ORF begins at nucleotide 15 1114 and ends at nucleotide 1650 of SEQ ID NO:5; the msgA *6 ORF begins at nucleotid 1825 and ends at nucleotide 2064 of SEQ ID NO:5; and the envF ORF begins at nucleotide 2554 and ends at nucleotide 3294 of SEQ ID Fig. 9 is a DNA sequence containing the prgH, 20 prgI, prgJ, and prgK genes. The start codon (ATG) of each gene is underlined, and the stop codon is indicated .with an asterisk. The prgH ORF begins at nucleotide 688 and ends at 1866 of SEQ ID NO:10; the prgI ORF begins at nucleotide 1891 and ends at nucleotide 2133 of SEQ ID 25 NO:10; the prgJ ORF begins at nucleotide 2152 and ends at nucleotide 2457 of SEQ ID NO:10; and the prgK ORF begins at nucleotide 2454 and ends at nucleotide 3212 of SEQ ID Fig. 10 is a line graph showing the growth rates of the parent Salmonella strain (AroA-) and the vaccine strain (AroA-, PhoP-).

Fig. 11 is a bar graph showing defensin sensitivity of mouse vaccine strains typhimurium).

20 Fig. 12 is a bar graph showing phoP activation as measured by LacZ activity using the PagB:LacZ recorder fusion construct.

Fig. 13 is a bar graph showing defensin sensitivity of S. typhi vaccine strain TyLH445 compared to the AroA' parent strain.

Fig. 14A is a graph showing the relative expression of constitutive expression (610 and 617) and phoP regulated (PagC and pagD) expression of AP fusion proteins.

Fig. 14B is a graph showing the immune response to lipopolysaccharide

(LPS).

Fig. 14C is a graph showing the immune response to the model heterologous antigen, AP.

15 Fig. 15 is a DNA sequence containing the pagC-pagD intergenic region. pagC translational start site (ATG on the opposite DNA strand) is underlined (nucleotides 1-3 of SEQ ID NO:15). The pagC transcriptional start (nucleotide 562) is indicated with an arrow pointing 20 left. The pagD translational start (ATG) is underlined (nucleotides 815-817 of SEQ ID NO:15). The pagD transcriptional start is indicated with an arrow pointing right (nucleotide 776).

Strain Deposit 25 Under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, deposit of the following materials has been made with the American Type Culture Collection (ATCC) of Rockville, MD,

USA.

Applicant's assignee, Massachusetts General Hospital, represents that the ATCC is a depository affording permanence of the deposit and ready accessibility thereto by the public if a patent is granted. All restrictions on the availability to the 21 public of the material so deposited will be irrevocably removed upon the granting of a patent. The material will be available during the pendency of the patent application to one determined by the Commissioner to be entitled thereto under 37 CFR 1.14 and 35 U.S.C. §122.

The deposited material will be maintained with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposited plasmid, and in any case, for a period of at least thirty (30) years after the date of deposit or for the enforceable life of the patent, whichever period is longer. Applicants' assignee acknowledges its duty to replace the deposit should the depository be unable to 15 furnish a sample when requested due to the condition of the deposit.

PhoP C strain CS022 (described below) has been deposited with the American Type Culture Collection on \B DeceM-oer l9c0 (Rockville, MD) and has received ATCC designation 55130.

20 The plasmid, pIBO1, containing the prgH gene has been deposited on July 9, 1993 with the American Type Culture Collection (Rockville, MD) and has received ATCC designation ATCC 75496.

Constitutive Expression of the PhoP Requlon Attenuates 25 Salmonella Virulence and Survival within Macrophaqes The phoP constitutive allele (PhoPC), pho-24, results in derepression of pag loci. Using diethyl sulfate mutagenesis of S. typhimurium LT-2, Ames and coworkers isolated strain TA2367 pho-24 (all strains, materials, and methods referred to in this section are described below), which contained a phoP locus mutation that resulted in constitutive production of acid phosphatase in rich media, Kier et al., 1979, J.

Bacteriol. 138:155, hereby incorporated by reference.

This phoP-regulated acid phosphatase is encoded by the phoN gene, a pag locus, Kier et al., 1979, supra, Miller 22 et al., 1989, supra. To analyze whether the pho-24 allele increased the expression of other pag loci the effect of the pho-24 allele on the expression of other pag loci recently identified as transcriptional pagA and pagB) and translational pagC) fusion proteins that required phoP and phoQ for expression, Miller et al., 1989, supra, was determined. pag gene fusion strains, isogenic except for the pho-24 allele, were constructed and assayed for fusion protein activity.

PhoPc derivatives of the pagA::Mu dJ and pagB::Mu dJ strains produced 480 and 980 U, respectively, of Pgalactosidase in rich medium, an increase of 9- to fold over values for the fusion strains with a wild-type phoP locus, see Table 1.

15 The pagC::TnphoA gene fusion produced 350 U of AP, an increase of three- to fourfold over that produced in strain CS119, which is isogenic except for the pho- 2 4 mutation, Miller et al., 1989, supra. These results compare with a ninefold increase in the acid phosphatase 20 activity in strain CS022 on introduction of the pho-24 allele. Therefore, these available assays for pag gene expression document that the pho-24 mutation causes constitutive expression of pag loci other than phoN.

23 Table 1: Bacterial strains and .properties Enzyme Strain Genotype activity Reference or (U)a source 10428 Wild type 180 (A) ATCC; Miller et al. 1989, 4 4 4* 4 *i 0

S

4500 a.

0* 0

S.

9. 0

S.

*500 4 0* OS S

S

*a*.ge I S 0 *05 *4 S S

S

TA2367 CS 003 CS022 CS023 CS012 CS013 Cs 119 ph o-2 4 AphoP ApurB pho-24 pho-24 phoN2 zxx: :6251Tnl0d-Cam pagAl::MU dJ pagBl::MU dJ pagCl: TnphoA phoN2 zxx: :6251Tn10d-Cam pagAl::Mu dJ pho-24 pag'B1::Mu dJ plho-24 pagCl: :TnphoApho-24pho\ zxx: :6251TnI0d-Cam, phoPlO2::TnlOd-Cam phoPlO5: :TnIOd supra 1,925 Kier et al., 1974, supra <10 Mil ler et al., 1989, supra 1,750 This work 25 This work 45 Miller et al., 1989, supra 120 Miller et al., 1989, 8 5 (C) supra Miller et al., 1989, supra This work This work This work SC024 SC025 SC026 450 980 385 CS015 TT13208 <10 Miller et al., 1989, suprab <10 ba A. Acid phosphatase; B, pl-galactosidase; C, alkaline phosphatase (AP).

b Gift of Ning Zhu and John Roth.

24 Identifications of protein species that are repressed as well as activated in the PhoPc mutant strain Whole-cell proteins of strain CS022 were analyzed to estimate the number of protein species that could be potentially regulated by the PhoP regulon. Remarkably, analysis by one-dimensional polyacrylamide gel electrophoresis of the proteins produced by strains with the PhoPc phenotype indicated that some protein species were decreased in expression when many presumptive pag gene products were fully induced by the pho-24 mutation.

S. The proteins decreased in the PhoPc strain might represent products of genes that are repressed by the PhoP regulator. Genes encoding proteins decreased by the pho-24 allele are designated prg loci, for phoP-repressed genes. Comparison of wild-type, PhoP", and PhoP c mutant strain proteins shows that growth in LB medium at 37 0

C

represents repressing conditions for pag gene products and derepressing conditions for prg gene products.

To estimate the total number of potentially PhoPregulated gene products, the total cell proteins of wildtype and PhoPc mutant strains grown in LB were analyzed by two-dimensional gel electrophoresis. At least species underwent major fluctuation in expression in response to the pho-24 mutation.

Virulence defects of the PhoPc strain Remarkably, strains with the single pho-24 mutation were markedly attenuated for virulence in mice (Table The number of PhoPc organisms (2 x 105) that killed 50% of BALB/c mice challenged (LDso) by the intraperitoneal route was near that (6 x 105) of PhoP" bacteria, Miller et al., 1989, supra. The PhoPc strains had growth comparable to wild-type organisms in rich and minimal media. The PhoPc mutants were also tested for alterations in lipopolysaccharide, which could explain the virulence defect observed. Strain CS022 had 9 d 4, 6 6. 4,

S

4, so.

4, 0 S 9 a 96 4, 0(4, *9 9 Vf 4 .600 a L 4 0 0~ 6, Table 2 Virulence and Protective efficacy of PhoPc and PhoP- Salmonella strains No. of survivors/total after wildtype challenge dose of: Immunizing dose No. of initial survivors total 5X10 7 5X10 5 5x10 4 5x10 3 PhoPc organisms 13/13 2 4/4 1.5x10 2 11/11 5x10 2 3 16/16 1.5x10 3 5/5 5x10 3 4 4/4 1.5x10 4 5/5 5x10 4 19/23 1.5x,0 5 5/5 5x10 5 1/4 5x10 6 0/6 5/5 3XIO 5/5 1. 5x10 1* PhoP-organisms 6x10 3 36/36 6x10 4 36/36 6x10 5 19/36 5x10 10 7/7 5/5 4/4 3/3 3/3 3/3 3/3 2/2 2/2 2/2 4/4 /4 4/4 4/4 5/5 3/7 0/12 0/12 0/6 0/12 0/12 0/6 0/12 3/12 4/7 Organisms were administered by the or organisms were administered by ip. challenge.

al route. In all other experiments, 26 normal sensitivity to phage P22, normal group B reactivity to antibody to O antigen, and a lipopolysaccharide profile identical to that of the parent strain, as determined by polyacrylamide gel electrophoresis and staining.

Since the TA2367 pho-24 strain was constructed by chemical mutagenesis and could have another linked mutation responsible for its virulence defect revertants of the PhoPc were isolated to determine whether the pho- 24 allele was responsible for the attenuation of a virulence observed. Phenotype PhoPc revertants, identified by the normal levels of acid phosphatase in fo rich medium, were isolated among the bacteria recovered from the livers of mice infected with strain CS022. Six 15 separate phenotypic revertants, designated CS122 to CS128, were found to be fully virulent (LD 50 of less than organisms for BALB/c mice). The locus responsible for the reversion phenotype was mapped in all six revertants a *e ao tested for virulence by bacteriophage P22 cotransduction *too 20 and had linkage characteristics consistent with the phoP locus (greater than 90% linkage to purB). These data S* indicate that these reversion mutations are not a*ale extragenic suppressors but are intragenic suppressors or S. true revertants of the pho-24 mutation. Thus, the e virulence defect of PhoPc mutants is probably the result of a single revertible mutation in the phoP locus and not the result of a second unrelated mutation acquired during mutagenesis.

Reversion frequency of the PhoPc phenotype The reversion frequency of the PhoPc mutation in vivo in mice was investigated to assess whether reversion could reduce the LDso of this strain. The presence of the revertants of strain CS022 was tested for by administering 10 6 104, and 102 challenge organisms to each of eight animals by i.p. injection. On day 7, three 27 animals died that received 106 PhoPc organisms. On that day, the livers and spleens of all animals were harvested and homogenized in saline. After appropriate dilution, of the tissue was plated on LB plates containing the chromogenic phosphatase substrate XP. Revertants were identified by their lighter blue colonies compared with PhoPc bacteria and were confirmed by quantitative acid phosphatase assays. An estimated 107, 105, and 103 organisms per organ were recovered from animals at each S 10 of the three respective challenge doses. Revertants were Sidentified only at the highest dose and comprised 0.5 to or 105 organisms per organ, at the time of death. It S* is likely that revertants are able to compete more effectively for growth in these macrophage-containing 15 organs, since strain CS022 is deficient in survival within macrophages (see below). However, revertants were not identified if fewer than 105 organisms were administered in the challenge dose, suggesting that the reversion frequency must be approximately 10 5 The reversion rate of the PhoPc phenotype for CS022 bacteria grown in LB is in fact 6x10 4 when scored by the same colony phenotypes. The percentage of revertants recovered from animals near death suggests that pressure is applied in vivo that selects for revertants of the PhoPc phenotype and implies that the virulence defect observed could be much greater quantitatively for a strain with a nonrevertible PhoPc mutation.

The PhoPc strain is deficient in survival within macrophages Because of the importance of survival within macrophages to Salmonella virulence Fields et al., 1986, Proc. Natl. Acad. Sci. USA 83:5189, hereby incorporated by reference, PhoPc bacteria were tested for this property. Strain CS022 was defective in the ability to grow and persist in macrophages as compared with wildtype organisms (Fig. In Fig. 1 the survival of 28 strain CS022 (PhoPc) (triangles) in cultured macrophages is compared with that of wild-type S. typhimurium ATCC 10428 (cicles). The experiment shown is a representative one. The difference between the two strains at 4 and 24 hours is significant (P 0.05). PhoP" bacteria seemed to have a macrophage survival defect qualitatively similar to that of PhoPc bacteria but survived consistently better by two- to threefold in side-by-side experiments. The increased recovery of organisms that 10 reverted to PhoPc phenotype in mouse organs rich in S* macrophage content is consistent with the reduced macrophage survival of PhoP c mutants in vitro.

Use of the PhoPc strain as a live vaccine It has been previously reported that PhoP" strains 15 are useful as live vaccines in protecting against mouse typhoid, Miller et al., 1989, supra. The immunogenicity of PhoPc when used as live attenuated vaccines in mice was compared with the of PhoP". This was done by simultaneous determination of survival, after graded challenge doses with the wild-type strain ATCC 10428, in mice previously immunized with graded doses of the two live vaccine strains. CS015 phoP::TnlOd-Cam and CS022 pho-24, as well as a saline control. The results obtained (Table 2) suggest the following conclusions: (i) small i.p. doses of the PhoPc strain 15 organisms) effectively protect mice from challenge doses as large as 5x10 5 bacteria (a challenge dose that represents greater than 10 4 i.p. LD 50 (ii) large doses of PhoPc organisms given orally completely protect mice from an oral challenge consisting of 5x10 7 wild-type bacteria (over 200 oral wild-type LD 50 s) and (iii) by comparison, a large dose of PhoP" organisms (5x10 5 does not provide similar protection. The reversion of the PhoPc mutation in vivo somewhat complicates the analysis of the use of these strains as vaccines, since revertants of the CS022 strain 29 wild-type cells) could increase immunogenicity).

However, we were unable to identify revertants by examining 10% of the available spleen and liver tissue from those mice that received 104 or fewer organisms.

Strains, Materials and Methods The strains, materials, and methods used in the PhoP regulon work described above are as follows.

American Type Culture Collection (ATCC) strain 14028, a smooth virulent strain of S. typhimurium, was 10 the parent strain for all virulence studies. Strain TT13208 was a gift from Nang Zhu and John Roth. Strain TA2367 was a generous gift of Gigi Stortz and Bruce Ames, *o* Kier et al., 1979, supra. Bacteriophage P22HT int was used in transductional crosses to construct strains 15 isogenic except for phoP locus mutations, Davis et al., 1980, Advanced Bacterial Genetics, p. 78, 87. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, hereby incorporated by reference. Luria broth was used as rich "medium, and minimal medium was M9, Davis et al., 1980, supra. The chromogenic phosphatase substrate 5-bromo-4- •chloro-3indolyl phosphate (XP) was used to qualitatively access acid and AP production in solid media.

Derivatives of S. typhimurium ATCC 10428 with the pho-24 mutation were constructed by use of strain TA2367 as a donor of the purB gene in a P22 transductional cross with strain CS003 AphoP ApurB, Miller et al., 1989, supra. Colonies were then selected for the ability to grow on minimal medium. A transductant designated CS022 (phenotype PhoPc) that synthesized 1,750 U of acid phosphatase in rich medium (a ninefold increase over the wild-type level in rich medium) was used in further studies.

Derivatives of strains CS022 and CS023 pho-24 phoN2 zxx::6251Tn0d-Cam, and acid phosphatase-negative derivative of CS022, containing pag gene fusions were 30 constructed by bacteriophage P22 transductional crosses, using selection of TnphoA- or Mu dJ-encoded kanamycin resistance. Strains were checked for the intact pag gene fusion by demonstration of appropriate loss of fusion protein activity on introduction of a phoP105::Tn10d or phoPlO2::TnlOd-Cam allele.

Assays of acid phosphatase, AP, and 8galactosidase were performed as previously described, Miller et al., 1989, supra and are reported in units as 10 defined in Miller, 1972, Experiments in molecular genetics, p. 352-355, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, hereby incorporated by reference.

In the mouse virulence and vaccination studies bacteria grown overnight in Luria broth were washed and diluted in normal saline. The wild-type parent strain of CS022 (ATCC 10428) was used for all live vaccine challenge studies. This strain has a 50% lethal dose (LDgo) for naive adult BALB/c mice of less than organisms when administered by intraperitoneal injection and 5x10 4 when administered orally in NaHCO 3 .Mice were purchased from Charles River Breeding Laboratories, Inc. (Wilmington, Mass.) and were 5 to'6 weeks of age at initial challenge. All i.p. inoculations were performed as previously described, Miller et al., 1989, supra. Oral challenge experiments were performed with bacteria grown in LB broth and concentrated by centrifugation. The bacteria were resuspended in 0.1 M NaHCO 3 to neutralize stomach acid, and administered as a bolus to animals under ether anesthesia. Colony counts were performed to accurately access the number of organisms administered. All challenge experiments were performed 1 month after i.p. inoculation and 6 weeks after oral challenge. Challenge inocula were administered by the same route as vaccinations. The care of all animals was under institutional guidelines as set 31 by the animal are committees at the Massachusetts General Hospital and Harvard Medical School.

Protein electrophoresis was performed as follows.

One-dimensional protein gel electrophoresis was performed by the method of Laemmli, 1970, Nature 227:680, hereby incorporated by reference, on whole-cell protein extracts of stationary-phase cells grown overnight in Luria broth.

The gels were fixed and stained with Coomassie brilliant blue R250 in 10% acetic acid-10% methanol. Two- 10 dimensional protein gel electrophoresis was performed by method of O'Farrell, 1975, J. Biol. Chem. 250:4007, hereby incorporated by reference, on the same whole-cell extracts. Isoelectric focusing using 1.5% pH 3.5 to ampholines (LKB Instruments, Baltimore, Md.) was carried 15 out for 9,600 V h (700 V for 13 h 45 min). The final tube gel pH gradient extended from pH 4.1 to pH 8.1 as measured by a surface pH electrode (BioRad Laboratories, Richmond, Calif.) and colored acetylated cytochrome pi markers (Calbiochem-Behring, La Jolla, Calif.) run in an adjacent tube. The slab gels were silver stained, Merril et al., 1984, Methods Enzymol. 104:441, hereby incorporated by reference.

In the macrophage survival assays experiments were performed as previously described, Miller et al., 1989, S 25 supra, by the method of Buchmeier et al., 1989, Infect.

Immun. 57:1, hereby incorporated by reference, as modified from the method of Lissner et al, 1983, J.

Immunol. 131:3006, hereby incorporated by reference.

Stationary-phase cells were opsonized for 30 min in normal mouse serum before exposure to the cultured bone marrow-derived macrophages harvested from BALB/c mice.

One hour after infection, gentamicin sulfate (8 .g/ml) was added to kill extracellular bacteria. All time points were done in triplicate and repeated on three separate occasions.

32 PhoPc Mutant Strains Are More Effective as Live Vaccines PhoPc mutant S. typhimurium are very effective when used as a live vaccine against mouse typhoid fever and are superior to PhoP- bacteria. As few a 15 PhoPc bacteria protect mice against 105 LD 50 (lethal doses of wild type organisms by the intraperitoneal route (Table This suggests that pag gene products are important antigens for protective immunity against mouse typhoid. Preliminary results have documented that 10 antigens recognized by serum of chronic typhoid carriers recognizes some phoP-regulated gene products of S. typhi.

If protective antigens are only expressed within the host, then dead vaccines only grown in rich media may not induce an immune response against these proteins.

15 The use of different S. typhimurium dead vaccine preparations containing different mutations in the phoP regulon was evaluated. As can be seen in Table 3 no dead cell preparations (even those containing mixtures of PhoP- and PhoPc bacteria) are as effective vaccines as are live bacteria. This suggests that there are other properties of live vaccines that increase immunogenicity or that important non-PhoP-regulated antigens are not in these preparations. The only protection observed in any S. animals studied was at the lowest challenge dose for those immunized with PhoPc bacteria. This further suggests that phoP activated genes are important protective antigens.

a

S

S

*5 O

S

a 55 0 0 555 5* 0 55 5 S a. 0 05 S a S S 5 0 a 0 Table 3 Salmonella with phoP regulon mutations used as a dead vaccine Vaccination Strain Challenge dose of wild type organisms 6 x 10 3 6 x 10 phenotype None ATCC10428 wild type (9) CS015 PhoP" (10) (13) CS022 PhoPc (14) CS022/CS015 PhoP-/PhoPc (13) CS015 phoP102::TnlOd-Cam CS022 pho-24 BALB/c mice were immunized twice, 7 days apart, with 5x10 8 formalin-killed bacteria.

Three weeks after the second vaccination, mice were challenged with wild-type organisms at the two doses indicated. The numbers in parentheses indicate no survivors after challenge and mean number of days until death Ratio of survivors to number challenged.

phoPc indicates the constitutive unregulated expression of phoP-activated genes and lack of expression of phoP repressed genes.

phoP- indicates a lack of expression of phoP-activated genes and expression of phoP repressed genes.

34 aroA PhoP Requlon Double Mutant Strains Recent efforts by Stocker, Levine, and colleagues have focused on the use of strains with auxotrophic mutations in aromatic amino acid and purine pathways as live vaccines, Hoseith et al., 1981, Nature 291:238, hereby incorporated by reference, Stocker, 1988, Vaccine 6:141, hereby incorporated by reference, and Levine et al., 1987, J. Clin. Invest. 79:888, hereby incorporated by reference. Purine mutations were found to be too S. 0 attenuating for immunogenicity, likely because purines are not available to the organism within the mammalian host, Sigwart et al., 1989, Infect. Immun. 57:1858, hereby incorporated by reference. Because auxotrophic mutations may be complemented by homologous recombination 15 events with wild type copies donated from environmental organisms or by acquiring the needed metabolite within the host, it would seem prudent for live vaccines to contain a second attenuating mutation in a different virulence mechanism, not just a second mutation in the same metabolic pathway). Additionally, in mice the aroA mutants have some residual virulence. Various strains with aroA mutations combined with phoP regulon mutations were investigated for virulence attenuation and immunogenicity. Table 4 demonstrates that a PhoP" or PhoPc mutation further attenuates aroA mutant S.

typhimurium by at least 100-fold and that, at least at high levels of vaccinating organisms, immunogenicity is retained. Strains with both a pagC- and phoPc phenotype are also further attenuated than either mutation alone.

Therefore, phoP regulon mutations may increase the safety of aroA live vaccine preparations.

000 0 *0 0 0 0 0 0 0 0 0.0 a 0 0 .0 0 0 00 0 0 0 00 000 to 006 00 to 9 go I Table 4A Additional attenuation of aroA mutants by PhoP regulon mutations Survivors of varying numbers of Salmonella mutant organisms Strain Phenotype 106 107 108 109 1010 CS004 aroA- 6/6 1/6 0/6 0/6 6/6 SL3261 aroAdel His- 6/6 1/6 0/6 0/6 6/6 CS322 aroA- PhoPc 6/6 6/6 6/6 1/6 6/6 CS323 S13261 PhoPc 6/6 6/6 6/6 2/6 6/6 CS315 aroA- PhoP- 6/6 6/6 6/6 2/6 6/6 CS316 SL3261 PhoP- 6/6 6/6 6/6 1/6 6/6 CS026 pagC- PhoPc 6/6 4/6 0/6 0/6 6/6 0eO a 00 *0 0* 0 0 0 a 0 000 *.e to .0.

00 6 Os. *g 0 OS S 0 6 0 0 0@ OS 0 0 5 0 a aso S.

55 055 a 0 Table 4B Protective efficacy of Salmonella with aroAlphoP regulon mutations Survivors of challenge doses of wild type organisms Strain Phenotype Inoculum 5 x10 5 x 107 CS004 aroA- 106 4/4 SL3261 aroAdel His- 106 4/4 CS322 aroA- PhoPc 10 6 CS323 SL3261 PhoPc 106 CS322 aroA- PhoPc 10 7 CS323 SL3261 PhoPc 10 7 CS322 aroA- PhoPc 10 8 CS323 SL3261 PhoPc 108 CS315 aroA- PhoP- CS316 S13261 PhoP- 108 ()Ratio of survivors to number of mice challenged.

(*)Indicates oral inoculation all other experiments were intraperitoneal inoculation.

CS004 aroA554::rnlO.

SL3261 aroADEL4O7 hisG46.

CS322 aroA554::TnlO pho-24.

CS323 aroADEL4O7 pho-24.

CS315 aroA554::TnlO phoP1O2::Tn10d-Cam.

CS316 aroADEL4O7 hisG46 phoPlO2::TnIOd-Cam.

CS026 pagCl::TnphoA pho-24 phoN2 zxx::6251TNIOd-Cam.

37 Salmonella typhi phoP Requlon Mutations The phoP regulon is at least partially conserved in S. typhi DNA hybridization studies as well as P22 bacteriophage transductional crosses have documented that the phoP, phoQ, and pagC genes appear highly conserved between S. typhi and S. typhimurium mutations in these genes in S. typhi have been made.

Salmonella Live Vaccines as Delivery Systems for Heterologous Antigens The vector used in the vaccine delivery system is a derivative of pJM703.1 described in Miller et al., 1988, J. Bact. 170:2575, hereby incorporated by reference. This vector is an R6K derivative with a Sdeletion in the pir gene. R6K derivatives require the 15 protein product of the pir gene to replicate. E. coli that contain the pir gene present as a lambda bacteriophage prophage can support the replication of this vector. Cells that do not contain the pir gene will Snot support the replication of the vector as a plasmid.

This vector also contains the mob region of RP4 which will allow mobilization into other gram negative bacteria by mating from E. coli strains such as SM01ambda pir, which can provide the mobilization function in trans.

The pagC region is shown in Figs. 2 and 3. Fig. 2 shows the restriction endonuclease sites of the pagC locus. The heavy bar indicates pagC coding sequence.

The TnphoA insertion is indicated by a inverted triangle.

The direction of transcription is indicated by the arrow and is left to right. The numbers indicate the location of endonuclease sites, in number of base pairs, relative to the start codon of predicted pagC translation with positive numbers indicating location downstream of the start codon and negative numbers indicating location upstream of the start codon. A is AccI, B is BglI, C is Clal, D is DraI, E is EcoRI, H is HpaI, N is NruI, P is PstI, S is SspI, T is StuI, U is PvuII, V is EcoRV, and 38 II is BglII. Fig. 3 shows the DNA sequence (Sequence I.D. No. 1) and translation of pagC::TnphoA. The heavy underlined sequence indicates a potential ribosomal binding site. The single and double light underlines indicate sequences in which primers were constructed complementary to these nucleotides for primer extension of RNA analysis. The asterisk indicates the approximate start of transcription. The arrow indicates the direction of transcription. The boxed sequences indicate 10 a region that may function in polymerase binding and recognition. The inverted triangle is the site of the sequenced TnphoA insertion junction. The arrow indicates a potential site for single sequence cleavage.

3 kilobases of DNA containing the pagC gene (from 15 the PstI restriction endonuclease site 1500 nucleotides to the start of pagC translation to the EcoRI restriction endonuclease site 1585 nucleotides downstream of pagC translation termination) were inserted into the pJM703.1 derivative discussed above. The pagC sequence from the Clal restriction endonuclease site was deleted (490 nucleotides) and replaced with a synthetic oligonucleotide polylinker that creates unique restriction endonuclease sites. DNA encoding one or more heterologous proteins, an antigen, can be inserted into this site. This creates a vector which allows the insertion of multiple foreign genes into the DNA surrounding pagC.

The vector can be mobilized into Salmonella by mating or any other delivery system, heat shock, bacteriophage transduction or electroporation. Since it can not replicate, the vector can only insert into Salmonella by site specific recombination with the homologous DNA on both sides of the pagC gene. This will disrupt and inactivate the native pagC locus and replace it with the disrupted pagC DNA carried on the vector.

39 Such recombination events can be identified by marker exchange and selective media if the foreign DNA inserted into the pagC locus confers a growth advantage.

The insertion of antibiotic resistance genes for selection is less desirable as this could allow an increase in antibiotic resistance in the natural population of bacteria. Genes which confer resistance to substances other than antibiotics to heavy metals or arsenic (for mercury resistance, see Nucifora et al., 10 1989, J. Bact., 171:4241-4247, hereby incorporated by reference), can be used to identify transformants.

Alternatively, selection can be performed using a Salmonella recipient strain that carries an auxotrophic mutation in a metabolic pathway and a vector that carries 15 DNA that complements the auxotrophic mutation. Many Salmonella live vaccine prototypes contain mutations in histidine or purine pathways thus complementation of these metabolic auxotrophies can be used to select for integrants. (Purine mutations specifically have been shown to be too attenuated for use in man.) Further proof of marker exchange can be documented by loss of the ampicillin resistance (carried on the plasmid backbone) or by blot hybridization analysis.

A gene useful for selection can be cloned by complementation of a vaccine strain with a metabolic auxotrophy. Specific examples include the cloning of the DNA encoding both purB and phoP by complementation of a strain deleted for function of both these genes.

Salmonella gene libraries have been constructed in a pLAFR cosmid vector (Frindberg et al., 1984, Anal.

Biochem. 137:266-267, hereby incorporated by reference) by methods known to those skilled in the art. pLAFR cosmids are broad host range plasmids which can be mobilized into Salmonella from E. coli. An entire bank of such strains can be mobilized into Salmonella vaccine 40 strains and selected for complementation of an auxotrophic defect in the case of purB growth on media without adenine). The DNA able to complement this defect is then identified and can be cloned into the antigen delivery vector.

As discussed above heterologous genes can be inserted into the polylinker that is inserted into the pagC sequence of the vector. The heterologous genes can be under the control of any of numerous environmentally 10 regulated promotor systems which can be expressed in the host and shut off in the laboratory. Because the expression of foreign proteins, especially membrane proteins (as are most important antigens), is frequently .toxic to the bacterium, the use of environmentally 15 regulated promoters that would be expressed in mammalian tissues at high levels but which could be grown in the laboratory without expression of heterologous antigens would be very desirable. Additionally, high expression j of antigens in host tissues may result in increased attenuation of the organism by diverting the metabolic "fuel of the organism to the synthesis of heterologous proteins. If foreign antigens are specifically expressed in host phagocytic cells this may increase the immune

C*

response to these proteins as these are the cells responsible for processing antigens.

The promoter systems likely to be useful include those nutritionally regulated promoter systems for which it has been demonstrated that a specific nutrient is not available to bacteria in mammalian hosts. Purines, Sigwart et al., 1989, Infect. Immun., 57:1858 and iron, Finklestein et al., 1983, Rev. Infect. Dis. 5:S759, e.g., are not available within the host. Promoters that are iron regulated, such as the aerobactin gene promoter, as well as promoters for biosynthetic genes in purine pathways, are thus excellent candidates for testing as 41 promoters that can be shut down by growth in high concentrations of these nutrients. Other useful environmentally regulated Salmonella promoters include promoters for genes which encode proteins which are specifically expressed within macrophages, the DnaK and GroEL proteins, which are increased by growth at high temperature, as well as some phoP activated gene products, Buchmeier et al., 1990, Science 248:730, hereby incorporated by reference. Therefore, promoters such as 10 the pagC 5' controlling sequences and the better characterized promoters for heat shock genes, GroEL and DnaK, will be expected to be activated specifically within the macrophage. The macrophage is the site of antigen processing and the expression of heat shock genes 15 in macrophages and the wide conservation of heat shock 0* genes in nature may explain the immunodominance of these proteins. A consensus heat shock promoter sequence is known and can be used in the vectors (Cowling et al., 1985, Proc. Natl. Acad. Sci. USA 82:2679, hereby incorporated by reference).

The vectors can include an environmentally regulated T7 polymerase amplification system to express heterologous proteins. For example, the T7 polymerase gene (cloned by Stan Tabor and Charles Richardson, See S 25 Current Protocols in Molecular Biology ed. Ausubel et al., 1989, (page 3.5.1.2) John Wiley and Sons, hereby incorporated by reference) under control of an iron regulated promoter, can be included on the vectors described above. We have inserted the aerobactin gene promoter of E. coli with the sequence

CATTTCTCATTGATAATGAGAATCATTATTGACATAATTGTTATTATTTTACG

(SEQ ID NO:2), Delorenzo et al. J. Bact. 169:2624, hereby incorporated by reference, in front of the T7 polymerase gene and demonstrated iron regulation of the gene product. This version of the vector will also include 42 one or more heterologous antigens under the control of T7 polymerase promoters. It is well known that RNA can be synthesized from synthetic oligonucleotide T7 promoters and purified T7 in vitro. When the organism encounters low iron T7 polymerase will be synthesized and high expression of genes with T7 promoters will be facilitated.

parC-fusion proteins in S. tvyhimurium Expression of heterologous antigens within 10 macrophages under the control of phoP regulated promotors .can be used as an effective method of both attenuating Salmonellae and enhancing immunogenicity of foreign antigens. As discussed above, the expression of PagC is induced in antigen processing cell, a macrophage.

15 Thus, expression of a heterologous antigen under the control of the pagC promoter is also likely to be inducible in macrophages.

To evaluate the immune respone to a heterologous antigen expressed under the control of inducible pag promoters, mice were inoculated with bacteria which o*oo expressed the antigen, AP, under the control of the pagC or pagD regulatory sequences. Pag-AP fusion proteins were produced in these bacteria from a single chromosomal copy of the gene encoding AP. The bacteria were generated utilizing two methods: TnphoA mutagenesis, and genetic engineering techniques using a suicide vector, both of which are described above.

As a control, mice were innoculated with bacteria which expressed an AP fusion protein under the control of constitutive promoters. The constitutive promoter was completely independent of regulation by genes in the PhoP regulon. Two such strains of bacteria, Strain 610 and Strain 617, were constructed using methods described above. AP expression in Strain 610 was moderate, whereas AP expression in Strain 617 was high (see Fig. 14C).

43 These strains were injected intraperitoneally into BABL/C mice. Serum samples were taken three weeks after inoculation. Normal mouse serum (MNS) was used as a control. Standard ELISA assays were used to test the sera for the presence of AP-specific antibodies. Sera was also tested for LPS-specific antibodies using S.

typhimurium LPS. Antibodies directed to LPS were detected in all the murine sera tested, but only those strains in which AP was expressed as a Pag fusion protein 10 from a single chromosomal gene copy engendered an immune response against the model heterologous antigen, AP (see Figs. 14A and Fig. 14B).

S* Despite approximately 10-fold higher constitutive expression of the AP fusion in strain 617, only a minimal 15 immune response to this antigen was noted after immunization with strain 617. In contrast, a strong response was observed in mice inoculated with strains which expressed the Pag-AP fusion protein. These data indicate that phoP-regulation which results in in vivo 20 induction of protein expression within macrophages increases the immunogenicity of heterologous antigens expressed under the control of the pag promoters. Any promoter which directs cell-specific, inducible expression of a protein in macrophages or other antigen presenting cells, pag described herein, can be used to increase the immunogencity of an antigen expressed in Salmonella.

The pagC gene and paqC Gene Product Strains, materials, and methods The following strains, materials, and methods were used in the cloning of pagC and in the analysis of the gene and its gene product.

Rich media was Luria broth (LB) and minimal media was M9, Davis et al., 1980, supra. The construction of S. typhimurium strain CS119 pagCl::TnphoA phoN2 zxx::6251 TnlOd-Cam was previously described, Miller et al., 1989, 44 supra. American Type Culture Collection (ATCC) S.

typhimurium strain 10428 included CS018 which is isogenic to CS119 except for phoPlO5::TnlOd, Miller et al., 1989, supra, CS022 pho-24, Miller et al., 1990, J. Bacteriol.

172:2485-2490, hereby incorporated by reference, and CS015 phoP0lO2::TnlOd-cam, Miller et al., 1989, supra.

Other wild type strains used for preparation of chromosomal DNA included S. typhimurium LT2 (ATCC 15277), S. typhimurium Ql and S. drypool (Dr. J. Peterson U.

Texas Medical Branch, Galveston), and Salmonella typhi Ty2 (Dr. Caroline Hardegree, Food and Drug Administration). pLAFR cosmids were mobilized from E.

coli to S. typhimurium using the E. coli strain MM294 containing pRK2013, Friedman et al., 1982, Gene 18:289- 296, hereby incorporated by reference. AP activity was screened on solid media using the chromogenic phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate AP assays were performed as previously described, Brickman et al., 1975, J. Mol. Biol. 96:307-316, hereby 0* incorporated by reference, and are reported in units as defined by Miller, Miller, 1972, supra, pp. 352-355.

One dimensional protein gel electrophoresis was

S

performed by the method of Laemmli, 1970, Nature, ;e 227:680-685, hereby incorporated by reference, and blot S 25 hybridization using antibody to AP was performed as previously described, Peterson et al., 1988, Infect.

Immun. 56:2822-2829, hereby incorporated by reference.

Whole cell protein extracts were prepared, from saturated cultures grown in LB at 37 0 C with aeration, by boiling the cells in SDS-pagE sample buffer, Laemmli, 1970, supra. Two dimensional gel electrophoresis was performed by the method of O'Farrell, 1975, J. Biol. Chem.

250:4007, hereby incorporated by reference. Proteins in the 10% polyacrylamide slab gels were visualized by silver staining, Merril et al., 1984, Methods in 45 Enzymology, 104:441, hereby incorporated by reference.

Chromosomal DNA was prepared by the method of Mekalanos, 1983, Cell, 35:253-263, hereby incorporated by reference. DNA, size fractionated in agarose gels, was transferred to nitrocellulose (for blot hybridization) by the method of Southern, 1975, J. Mol. Biol. 98:503-517, hereby incorporated by reference. DNA probes for Southern hybridization analysis were radiolabeled by the random primer method, Frinberg et al., 1984, supra.

10 Plasmid DNA was transformed into E. coli and Salmonella by calcium chloride and heart shock, Mekalanos, 1983, supra, or by electroporation using a Genepulser apparatus (Biorad, Richmond, Ca.) as recommended by the manufacturer, Dower et al., 1988, Nucl. Acids Res.

15 16:6127-6145, hereby incorporated by reference. DNA sequencing was performed by the dideoxy chain termination method of Sanger et al., 1977, Proc. Natl. Acad. Sci.

USA, 74:5463-5467, hereby incorporated by reference, as modified for use with SEQUENASE® Biochemical, Cleveland, Ohio). Oligonucleotides were synthesized on an Applied Biosystems Machine and used as primers for sequencing reactions and primer extension of RNA.

Specific primers unique to the two ends of TnphoA, one of which corresponds to the AP coding sequence and the other to the right IS50 sequence, were used to sequence the junctions of the transposon insertion.

Construction of a S. typhimurium cosmid gene bank in pLAFR3 and screening for clones containing the wild type pagC DNA was performed as follows. DNA from S.

typhimurium strain ATCC 10428 was partially digested using the restriction endonuclease Sau3A and then size selected on 10-40% sucrose density gradient. T4 DNA ligase was used to ligate chromosomal DNA of size 20-30 kilobases into the cosmid vector pLAFR3, a derivative of pLAFR1, Friedman et al., 1982, Gene 18:289-296, hereby 46 incorporated by reference, that was digested with the restriction endonuclease BamHI. Cosmid DNA was packaged and transfected into E. coli strain DH5-a using extracts purchased from Stratagene, La Jolla, Ca. Colonies were screened by blot hybridization analysis.

The analysis of proteins produced from cloned DNA by in vitro transcription/translation assays was analyzed as follows. These assays were performed with cell free extracts, (Amersham, Arlington Heights, Illinois), and .10 were performed using conditions as described by the S manufacturer. The resultant radiolabeled proteins were analyzed by SDS-pagE.

RNA was purified from early log and stationary phase Salmonella cultures by the hot phenol method, Case 15 et al., 1988, Gene 72:219-236, hereby incorporated by reference, and run in agarose-formaldehyde gels for blot hybridization analysis, Thomas, 1980, Proc. Natl. Acad.

Sci. USA 77:5201, hereby incorporated by reference.

Primer extension analysis of RNA was performed as previously described, Miller et al., 1986, Nuc. Acids.

Res. 14:7341-7360, hereby incorporated by reference, using AMV reverse transcriptase (Promega, Madison, Wisconsin) and synthesized oligonucleotide primers complementary to nucleotides 335-350 and 550-565 of the pagC locus.

Identification of an 18 kDa protein missing in a paC mutant of S. typhimurium pagC mutant strain CS119 was analyzed by two dimensional protein electrophoresis to detect protein species that might be absent as a result of the TnphoA insertion. Only a single missing protein species, of approximately 18 kD and pI-8.0, was observed when strains, isogenic except for their transposon insertions, were subjected to this analysis-. This 18 kDa species was also missing in similar analysis of Salmonella strains with mutations phoP and phoQ. Though two-dimensional 47 protein gel analysis might not detect subtle changes of protein expression in strain CS119, this suggested that a single major protein species was absent as a result of the pagC::TnphoA insertion.

Additional examination of the 2-dimensional gel analysis revealed a new protein species of about 45 kDa that is likely the pagC-Ap fusion protein. The pagC-AP fusion protein was also analyzed by Western blot analysis using antisera to AP and found to be similar in size to 10 native AP (45 kDa) and not expressed in PhoP-S.

typhimurium.

Cloning of the paC::TnphoA insertion Chromosomal DNA was prepared from S. typhimurium strain CS119 and a rough physical map of the restriction 15 endonuclease sites in the region of the pagC::TnphoA fusion was determined by using a DNA fragment of TnphoA as a probe in blot hybridization analysis. This work indicated that digestion with the restriction endonuclease ecoRV yielded a single DNA fragment that included the pagC::TnphoA insertion in addition to several kilobases of flanking DNA. Chromosomal DNA from strain CS119 was digested with EcoRV (blunt end) and ligated into the bacterial plasmid vector pUC19 (New England Biolabs) that had been digested with the restriction endonuclease SmaI (blunt end). This DNA was electroporated into the E. coli strain DH5-a (BRL) and colonies were plated onto LB agar containing the antibiotics kanamycin (TnphoA encoded and ampicillin (pUC19 encoded). A single ampicillin and kanamycin resistant clone containing a plasmid designated pSMl00 was selected for further study.

A radiolabeled DNA probe from pSM100 was constructed and used in Southern hybridization analysis of strain CS119 and its wild type parent ATCC 10428 to prove that the pagC::TnphoA fusion had been cloned. The 48 probe contained sequences immediately adjacent to the transposon at the opposite end of the AP gene [HpaI endonuclease generated DNA fragment that included 186 bases of the right IS50 of the transposon and 1278 bases of Salmonella DNA (Fig. As expected, the pSM100 derived probe hybridized to an 11-12 kb AccI endonuclease digested DNA fragment from the strain containing the transposon insertion, CS119. This was approximately 7.7kb (size of TnphoA) larger than the 3.9 kB AccI S. 0 fragment present in the wild type strain that hybridizes to the probe. In addition, a derivative of plasmid pSM100, pSM101 (which did not allow expression of the pagC-PhoA gene fusion off the lac promoter), was transformed into phoP- (strain Cs015) and phoN- (strain 15 CS019) Salmonella strains and the cloned AP activity was found to be dependent on phoP for expression. Therefore we concluded that the cloned DNA contained the pagC::TnphoA fusion.

The presence of the page gene was also demonstrated in other strains of S. typhimurium, as well as in S. typhi, and S. drypool. All Salmonella strains examined demonstrated similar strong hybridization to an kb EcoRV and a 3.9 kb AccI restriction endonuclease fragment suggesting that pagC is a virulence gene common to Salmonella species.

The page gene probe from nucleotides -46 (with 1 as the first base of the methionine to 802 (PstI site to the BglII site) failed to cross hybridize to DNA from Citrobacter freundii, Shigella flexneri, Shigella sonnei, Shigella dysenterial, Escherichia coli, Vibrio cholerae, Vibrio vulnificus, Yersenia entero colitica, and Klebsiella pneumonia.

49 Cloning of the wild type pagC locus DNA and its complementation of the virulence defect of a S.

typhimurium paqC mutant The same restriction endonuclease fragment described above was used to screen a cosmid gene bank of wild type strain ATCC 10428. A single clone, designated pWP061, contained 18 kilobases of S. typhimurium DNA and hybridized strongly to the pagC DNA probe. pWP061 was found to contain Salmonella DNA identical to that of pSM100 when analyzed by restriction endonuclease analysis and DNA blot hybridization studies. Probes derived from pWPO61 were also used in blot hybridization analysis with DNA from wild type and CS119 S. typhimurium. Identical hybridization patterns were observed to those seen with 15 pSM100. pWP061 was also mobilized into strain CS119, a pagC mutant strain. The resulting strain had wild type virulence for BALB/c mice (a LD 5 0 less than 20 organisms when administered by IP injection). Therefore the cloned DNA complements the virulence defect of a pagC mutant 20 strain.

Since, a wild type cosmid containing pagC locus SDNA was found to complement the virulence defect of a oO pagC mutant S. typhimurium strain, it was concluded that the pagC protein is an 188 amino acid (18 kDa) membrane (see below) protein essential for survival within macrophages and virulence of S. typhimurium.

Physical mapping of restriction endonuclease sites. DNA sequencing, and determination of the pagC gene product Restriction endonuclease analysis of plasmid pSM100 and pWP061 was performed to obtain a physical map of the pagC locus, and, in the case of PSM100, to determine the direction of transcription (Fig. DNA subclones were generated and the TnphoA fusion junctions were sequenced, as well as the Salmonella DNA extending from the HpaI site, 828 nucleotides 5' to the phoA fusion junction, to the EcoRI site 1032 nucleotides 3' to the 50 TnphoA insertion (Fig. 2 and The correct reading frame of the DNA sequence was deduced from that required to synthesize an active AP gene fusion. The deduced amino acid sequence of this open reading frame was predicted to encode a 188 amino acid protein with a predicted pi+8.2. This data were consistent with the 2-D polyacrylamide gel analysis of strain CS119 in which an 18 kDa protein of approximate pI+8.0 was absent. No other open reading frames, predicted to encode peptides e 10 larger than 30 amino acids, were found.

The deduced amino acid sequence of the 188 amino acid open reading frame contains a methionine start codon

*Q

33 amino acids from the fusion of pagC and AP (Fig. 3).

This 33 amino acid pagC contribution to the fusion 15 protein was consistent with the size observed in Western blot analysis and contains a hydrophobic N-terminal region, identified by the method of Kyle et al., 1982, J.

Mol. Biol. 157:105-132, hereby incorporated by reference, that is a typical bacterial signal sequence, Von Heinje, 1985, J. Mol. Biol. 184:99-105, hereby incorporated by reference. Specifically, amino acid 2 is a positively charged lysine, followed by a hydrophobic domain and amino acid 24 is a negatively charged aspartate residue.

A consensus cleavage site for this leader peptide is predicted to be at an alanine residue at amino acid 23, Von Heinje, 1984, J. Mol. Biol. 173:243-251, hereby incorporated by reference. The DNA sequence also revealed a typical ribosomal binding site, Shine et al., 1974, Proc. Natl. Acad. Sci. USA 71:1342-1346, hereby incorporated by reference, at 6-2 nucleotides 5' to the predicted start of translation (Fig. 3) nucleotides 717- 723). This suggested that the open reading frame was, in fact, translated and further supported the assumption that this was the deduced amino acid sequence of the pagC protein interrupted by the TnphoA insertion (Fig. 3).

51 In vitro synthesis of proteins by the cloned paqC locus To detect if other proteins were encoded by pagC and to determine the approximate size of the pagC gene product, an in vitro coupled transcription/translation analysis was performed. A 5.3 kilobase EcoRI fragment of pWP061 was inserted into pUC19 so that the pagC gene would not be expressed off the lac promotor. This plasmid was used in an in vitro coupled transcriptiontranslation assay. A single protein of approximately 22 10 kilodaltons was synthesized by the cell free system. The size was compatible with this being the precursor of the pagC protein containing its leader peptide. These data further support the conclusion the single and the single pagC gene product had been identified.

15 Identification of the paaC encoded RNA An approximately 1100 nucleotide RNA is encoded by pagC. The pagC gene is highly expressed by cells with a phoP constitutive phenotype of pag activation, as compared to wild type and phoP constitutive phenotype of pag activation, as compared to wild type and phoP" bacteria. In these blot hybridization experiments pagC is only detected in wild type cells grown in rich media during stationary growth. This result, coupled with previous work, Miller et al., 1989, supra, Miller et al., 1990, supra, demonstrates that pagC is transcriptionally regulated by the phoP gene products and is only expressed during early logarithmic phase growth in rich media by cells with a phoP constitutive phenotype.

The size of the pagC transcript is approximately 500 nucleotides greater than that necessary to encode the 188 amino acid protein. Primer extension analysis of Salmonella RNA using oligonucleotide primers specific for pagC sequence was performed to determine the approximate start site of transcription and to determine whether these nucleotides might be transcribed 5' or 3' to the 52 188 amino acid pagC gene product. Primer extension analysis with an oligonucleotide predicted to be complementary to nucleotides 550-565 of pagC, 150 nucleotides 5' to the predicted start codon, resulted in an approximately 300 nucleotide primer extension product.

Therefore a primer further upstream was constructed complementary to nucleotides 335-350 of pagC and used in a similar analysis. A primer extension product of 180 nucleotides was observed to be primer specific. This is 10 consistent with transcription starting at nucleotide 170 (Fig. Upstream of the predicted transcriptional start, at nucleotides 153-160, a classic RNA polymerase a* 6 binding site was observed with the sequence TATAAT at -12 nucleotides as well as the sequence TAATAT at 15 nucleotides. No complete matches were observed for the consensus RNA polymerase recognition site (TTGACA) 15-21 nucleotides upstream from the -10 region. AT -39 (126- 131) nucleotides (TTGGAA), -38 (127-132) nucleotides (TTGTGG), and -25 (135-140) nucleotides (TTGATT) are sequences that have matches with the most frequently conserved nucleotides of this sequence.

Based on the above results transcription was predicted to terminate near the translational stop codon of the 188 amino acid protein (nucleotide 1295, Fig. 3).

Indeed, a stem loop configuration was found at nucleotides 1309-1330 that may function as a transcription terminator. This was consistent with the lack of evidence of open reading frames downstream of the 188 amino acid protein and the lack of synthesis of other transcription/translation using the cloned pagC DNA.

This further suggests that the pagC::TnphoA insertion inactivated the synthesis of only a single protein.

53 Similarity of paqC to Ail and Lom A computer analysis of protein similarity using the National Biomedical Research Foundation/Protein Identification Resource, George et al., 1986, Nucleic Acids Res. 14:11-15, hereby incorporated by reference, protein sequence base was conducted to identify other proteins that had similarity to pagC in an attempt to find clues to the molecular function of this protein.

Remarkably, pagC was found to be similar to a bacteriophage lambda protein, Lom, that has been localized to the outer membrane in minicell analysis, Court et al., 1983, Lambda II, Hendrix, R.W. et al. ed.

Cold Spring Harbor Laboratory (Cold Spring Harbor NY), pp. 251-277, hereby incorporated by reference, and 15 demonstrated to be expressed by lambda lysogens of E.

coli, Barondess, et al., 1990, Nature 346:871-874, hereby incorporated by reference. Recently, the deduced amino acid sequence of the cloned ail gene product of Y.

enterocolitica was determined and found to also be similar to Lom, Miller et al., 1990b, J. Bacteriol.

172:1062-1069. Therefore, a protein family sequence .alignment was performed using a computer algorithm that establishes protein sequence families and consensus sequences, Smith et al., 1990, Proc. Natl. Acad. Sci.

87:118-122, hereby incorporated by reference. The formation of this family is indicated by the internal data base values of similarity between these proteins pagC and Lom (107.8), pagC and Ail (104.7), and Ail and Lom These same proteins were searched against 314 control sequences in the data base and mean values and ranges were 39.3 (7.3-52.9) pagC, 37.4 (7.3-52.9) Ail, and 42.1 (7.0-61.9) Lom. The similarity values for this protein family are all greater than 3.5 standard deviations above the highest score obtained for similarity to the 314 random sequences. No other 54 similarities or other family members were found in the database. Regions of similarity are located not only in the leader peptide transmembrane domains but throughout the protein.

pDa Mutant Strains Are Attenuated For Virulence Salmonella typhimurium strains of the invention with a pagC mutation were attenuated for virulence by least 1,000-fold.

In addition pagC, other pag genes described herein 10 may be useful in the development of live Salmonella vaccines. Mutations in phoP-activated genes could be S" used to construct attenuated, live Salmonella vaccines.

In constructing multivalent Salmonella vectored vaccines, PhoP-activated promoters could increase immunogenecity by 15 targeting foreign protein expression to antigen presenting macrophages.

Identification of novel phoP-activated genes.

To further analyze the role of phoP-activated genes in bacterial virulence, a bank of strains with active phoA gene fusions was generated by TnphoA mutagenesis. Strain CS019 was the parent strain for TnphoA mutagenesis because it has wild-type bacterial virulence and carries the phoN2 allele, which results in minimal background phosphatase activity. Strains with active phoA gene fusions were identified by blue colony phenotype after growth in agar containing XP. Such strains were then screened for decreased fusion protein activity on acquisition of the phoPl2 allelle that results in a PhoP-null phenotype.

Two thousand and sixty-four AP expressing strains were isolated and colony purified from two hundred and forty independent matings. Strains with AP activity were isolated at a frequency of 0.8% from the total pool of kanamycin resistant (TnphoA containing) bacteria. A total of fifty-four candidate pag::TnphoA insertions were 55 isolated from the AP expressing strain bank, and fortynine of these were determined to have greater than sixfold reduction in AP activity in the absence of functional phoP/phoQ. Therefore, approximately 2% of the colonies expressing AP were identified as pag-phoA gene fusions.

Identification of thirteen unique pa loci.

Three methods were used to determine whether the forty-nine TnphoA insertions defined unique pag loci.

10 First, physical maps of the EcoRI and HindIII restriction S, endonuclease sites 5' to the TnphoA insertions were defined. Second, linkage analysis to transposon insertions highly linked to known pag loci was performed.

Third, strains determined to be unique by the above 15 methods were screened for linkage to a bank of strains with transposon insertions of known chromosomal location.

Blot hybridization analysis demonstrated that thirteen of the forty-nine strains had unique restriction endonuclease sites 5' to the TnphoA insertion. The numbers of strains with similar physical maps 5' to the TnphoA insertion ranged from 1-7. One of the thirteen physical maps was similar to that expected for an insertion in page and was noted in seven of the strains S. isolated as containing candidate pag::TnphoA insertions.

Analysis of these seven strains indicated that only three of these were pagC::TnphoA insertions, since blot hybridization analysis with a fragment of page as a probe and linkage analysis to transposon insertions highly linked to pagC indicated that four of these insertions were not in pagC. Another of the pag::phoA fusions, denoted pagP, had the physical 5' restrictionendonuclease map that would be expected for phoN.

However, this insertion was determined not to be within phoN by linkage analysis and blot hybridization. A transductional cross was performed between wild type 56 bacteria and strain CS1247 containing pagP::TnphoA and zxx::6215Tn0Od-cam. These transductants were selected on kanamycin, insuring the inheritance of the pagP::TnphoA which encodes kanamycin resistance. These colonies were then screened for choramphenicol resistance which would indicate linkage of zxx:6215Tn0d-cam to pagP. No linkage was found indicating that pagP was not linked to phoN. Blot hybridization using a portion of phoN as a probe was also performed on CS1247 and indicated that 10 this strain contained a wild type phoN locus. Thirteen pag loci were defined and designated pagD-P.

To further define the PhoP regulation of the 13 S* pag::TnphoA fusion proteins, AP activity was assayed in strains isogenic except for the phoP locus. AP activity 15 was assayed during bacterial growth in rich medium in logarithmic and stationary growth phase (Table 13). The dependence of an intact phoP locus for full expression remained constant for the different stages of growth; however, the relative amount of AP expression increased as growth was limited. The difference in expression of pag gene fusions varied from six to forty-eight fold when isogenic strains with a wild type and null phoP locus were compared.

P Of the five previously identified pag loci, only phoN, page, and pagA have known chromosomal locations.

Linkage analysis of the 13 newly identified pag loci was performed using strains containing transposon insertions linked to pagC (AK3233 and AK3140), and to pagA (AK3255).

Three pag::TnphoA insertions were found to be linked to AK3140 which is in a region near pagC at 24-25 minutes on the chromosome. These were designated pagD, pagE, and pagF. PagD::TnphoA was similarly linked to the transposon insertion of AK3233 and AK3140 as was previously reported for pagC. The TnphoA insertion of this strain has been further defined and is 57 divergently transcribed from pagC. pagE and pagF exhibited different linkage to the insertions of AK3233 and AK3140 than pagC and pagD suggesting a significantly different chromosomal location. The pagE::TnphoA insertion is 39% linked to the transposon insertion of AK3233 and 99.1% linked to that of AK3140, while pagF::TnphoA is 31% linked to the insertion of AK3140 but not to that of AK3233. These different linkages in addition to the physical maps of the restriction endonuclease sites 5' to the TnphoA insertion indicated that these were new pag loci. Therefore, three new pag loci were found in the region of 25 minutes, one of which is highly linked to the previously defined pagC.

Linkage analysis was then performed using a group 15 of defined random Tn10a16Al7 insertions on the ten strains with TnphoA insertions of no known location. Of these ten pag::TnphoA alleles only two demonstrated linkage to the bank of Tn10A16Al7 insertions. The pagG::TnphoA insertion was demonstrated to have 97% 20 linkage to the transposon insertion of AK3258 located at approximately 30 minutes. The pag::TnphoA insertion, designated pagH, exhibited 23% linkage to the insertion of AK3091. The linkage to the transposon insertion of AK3091 was similar to linkage previously demonstrated for prgE Therefore, this chromosomal region contains both PhoP-activated and repressed genes. This Tna16A17 insertion was analyzed using pulse field gradient electrophoresis of chomosomal DNA from AK3091 digested with the restriction endonuclease Xbal and BlnI. These data indicate that the transposon insertion of AK3091 was located in the region of 20-25 minutes and that pagH and prgE are located in this region of the chromosome.

58 Strains with paq:TnphoA insertions have wild type sensitivity to the rabbit NP-1 defensin S. Typhimurium strains with null mutations in the phoP operon have increased sensitivity to a variety of cationic antimicrobial peptides including defensins, magainins, and protamine. The defensins are a family of mammalian peptides present in the granules of neutrophils, lung macrophages, and intestinal Paneth cells. Resistance to these peptides may contribute to bacterial virulence and the ability to colonize mucosal surfaces. Strains with pag::TnphoA insertions were tested for sensitivity to the highly active rabbit defensin NP-1. None of the strains with single pag::TnphoA insertions demonstrated increased sensitivity 15 to NP-1 defensin (see Fig. Thus despite the 0 demonstrated sensitivity of PhoP-null mutants to rabbit defensin NP-1, no defined mutations in pag loci were associated with sensitivity to defensins.

0.0 Four strains with pag::TnphoA insertions demonstrate 20 marked attenuation for mouse virulence To further define whether these new pag loci 0:.0 contributed to mouse virulence, the 13 strains with pag *0 transposon insertions were screened in vivo. Mice were injected intraperitoneally with approximately 100 25 organisms. Four strains with transposon insertions in pagD, pagJ, pagK, and pagM demonstrated attenuated virulence. *Mice injected with these strains all survived and showed no signs of systemic infections, such as hepatosplenomegaly and scruffiness (piloerection due to fever). These four strains were subjected to further virulence testing by intraperitoneal injection of multiple doses of organisms in a total of ten mice on two separate occasions. The mean LD 50 was determined from these subsequent injections and is listed in Table 14.

One of these strains, containing the pagD::TnphoA insertion, has a LD 50 10,000 fold greater than wild-type 59 S. typhimurium. The other three strains were also markedly attenuated for mouse virulence with LD 50 values greater than 1000-10,000 times that of wild type organisms. These data indicated that the PhoP-regulated loci, pagD, pagJ, pagK, and pagM, when mutated, result in attenuation of bacterial virulence.

pa:cr:TnphoA strains attenuated for mouse virulence have reduced survival within macrophages.

Since PhoP mutant Salmonella are deficient in survival within macrophages, strains containing mutations in pag genes that had attenuated mouse virulence were tested for reduced viability within macrophages. As shown Table 14, all strains with pag mutations S"demonstrated significantly reduced survival within 15 macrophages. Decreased intracellular survival of pag oo' mutants was not observed until a time when pag are predicted to be maximally expressed.

Four strains with mutations in the pagC, pagD, "O pagJ, pagK and pagM loci were found to be attenuated for 20 mouse virulence and survival within macrophages. Strains with mutations in these five pag all had varying degrees of virulence attenuation. Strains with a mutation in pagJ had a virulence defect comparable to that observed for pagC mutants (greater than 1000 x the LD 50 of wild 25 type organisms). The pagD::TnphoA insertion resulted in the greatest attenuation of virulence, comparable to that of a PhoP null mutation (greater than 10,000 x the LD 50 of wild type organisms). pagK and pagM mutants had virulence attenuation that was intermediate between the pagJ and pagD mutants. The cumulative effect of deletion of pagC, pagD, pagJ, pagK, and pagM, if additive and similar to the attenuation observed with TnphoA insertions, may be much greater than that observed by deletion of phoP alone. The observation that many of these genes are somewhat expressed in stationary phase in the absence of PhoP suggests that functional Pag proteins 60 could be produced in vivo in the absence of PhoP. One virulence gene pagM is significantly expressed in the absence of PhoP, though it may still require PhoP/PhoQ for induction within macrophage phagosomes. This data suggests that deletion of pag gene products could lead to greater virulence attenuation than deletion of the regulatory proteins.

Salmonella envelope proteins as virulence factors: Defensin senstivity Based on the methods used to identify pag loci, translational gene fusions to phoA, and the observation that the pagC gene fusions produce AP, it has now been discovered that many pag encode bacterial envelope proteins. No strains have been found with 15 single pag mutations that confer sensitivity to defensins or other cationic peptides. The data suggest that an alteration of the bacterial envelope as a result of the change in synthesis of the entire aggregate of envelope proteins mediated by PhoP/PhoQ may be important to S.

typhimurium virulence.

Defensins are small amphipathic cationic peptides of approximately 30-35 amino acids in length whose antimicrobial action involves penetration and disruption of membranes, possibly by forming selective anionic 25 channels. Though defensins are largely found in neutrophils and Paneth cells these or other related molecules likely contribute to non-oxidative killing of phagocytosed bacteria by macrophages. Though it remains possible that a single unidentified pag encodes a protein responsible for defensin resistance, it seems more likely that a cumulative effect of expression of several pag encoded envelope proteins could result in resistance to defensins. An aggregate change in a large number of bacterial envelope proteins could alter the membrane charge, electrical potential, or lipid content such that defensin interaction with bacterial membranes could be 61 changed.

Identification of transcriptional units linked to pacC.

To identify genes upstream of pagC, E. coli carrying plasmid pWPL17 containing 2.8kb of DNA 5' to pagC (Table 15 and Fig. 7) was mutagenized with the transposons MudJ and TnphoA, and strains with AP or 8galactosidase activity were identified on chromogenic substrates. In addition, as part of an effort to identify additional PhoP-activated genes, random 10 mutagenesis of the Salmonella chromosome with TnphoA was performed, and strains with AP activity were screened for **0 TnphoA insertions linked to the TnlOAl61l7 of strain AK3233, which is 75% linked to pagC. Several strains that contained plasmids with active MudJ or TnphoA S 15 generated gene fusions were identified. In addition, two strains were identified that contained active chromosomal TnphoA insertions closely linked to pagC. Physical maps of the restriction endonuclease sites surrounding the transposon insertions in strains with active plasmid or chromosomal lacZ and phoA gene fusions were performed to determine the relationship of the transposon insertions to pagC. This analysis revealed that several regions of the DNA were transcribed oppositely to pagC (Fig. 7).

Several TnphoA insertions that resulted in active phoA gene fusions were identified. These data indicated that pagC-linked genes encoded membrane or secreted proteins.

Genes linked to paqC encode four novel proteins.

To further analyze the genes defined by transposon insertions, the DNA sequence of this region was determined (Fig. DNA containing this region was cloned; 4 kb of DNA between the HpaI site 737bp upstream of the start codon of pagC to a ClaI site far upstream was sequenced. The DNA sequence of the fusion junctions of all TnphoA and MudJ gene fusions was also determined.

Based on these data, the correct reading frame of each 62 gene was determined. The DNA sequence data revealed four ORFs predicted to be transcribed and translated based on the data derived from the TnphoA and MudJ insertions.

All ORFs revealed typical ribosome binding sites 6 to 11 bases from the predicted start of translation. The translation of the ORF immediately upstream and oppositely transcribed to pagC, pagD, indicates that a short envelope protein of 87 amino acids (unprocessed) is encoded. It is followed by a second ORF (envE) which encodes an envelope protein of 178 amino acids (unprocessed). This ORF is followed by a structure that could function as a Rho-independent transcriptional terminator (see Fig. The third ORF, msgA (macrophage survival gene), encodes a small protein similar in size 15 to that of the first gene product (79 amino acids) and is S also followed by a structure that could function as a Rho-independent transcriptional terminator (see Fig. 8).

The DNA sequence predicts that this protein is composed of several charged residues with a large number of negatively charged amino acids residing at the carboxy terminus. The predicted protein product does not contain S a structure resembling a signal sequence at its amino terminus nor any hydrophobic stretches; therefore, the third ORF is unlikely to encode an envelope protein. The S 25 final ORF (envF) encodes an envelope protein of 278 amino acids (unprocessed). A computer search of known protein motifs revealed that EnvF contains a consensus prokaryotic membrane lipid attachment site and, therefore, is likely to be a lipoprotein (see Fig. 8 for consensus site location).

The predicted proteins produced by pagD, envE, and envF contain a typical bacterial signal sequence structure. In addition, hydrophobic profiles confirmed the hydrophobic nature of the amino-termini of these proteins. The EnvE and EnvF proteins also contain 63 hydrophobic stretches that could function as membrane spanning domains. The G+C content of the genes in this region are: pagC, 43.4%; pagD, 42.1%; envE, 45.9%; msgA, 46.8%; and envF, 40.5%, which is considerably lower than the average G+C content of S. typhimurium A complete search of the database with the predicted protein sequences of these four ORFs showed no significant similarities. Strains containing three distinct TnphoA insertions and one MudJ insertion, each 10 located in one of the four genes, were chosen for further characterization.

A gene pagD, oppositely transcribed to DaqC, is positively regulated by PhoP/PhoQ Representative strains with transposon insertions were examined to evaluate whether genes transcribed r" oppositely to pagC were increased in synthesis in the presence of PhoP. To accurately determine if these genes were PhoP regulated, it was necessary to recombine plasmid insertions onto the Salmonella chromosome. Upon 20 replacement of the wildtype gene with the gene containing the transposon insertion, P22HTint lysates made on these strains were transduced into a PhoP deleted (PhoP-) strain and AP or 8-galactosidase levels were monitored.

One of these transposon generated gene fusions demonstrated a significant increase in activity between PhoP' and WT backgrounds, while the other insertions showed no PhoP regulation (Table 16). This pagD loci is adjacent to and divergently transcribed from pagC.

The representative transposon insertion in envF was unable to be recombined onto the chromosome, likely due to an insufficient amount of homologous DNA downstream of the transposon. In order to examine the possibility of PhoP regulation of the envF gene, a region upstream of this gene through and including the phoA gene of the TnphoA transposon was cloned as a 3-kb PvuI (blunt-ended)-XhoI fragment into the EcoRV-SalI sites of 64 the suicide vector pGP704. This clone was mated into Salmonella strain CS019, and ampicillin-resistant recombinants were selected (creating a strain designated envF::pGPP2). A phoP105::TnlOd-Tet mutation was transduced into this strain to create an isogenic pair differing only in the ability to produce a functional PhoP protein. As shown in Table 16, the introduction of the phoPlO5::TnlOd-Tet had no effect on the AP levels of these two strains, demonstrating that envF is not a PhoPactivated gene.

Transposon insertions in paqC-linked genes attenuate virulence and cause reduced survival within macrophages Since transposon insertions in pagC significantly Sincrease the LD 50 of S. typhimurium in BALB/c mice, 15 strains containing transposon insertions linked to pagC were evaulated for attenuation of mouse virulence. As shown in Fig. 7, while the transposon insertion in envE had no affect on strain virulence, a TnphoA insertion in pagD and the MudJ insertion 1.8 kb downstream in msgA S: 20 attenuate S. typhimurium virulence by greater than 300 fold as compared to wild-type organisms (LD 50 organisms). These data suggested that these two loci are essential to virulence.

To examine the survival capabilities of those 25 strains having a virulence defect, S. typhimurium containing insertions in either pagD or msgA were used to infect bone marrow-derived macrophages. The results, shown in Table 15, demonstrate a macrophage survival defect for these two strains. The survival defect is greater for the pagD insertion (MSI=0.002) compared with the msgA insertion (MSI=0.01), and both defects are equal to or greater than that of the PhoP'strain (MSI=0.01).

Transposon insertions in this gene could not be recombined onto the chromosome. Thus, it was necessary to demonstrate that the virulence and macrophage survival defects of msgA was not due to a polar effect of the MudJ 65 insertion on envF transcription. Therefore, pGPP2 was recombined into the msgA::MudJ strain and AP activity of this strain was compared to that of CS019 containing the recombinant pGPP2. This data (shown in Table 16) demonstrates that the transcription of the envF gene is unaffected by the msgA::MudJ insertion and is transcribed from its own promoter. However, it is possible that under different environmental conditions, other promoters may be activated that could place msgA and envF on the same transcript.

Determination of the msqA and pacqD transcriptional start sites The 5' regions of these genes were examined to define the transcriptional start sites of msgA and pagD.

15 Oliogonucleotides complimentary to the 5' end of each ORF or upstream region were used in a primer extension analysis. The results of this analysis revealed that the pagD transcript begins 39 bases upstream of the translational start. The predicted -10 (TTCCAT) and 20 (TTGAAT) regions were found to be similar to the known consensus sequences for E. coli promoters. The pagD transcript was detected only in PhoPc Salmonella RNA and not in RNA from PhoP- Salmonella. The msgA transcriptional start was found to begin 58 bases 25 upstream of the translational start and contain predicted (CAAAAC) and -35 (TTACGT) sequences. These regions do not conform well to consensus -10 and -35 sequences; however, the cDNA from this transcript was easily detected using various primers in primer extensions of both PhoPc and PhoP- RNA and appears to produce an abundant RNA.

Distribution of paqD and msA genes in the Enterobacteriaceae and in two G+C content oranisms The G+C content of the pagC chromosomal region is much lower than the average G+C content of Salmonella.

The gene encoding the PhoP-regulated acid phosphatase of 66 S. typhimurium (phoN) also has a low G+C content and DNA homologous to phoN was found only in two low G+C organisms of several genera tested. The DNAs of several members of the Enterobacteriaceae and two low G+C organisms were examined for similarity to pagD and msgA by blot hybridization. PCR fragments highly specific to each ORF were labeled and used as probes. This analysis demonstrated hybridization at high stringency to all Salmonella species examined as well as Shigella sonnei, Shigella flexneri, Klebsiella pneumoniae and Citrobacter freundii. No hybridization was seen to the low G+C organisms Morganella morganii or Providencia stuartii.

Identical hybridization patterns were seen with probes specific for both genes indicating that these genes are 15 also linked in organisms other than Salmonella.

A virulence gene cluster required for Salmonells typhimurium survival within macrophaqe macrophages Four genes upstream and oppositely transcribed to the pagC gene of Salmonella typhimurium have now been 20 identified. Three genes (pagD, envE and envF) are predicted to be envelope proteins based on the isolation Sof active TnphoA insertions in these loci and the presence of a typical signal sequence at the aminoterminus of each protein. None of the four proteins possess significant homology to any protein in the database.

Only the gene immediately upstream of pagC and oppositely transcribed (pagD) was determined to be PhoP regulated. Transposon insertions in this gene greatly attenuate virulence and the ability of the organism to survive within murine macrophages. The transcription of several pag (including pagC) has been shown to be induced when Salmonella are within macrophage phagosome. In addition, analysis of proteins produced by Salmonella after infection of macrophage-derived cell lines indicate that pag products are induced and that pagC may be among 67 the most abundant gene products induced upon macrophage infection. Since pagD is required for macrophage survival, it is likely that the transcription of this gene also will be induced within macrophage phagosomes.

The pagD protein is small (87 amino acids, unprocessed) and has no strong hydrophobic domains; therefore, it is likely that it is a periplasmic or secreted protein.

Transposon insertions in the msgA gene were found to have an effect on mouse virulence and macrophage survival. It is likely that this gene may also be induced within acidified macrophage phagosomes as are other genes necessary for macrophage survival. If this gene is induced by the macrophage environment, its expression (as well as other genes necessary for 15 macrophage survival) may be controlled by a regulatory system separate from the PhoP/PhoQ system.

These pagC-linked genes do not appear to form an operon. Because none of the genes downstream of pagD are PhoP regulated, they appear not be transcribed from the pagD promoter. The presence of a potential transcriptional terminator at the end of the envE gene makes it unlikely that msgA is co-transcribed with envE.

S The data suggest that the msgA::MudJ insertion is not polar on envF, which suggests that envF has its own promoter. Additionally, a potential transcriptional terminator following msgA as well as a 493 bp intergenic region makes it unlikely that these genes are cotranscribed. Primer extension analysis of these genes confirms that all four genes are transcribed from their own promoter.

The other two genes identified in this region, envE and envF, appear to produce membrane proteins that contain characteristic membrane spanning regions. The envF gene product is likely to be a lipoprotein based on the presence of a consensus lipid attachment site and is 68 likely to play a role in Salmonella virulence.

The low G+C content of the genes in the pagC region suggests that they may have been acquired by horizontal transmission. Southern blot analysis of low G+C organisms probed with the msgA or pagD genes showed no homology, but this does not eliminate the possibility that they were acquired from another low G+C content organism. The possibility also exists that these genes reside on a mobile genetic element acquired from another source. The msgA and pagD probes hybridized in identical S. patterns to some members of the Enterobacteriaceae other 9 8* than Salmonella. However, the pagC gene has been shown to be unique to Salmonella species. This may indicate that the products of the genes upstream of pagC do not 15 form a complex with PagC or that their functions do not require PagC interaction. Alternatively, because proteins that have homology to PagC exist in other Enterobacteriaceae (in the absence of any DNA homology), a PagC homolog may be linked to msgA and pagD in other species which was not detected by the DNA hybridization S experiments.

9 aqC/paqC D promoter region: expression of heterologous proteins pagC and pagD are divergently transcribed and are 25 both PhoP activated. Other divergently transcribed, regulated genes are known in the art (Beck et al., 1988, Microbiol. Rev. 52:318-326), the Klebsiella pneumoniae pulA-malX region (Chapon et al., 1985, J.

Bacteriol. 164:639-645). Transcription of most of such genes require accessory proteins, such as CAP, in addition to the regulator to activate transcription.

These two genes are divergently transcribed, and their promoters are arranged back-to-back. A region of 134 bp exists between transcriptional start sites of these genes, which is similar to the intergenic region between pagC and pagD. The pulA-malK promoter region is 69 predicted to contain two MalT (the regulatory protein of this system) binding sites, one for each gene. Other MalT-activated genes require the CAP protein for expression, but the pulA and malX genes do not, possibly because of the high local concentration of the MalT regulator. Since the region between the transcriptional start sites of pagC and pagD (the predicted sequences) is only 137bp (nucleotides 562 to 776 of SEQ ID NO:15), it is likely that only PhoP binding sites Q 10 exist in the intergenic region, and that binding of one or more phosphorylated PhoP molecules positively regulates both genes. This pagC/pagD intergenic region w* which contains the divergent promoters can be used to construct vectors to express two heterologous proteins, 15 one in each direction.

prg genes As discussed above, phoP/phoQ constitutive mutations (phenotype PhoP e increase the expression of pag and repress the synthesis of approximately proteins encoded by phoP-repressed genes (prg). PhoPc bacteria are attenutated for mouse virulence suggesting that prg are virulence genes.

By use of the transposon, TnphoA, five unlinked prg loci were identified. In general, media conditions (starvation) that activate pag expression repress prg expression. One prg locus, prgH, was demonstrated to contribute to mouse virulence by both the oral and the intraperitoneal route. Both PrgH as well as PhoPc mutant S. typhimurium were found to be defective in induction of endocytosis by epithelial cells. Identification and mutation of such virulence genes will be useful in vaccine development.

70 Nucleotide sequence of the pra H. prcI, prqJ. and prqK cenes SEQ ID NO:10 represents the nucleotide sequence of a 5100-bp HindIII fragment that contains the hyperinvasive hil locus. Four ORFS encoding four prg genes are located within this DNA (see Fig. The ATG start codon is underlined; the asteriks indicate the positions of the prgH, prgI, prgJ, and prgK stop codons.

These prg loci are required for bacterial invasion of epithelial cells, full mouse virulence, and transepithelial neutrophil migration. A bacteria attenuated by a mutation in one or more of these loci can be used to vaccinate individuals against infection by the wild type pathogen.

15 Strains, materials and methods All bacterial strains used in the characterization of prg genes are listed in Table

S.

g 71 Table Strain genotype or description Relevant Reference or source

S

0 *4

S

S

S

04..

4 4. 0 0 S S *4

S

dO 0 4s 0 S. typhirurium 14028s derivat2 14028s Wild CS002 phoP CS003 Aphol CS012 pagAl 15 CS013 pagE: CS119 pagC] CS015 phoP- CS019 phoN CS022 pho-; 20 CS023 pho-; CS030 phoN AD154 phoP] CS031 pho-; 25 IB001 phoN; 1B002 CSO3C IB003 IBOO; 1B004 IB00 IB005 CSO1S IB006 CSO11 1B007 CS03C 1B008 IB00 1B009 IB0OO IBO10 CSO1S IBO11 CSO11 IB012 CS03C IB013 IB012 IB014 IB01; IB015 CSO1S 1B016 CSO1E 1B017 CS03C 1B018 IB017 IB019 IB017 1B020 CS019 1B021 CSO1I IB022 CS03C 1B023 IB022 1B024 IB022 1B025 CS019 IB026 CS015 IB027 CS03C IB028 IB027 ives type

ATCC

12 This work P ApurB This work t::Mu dJ This work L::Mu dJ This work ::TnphoA phoN2 zxx::6251 TnlOd-CmThis work -102 ::TnlO d-Cm This work zxx::6251Tn0d-Cm This work !4 This work !4 phoN2 zxx::6251Tn10d-Cm This work zxx::6251Tn10d-Cm phoPl2 This work L2 purBl744::TnlO Gift of E.

Eisenstadt !4 i r r i i r r i purBl744::TnIO This work zxx::625Tn10d-Cm AphoP ApurE This work with prgAl::TnphoA This work with pho-24 purB!744::TnlO This work with phoPl2 purBl744::TnIO This work with prgAl::TnphoA This work with prgAl::TnphoA This work with prgBl ::TnphoA This work with pho-24 purB1744::TnIO This work with phoPl2 purB1744::TnIO This work with prgBl ::TnphoA This work with prgBl ::TnphoA This work with prgB2::TnphoA This work with pho-24 purB1744::TnlO This work with phoP12 purB1744::TnIO This work with prgB2::TnphoA This work with prgB2::TnphoA This work with prgCl::TnphoA This work with pho-24 purB1744::TnIO This work with phoPl2 purB1744::TnIO This work with prgCl::TnphoA This work with prgCl::TnphoA This work with prgEl::TnphoA This work with pho-24 purBl744::TnlO This work with phoP12 purB1744::TnlO This work with prgEl::TnphoA This work with prgEl::TnphoA This work with prgE2::TnphoA This work with pho-24 purBl744::TnlO This work 72 IB029 IB030 IB031 IB032 IB033 IB034 IB035 IB036 IB037 IB038 IB039 IB040 IB041 IB042 IB043 IB044 CS032 CS033 CS034 Other IB027 with CS019 with CS015 with CS030 with IB032 with IB032 with CS019 with CS015 with IB001 with IB037 with IB037 with CS019 with CS015 with Tn5B50-380 phoP12 pur31744: :TnlO prgE2 :TnphoA prgE2: TnphoA prgE3 :TnphoA pho-24 purB1744: :TnlO phoP12 purB1744::TnlO pz-E3: TnphoA prgE3: TnphoA prgH1: :TnphoA pho-24 purB1 744: :TnlO phoP2 purB1744: :TnlO prgHl :TnphoA prgH1 :TnphoA in IB040 This This This This This This This This This This This This This This This This This This This work work work work work work work work work work work work work work work work work work work 6 .o a 0 *6e* 0.

&two** 0 00&S 00 000* 0 46 6 4~ 4 4 pWKSi5 in IB040 pWKSH5 in CS022 oxiA1O49::Mu dl-8 supD10 oxiC1048::Mu dl-8 supDlO oxiE4:: Mu dl AnadA100 S. typhinurium derivatives AK3011-AK3314 Collection of randomly spaced TnlOA16Al7 insertions (19) TT520 sri -202: :TnlO (41) TT2979 sri-211::Tn5 (41) TN3061 zcf-845::TnlO dcp-1 zhg-1635::TnlOdCm (41) SH7782 ompD::Tn5 (41) X4115 invA::cat (13) EE517 Ahil-517 (Tn5B5O-380) Gift of C.

Lee 30 JF897 JF896 JF739 oxIA1049::Mu dl-8 oxiClO4B::Mu dl-8 oxaE4::Mu dl AnadA100 S. enteritidis SM7 clinical wild-type isolate Strr smb E. coli SM1O(pRT291) contains plasmid pRT29l (TnphoA) derived from (49) pRX29O selecting for Tor and Klr.

MM294(pPH1JI) contains Gmr plasmid pPHlJI, which is incompatible (49) with pRK29O VV42(pWKSH5) contains plasmid pWKSH5, a derivative of pSC101 (51) that contains a 5.1 kb HindIXX fragment of hil DNA including prgH V.Bajaj and C.Lee 73 (19) Kukral et al., Journal of Bacteriology, 169:1787- 1793, 1987 (41) Sanderson et al., Microbiological Reviews, 52:485- 532, 1988 (13) Galan et al., Infection and Immunity, 59:3116- 3121, 1990 Aliabadi et al., Journal of Bacteriology, 165:780- 786, 1986 Stone et al., Journal of Bacteriology, 174:3945- 3952, 1992 Bacteria were grown as follows: Luria-Bertani (LB) broth was used as rich medium. Antibiotics were used in the following concentrations in growth media or agar: ampicillin 100 g/ml chloramphenicol 25 g/ml (Cm), t 15 gentamicin 30 Ag/ml kanamycin 45 gg/ml and tetracycline 25 Lg/ml The chromogenic substrate 5-bromo-4-chloro-3-indolyl-phosphate (p-toluidine salt) Y, (XP) was used to detect phosphatase activity on agar at a final concentration of 40 gg/ml. p-nitrophenyl phosphate (p-NPP) was used as a substrate for S" quantitative measurement of AP activity. Media was buffered to various pH ranges with 1 M sodium citrate. E media (Vogel-Bonner minimal) was prepared as described by t Davis et al., 1980, Advanced Bacterial Genetics: A Manual for Genetic Engineering. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. Nitrogen-, carbonand phosphate free medium was prepared as described by Kier et. al., 1977, J. Bacteriol. 130:399, herein incorporated by reference.

This starvation medium was supplemented with 0.04% (wt/vol) glucose as the carbon source, 10 mM NH 4 Cl as the nitrogen source, and 1 mM NaH 2

PO

4

.H

2 0 as the phosphate source. The carbon concentration is one log less than described by Kier et al., supra.

AP activity of strains isogenic except for 74 mutations in the phoP locus was measured in cultures grown from a single colony inoculum under various oxygen tensions with or without shaking at 37 0 C. Anaerobic cultures were grown in an anaerobic chamber (Coy Laboratories Products, Inc.) with a gas mixture of

N

2 10% 02, and 10% CO 2 at 37 0 C. For acid regulation, aliquots of mid-logarithmic cultures were removed to measure initial pH and AP activity. 1M sodium citrate (pH or 1M citric acid (pH 4.7) were added to 10 equivalent amounts of culture to a final concentration of 50 mM citrate. Cultures were grown aerobically for two hours at 37 0 C and then pH and AP measurements were taken.

T AP activity was measured as described previously (Michaelis et al., 1983, J. Bacteriol. 154:366-374, 15 herein incorporated by reference). AP units were calculated by the following formula: units {OD 420 /[time (minutes) x volume x OD 600 x 1000 as defined by Miller for f-galactosidase (Miller et al., 1972, Experiments in molecular genetics, p. 352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.).

Standard bacterial genetic techniques were used to study prg loci. Bacteriophage P22HTint-mediated transduction was performed as according to methods known in the art. TnphoA mutagenesis was performed using a broad host range plasmid (pRT291) to deliver TnphoA (Taylor et al., 1989, J. Bacteriol. 171:1870, herein incorporated by reference). Transpositions of TnphoA into Salmonella DNA were identified by use of the incompatibility plasmid pPH1JI (Taylor et al., supra).

Screening for phoP-repressed genes was performed using CS031, the donor strain of the pho-24 allele. CS031 was constructed by a P22 bacteriophage transductional cross between strains AD154 and CS022 which contains the purB::TnlO allele and the pho-24 allele, respectively.

The linkage of pho-24 and purB::TnlO was 70%, similar to 75 the linkage of purB to other phoP alleles. Therefore, when P22 bacteriophage transductional crosses were performed between CS031 and the strains containing active gene fusions to phoA, strains could be screened for loss of fusion protein activity on acquisition of tetracycline resistance. Initial screening involved detection of loss of AP activity in approximately 70% of colonies that acquired tetracycline resistance, as they were presumed to contain the pho-24 allele. In addition, controls 10 were performed using strain AD154 that contains the same purB::TnlO allele linked to a phoP null allele, phoP12.

Plasmid DNA was transformed into S. typhimurium strain LB5010 by the calcium chloride and heat shock procedure (Maclachlan et al., 1985, J. Bacteriol. 161:442).

Isolation of strains with TnphoA insertions in phoPrepressed genes Constitutive mutations in the phoP locus (phenotype PhoPc) that result in increased expression of pag in an unregulated fashion also markedly attenuate S.

20 typhimurium virulence and survival within macrophages.

The virulence defect of PhoP c strains can be explained by their decreased expression of approximately polypeptides encoded by phoP-repressed genes (prg).

A PhoP'PhoN- strain (IB001) was constructed by a *o 25 P22 transductional cross between CS019 and CS003. IB001 was then mutagenized with TnphoA (so that background acid phosphatase, encoded by phoN, would not interfere with the measurement of fusion protein activity on alteration of the phoP locus) and 1800 individual blue colonies with PhoA fusion protein activity were isolated on LB agar plates containing XP. These colonies were the result of 18 separate matings with approximately 20 pools in each.

These strains were tested for reduction of fusion protein activity on acquisition of the pho-24 allele (CS031), which resulted in a PhoPc phenotype. AP assays were then performed on strains isogenic except for the phoP locus.

76 The PhoPc phenotype was confirmed in these strains by preparation of whole cell protein extracts and SDS- PAGE analysis. All strains with a PhoP c phenotype demonstrated the expected. distinctive pattern of protein expression in PhoPc strains, i.e. repressed protein species of specific sizes.

Eight strains were identified with gene fusions to phoP-repressed genes. As shown in Table 6, the synthesis of most prg::TnphoA fusion proteins was fully repressed by the pho-24 allele. While two loci had complete repression of fusion protein activity, others demonstrated only partial repression. The expression of pag in PhoPc strains is 5-10 fold less than that observed after bacteria are phagocytosed by macrophages suggesting 15 that the degree of repression of some prg loci may be greater when pag are maximally activated within acidified macrophage phagosomes.

Lower values for prgB -phoA fusions in strains with a wildtype phoP locus (Table 7B) compared to PhoPstrains (Table 7) may represent some degree of repression in the presence of PhoP.

0

S

oeoo 77 Allele prgAl: :TnphoA prgBl: :TnphoA prgB2: :TnphoA prgCl: :TnphoA prg~l::TnphoA prgE2::TnphoA prgE3::TnphoA prgHl::TnphoA Table 6 PhoP- 29 137 77 14 21 34 25 92 PhoPc 7 27 19 1 5 6 6 2 Fold Repression 4 4 14 4 6 4 46 I~e

S

S S 5* 5.

S S

S

S

0 Sw 55@ 0** 0 55 0 *9 S S

S.

S S *500 .t

S

S S 55 S S

S

78 In Table 6, a comparison of the effect of phoP locus mutations on Prg-PhoA fusion protein activity is made.

PhoP" indicates that the strain assayed contains the phoP12 allele (CSO30) and PhoPc indicates the strain assayed contains the pho-24 allele (CS031). Values were calculated from stationary phase cultures. The numbers denote representative values of experiments performed on three separate occasions and represent activity in units of AP as defined above.

6 *e 0e 9 e* 0 00* e 79 Table 7A Strain Allole .t L.*LLL u L4 1 1 IB010 prgBl: :TnphoA 1B040 prgHl::TnphoA CS 119 pagCl::TnphoA 26 181 102 1263 Table 7B Strain Allele IBOlO prgEZ:; IB040 prg~l:: CS119 pagCl:: Table 7C Strain Allele TnphoA :TnphoA TnphoA Aerobic Microaeraphilic 777 85 173 Ainaeropi2c 1521 41 81

S.

9 0 90 S S @9 9 9 i 9 6 996@9 0 090@ S 0 69 9. 9 9B @9 9 9 S. S *@S9 Se 0 099909

S

S.

0 9 PH 4. 5 ipH 7. 0

IBOIO

15 IB040 CS 119 prg~l::TnphoA prgill::TnphoA pagCZ: :TnphoA 80 Table 7 demonstrates the effects of environmental conditions on the in vitro regulation of prg loci.

Table 7A shows the effect of starvation on prg and pag expression. Starvation medium (17) contained 0.04% glucose, 10 mM NH 4 C1, and 1 mM NaH 2

PO

4

.H

2 0. The fusion protein activity for starvation media was measured after 48 hours of growth (OD 600 0.5) while that in rich media (LB) was measured in late-logarithmic growth (OD 600 All cultures were grown aerobically.

Table 7B shows the effect of oxygen tension on expression of phoP-activated and phoP-repressed genes.

Expression in rich medium is compared under aerobic ,9 conditions at stationary phase (OD 600 microaerophilic

(OD

600 and strict anaerobic conditions with 80% N 2 15 10% 02, and 10% CO 2

(OD

600 0.6) after 24 hours of growth.* Table 7C shows the effect of pH on the expression of fusion protein activity of prg and pag loci. Expression was measured from cultures grown to logarithmic growth

(OD

600 0.5) in LB media buffered to various pHs with sodium citrate. All the numbers represent activity in units of AP as defined above.

Chromosomal location of prq::TnphoA loci prg::TnphoA linkage analysis was performed to a bank of strains with randomly spaced Tn10Al6A17 insertions to determine chromosomal locations and whether prg::TnphoA alleles were unlinked loci. The prg::TnphoA insertions were in five distinct linkage groups. Three alleles, prgEl- 3::TnphoA were identically linked to the Tn1OAl6A17 insertion of AK3091(26%) and two other alleles, prgBl- 2::TnphoA were similarly linked to the Tn1OAl6AI7 insertion of AK3190 AK3249 and AK3186 Another allele, prgHl::TnphoA, was found to be 37% linked to the Tn0OA16Al7 insertion of strain AK3304. The other two prg alleles did not demonstrate linkage to the bank of strains tested. The chromosomal DNA of these two strains was 81 analyzed by Southern hybridization analysis using a portion of TnphoA as a probe, and a rough physical map of the sites located adjacent to the TnphoA insertion was determined.

These alleles, prgA and prgC, had different restriction endonuclease sites surrounding the TnphoA insertions. In addition, the repression of prgA and prgC fusion protein activity in strains with the pho-24 mutation was different; prgC was completely repressed, while prgA was only partially repressed indicating that these loci are different. Thus, five unlinked loci encoding envelope proteins repressed in Sthe PhoP c phenotype were identified.

9* Though three prg loci were identified that were S* linked to transposon insertions, none of the Tn0OAl6Al7 insertions had a known map location. The physical map 15 location of two of these transposon insertions, AK3249 and AK3304, was analyzed using XbaI restriction endonuclease digestion and pulse field gel electrophoresis (PFGE). Since TnlOAl6A17 contains a single XbaI site, these TnlOA16A17 insertions can be assigned to a specific Xbal fragment of known map location (Liu et al., 1992, J. Bacteriol.

174:16622). AK3249 was assigned to 28-32 min, while AK3304 was assigned to either end of the 58-70 minute fragment.

Further P22 transduction to known markers in those regions was performed. The Tn0OAl6Al7 insertion of strain AK3249 and prgBl::TnphoA were found not to be linked to the TnlO insertion of strain TN3061 linked to dcp), which has a transposon insertion at 28 min, or to the insertion of strain SH7782 at 32 min. prgHl::TnphoA was found to be very weakly linked to the sr2202::TnO0 insertion of strain TT520 at 59 minutes. These data indicate that prg are unlinked on the Salmonella chromosome, consistent with the function of PhoP/PhoQ as global regulators.

82 The chromosomal location of TnphoA insertions in phoP-repressed genes (prg::TnphoA) was determined by linkage analysis to a bank of strains with TnlOAl6Al7 insertions (Kukral et al., 1987, J. Bacteriol. 169:1787, herein incorporated by reference). Cells with TnphoA insertions were spread on LB agar plates containing 10 gg/ml tetracycline and 40 gg/ml XP. Then P22 lysates grown on strains with Tn0OAl6Al7 insertions were spotted onto plates with a multiprong inoculator. After overnight inoculation, 10 plates were reviewed for linkage by looking for mixed blue and white colonies. Linkage was confirmed and quantitated by carrying out individual transductional crosses between the Tn10Al6Al7 containing strains and the strain with the TnphoA insertion. After selection for the Tnl0Al6A17 15 encoded tetracycline resistance, strains were scored for loss of blue color and TnphoA encoded kanamycin resistance.

Some TnphoA strains were found to be linked to TnlOA16A17 strains with no known map location. Two of these Tn1OA16A17 insertions were physically mapped using PFGE following XbaI restriction endonuclease digestion. Based on physical mapping, linkage analysis to other transposon insertions by P22 bacteriophage transduction was determined as necessary.

Chromosomal DNA was prepared as described by Mekalanos, 1983, Cell 35:253, herein incorporated by reference, using Proteinase K instead of Pronase.

Purification of plasmid DNA was performed by standard methods. Restriction endonuclease digestion was performed according to the recommendations of the manufacturer (New England Biolabs). DNA, size fractionated in agarose gels, was transferred to Genescreen Plus membranes (New England Nuclear/Dupont, Boston, MA) for blot hybridization by the method of Southern well known in the art. DNA probes were purified from agarose gels by the freeze-squeeze method (Tautz et al., 1983, Anal. Biochem. 132:14) and radiolabelled with 32 P]dCTP by the random primer method 83 (Feinberg et al., 1983, Anal. Biochem. 132:6).

Cloning genes from Tnpho A fusions The gene encoding prgH has been cloned using methods described below. The plasmid, pIBO1, containing the prgH gene has been deposited with the American Type Culture Collection on July 9, 1993 (Rockville, MD) and has received ATCC designation ATCC 75496. Fig. 5 shows the partial DNA sequence of prgH (SEQ ID NO: Fig. 9 shows the location and sequence of the entire prgH gene.

The genes described herein which have been identified by ThphoA insertion can be cloned using methods known in the art (Beattie et al., 1990, J. Bacteriol.

172:6997). Chromosomal For example, DNA of each strain S containing a prg::TnphoA gene fusion is digested with a 15 restriction enzyme such as BamHl which cuts at a single site in TnphoA maintaining the fusion junction, phoA sequences and the neo gene. Similarly, a plasmid such as pUC19 is digested with the same enzyme. Digested chromosomal and plasmid DNA are ligated overnight at 15°C and transformed 20 into competent E. coli. Transformations are plated on LB agar containing ampicillin and kanamycin to select for the bla gene of pUC19 and the neo gene of TnphoA. The chromosomal DNA containing the prg::TnphoA gene fusion can then be sequenced using standard methodology described above, such as the SEQUENASE® (United States Biochemical) kit. Universal primer (United States Biochemical) corresponding to DNA sequences in the plasmid or TnphoA primer (5'-AATATCGCCCTGAGCA-3') (SEO ID NO:4) corresponding to bases 71 to 86 of TnphoA can be used as primers.

To clone the wild type gene, a fragment of chromosomal DNA flanking TnphoA sequences can be used to screen a cosmid gene bank of wild type Salmonella strain ATCC 10428 using methods described above for cloning wild type pagC.

84 Environmental regulation of prg loci Since PhoP/PhoQ are environmentally responsive regulators, the effects of different growth conditions on prg::TnphoA expression were tested. The growth rate of strains with prg::TnphoA insertions was comparable to wildtype organisms under all conditions. The expression of all prg loci was maximal in late logarithmic growth phase when bacteria were grown in rich (LB) media. An example of this is the comparison of values of prgH::TnphoA expression in Table 7A (rich media and stationary growth) and Table 7C (pH 7.0, log phase). Since the expression of pag loci was maximal in starvation (which only reaches a maximal OD 600 0.5) and stationary growth phase, this was consistent with a S reciprocal relationship between the expression of pag and prgs. Further analysis of prg loci expression under starvation conditions confirmed this reciprocal relationship (Table 7A). prgH expression was repressed (Table 7A) and other prg were minimally affected under starvation conditions, in contrast to the induction of pag expression when bacteria were starved (Table 7A).

Because of its role in bacterial-mediated endocytosis (BME), the effect of oxygen tension in rich medium on pag and prg expression was also tested (Table 7B).

Different but not reciprocal regulation of pag and prg loci was found on growth at different oxygen tensions. Though pagA and pagB loci were minimally affected by growth at different oxygen tensions, the pagC virulence locus was approximately 5 fold repressed when bacteria were grown anaerobically as compared to aerobic growth (Table 7B).

Variability was also noted in the expression of prg loci in response to growth conditions in the absence of oxygen. One loci, prgH, was repressed three-fold in anaerobic growth, while another locus, prgB, was induced almost 50-fold when grown anaerobically (Table 7B). Other prg loci had minimal change in fusion protein expression as a result of different 85 oxygen tensions in the growth media.

Low pH conditions also had a variable effect on prg expression (Table 7C). The expression of pagC fusion protein activity was induced under acid conditions as previously known. When bacteria were grown to midlogarithmic growth, no significant induction of the relative repression of prgH expression was noted in media of low pH, while prgB expression was induced on exposure of bacteria to low pH (Table 7C). Hence, loci maximally expressed under 10 diverse environmental conditions can all be repressed by the .PhoPc phenotype.

Acid sensitivity was tested by the method of Foster S* et. al., 1990, J. Bacteriol. 172:771, herein incorporated by reference. Strains were grown aerobically in E media and 15 0.4% glucose at 37 0 C to an OD 600 of 0.5. The pH of the bacterial culture was decreased to near 3.3 by the addition of 1 M hydrochloric acid. An aliquot was taken immediately the remainder of the culture was incubated further at 37 0 C with subsequent aliquots removed at 40 min (t 40 and min (t 8 o) time points. The pH of the cultures remained near 3.3. The aliquots were diluted 1:10 in cold PBS, washed and resuspended in normal saline prior to plating serial dilutions for colony forming units.

prgH is a virulence locus for S. tvphimurium Since the PhoPc phenotype resulted in virulence attenuation and repressed the synthesis of approximately proteins, the virulence of strains with single mutations in prg loci was tested (Table Strains with prg::TnphoA insertions were screened for virulence defects by intraperitoneal injection of approximately 150 organisms into BALB/c mice. Controls were also performed with wildtype bacteria. A significantly longer time course of clinical disease progression was observed with a prg mutant strain compared to wild type bacteria. Mice injected intraperitoneally with strains containing the prgHl::TnphoA 86 insertion developed clinical signs of typhoid fever, such as a "scruffy "phenotype (fever and piloerection) and hepatosplenomegaly in approximately 10-14 days, compared to approximately 24 hours for the wild type bacteria. Despite the extended time course of disease development, all the mice eventually died. Disease progression of mice injected with other strains containing prg::TnphoA insertions showed a similar pattern of illness to that of wild type bacteria.

C.

*0 *cC C C 87 Table 8 Intraperitoneal injection 14028s Wild type IB040 pr-gHl LDq 0 5.6 x 101 6.7 X 105 1.2 IB041 phoP-102 prgH phoP-102 oral inoculation 14028s IB040 Wild type P-rgHlI 6.5 X 104 6.5 4 444 S a 04 a. 6 a 4 See 04 4.

S.

S S 4 00 a. ag 0a CO C

S

5.5540 0 4 055 a S 4, 0O O4 0 Cia C 88 Table 8 shows the effect of the prgHl::TnphoA mutation on Salmonella mouse virulence. Strains were isogenic and administered by intraperitoneal injection and oral inoculation in 35 day old BALB/c mice. The number of animals used at bacterial dilutions near the LD50 for each allele is listed in parentheses. The LD 50 determinations were repeated on three separate occasions.

Further testing of the LD 50 of strains containing prgH mutations was performed. prgH mutants were determined to have an LD 50 of approximately 60 organisms compared to a 4 value of <10 for wild type bacteria. Due to the difficulty in accurately delivering organisms in small doses to mice, a strain with a mutation in both prgH and phoP was constructed. The PrgH-PhoP- strain had greater than a 15 fold increase in LD 50 compared to CS015, an isogenic PhoP" strain (Table The combined effect of the two mutations further documented that the prgHl::TnphoA mutation attenuated S. typhimurium virulence and indicated that mutations which affected two phases of PhoP/PhoQ regulated gene expression were additive in their effect on virulence.

Strains with prgHl::TnphoA insertions were also tested for virulence when administered by the oral route. A 10 fold decrease in virulence (increase in LD 5 0) was observed (Table 8).

Further analysis of the efficiency of strains with prgHl::TnphoA insertions in crossing the mucosal barrier was tested by competition experiments with wild-type bacteria.

During the first 72 hours after oral inoculation with mutant bacteria, no prgHl::TnphoA mutants were recovered from the bloodstream of mice compared to control experiments in which organisms were routinely isolated from the blood of mice inoculated with wild type bacteria. Other strains with prg mutations were also tested for virulence defects by the oral route, but no significant change in virulence was observed.

89 Mouse virulence studies were carried out as follows. Bacteria were grown aerobically at 37 0 C to stationary phase, washed with LB, and diluted in normal saline. 35 days old (16-18g) female BALB/c mice were purchased from the Charles River Breeding Laboratories, Inc.

(Wilmington, MA). Diluted bacterial samples in saline were injected intraperitoneally with an inoculum of 0.1-0.15 ml.

Bacteria were administered orally as a 0.5 ml bolus to mice fasted for 2 hours, via a 2 inch straight, 18 gauge 10 stainless steel animal oral feeding needle (Harvard :a Apparatus, Inc., South Natick, MA) under mild 2-bromo-2chloro-l,1, -trifluoroethane (Halothane) anesthesia. The number of organisms administered was quantitated by plating for cfu/ml on LB agar. Mouse 50% lethal dose (LD 50 values 15 were determined by standard methods (Reed and Muench, 1938, u• Amer. J. Hygiene 27:493). The LD 50 determinations were repeated on three separate occasions. Competition assays were performed after bacteria were administered orally to mice as above. Bacteremia was assessed on days 1-4 from tail bleeds or intracardiac punctures with 50 p1 of blood plated immediately and after growth in LB broth at 37 0

C

overnight. Spleen and intestinal harvests were performed on days 1-6 with organs homogenized in 3 mls of 0.9% sodium f9 chloride. Samples and cultures were plated in serial dilutions. S. typhimurium was confirmed by characteristic growth (black colonies) on Hektoen-enteric agar (Difco Laboratories) and by the macroscopic slide agglutination test with Salmonella rabbit serum Group B (Antigens 4, 12) (Fisher Scientific).

Mutations in oxygen-induced genes do not affect mouse virulence Both prgH and pagC loci were shown to be repressed by anaerobic growth and required for full virulence, thus suggesting that a shift from anaerobic to aerobic conditions might serve as a general signal for induction of virulence genes. Strains with mutations in oxygen-inducible loci 90 (Aliabadi et al., 1986, J. Bacteriol. 165:780) were constructed. ATCC14028s derivatives with oxiA, oxiC, and oxiE mutations were made (termed CS032, CS033, CS034, respectively). These strains were as virulent as wild type bacteria. Though these gene fusions could still mark operons containing virulence genes, this data suggests that these loci are not essential to full virulence and that oxygen induction is not always correlated with virulence function.

prgH mutants have normal survival within macrophages Since the PhoPc phenotype resulted in a defect in bacterial survival within macrophages, the effect of this mutation on the synthesis of a prgH-encoded protein was tested. A strain with the prgHl::TnphoA insertion was 15 tested for intracellular survival within bone marrow-derived macrophages from BALB/c mice and J774.2 cells, a macrophage derived cell line. No defect in intracellular survival was observed. A strain with a prgBl::TnphoA insertion was also tested and found not to have a defect in survival within 20 macrophages.

*0 Assays to determine bacterial survival within macrophages were performed as described by Buchmeier al., 1989, Infect. Immun. 57:1, herein incorporated by reference.

Bacteria grown to stationary-phase were opsonized for *25 minutes in normal mouse serum before exposure to cultured bone marrow-derived macrophages harvested from BALB/c mice.

One hour after infection, gentamicin 10 gg/ml was added to kill extracellular bacteria. All time points 4, and 24 hr) were done in triplicate and repeated on three separate occasions.

Cultured bone marrow macrophages were harvested from BALB/c mice purchased from the Charles River Breeding Laboratories. J774.2 macrophages were cultured in Dulbecco's minimal essential medium with 10% fetal bovine serum 91 prq::TnphoA insertions do not suppress the phenotypes of PhoP mutants Several phenotypes of phoP mutants, including defensin and acid sensitivity as well as mouse virulence attenuation, were tested for suppression on addition of a prg::TnphoA mutation. To test the ability of a phoP mutation to suppress the synthesis of prg products, PhoP mutant strains isogenic except for prg::TnphoA mutations were constructed and tested for mouse virulence, where suppression would involve an increase in virulence, or decreased acid and defensin sensitivity. prg::TnphoA insertions had no effect on the virulence phenotypes of PhoP- bacteria. These results indicate that the prg::TnphoA Smutations tested did not suppress the PhoP null phenotype as single mutations.

PrqH and PhoPc mutants are defective in bacterial-mediated endocvtosis by cultured epithelial cells The BME of prg::TnphoA and PhoPc S. typhimurium strains was tested. The following observations (described 20 herein) suggested that prg genes may be involved in bacterial-mediated uptake by eucaryotic cells: prgHl::TnphoA was shown to be located at 59' on the bacterial chromosome, a location where other genes essential to invasion are clustered; prgH mutants were shown to be 25 defective in competition with wild type organisms on reaching the bloodstream of mice in the first 72 hours after oral ingestion; and the expression of one prg locus, prgB, was dramatically induced under anaerobic growth conditions.

Strains with prgH and pho-24 mutations had a significant reduction (p-value 0.01) in their ability to induce uptake by Madin-Darby canine kidney (MDCK) polarized epithelial cells compared to wild-type bacteria. Other prg strains with TnphoA insertions did not demonstrate a statistically significant defect in BME by epithelial cells (Table 9).

The adherence of strains defective in BME was unaffected by the prgH::TnphoA insertion when determined by cell- 92 associated cfu/ml before the administration of gentamicin (Table 9) and by microscopy.

To assay bacterial adherence and uptake of bacteria by epithelial cells, bacterial strains were grown at 37 0

C

without shaking (microaerophilic) to a final density of approximately 2x10 8 colony forming units (cfu)/ml. Assays were performed by seeding 105 MDCK cells/well in 24-multiwell tissue culture plates. Cells were incubated overnight at 37 0 C in 5% C0 2 /95% air atmosphere in DMEM/10%FBS without antibiotics until >80% confluent. The adherence and invasion assays were carried out according to the protocol of Lee and Falkow, 1990, Proc. Natl. Acad. Sci. USA 87:4304, herein incorporated by reference.

00 o 0

OSO

S

93 Table 9 strain 14028s SM7 CS 119 lB 005 IB010 IB020 IB025 IB040 CS022 1B043 IB044 Genotype Wild type Strr sm pagCl::TnphoA pgA1::TnphoA pr-gBl: :TnphoA pr-gCl::TnphoA pr~gEl: :TnphoA pr~gHl: :TnphoA pho-24 pWKSH5 in IB040 pWKSH5 in CS022 Adherence 4.2% Invasion 3.8% 1.9% 7.6% 2.9% 1.9% 0. 06%* 17.5% 0. 09%* q 0 0 00000 0 *00* 0 0 PS 0 0@ 0 0 0*0* 00 0 0 I00* 00 0 0 *000 0@ 0 0* 09 0 000 0 5.7% 1.9-11 94 In Table 9, the effect of prg::TnphoA insertions on Salmonella-mediated endocytosis by MDCK epithelial cells is shown. Microaerophilically grown bacterial strains were assessed for changes in adherence and invasion. Adherence was determined as the percentage of bacteria adhered to the cells after centrifugation and minute 4 0 C incubation/ total number of bacteria added to each well. Invasion was determined as the percentage of bacteria that had invaded after a two hour incubation with gentamicin/ total number of bacteria added to each well. There was no difference between S. typhimurium wildtype and S. enteritidis CDC5 wildtype strains with respect to adherence and invasion frequency. The asterisk represents statistical significance by 15 variance analysis of the invasion data done in triplicate compared to wild-type (p-value 0.01 The confluent MDCK monolayers were washed three times with PBS, then 0.9 ml of cold DMEM/10%FBS was added to each well. Bacteria were washed in LB and resuspended 20 in an equivalent volume of DMEM/10%FBS. Approximately 5x10 7 bacteria were added/well. The plates were spun at S500 rpm at 4 0 C for 10 minutes, then incubated at 4 0 C for minutes. Adherent bacteria were recovered by washing the plates three times with phosphate-buffered saline 25 (PBS), lysing the epithelial cells in 0.5 ml of 1% Triton-X-100/PBS, and plating for cfu/ml on LB agar. A morphologic assessment of adherence was also performed by staining bacterially infected epithelial cell monolayers grown overnight on coverslips for 7 minutes in 1 Ag/ml 4' 6-diamidino-2-phenylindole (DAPI). These DAPI stained coverslips were examined by both fluorescent and phase contrast microscopy using a Leitz Laborlux 12 microscope.

Invasion or bacterial-mediated endocytosis (BME) was assessed by allowing bacteria to adhere as described above. Plates containing bacteria and epithelial cells 95 were incubated for two hours at 37 0 C in a 5% C0 2 /95% air atmosphere. Each well was washed three times with PBS to remove bacteria not associated with cells. supplemented with 10 gg/ml gentamicin was then added to kill extracellular bacteria. After 90 minutes of incubation, the cell monolayers were washed three times with PBS and the viable intracellular bacteria were released by vigorously pipetting with 0.5 ml of 1% Triton X-100/PBS. An invasion deficient Salmonella enteritidis mutant and an invasive clinical wild-type isolate of S.

enteritidis were used as controls for BME. Viable bacteria were quantitated by plating for cfu/ml on LB agar medium. All assays were done in triplicate and repeated at least three times.

15 MDCK epithelial cells were used between passage 40-58 to maximize bacterial adherence and invasion.

Epithelial cell lines were cultured in DMEM/10% FBS and 1% penicillin/streptomycin solution at 37 0 C in a 5% CO 2 atmosphere.

To assay bacterial defensin sensitivity, NP-1 defensin was purified from rabbit peritoneal neutrophils according to methods known in the art (Selsted et al., 1985, J. Biol. Chem. 260:4579; Selsted et al., 1984, Infect. Immun. 45:655). Typically, l05 bacteria in 25 tryptone in 100 jl volume were exposed to 50-100 jg of defensin/ml at 37 0 C for 2 hours. The reactions were stopped by diluting the reaction in 0.9% NaCl.

Appropriate dilutions were plated to determine the cfu/ml of surviving bacteria. Assays were performed in duplicate at least twice for each strain. Appropriate assays with sensitive (PhoP-) and resistant (wild-type) strains were performed as controls.

Mapping of prqH 96 The location of prgH relative to other invasion loci at 59 minutes was determined using linkage analysis.

P22 transduction linkage analysis indicated that the Tn1OA16Al7 of strain AK3304 had similar linkage to invA and prgH however, invA was not linked to sorbital. The prgHl::TnphoA insertion was found to be linked to the transposon insertion of EE517, a strain with a 8.5 kilobase deletion adjacent to the Tn5B50- 378 insertion of hil.

A physical map of the restriction endonuclease sites surrounding the TnphoA insertion of strain IB037 was made (Fig. 4) revealing no similarities to the known restriction endonuclease map of the invA-E region.

Plasmids containing the cloned inv and hil DNA were then 15 used as probes in Southern hybridization analysis of chromosomal DNA from wild type ATCC10428s and IB040 bacteria containing the prgHl::TnphoA insertion. When a plasmid which contains other invasion loci highly linked to invA-E (invH, invF, and part of invG) was used as a probe, no differences in hybridization pattern was found between wild type bacteria and strain IB040 indicating that prgH was not located within the inv region.

S However, when a plasmid containing a 5 kb region immediately downstream of the Tn5B50-380 insertion of 25 hil was used as a probe, the prgHl::TnphoA insertion was demonstrated to be located within this region. By use of the known restriction map of the hil locus (Lee et al., 1992, Proc. Natl. Acad. Sci. USA 89:1847) and the known restriction endonuclease sites of TnphoA, the physical map of this area and the relationship of prgHl::TnphoA within it were further defined (Fig. The prgHl::TnphoA insertion was oriented so that the direction of transcription of the phoA fusion protein was opposite to that of the Tn5B50 insertions that confer the hil phenotype and contain a constitutive neomycin 97 promoter that is transcribed out of the transposon (Fig.

Although prgH was found to be located within the hil locus, this gene is unique in that it is oppositely transcribed and unlike any other genes identified within the hil locus, prgH is regulated by the phoP regulon.

Since it was possible that a protein whose expression was altered by the Tn5B50-380 insertion might alter the expression of prgH, strains containing both insertions were constructed and the prgH-phoA fusion protein activity compared under different environmental conditions. When bacteria were starved or grown anaerobically, derepression of fusion protein activity was observed. Table 11 shows the effect of the Tn5B50- 380 insertion on expression of prgH fusion protein 15 activity.

Table 11 Strain Allele Starvation LB (aerobic) LB(anaerobic) IB040 prgHl::TnphoA 5 142 41 IB042 Tn5B50-380 46 248 227 20 prgHl::TnphoA This data demonstrates that the Tn5B50-380 insertion increased prgH expression, even though prgH transcription was opposite to that of the Tn5B50-380 encoded neomycin promoter. Starvation (repressing conditions for prg) indicates that bacteria were grown aerobically for 48 hours in starvation medium containing 0.04% glucose, 10 mM NH 4 Cl, and 1 mM NaH 2

PO

4

.H

2 0. LB (aerobic) indicates that bacteria were grown in Luria-Bertani broth (rich media) to late logarithmic growth (nonrepressing conditions) (OD 600 LB (anaerobic) indicates that bacteria were grown under strict anaerobic conditions for 24 hours (OD 600 All the numbers represent activity in units of AP as described above.

98 To rule out the possibility that the BME defect of the prgH mutant was an artifact of the PhoA fusion protein produced, complementation analysis was performed with a plasmid (pWKSH5) containing a 5.1 kb HindIII fragment which included the hil and prgH loci. The plasmid was crossed into PrgH (IB040) and PhoPc (CS022) mutant bacteria to create strains IB043 and IB044, respectively. The BME phenotype of the PrgH mutant was similar to wild-type with the same plasmid insertion.

10 The BME phenotype of the PhoPc mutant was not complemented by this plasmid. These results indicate that a gene product altered in synthesis as a result of the prgH::TnphoA insertion was necessary for BME.

Using a strain with a phoP/phoQ locus mutation that constitutively simulates the environmental activation of pag (phenotype PhoPc), five unique phoPrepressed loci encoding envelope proteins were defined.

phoP-repressed genes (prg) were found to be widely spaced on the chromosome and the expression of prg loci was repressed under starvation conditions, when pag loci were induced (Table Table Environment pg prg media starvation rich 02 aerobic page aerobic -prgH anaerobic prgB pH 3.3-5.5 3.3-5.5 -prgB prgH mammalian cell macrophage epithelial PrgH was shown to lie between two Tn5B50 insertions that confer the hil phenotype. Since deletion mutants in this region have been demonstrated to also have defects of BME, and the BME defect of prgH mutants can be complemented with a plasmid containing this locus, it is 99 possible that a protein not synthesized as a result of the prgHl::TnphoA insertion promotes BME (Fig. 4).

Contrary to the expectation that genes essential to the hil phenotype would be induced under microaerophilic conditions similar to what was found for prgB, prgH expression was maximal during aerobic growth and the Tn5B50-380 insertion, which results in a hil phenotype, derepressed expression of prgH. In addition, the direction of transcription predicted by the prgHl::TnphoA insertion is opposite to that of the Tn5B50-380 encoded neomycin promoter associated with the hil phenotype suggesting that a regulatory protein interrupted by or transcribed from the Tn5B50-380 insertion affects the expression of prgH.

15 In view of the observation that pWKSH5, a plasmid containing prgH (hil), did not complement PhoPc bacteria for BME, it is possible that other invasion genes may also be regulated by PhoP/PhoQ. If prgH was expressed from pWKSH5, despite the presence of the pho-24 mutation, this suggest that other genes repressed as part of the PhoPc phenotype are necessary for BME.

The identification and characterization of prgH has shown that PhoP/PhoQ oppositely regulate factors necessary for bacteria to enter or to survive within mammalian cells, further documenting the importance of gene regulation to bacterial virulence. The identification of prg loci can be used to study the regulation of bacterial genes after infection of mammalian cells. Understanding the regulation of virulence genes, such as prgH can also be used to attenuated pathogenic bacteria for the development of new live vaccines for typhoid fever.

Role of prg genes in virulence The prg locus, prgH, was found to contribute to mouse virulence when S. typhimurium was administered by 100 both the oral and intraperitoneal routes. PrgH as well as PhoPc mutants were further found to be defective in bacterial-mediated uptake by epithelial cells suggesting that an inability to cross epithelial barriers might contribute to the attenuation of virulence observed.

Competition studies in mice after oral ingestion of bacteria further supported that prgH mutants were defective in transcytosis across the intestinal epithelial barrier. Therefore, at least two phases of PhoP/PhoQ regulated protein expression essential to bacterial virulence have been defined. In one phase, prg expression promotes bacterial mediated endocytosis by epithelial cells (Table 10), while in another phase, pag Sexpression promotes survival within macrophages.

15 Systemic pathogens, such as Salmonella, may encounter more complex and varied environments than may be encountered by mucosal pathogens. The achievement of intermediate states of pag and prg expression could be S essential to virulence at some stage of the infectious 20 cycle. Consistent with this concept was the lack of uniformity observed in the expression of pag and prg on growth at different oxygen tensions and pH conditions.

These data may also indicate that not all regulation of pag and prg is mediated directly through PhoP and PhoQ.

25 Given the function of PhoP as a transcriptional regulator, it is likely that prg loci repression occurs at the level of transcription.

The approach of defining genes repressed by the pho-24 mutation has led to the discovery of at least one virulence locus, prgH, which can be mutated to attentuate the bacteria for vaccine purposes.

Attenuation of Bacterial Virulence by Constitutive Expression of Two-component Requlatory Systems The virulence of a bacterium can be attenuated by inducing a mutation which results in the constitutive expression of genes under the control of a two-component 101 regulatory system or by inducing a mutation that inactivates a gene under the control of the two-component systems. A balance between the expression of the genes under the control of the two-component system, e.g., between pag and prg gene expression, and possibly between two-component system regulated genes and other genes, is necessary for full virulence. Mutations that disrupt this balance, mutations that cause the constitutive expression of a gene under the control of the two- 10 component system, or a mutation that inactivates a gene under the control of the two-component system, the *pag gene, reduce virulence.

Constitutive mutations in two-component regulators can be identified by the use of a strain containing a 15 recorder gene fusion to a gene. regulated by the twocomponent system. Such gene fusions would most typically include DNA encoding the lacZ gene or AP fused to a gene under the control of the two-component system. Strains containing fusions that are (as compared to wild type or parental strains) highly expressed in an unregulated fashion, constitutive, can be detected by increased color on chromogenic substrates for the enzymes. To detect constitutive mutations a cloned virulence regulator could be mutagenized by passage through an E. coli strain defective in DNA repair or by chemical mutagenesis. The mutated DNA for the regulator would then be transferred to the strain containing the gene fusion and constitutive mutations identified by the high gene fusion expression (blue color in the case of a lacZ fusion grown on media containing X-gal). Constitutive mutations in a component of a two-component regulatory system could also be made by in vitro mutagenesis after other constitutive mutations have been sequenced and a specific amino acid change responsible for the constitutive phenotype identified. Putting several amino 102 acid changes that all result in a PhoP constitutive phenotype would result in a decreased frequency of reversion by spontaneous base changes. A constitutive mutation could also be constructed by deletion of the portion of the amino terminus of the phospho-accepting regulator which contains the phosphoacceptor domain e.g., deletion of sequences encoding amino acids amino terminal to amino acid 119 in the phoP gene or deletion of analogous phospho accepting sequences in genes of other two-component regulatory systems. This could result in a conformational change similar to that induced by phosphorylation and result in increased DNA binding and transcriptional activation.

Attenuation of virulence: deletion in the phoP/phoQ 15 reculon 0 *r 0.

9.

590

S

6 B. .9 9.

0 As discussed above, the PhoP regulon is essential to full virulence of Salmonella. This regulon is composed of two genes, PhoP and PhoQ located in an operon, and over 40 genes they positively and negatively regulate (pag and prg, respectively).

PhoP null S. typhimurium mutants have been demonstrated to be markedly attenuated and also effective vaccine strains when studied in the BALB/c mouse model of typhoid fever. This phenotype is likely the result of multiple, phoP-activated virulence genes, as transposon insertions in multiple different phoP-activated genes have been independently demonstrated to decrease S.

typhimurium virulence. S. typhimurium mutants deleted for genes essential to aromatic amino acids (aroA null or aroC/aroD null mutants) are also markedly attenuated in the mouse model. However, testing of aroC/aroD mutants in humans has shown that although these strains are immunogenic, bacteremias and side effects such as fever have been noted at doses as low as 10 5 to 107 organisms administered as a single oral dose Clin. Invest.

90:412-420).

103 It has now been found that a large deletion in a global regulator of Salmonella virulence, the PhoP/PhoQ operon, significantly decreases the virulence of the bacteria. This mutation, the result of a 1 kB deletion of DNA within the phoP/phoQ locus, was initially made in S. typhimurium and subsequently transferred via homologous recombination to S. typhi. In order to confer an even greater margin of safety in construction of this vaccine, it was created in a strain background deleted for genes essential to aromatic amino acids and carrying the histidine G46 mutation, a mutation rendering the organism auxotrophic for histidine. The resulting strain, S. typhi TyLH445, offers several advantages over existing vaccine candidates, most notably, immunogenicity 15 without transient bactermia.

Use The Salmonella cells of the invention are useful as sources of immunological protection against diseases, typhoid fever and related diseases, in an animal, 20 a mammal, a human, in particular as the basis of a live-cell vaccine capable of colonizing the inoculated animal's intestine and provoking a strong immune reaction. Appropriate dosages and conditions of administration of such a live, attenuated vaccine are 25 known in the art, as described in Holem et al., Acute Enteric Infections in Children, New Prospects for Treatment and Prevention (1981) Elsevier/North-Holland biomedical Press, Ch. 26, pp. 443 et seq. (Levine et hereby incorporated by reference, and are described in the examples below.

Advantages One advantage of the invention is that the bacterial cells are attenuated as a result of a mutation(s), the phoP/phoQ operon, that directly affect a virulence pathway. Another advantage is that 104 the bacterial cells have mutations in two completely different attenuating genes, the aromatic amino acid synthesis pathway (Aro), and in an operon important to Salmonella virulence (PhoP/Q). As a result, the bacteria appear to be extremely attenuated; doses as high as 1 x 109 cfu appear to be very safe. Other vaccines under development, such as CVD 908, have caused some systemic symptoms, fever or bacteremia, at doses as low as 1 x 107 cfu.

In addition to the phoP/phoQ deletion and the g- AroA-mutation, the bacterial cells of the invention may also contain a histidine mutation to further alternate virulence, although absence of the histidine mutation may improve immunogenicity. The bacterial cells of the S* 15 invention are the most promising vaccine candidates to date because they are strongly immunogenic and safe, extremely attenuated.

I4 EXAMPLE 1: Construction of vaccine strain The bacterial cells of the invention were made by 20 deleting approximately 1 kb of DNA in the phoP/phoQ regulon.

PhoP/phoQ deleted suicide vectors were constructed using methods known in the art. A DNA fragment containing the phoP/phoQ locus was obtained by PCR using wild type S. typhimurium chromosomal DNA as a template.

PCR primers flanking the phoP/phoQ locus were engineered to contain terminal restriction enzyme recognition sites, recognition site for EcoRI, to facilitate subsequent cloning. Following amplification, the PCR product was digested with EcoRI and cloned into the EcoRI site in the polylinker of a high copy vector. The plasmid containing the phoP/phoQ DNA fragment was named pLH356.

Sequence analysis and restriction mapping of the 105 phoP/phoQ locus revealed four HpaI sites within the locus; no HpaI sites were found in the vector. To create an internal deletion within the phoP/phoQ locus, pLH356 DNA was cut to completion with HpaI, and religated, to yield with an internal deletion from nucleotides 376-1322 (pLH418). This deletion was confirmed by restriction digestion of the plasmid.

A DNA fragment containing the internally deleted phoP/phoQ locus was excised from pLH418 using the SacI/SphI restriction sites within the polylinker region of the vector. This fragment was cloned into compatible sites in the plasmid CVD442, which carries the sacB gene S* to allow positive selection for allelic exchange. The resulting suicide vector was called pLH423.

15 pLH423 was transformed into E. coli lambda pir SY327, and subsequently into E. coli lambda pir (strain LH425). E. coli strain LH425 was mated with S. typhimurium strain CS019. Single recombinants carrying plasmid sequences integrated onto the S. typhimurium chromosome were selected by plating on agar containing ampicillin and chloramphenicol (Strain LH428). These strains were confirmed to be ampicillin resistant and sucrose sensitive, death on sucrose plates containing no NaCl when incubated at These data confirm the integration of plasmid sequences into the Salmonella chromosome.

A P22 bacteriophage lysate was made from strain LH428; phage particles were concentrated 20x by high speed centrifugation and transduced into S. typhi strain 522Ty2 (a strain with a deletion in the aroA gene, and the G646 mutation which renders the organism auxotrophic for histidine). Single recombinant S. typhi organisms were selected by plating on LB plates supplemented with aromatic amino acids, cystine, histidine, and ampicillin (strain LH435).

106 Strain LH453 was grown with aromatic amino acids, cystine, and histidine (but without ampicillin) to mid logarithmic growth phase. Serial dilutions were plated on LB 20% sucrose plates lacking NaCl, and on LB plates lacking NaCl. The number of bacteria that grew on plates without sucrose was greater than the number that grew on sucrose-supplemented plates by a factor of three logs.

These data suggest that many colonies lost plasmid sequences containing the sacB gene.

Multiple colonies from the sucrose selection were picked and confirmed to be ampicillin sensitive and sucrose resistant. Chromosomal DNA from approximately colonies was purified and subjected to Southern blot 0. analysis, utilizing the 2.3 kb fragment of wild type 15 phoP/phoQ as a probe.

Southern blotting revealed the loss of two HpaI sites and an XmnI site known to be within the 1 kb deleted fragment of phoP/phoQ in several strains. One of these strains was designated TyLH445.

EXAMPLE 2: in vitro evaluation of TyLH445 TyLH445 was extensively characterized in vitro using standard clinical microbiological tests. The nutritional requirements of TyLH445 were evaluated.

TyLH445 did not grow on M-9 plates unless supplemented with aromatic amino acid mix, cystine typhi grows better with cystine), and histidine. These data confirmed that TyLH445 was AroA-, His-.

TyLH445 was found to agglutinate with polyclonal serum against Salmonella and polyclonal serum against S.

typhi Vi antigen. Group D agglutination was found to be variable, perhaps due to excess Vi antigen. TyLH445 was also found to be indole negative (as are all Salmonellae), and to produce very little hydrogen sulfide (as do many S. typhi). Biochemical testing utilizing 107 both the VITEK system as well as the BBL Crystal Enteric organism identification system was also carried out.

These data indicated that the TyLH445 strain was S.

typhi.

Growth characteristics of TyLH445 were also evaluated. TyLH445 was found to grow just as quickly as its parent, 522Ty2, (phoP/phoQ locus intact). Growth in vitro was measured in aromatic amino acid/histidine/cystine-supplemented Luria broth at 37 0

C.

Growth curves of the parent and vaccine strain were found to be essentially identical (see Fig. Standardized clinical testing methods were use to determine antibiotic sensitivity. TyLH445 and the parent strain, 522Ty2, were found to be sensitive to ampicillin, 15 trimethoprim-sulfamethoxazole, ciprofloxacin, aminoglycosides, and third generation cephalosporins. No difference in zone sizes was detected between the parent and vaccine strains, suggesting that no other antibiotic resistance mechanisms, modification of antibiotic 20 transport systems, or modification of the cell wall of the bacterium, were affected by introduction of the mutated phoP/phoQ locus into S. typhi.

The phoP/phoQ HpaI deletion mutants were tested for defensin sensitivity, a phenotype of PhoP null 25 mutants. Defensin sensitivity assays were performed as follows.

Liquid cultures of strains to be tested were grown overnight. Cultures were then diluted 1:200, and grown to an optical density (OD 600 of approximately 0.2, after which the cells were diluted to concentration of approximately 1 x 105 organisms per 0.05 ml.

Two reactions were carried out for each strain: vehicle alone (0.01% acetic acid in sterile water) and defensin NP-1 solution (70 ug/ml in 0.01% acetic acid). An equal volume of bacterial suspension in 108 tryptone was added and the test tubes were incubated on a roller at 37 0 C for 2 hours. The final volume in each reaction tube was 0.1 ml, making the final concentration of defensin 35 ug/ml.

Defensin is inactivated by the high salt and high protein concentration present in bacterial growth media, e.g. LB broth. Thus, defensin activity was stopped by adding 900 ul of Luria broth to each tube. Serial dilutions of each tube were plated and cfu/ml was determined for both the control tube and treatment tube e** for each strain. Results were expressed as log of bacteria killed for each strain. Typically, 1.0-1.5 log of wild type bacteria were killed. PhoP null mutants .generally exhibit 2-4 logs of killing. Since strains 15 with slower growth rates appear less susceptible to defensin killing, the growth rate of each strain tested in the defensin sensitivity assay was measured. Strains with similar growth rates were compared in the defensin 0 sensitivity assay.

S" 20 The HpaI deletion was evaluated both in an S.

typhimurium background and in the S. typhi background.

SIn both backgrounds, the deletion mutation conferred sensitivity to rabbit defensin NP-1 at a concentration of 35 ug/ml. See Fig. 11 and Fig. 13. The difference S 25 between PhoP+ and HpaI deleted PhoP null mutants was less pronounced in the S. typhi strain, an effect that may reflect the slower growth rate of the less hardy S. typhi strain compared to the S. typhimurium strain which lacks the additional auxotrophies.

The state of phoP activation in bacteria with the HpaI phoP/phoQ deletion was tested utilizing a LacZ recorder gene fused to phoP-activated gene B (pagB).

Since the efficiency of transduction utilizing P22 in S. typhi is low, these studies were performed in S.

typhimurium rather than S. typhi. PhoP activation was 109 found to be 40-60 Miller units (Miller et al., 1972, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, pp. 352-355) in the presence of an intact phoP/phoQ locus, and just barely detectable in strains with the HpaI deletion (3cfusee Fig. 12).

EXAMPLE 3: In vivo evaluation of S. typhimurium HpaI deleted strain As S. typhi strains are not pathogenic for mice, the HpaI phoP/phoQ deletion mutation was evaluated in both wild type and aroA- S. typhimurium. Female BALB/c mice were injected intraperitoneally with various dilutions of S. typhimurium LH430, a wild type S.

Styphimurium carrying the HpaI deletion. The LD0 of this 15 strain was determined to be between 8.2 x 10 5 and 8.2 x 106. (All mice receiving 8.2 x 105 cfu survived, and all receiving 8.2 x 106 died.) These data are consistent with the LD 50 data obtained with strains harboring transposon insertions at the phoP/phoQ locus.

20 Immunogenicity of the HpaI phoP/phoQ deletion was evaluated in S. typhimurium aroA::tet (LH481), a strain comparable to the human vaccine strain. Mice were inoculated intraperitoneally with 2.3 x 105 and 2.3 x 106 cfu of LH481 (4 mice per vaccine dose), and challenged 25 days later with 30 x the LD 50 of wild type organisms. All mice but one mouse survived. The mouse that died was in the group that received the lower vaccine dose. No animal receiving the higher vaccine dose became ill.

EXAMPLE 4: Phase I study human studies The vaccine strain was administered to human volunteers at doses of 1 x 105 to 1 x 101 0 cfu/single oral dose. Two volunteers received each dose; 3 volunteers were given a dose of 1 x 108 cfu/ml. Volunteers were evaluated at various time points following administration of the vaccine.

110 Safety To detect the presence of the vaccine strain in patient blood, Bactec blood cultures were performed in duplicate on days 4, 6, 8, 10, 12 after taking vaccine.

Bacteremia was not detected in any of the volunteers.

Thirteen adult human volunteers have received escalating single oral doses of this new attenuated typhoid fever vaccine. No individuals have had side effects of any sort. Specifically, there have been no fevers, no gastrointestinal symptoms, and no constitutional symptoms. Volunteers have been subjected to serial blood cultures on a preset schedule after receiving the oral vaccine 2 sets of BACTEC blood cultures performed on each of days 4, 6, 8, 10 and 12 c€0 15 after receiving the vaccine, and no positive blood cultures have been noted. Volunteers have been followed up at 2 months after receiving the vaccine, and no late symptoms have been reported.

Colonization 20 Stool samples were tested for the presence of the vaccine strain TyLH455 using methods known in the art.

S Primary stool was evaluated for the presence of the vaccine strain on culture plates. In some cases, it was necessary to enrich stool samples for the vaccine strain 25 by incubating the stool overnight in BBL Selenite F broth supplemented with Aro/His/Cystine in order to detect the bacteria. This medium is somewhat inhibitory for E. coli and but promotes Salmonella growth.

Volunteers have been colonized for various time periods from 1-6 days after receiving the vaccine. With the highest doses (109 or 101 0 volunteers have had positive primary culture plates in the initial 1-3 days post vaccination, whereas at lower doses, only selenite enrichment broth cultures (selective medium for Salmonella which inhibits other enterics) have been ll positive for the vaccine organism. No volunteer studied thus far has had prolonged carriage of the vaccine organism at 2 months of followup.

Table 17 Dose Number Colonization 105 2 NO 106 2 2/2 for 1-2 days 7 2 1/2 for 3 days 10 8 3 1/3 for 6 days 10 10 9 2 2/2 for 4-6 days both had positive primary plates day 1 101** 2 2/2 for 3-6 days both had positive primary plates on days 1 and 2 C. e Measured by whole cell and LPS ELISAs and Widal test vs. H flagellar antigen. Sera analyzed at 1:40 and higher dilutions in all tests.

One of these volunteers has received a booster dose of 101 0 organisms, given one month after the primary inoculation (serologies pending).

Immunoenicity Induction of an immune response to the vaccine strain was measured by standard ELISA assays. Sera was collected from volunteers 0, 7, 14, 21, and 28 days after receiving a single oral dose of the vaccine. ELISA assays were carried out using whole bacteria TyLH445 and S. typhi LPS (SIGMA, St. Louis, MO) as antigens. Day 0 serum from each volunteer was used as an internal negative control. Convalescent sera from patients previously infected with wild type S. typhi (most from 112 Mexico) were used as positive controls.

Several volunteers had documented seroconversion at 21 days after receiving the vaccine, as measured by ELISA in which IgG antibodies directed against whole vaccine organisms or against S. typhi LPS were detected.

Sera taken from patients prior to administration of the vaccine (pre-immune sera) were tested, and the data used to establish a baseline. Patient sera taken at various time points after vaccination were considered positive if the test results were 0.2 ELISA OD units greater than that of the preimmune serum.

Other Embodiments Other embodiments, strains of Salmonella S which contain only a deletion in the phoP/phoQ regulatory 15 locus to attenuate virulence, and strains which, in S* addition to a phoP related mutation or genetic alteration, also contain an attenuating mutation in another gene, cya gene (adenylate cyclase) or crp gene (adenylate cyclase receptor), are also within the 20 claims.

The entire disclosure in the complete specification of our Australian Patent Application No. 73259/94 is by this cross-reference incorporated into the present specification.

9. 0 040 0 113 SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: Miller, Samuel I.

Mekalanos, John J.

(ii) TITLE OF INVENTION: SALMONELLA VACCINES (iii) NUMBER OF SEQUENCES: (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Fish Richardson STREET: 225 Franklin Street S. CITY: Boston STATE: Massachusetts COUNTRY: U.S.A.

ZIP: 02110-2804 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.25 and WordPerfect (Version .5.1) (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSIFICATION:

(vii) PRIOR APPLICATION DATA: APPLICATION NUMBER: 08/090,526 FILING DATE: July 9, 1993 (viii) ATTORNEY/AGENT INFORMATION: NAME: Clark, Paul T.

REGISTRATION NUMBER: 30,162 REFERENCE/DOCKET NUMBER: 00786/220001 (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: (617) 542-5070 TELEFAX: (617) 542-8906 TELEX: 200154 114 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: Mi SEQUENCE CHARACTERISTICS:

LENGTH.*

TYPE:

STRANDEDNESS:

TOPOLOGY:

2320 nucleic acid double linear (iMOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: ew i 0 0 *S 0 0S 0*

S

0

S

OS0S* 0

S..

S.

0

OS

0 0 *5 S. eS

SO

S

S

*SS 0 0 50

S

S

GTTAACCACT

AATATTTGCG

TTATGTTGGA

ATAGATATAT

TATGATTACA

CTGTGAAGCA

TAGCCGAACG

TGTTGCATGG

TATATGCGTG

GTTACCTAAA

ATCAGGAGCG

TGAATGCCGG

GAGTTGTT

CTTAATAATA

TTAGTTATTA

ATTGTGGTGT

TAAAAGATTA

GCGCCTGCGA

CAATGCGATA

GTCTCAAGTT

GTGATTTGTT

AGAAAAATTA

TGAGCGATAG

ATAGCGGTCA

ATCGGTACTG

ATGGGTTTTA

TTTTTTTGGA

TGATTCTATT

AATCGGACG

TGGCATATAA

TGTTCTGATT

TCTTAATGTG

GTTCTATAGT

GCATTCAAAT

AGTCCTTCGG

ATTATTCGTG

CAGGTGTTTA

TAGCGAAATA CACTTTTTTA ATGTAAATTC TCTCTAAACA

CTTATAATAT

GGAATAAAGC

CCGTATTCCG

ATATGGCGAG

GTTGTGAGAT

GGCTAAAGAC

CTATAAAAGT

TAGTAAAAAT

GTTTTGTCGA

AACACACCGT

AACAAGAAAT

GTGCTAAGCA

GATGGAGCGT

TTTGCTTAAT

TTTCTCTTTA

TTTATGGTTT

TAGATGACAT

ATCTTTCAGG

TTCGCCATAG

AAATAATAAG

TCGCGTGTTC

CAGCTGATAT

GTTGTAACTG

TCATCGTGAA

CACCTGAGGA

GACATGTTTT

AATATCAAAA

CTGTTAAATA

TGTAGAACCG

AAGTAAACAC

TGGCGATAAC

TAGTATTAAG

120 180 240 300 360 420 480 540 600 660 720 728 776 824 872 920 968 ATG AAA AAT ATT ATT TTA TCC ACT TTA GTT ATT Met Lys Asn Ile Ile Leu Ser Thr Leu Val Ile 10 GTT GTA AAT GTT GCA CAG GCC GAT ACT AAC GCC Val Val Asn Val Ala Gin Ala Asp Thr Asn Ala 25 GCA CGG TAT GCA CAA ACT AAA GTT CAG CAT TTC Ala Arg Tyr Ala Gin Ser Lys Val Gin Asp Phe 40 GTA AAT GTG AAA TAC CGT TAT GAG CAT GAC TCT Val Asn Val Lys Tyr Arg Tyr Ciu Asp Asp Ser s0 55 TCC TCG CTA AGT TAC TTA TAT GGA GAC AGA CAG Ser Ser Leu Ser Tyr Leu Tyr Cly Asp Arg Gin 70 75 ACT ACA ACC OTT TTG Thr Thr Ser Val Leu TTT TCC GTG GGG TAT Phe Ser Val Gly Tyr AAA AAT ATC CCA GGG Lys An Ile Arg Giy CCC CTA ACT TTT ATT Pro Val Ser Phe Ile CCT TCC GGC TCT CTT Ala Ser Cly Ser Val 115 GAG CCT GAA GGT Giu Pro Giu Gly TCT TTA ATG GTT Ser Leu Met Val 100 TAC GCG CTG GCG Tyr Ala Leu'Ala 115 TCC ACT CAG GAT Ser Thr Gin Asp

ATT

Ile

GGG

Gly CAT TAC CAT GAC His Tyr His Asp TTT GAG GTG AAG Phe Giu Val Lys TAC GGT Try Gly CCA GCC TAT Pro Aia Tyr

CGA

Arg 105

GTA

Val TCT GAC AAT Ser Asp Asn GGT GTC GCC Gly Val Giy

ACG

Thr 120

TTT

Phe AAG GCG ACA Lys Aia Thr

TTT

Phe 125

TCC

Ser TTT TCG TTA Phe Ser Leu 110 AAA GAA CAT Lys Giu His TCA AGG AAA Ser Arg Lys GGC GAT Giy Asp TCT AAC AAA Ser Aen Lys 130 ACG GCA Thr Gly

ATT

Ile 140

AAT

Asn TTT GCC TGG Phe Ala Trp 6e

C

S.

0* SO 0 i

S

see..

C

0 C 145

ATC

Ile

GGC

Gly 150

GGG

Giy GGT GTA CAG Gly Val Gin

ATG

Met 155 GTC GTC GAT Vai Val Asp

GTT

Val 165

AAC

Asn TAT GAA GGA Tyr Giu Gly AGC AAC ATC Ser Asn Ile 170 TAC CGT TTC Tyr Arg Phe CCG CTC GAG Pro Leu Giu TCC TCT ACA Ser Ser Thr 175 TGA AAAGC

AAT

Asn 160

AAA

Lys ATA AAC GC Ile Asn Giy GTC COG GTT Vai Giy Vai

GGA

Gly 185 6 CC ATAAGCTATG

CAGTGACACG

CTGTACATAA

TGCTCAGGTA

GATTCACTCT

CTTCGCATAT

CCAGGAGAGC

TAGAGCATCA

TGGTTATCGT

TGACCACTTC

ATTACGTCAC

TTGTGAGTTG

AATAGTTAAT

GCACCGCAAT

CATCAGGTGG

GTGATTTCGT

GGTTGGCCGG

CGGAAGGTTC

TACCTGCCTG

CATCTCACTA

GGTGATAAC

GAAAAATTTT

TGTACCTGCC

ACCTTTTTTG

ACCTCCTAAG

ATAATGTTAT

ACTTTTGAAT

AAGATAGTCA

TAGATTTTTC

GTTCCTCGCG

TTTTTATAAA

GCAAGCATAA

TTATGGCCTG

TGATCGTTCA

GCCTTCCGCA CCCCAGTCA

TCTTTTCTCT

GCATAAGCAC

AGGAAGGAAA

CCTGGAATTA

GCTGAACGAC

CGCCTGGCAG

TTGATGGTGC

TACCTCAGTG

AAGTATTGTC

TTTATAAAAA

TTATGCGGTG

AACCATATTG

ATGAA6ATTCA

TGCAGGTTAA

GGGATTTAAC

ATAGTGCGAA

CTTCGTCATA

AGATAAAGGA

ATCTGGTGTA.

ATCACAATGT

TACTGAAAAG

AAGTCCCCAG

GAGGTTCGAG

TCAGGCTGAT

TCGCAACCCT

ATGCACAAAA

AATCCCCCTT

ACTGTGGTAT

CACCCTATGG

CTTGA&AGAT

CGCGCCAGAG

TATGAATGGT

ATAAAACAGG

CTCTCTTCGT

TTGTGGTAAG

AATAACGCCA

CATCAAGATT

TAGCAAGGTA

CCGCCACTAG

GCCTCGGTGG

GATGTGGGTT

GTTACAGAAT

ATGTTATTGT

TGCGGCGGGG

GGTTCACCGG

TTCAGAGCGG

ACGATCAATA

CGTATGCAAG

TACCAGCCGC

GCTTCTTTAC

CATACTGACG

CAATCAAGGT

GATCTCACAA

TTGTGACCGC

TGTATTTTAT

CTCAGCTGGA

CGGTCCAATG

CGACTCCCAC

AATTTCATTT

CTTTTATTAC

CGTCCAGTCA

GAGGCACCCG

TGTCTTTTTA

GCAGAAACCA

ACCCTGGCGC

CTGCGAATTC

1016 1064 1112 1160 1208 1256 1300 1360 1420 1480 1540 1600 1660 1720 1780 1840 1900 1960 2020 2080 2140 2200 2260 2320 116 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER-.

SEQUENCE CHARACTERISTICS: LENGTH: 53 TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: CATTTCTCAT TGATAATGAG AATCATTATT GACATAATTG TTATTATTTT ACG INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS: g* 0* 0 0 0 *0 4 0 0 0 0 0 0 0 0

LENGTH:

TYPE:

STRANDEDNBSS:

688 nucleic acid double TOPOLOGY: linear (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

GAGCGCATTA

CCTGTGTCCT

ATGGAAACAT

AACAGCTCAC

GGTCAGAGTG

TTTATCCCGC

GAAATTATAC

ACGCCAATAC

CCCGAGCAGC

GGAATTGTAG

TGGATACTTA

AAGGAGCGTT

TCAGATAAAT

GTGCGGTAAT

CAAAAGAGAA

TGAACGGCTG

ATGCGCTCAC

TGGACCATGG

TCCATGAGCT

AGGTCGGTGA

CTGAGAAGTT

CAGCACTGGC

ACTCGCCGCA

TTCAGGTGTT

TGATTTATTT

CTGCTGCTAT

GACGATAACA

TGAGTTTCCA

TGCTTCAGGT

CGGAGTAAAT

GAAAGAAGGA

ATTGCTTATC

AGAAACGTCT

CGGGTTTTTT

GCGGCAGCCC

GCCAGGCC

CTCACTTTCA

CGAGAACGAC

AGCCCAG4GGC

TTGCTGACAG

CAACTCCCTG

TTTGAAATCC

AATTCTGAAT

CTGATTCGCC

GCAAAAAPAGA

ATATTGGGAA

CGAGAGCTCG

TTCTATTTTC

AGACATCGCT

CATACATAGT

GCCGAACACT

ATATACCTGC

AGGTGGATAC

CTCGTTCGGT

CGGAAAGCGA

ACGAGCCGCG

TTGGGACTGT

ATTCGTTATT

ATCAGGAATC

AACAGTATAT

TCGATTACTT

CTTTGTGGTA

CGATAGCTTT

GGATGCGACC

GCAATTAAAT

GCCGTGGGTG

TTTTAAAAAC

GGGGACGTTA

GGGGCAGGAG

120 180 240 300 360 420 480 540 600 660 688 117 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS:

LENGTH:

TYPE:

STRANDEDNESS:

TOPOLOGY:

16 nucleic acid single linear

S*

0

B

*0 0 0 0000 40 0* 0 0 0 @0000* 0 0. 0 0@ B S *0

SOS.

0* @5 0 0 000000 0

S

0 SeS S (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: AATATCGCCC TGAGCA INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: Ci) SEQUENCE CHARACTERISTICS: LENGTH: 4044 TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:

GGTTAACTCT

CACAAGTCAT

TTACTTATTT

GCATCATGGG

ACTGATAAAA

ATGTCCGCAC

TTATCTACAA

TATAGCTGGC

TTGTTTGTCT

TCTCATCACC

CACGAAACAG

CGCGGACCTA

AAATTTAGCr(

GAATGTTTTC

TCGTTGAATA

TATATATAAC

TTTCATTCCA

ATATTTTTAT

AGCAAGCCAG

CAGTCAATGA

TGGTGCCGAC

ATTATTTTTC

CGTAAAATGA

CCCTCCGATG

AAGCGCTTAT

CCGCCGCCIL-

AGTACGTCTA

AGTGGCGAAA

AAAALATGTCA

AGGAGGTGCT

TGTTTTGGCC

CTACGATTTT

GCAGATTAGT

CGCCAGGAAA

GACTACTTTT

CTGACGTGTA

CAGGAATTGT

ACGCAAAGAT

CCCGGTAT-%

CGTTTATCTT

CCTCCGCAGC

ATCTAAAAGA

ATGACGTTCC

ATGAAACATC

AGTTCAGGCC

GGTAGTAAAA

TCACCGTCCT

GGGAATACTT

AGCCACCCGG

TAGTGCGCCT

CAAAACCTTT

GTTCAGGTCC

CU3COTTGAGT

TCATAATTCG

CTGCTATGAG

TTTATTTTGC

ATAATTCAGG

ATGCTTTTAT

ATTGTTCTGG

CCCCGCAACC

GCCCGACGAC

TCTCCAGAAC

AAATCTTGAT

CGTTATCCCC

GATTGTAAGA

ACATTTCAGC

TTTATCGTAT

TCACCCGGCA

GCTTTGCCTG

TAATCAGTCC

AGATGAACTT

GCTTTGGTCA

TTTACAACAG

ACCTACAAAT

AAAACCCATG

ATAATGTTAT

TGCCATCAAA

ATTAAGGAAT

GCGGTAAAGG

ATGTCGCCAA

TAATGG.CCTC

TTTTTCAGAA

AAAGGCTGCA

TGTGACCTCT

120 180 240 300 360 420 480 540 600 660 720 780 840

N

eb C C

C

C.

C q 0* C.

C C 6 S C C.

C*

C S. *C

CC

C. S 6 C@CC *q

C

0**@SC

C

C.

S

C

TTTATCATAT

GTTTTTCACT

ACAGGAGTGG

TTATCTCTAT

TGTAACGCTA

CTGGTTCTCT

TATAGTATTA

TACATAAATG

GATCAACAGA

TTTCACCGAG

AAGAAGGCAC

CTGATCATAA

TTGTCAGAAA

TTACCATCAG

ACAGGTTAGC

ATGACAAAAC

CCAACCAGTA

GAAGGTTTGC

CTTTTTCCCG

TGTACAAAAA

GATATGTGGC

AACAGCGCCC

TTGTTGTTGA

GGTATGAGTA

CGTTTGGTTT

GCTTTAACGA

TATTTACGAA

ACTGCAGATA

TATCTATTTT

AATCTCTTAC

AAAGATGCCA

AAAGAGCACC

ATCGGGTGCC

GTGATAGCAT

CTGCGTGCGA

TGCCGCTCAA

TTTATTTTTA

GCCTCTCCTC

ATTTGTCGTT

ACGCGGAACA

ATCGTTTGAC

ACAGAATCAC

ACCAATCATT

CAAAATTAAG

AGGCGACCCT

GTAGCAGGAC

GACCTTTACT

GGCGGCTAAA

AAAAGGAAAT

CAGGCGCACG

ATGCGCAAGT

CCGAGAAAGA

TGGTCGCCGA

TGAGGCGCTG

TACCTCAGAC

GCCCTTATCA

TOTTGTTTAT

TTACGCCTAC

CAAAAAGTAA

TGCACACGCA

ATATAAA.AAG

TTCCGATTAC

TGGCGGAAGC

AGCAATCAAT

CCCCCTTCTC

CTAATATTGC

GCTGAGCTAT

TGCTACGTCA

GGGTAATAAT

TATTTTATGT

CCCGGTCATT

AATTCGGACA

GCTGCGGGAG

GCAGGGTGAG

CTTTATTCAT

GGGAAACAGA

GTTGTGTTGG

ACCGCTGTGA

TCCACGTGCG

CCTTGACACC

GGCGATGTTC

CGAAATCATC

GAAAGTTAAG

ACGGCTGCAC

ATAACGTCCC

TCTGTGACGA

CGGTATGTGG

ACAATCAGCT

TAAGAGCCTA

TGGGATAGGT

CAGGTAAAAA_

TTATTACTAT

rGPAAATACTT

CTTCATCGCG

TGAAAAAAAT

GTTCTTTTAC

118

ACTTTGTTTA

AAAAGTATTT

TTAACCGAAG

TATTCAGTGG

TGAATGACTT

GGATGTACGA

ACACAAAACC

ACTGATGGTC

TGTAAGCATG

AAATGTCTGG

GCACGGGTAA

GCCGAAAATG

CCGATTGCGA

AGAGAGTGCC

ATCAATTTAC

AGTTATATAC

GTCGAACTCG

CTCAATGAAC

CCAATGCAGG

CGTATCCTGG

CTCCTGCGAA

TATAACGCAA

AACCGACATT

GTGCGCATTC

TCCCATTAGA

TCTAAACTTA

TCCGAAATAA

GTTTCCAGGA

GCAACTCTAA

CAAGAGAAAT

GACAAAGCCG

AACGCTATAT

TATTTATGTG

GTATAAATCG

TGCTTTCAGG

CGAACGGCTT

AGATTAATTC

TGTGCCTTGA

TGCAATCTCA

ATGCCGCAGA

TGATAACCAG

CCTGGGCACA

TTTTAGTCGC

GCTAACCTCT

TTTACGTCCG

CCAGCTTAAA

TTTATGACAA

TCACAAAACG

CGAACGCATT

AAGAGATGTT

AGCCAACATG

ACGCTACCAC

CATCGCTTCA

CAGCCTGAAA

CTCTTTTATT

!CATCAATAC

AACCAGCATA

TAGTCTCGAC

AAATACATGT

TTAGCGCC~,c

ACATGCAAAA

AAATGCAAAA

ACCCATTGTC

ATCATTGGAA

CCAATATAGT

AAAAACCACA

ACCCACACCT

CGGTGGTTAT

TGCAGGCCCA

GCTTTTCTCA

CAAGGTACAA

CGCTGGCTCA

AATAGCATTA

GCCCTGGAAT

TGACACGACA

CAACGTCAGG

TACTGGTCAT

GCGAAATGTT

CGTACATCAA

AAACAGTGAC

TGAAGAG4GCT

TCCGATCGAA

TCACAACATG

CTGGCCTGTC

TCTGAAAGTA

CGCCAAACTG

GTAAAATACC

ACTAAAACTT

CAGTCAAGAC

TACATATAAA

TGATAACGAT

AATCCAG~i&k_.

AGCTATTGCC

ACGTGAAGAA ATGTACAGCC 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 0* i 0* B.

0 S

S

B

S 5* 4 4* 0 C 0* S. SC 0* SC S

S

0

S

S.

S

AATATCAACG

GGGTATTCAT

AACAACGGCT

GAGGAGCAAA

AGCATTATAC

TCCGTTACGG

GTCTATGACA

GATGGTTCTA

AAAGCACAGC

AGCTGGAA.AG

ATAAA.AATTA

AATCGCTATT

TCTTTTGTGG

TTGTTGGAGC

AAGAATTTCG

AATATGAAGA

TTTGCTATAT

TCATTTTTTA

AAAAATCATA

CAGCGCAATA

CATGTACTGG

ATTGATATGA

CAAAAGGTGG

TCATTCGACA

ACTGGGGGGG

AACAAGAAGC

CAGAGCGTAT

AAGATAGCGA

TTACCATCAC

TTGCCGGATA

AACTTGTTGA

ATGAACGAAA

TAGCGCGAAA

TCATTCTCTG

ATAACCAGGT

CAGTGTGAAG

AGCACTGCCC

ATTTTTTCAA

TTTTATGCAT

TTGCATTAAiT

AAAAAAATAT

AAACAGAGCA

ACCGTGAGCT

GCAGGAATAT

AGCCAATCTT

AACCGTTAAC

ACCTTCGCCT

ACTAAAAGAG

TCAGGAAACA

TATCGTTGTA

TGCTAAAAAT

TGAGATCAAA

ACAATCGAGA

TACAGCAGAC

GAGCGCGTGC

ACACTGTAAT

GAAGTTATGT

CCGGGCAGCG

GACCTAAAAA

AATAATTACT

GTTATTCGTA

TATTTATATC

TCAAATAAGT

ACTAAAAAAA

GGTCGGGAGA

CGAT

119

GCGATTATTG

ACCCCTGCTA

GTCAATTTAA

GCTTTATTCA

ATTAAACGCG

CGAGCAGAGA

ACAGCACGTG

GAACCTTTCG

AAAGACATTG

ATTTAAAAAT

CAGGTACTAA

TTTTCGTACT

GACGCCAGGA

CGCAGAAACC

TGATGAATAA

GATTTCATCG

TACAAAACAG

ATTCTTCATT

ATTTAAAATT

ATTAGGCGTA

GCAATGTACG

AAGTCCGTTT

ALAGTAGAGGT

CCATCTTTGG

AATTCGACTC

CTAACGCCAG

TAGCTCATAA

CGGTAATGAC

CCCCAAAAAA

AAAGTCCAGC

AGCAGGCGAT

GGCACTGCTT

CAAGATGTTT

ATCTATTCCA

GGAGCGTATA

AATAGATATT

CGGATATTTC

GACCATCAAT

TTTTTTTACT

ATTGTTTTGT

GCGAAGTGGA

GGAAAGAGCG

CTTCAAGGGC

GTTTAAATTT

CACTATAACA

GATCAATTTC

TGGCATCATT

TGGCGAATTC

CTTAAATAAG

AGAAGCcOGAA

GTAAAAAAGC

ACAAACATTG

GAAGACAGCG

ATTTATTGAG

GCGGGCGTAC

CGTTGTACGT

TTAAAGAG43T

CCTTGATCTA

TGGTGTGATA

CATTTCTTGA

GGTACAAATT

AAAGGACTGT

AAATACTGTC

2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4044 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS: SEQUENCE CHARACTERISTICS: LENGTH: 87 amino acids TYPE: amino acid TOPOLOGY: linear (i)MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: -120 Met Lye His His Ala Phe Met Leu Trp Ser Leu Leu Ile Phe Ser Phe 1 5 10 His Val Leu Ala Ser Ser Giy His Cys Ser Gly Leu Gin Gin Ala Ser 25 Trp Asp Ile Phe Ile Tyr Asp Phe Gly Ser Lys Thr Pro Gin Pro Pro 40 Thr Asn Thr Asp Lys Lye Gin Ala Arg Gin Ile Ser Ser Pro Ser Cys 55 Pro Thr Thr Lys Pro Met Met Ser Ala Pro Val Asn Asp Ala Arg Lys 70 75 Giy Asn Thr Phe Ser Arg Thr INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 7: ()SEQUENCE CHARACTERISTICS: LENGTH: 178 amino acids TYPE: amino acid TOPOLOGY: linear (iMOLECULE TYPE: peptide SEQUENCE DESCRIPTION: SEQ ID NO: 7 Met Thr Leu Leu Ser Gly Lys Thr Thr Leu Val Leu Cys Leu Ser Ser 10 I*9*le Leu Cys Giy Cys Thr Thr Asn Gly Leu Pro Thr Pro Tyr Ser 1ie 25 Aen Leu Ser Phe Pro Val Ile Thr Gin Asn Gin Ile Aen Ser Giy Giy 40 *see Tyr Tyr Ile Asn Asp Ala Giu Gin Ile Arg Thr Thr Asp Gly Leu Cys 55 Leu Asp Ala Giy Pro Asp Gin Gin Aen Arg Leu Thr Leu Arg Giu Cys 70 75 Lys His Val Gin Ser Gin Leu Phe Ser Phe His Arg Asp Arg Ile Thr 90 Gin Gly Giu Lye cys Leu Asp Ala Aia Asp Lye Val Gin Lye Lys Ala 100 105 110 His Gin Ser Phe Phe Ile His Ala Arg Val Met Ile Thr Ser Ala Giy 115 120 125 Ser Leu Ile Ile Thr Lye Leu Arg Gly Asn Arg Ala Giu Asn Ala Trp 130 135 140 Ala Gin Ile Ala Leu Leu Ser Giu Lys Ala Thr Leu Leu Cys Trp Pro 145 150 155 160 121 Ile Ala Ile Leu Val Ala Pro Trp Asn Leu Pro Ser Gly Ser Arg Thr 165 170 175 Pro Leu INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 8: SEQUENCE CHARACTERISTICS: LENGTH: 79 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 *Met Phe Val Glu Leu Val Tyr Asp Lys Arg Asn Val Giu Giy Leu Pro *1 5 10 .Gly Ala Arg Glu Ile Ile Leu Asn Giu Leu Thz Lys Arg Val His Gin ev* 20 25 we Leu Phe Pro Asp Ala Gin Val Lys Val Lys Pro Met Gin Ala Asn Aia 40 eo,*00Leu Asn Ser Asp Cys Thr Lys Thr Giu Lye Giu Arg Leu His Arg Met 55 *Leu Giu Giu Met Phe Giu Giu Ala Asp Met Trp Leu Vai Ala Glu 70 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 9: Ci) SEQUENCE CHARACTERISTICS: see LENGTH: 246 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9 Met Asn Lys Ile His Val Thr Tyr Lys Asn Leu Leu Leu Pro Ile Thr 1 5 10 Phe Ile Ala Ala Thr Leu Ile Ser Ala Cys Asp Asn Asp Lye Asp Ala 25 Met Ala Giu Aia Giu Lye Asn Gin Glu Lye Tyr Met Gin Lye Ile Gin 40 122 Gin Lys Giu His Gin Gin Ser Met Phe Phe Tyr Asp Lys Ala Glu Met so 55 Gin Lys Ala Ile Ala Asn Ile Asn Ala Lye Gly Gly Ala Asn Leu Ala 70 75 Ile Ile Glu Val Arg Phe Phe Lys Gly Gly Tyr Ser Phe Ile Arg Gin 90 Ser Val Aen Thr Pro Ala Lys Val Giu Val Phe Lys Phe Aen Aen Gly 100 105 110 Tyr Trp Gly Giy Pro Ser Pro Val Asn Leu Thr Ile Phe Gly Th~r Ile 115 120 125 Thr Giu Giu Gin Lye Gin Giu Ala Leu Lye Giu Ala Leu Phe Lye Phe 130 135 140 *.Asp Ser Ile Asn Phe Ser Ile Ile Pro Giu Arg Ile Gin Giu Thr Ile 145 150 155 160 Lys Arg Ala Aen Ala Ser Gly Ile Ile Ser Val Thr Giu Asp Ser Asp *eg165 170 175 Sle Val Val Arg Ala Giu Ile Ala His Aen Gly Giu Phe Val Tyr Asp *180 185 190 I**le Thr Ile Thr Ala Lys Aen Thr Ala Arg Ala Val Met Thr Leu Aen 195 200 205 Lys Asp Gly Ser Ile Ala Gly Tyr Giu Ile Lye Giu Pro Phe Ala Pro 210 215 220 Lys Lye Giu Ala Giu Lye Ala Gin Gin Leu Val Giu Gin Ser Arg Lye 0 *225 230 235 240 *Asp Ile Giu Ser Pro Ala 245 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS: LENGTH: 3700 TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: TTTTGGTTTG CTGCCGTTTG GGATAACTGC ATAGAGAGCG GCCAAGTCGC TTGCGGTCGG TATCTCGAGT ATATCGAAAT CCATGTGGCC ATTGACCTCT TCAAGCGCTC ACGTTAACTA 120 CCTGCTCTTT TTTGAGCACC AACATCCCAG GTTCGTCACA GTAAATCGTA TCGTGATTAT 180 *0 6

S

S

4. b0 S S S 5 0 0 S S. 40

U

5* 6* 55 5

S

S

S

S

S.

S S

S

TGCTALATCGT

TTTTGATGGT

ATTTTAATTT

CATTTTCCAT

AAAAAATCTG

ACCAAAAGAA

TGGTTCTTTT

TTTCATTCTA

AACGACAGAC

TTCCAGGGCC

TGGGCCTGAC

GTCAATGTGA

CGGAGTAAAT

GCTGAAAGAA

TCGGTGAATT

TGAGAAGTTA

GCAGCACTGG

TACTTAACTC

GAGAAGGAGC

AAAATGAAAG

AAAAATGCGC

GATACCTATT

CCGTTTTCTG

AGTCAAAAGC

ACGATGTTAC

TACCTTATTC

GTGAGATGAT

GGGAATGGGA

CTCATTTGAG

CCCAAGCCCA

TCAGGCTATC

ACGCAGGTAA

CAGTTTACCG

AACCTGCTGA

CTGTAAGTTA

ATTATCCCTT

AGTTGTAAAT

CCCAAATTTG

AATATGTGTT

TTTTCATCAG

ATCGCTAACA

ATACATAGTT

AGGCCGAACA

TAGCTCCCTG

TTTAGGGAAA

GGAAATTATG

GCTTATCCTG

GAAPJCGTCTG

CCGGGTTTTT

GCCGCAGCGG

GTTTTCAGGT

AGATACGTTG

GAGTGATTAA

ATCCGCAGCT

GCTAAGCCGC

TGAGAGCGCT

CGCAGCAGGC

CCGCAGGAAT

GTAGAAATAC

CGCTATGTGC

CAGTACGGGG

GAGGGCTTTA

TGGATATGGA

CAGAGGCGAT

CTCCGAAAGC

GTCTGACTTT

TCTGCGGCAG

TGTTGAACTT

GCTCTTTATT

GGTAATTTAT

GAGACGCATT

GAATCCCTGT

GTATATATGG

CGATTACTTA

CTCTTTGTGG

ATATACCTGC

TCCAGGTGGA

TCTGAATCTC

TGATTCGCCC

CATAAAAAAG

TATAGAAAGT

CAGGCCGCAG

GTTGCCAGGC

TGGGCTCGTC

CGAAAACGAA

GGCTTATTAT

CAGCGAAACA

AATGCCTTAC

CAGGCGGAAG

CATAAGGGGG

TCAGAGCCCG

AGTTTGCGAT

CGGAAGGTTA

ATTTAACGTA

CGTCTCAGCA

GTTACTGGAT

123

AAACTAAAGT

TAATTTGCTG

GACGCTGATG

ATTTTAATGT

ACTGTGTT

CTACAGTAGT

ATACAGAATA

GTCCTGTGCG

AAACATCAAA

ACAGCTCACT

TAGGTCAGAG

CGATAGCTTT

TACGGATGCG

GTTCGGTGCA

GGAAAGCGAG

AACGAGCCGC

TGGGAATTGG

GTGTAAGAGC

CGGGACGGAA

AGGTTTTAAA

GAAAATAAGC

CGGATTCATT

CGATGAGCAA

GCGGATTCGG

CGGGGCTAAA

GCGTAACGTT

TCAATTTGTC

CGAATTAAAA

TATCAAAATG

AATAAGGAAG

AAATTTGATA

AAATTAGCAG

GAAACTGCTT

CCGGGTATTT

ACTATTACTT

TCCTTACTGG

GGCAATGGTC

TTAAGCCCCA

AATTGATTTT

GTAATCTGCT

AGAGAAGACG

GAACGGCTGT

TGATGCGCTC

TTTATCCCGC

ACCGAAATTA

ATTAAATACG

CCGTGGGTGC

GTTTTAAAAA

GACTGTGGGG

TCGATTCGTT

AATGCTCTAT

TAGCGAGGGG

GTAGAATCTC

TCGATTAGAG

GAAAGAGTCT

TTAACATCAA

ACAGCAGGCG

TGTTATTCAG

GATAGCTATT

GATGACTGGC

AGCCCAGGCC

TCATTATGGC

CGGGCGTTGA

CAAAACCCTC

ACATAAAGAT

GTCAAAAGTG

ACAAAC.GTTA

TATCCTACTG

TGATTGTTAC

ATGGGGATGA

ATTTCTCACT

GCTATCGAGG

ATAACAAGCT

GAGTTTCCAT

ACTGCTTCAG

TGGACCATGG

TACTCCATGA

CCAATACAGG

CCGAGCAGCC

CGGAATTGTA

ACGTTATGGA

ATTGGGGCAG

GTCGCTGCGC

CGATTATGAT

TATCTGGCTG

CCGCGTAAAC

CGAGGTGTTA

ACGTTGATGG

TTAAGAAGAT

GGGGCGCTCG

ACCGCACATG

TcAAGGGGCG

ATTGGTATTT

AACACCTTGG

TAATCTACAA

CGATCCGGCG

240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100

CTACTGGCGG

AATCGAACAC

GTTAATCAGT

TATAGGGCAG

GACCGGCTAC

AGACGATTAC

GGCTATTTCG

CTTACTCGTA

GATATCTATA

*GCTTTTAAAA

CAGAAATATA

TGAGCAGGTA

:CGGCCACGGG

obv* GCGAGCTGAA

TACAGACGAT

CTGGTGAAAA

6 GAACGAGGTT oO TAGTTTTGCC

CCCAATTACA

ATTGTTTTGA

AAAAACCATT

TCGTCAAATG

ATCGTATATC

CGCGAAATGA

TTCAAAACTC

TTTACTAAAC

GGCGAAATGA

CGTATCAGAG

GGTAAAPAGTC

TATAAGGTGG

GCGGTCAATA

TCCAGGCTTT

CAACAGGATT

CAAGAGATGA

AAGGAGTCGG

TACTTTTCTG

GGACTGGACC

GAGGCGAATA

CTGATTTTAC

TAATTGGAAA

AAGGAAA.ACC

GGAGGGCGAT

TGGCCGCCCG

CGCCGCTTGC

GATGTGGATT

GGCTCCCGGC

TTATTTTGTT

ATGCCCGCAA

AATAGGCAGC

CATCCTCAGC

GTTAATACTG

ACTGACGCAG

TGAGAGCCGA

GTTAATACTG

TAACAAAAAC

TTTAAGGATA

ATTATGTCGA

TCAGGTCTAT

TTCTGGTTCG

GAGGACCCTA

TTTCAGATTA

GGCTGTTGAA

CTGGTAATGA

AGGAACAGGC

AAATTGATAG

CGCTGCGGTG

TAGCGCAGAT

AGGTTATATT

GTGCTCTCCG

CAAGGCAAAA

GCATCAAGAA

ATGACAACAA

ACACCAGTAA

ATCCGTGATG

TAAGAAAGGC

CATTACCCAT

GGTTGCAGAT

GCGGCATGGC

CTGTGGCTGC

TCTGGCAAGG

GCGGCATGGC

124

TCTCGGAATA

TGATTGATGC

TTAAGCAACT

GGAAATAGAA

GCGATTGCCT

ATCTGGTGAC

TAACCTGTAT

ACGCTATTAC

CCCTTGCCGG

TAATGAGGTC

CGGAAAATTG

TACTGGATTA

GTTCCCGGCG

CGGCTATTGA

CCAGGGTCCA

CCTGTTCATC

GATCAGCGAT

TTTCTGTTGT

AAGTAACGTA

TCAGATACAG

ATAACGGGGA

TAACTTGTAC CGTAACGCGC

TGCCATTATT

ATTGTCCCTG

CGGACATTGT

AGAAACGGCT

GGATTATTTC

GTTTCTATGA

GCTCATGATT

CTGTAAGGAT

ATTGCCGTTC

GGCTATAGCA

AAACTTATCA

GATTCGCTGG

ACAGCGACTG

TATTAGTTAT

TGTCGGCATT

ATCAAGCGTT

GTTGTCAGAA

ATTCTTTTGC

GCTTTGGCGT

GTACTGATGA

CAGAACTTCC

AGAATGCCGT

CTCGCTGGAT

GTGGATAAAC

CTAAAGAGCT

GGTCAGTACC

CTTGGATGTC

AAGGATCTTA

TGCAAATGCA

TTACCGTTGC

GCTTCCTCCC

TATCGTCTCC

GAACAGTCAT

GATATTGATG

AGCCGTATAT

TCTTAAAGAA

CGTTCTGATG

AACCAGTTGG

CTGGTATTAC

TAAGGCGAAA

TTGATCCGTT

GACCGCGCCA

AAGGAGTGTA

AAGTAGCGTA

AGCCGGATTG

2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3700 TATCTGGCAA AGAATCATTT AGCGCCGGAA ATGATTGTCA GGCGGCTTAA GAACGGAGAA TCAGTGGCGC CGACTGCCGC CAGGGAGCCT TGCTTGGCCT

GGCTTGCCAT

INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: i)SEQUENCE CHARACTERISTICS: 11:

LENGTH:

TYPE:

TOPOLOGY:

392 amino acids amino acid linear 125- (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 Met Giu Thr Ser Lys Giu Lys Thr Ile Thr Ser Pro Gly Pro Tyr Ile 1 5 10 Val Arg Leu Leu Asn Ser Ser Leu Asn Gly Cys Giu Phe Pro Leu Leu 25 Thr Gly Arg Thr Leu Phe Val Val Gly Gin Ser Asp Ala Leu Thr Ala 40 Ser Gly Gin Leu Pro Asp Ile Pro Ala Asp Ser Phe Phe Ile Pro Leu so 55 *.Asp His Gly Gly Vai Asn Phe Giu Ile Gin Val Asp Thr Asp Ala Thr 70 75 Giu Ile Ile Leu His Giu Leu Lys Giu Gly Asn Ser Giu Ser Arg Ser 90 Val Gin Leu Asn Thr Pro Ile Gin Val Gly Giu Leu Leu Ile Leu Ile *100 105 110 *few Arg Pro Giu Ser Giu Pro Trp Vai Pro Giu Gin Pro Giu Lys Leu Glu 115 120 125 Thr Ser Ala Lys Lys Asn Giu Pro Arg Phe Lys Asn Gly Ile Val Ala C*130 135 140 'a.Aia Leu Ala Gly Phe Phe Ile Leu Gly Ile Giy Thr Val Gly Thr Leu *145 150 155 160 Trp Ile Leu Aen Ser Pro Gin Arg Gin Ala Ala Giu Leu Asp Ser Leu *165 170 175 Leu Gly Gin Giu Lys Giu Arg Phe Gin Val Leu Pro Giy Arg Asp Lys 5180 185 190 **aMet Leu Tyr Val Ala Ala Gin Asn Giu Arg Asp Thr Leu Trp Ala Arg "5195 200 205 Gin Val Leu Ala Arg Gly Asp Tyr Asp Lye Asn Ala Arg Val 1ie Aen 210 215 220 Giu Aen Giu Giu Asn Lye Arg Ile Ser Ile Trp Leu Asp Thr Tyr Tyr 225 230 235 240 Pro Gin Leu Ala Tyr Tyr Arg Ile His Phe Asp Glu Pro Arg Lye Pro 245 250 255 Val Phe Trp, Leu Ser Arg Gin Arg Asn Thr Met Ser Lye Lye Giu Leu 260 265 270 *Giu Val Leu Ser Gin Lye Leu Arg Ala Leu Met Pro Tyr Ala Asp Ser 275 280 285 Val Aen Ile Thr Leu Met Asp Asp Vai Thr Ala Ala Gly Gin Ala Giu 290 295 300 126 Ala Gly Leu Lys Gin Gin Ala Leu Pro Tyr Ser Arg Arq Asn 305 310 315 Gly Gly Val Thr Phe Val Ile Gin Gly Ala Leu Asp Asp Val 325 330 Leu Arg Ala Arg Gin Phe Val Asp Ser Tyr Tyr Arg Thr Trp 340 345 350 Arg Tyr Val Gin ,Phe Ala Ile Glu Leu Lys Asp Asp Trp Leu 355 360 365 Arg Ser Phe Gin Tyr Gly Ala Giu Gly Tyr Ile Lys Met Ser 370 375 380 His Trp Tyr Phe Pro Ser Pro Leu 385 390 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS: LENGTH: 80 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTI ON: SEQ ID NO: 12 His Lys 320 Glu Ile 335 Gly Gly Lys Gly Pro. Gly 6 ID 00 1 06ob 0000 12: Met Ala Thr Pro Trp Ser Gly Tyr Leu Asp Asp Val Ser Ala Lye Pile 1 5 10 Asp Thr Gly Val Asp Aen Leu Gin Thr Gin Val Thr Giu Ala Leu Asp 25 Lye Leu Ala Ala Lys Pro Ser Asp Pro Ala Leu Leu Ala Ala Tyr Gin 40 Ser Lye Leu Ser Giu Tyr Asn Leu Tyr Arg Asn Ala Gin Ser Aen Thr 55 Val Lye Val Phe Lye Asp Ile Asp Ala Ala Ile Ile Gin Aen Phe Arg 70 75 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 13: SEQUENCE CHARACTERISTICS: LENGTH: 101 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 127 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13 Met Ser Ile Ala Thr Ile Val Pro Giu Asn Ala Val Ile Gly Gin Ala 1 5 10 Val Asn Ile Arg Ser Met Giu Thr Asp Ile Val Ser Leu Asp Asp Arg 25 Leu Leu Gin Ala Phe Ser Gly Ser Ala Ile Ala Thr Ala Val Asp Lys 40 Gin Thr Ile Thr Asn Arg Ile Glu Asp Pro Asn Leu Vai Thr Asp Pro 55 Lys Giu Leu Ala Ile Ser Gin Giu Met Ile Ser Asp Tyr Aen Leu Tyr 70 75 Val Ser Met Val Ser Thr Leu Thr Arg Lys Gly Val Gly Aia Vai Glu 90 Thr Leu Leu Arg Ser 100 INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 14: SEQUENCE CHARACTERISTICS: O 00(A) LENGTH: 252 amino acids O 00(B) TYPE: amino acid TOPOLOGY: linear 0000 (ii) MOLECULE TYPE: peptide 0000 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14 O Met Ile Arg Arg Tyr Leu Tyr Thr Phe Leu Leu Val Met Thr Leu Ala @001 5 10 Gly Cys Lys Asp Lys Asp Leu Leu Lys Gly Leu Asp Gin Giu Gin Ala 25 Asn Giu Vai Ile Ala Vai Leu Gin Met His Asn Ile Giu Ala Aen Lys 40 Ile Asp Ser Gly Lys Leu Giy Tyr Ser Ile Thr Vai Ala Giu Pro ASP 55 Phe Thr Ala Ala Val Tyr Trp Ile Lye Thr Tyr Gin Leu Pro Pro Arg 70 75 Pro Arg Vai Glu Ile Ala Gin Met Phe Pro Ala Asp Ser Leu Val Ser 90 Ser Pro Arg Ala Giu Lye Ala Arg Leu Tyr Ser Ala Ile Giu Gin Arg 100 105 110 128 Leu Giu Gin .115 His Ile Ser 130 Pro Val His 145 Ala His Gin Asp Val Asp Ala Gin Leu 195 Thr Ser Trp Ser Leu Gin Thr Met 120 Ala Giu Giy Val Leu Ser 125 Arg Ala Arg Val Pro Pro Lys Tyr Asp Ile Asp 135 Leu Giy Glu Asn G ly 140 Arg Leu Ser Ile Ser 165 Tyr Asp Ala 150 Asp Ala Val Tyr Glu 155 Leu Gly Ser Pro Leu 160 Ile Lys Arg Lys Asn Ser Phe Ala 175 Asn Ile Ser 180 Gin Val 185 Pro Leu Ser Glu Ala Pro Gly .0 S. S 000 0 0 *000 00 @6 S 0 *OeS@0 0 0 q. S 0 0

S.

0s@0 00 00 0

S

060000

S

0 000000 0 05 0 000 0 Thr 200 Ile Val Lys Arg Asn 205 Met Arg Ser Asp 190 Ser Phe Ala Ser Ala Gly Ile Val Leu 210 Gly Ile 215 Lys Leu Leu Ser Val 220 Phe 225 Ile Val Trp Tyr Tyr 230 Lys Aen His Tyr Ala Arg 235 Asn Glu Asn Lys Lye Gly 240 Thr Ala Asp Asp 245 Ala Lye Ser INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: SEQUENCE CHARACTERISTICS: CA) LENGTH: 818 TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:

CATAACAACT

TCCGGCATTC

TCGCTCCTGA

ATTTAGGTAA

TCACGCATAT

CCCATGCAAC

CCGTTCGGCT

TGTGCTTCAC

GCTGTAATCA

TAATATATCT

ATTCCAACAT

CCTTAATACT

AGTTATCGCC

TGTGTTTACT

CCGGTTCTAC

ATATTTAACA

ATTTTGATAT

AAAAAACATG

AGTCCTCACG

TATTCACGAT

ATCAGTTACA

AAATATCACC

ACTTATTATT

ACTATGCCGA

TCCTGAAAGA

AATGTCATCT

GAAACCATAA

TTAAAGAGAA

TCATTAAGCA

TGACGCTCCA

GATGCTTAGC

ACATTTCTTG

TGTGTTTAGA

TACGGTGTGT

ATCGACAAAA

TATTTTTACT

AACTTTTATA

AGTGTTTAGC

AATCTCACAA

AACTCGCCAT

TCCGCAATAC

ACGCTTTATT

TTATATTATA

GAGAATTTAC

TTAAACACCT

CCACGAATAA

ACCGAAGCAC

GATTTGAATG

CACTATAGAA

CCACATTAAG

ATAATCAGAA

GGTTATATGC

CCCGCTCCGA

AGAATAGAAT

ATTCCAAAAA

GCAGTACCGA

TTCACCGCTA

TCTATCGCTC

CTAATTTTTC

CAACAAATCA

AAACTTGACA

CATATCGCAT

CATCGCAGGC

TTTAATCTTT

CAACA~CACA

AATAATAACT

120 180 240 300 360 420 480 540 600 660 129 AACGCAAATA TTGAACACGC GATAAAAAAG TCTATTTCGC TATAAAACCC ATTATTATTA 720 AGAGTGGTTA ACTCTTCGTT GAATAAAAAA TGTCAATGAC GTTCCATAAT TCAGGAGATG 780 AACTTCACAA GTCATTATAT ATAACAGGAG GTGCTATG 818 0 0 00 -130- TABLE 12 Bacterial strains.

Strain Genotype Suc S. ryhimurium 1 4 082s CS019 CS015 AD 154 TT 13 208 CS585 ~*CS586 .00.CS619 CS620 **CS1599 *CS 1600 CS334 oCS335 :::.CS1488 CS2054 CS2055 0 *CS1074 0* CS1075 *.CS767 *.*tS768 CS993 ****9VS994 0 CS1845 o-t1846 S728 :..CS729 CS 1194 CS1195 CS 1247 CS 1248 11-3314 E. coli Wild type phoN2 zxxr::6 2 phoP-1O2::Tn1Od-Cm phoPl2 PurB]744::Tn1O Ph0P105::TflJOd pagDi::TnphoA phoN2 zx:: 6 2 ISTn]Od-Cm pagDl::TnphoA PhOPlOS::TnlOd phoN2 6 21TnOdCm PagE]::TnphoA phoN2 zxx:: 6 2 l5TnlOd-Cm PagEl::TnphoA phoPIOS::TnlOd p/oN2 6 2 15TnOd.Crn pagF1::TnphoA phoN2 zxx:: 6 2 l5TnhOd.Cm pagFI::TnphoA phoPlOS::TnIOd phoN2 zxx:: 6 2 lSTn]Od.Cm Pag GI::TnphoA PhoN2 zxx:: 62 TnlOd.Cm pagGl::TnphoA phoP)OS::TnlOd phoA'2 zzz:: 6 2 15Tn]Od..Cm PogH1::TnphoA phoN2 zxx:: 62 lSTnIOd..Cm pagJ-1::TnphoA phoPJOS::TnIOd phoN2 zx=:: 6 2 15TnIOdj.Cm pagIl::TnphoA phoN2 zxx:: 6 2 5Tnl~d.Cm pagII::TnphoA phoPlOS::TnlOd phoN2 zx.: 62 lSTnl0d.Cmn pagJ]::TnphoA p/wN2 zxx::621 STn1Od-Cm pOgJl::TnphoA phoPJOS::TnlOd phoN2 zzr: 6 21TnIOdCm PagK]::TnphoA phoN2 zx:: 62 l5Tn10d..Cm PagKI::TnphoA phioPlOS::TnlOd phoN2 zxx:: 62 15Tn]Od..Cm PagLI::TnphoA phoN2 zxx:: 62 TnOdCm pagLl::TnphoA phoPlOS::TnlOd phoN2 zxx:: 6 2 l5Tn]Od-Cm pagMJ::TnphoA phoN2 zxx:: 62 lTnlOd.Cm PogM1:TnphoA phoPlOS::TnJOd phoNA2 zxx:: 62 5TnOdCm pagNl::TnphoA phoN2 zxx:: 62 5TnOdCm POSNI::TnphoA phoPlOS::TnJOd phoN2 zxx:: 6 25TnJOd.Cm Pag~f::TnphoA phoN2 zxx: 6 2 15Tn]0d.Cm PagO1::TnphoA phoPlOS::Tn]Od phoMV2 zxx:: 62 15Tn10d..Cm PagPl::TnphoA phoM zxr:: 6 2 5Tn]Od.Cm PagPl::TnphoA phoPlOS::TnIOdphoN2 zxx:: 62 lTnOdCm Collection of Randomly spaced TnlO A1617 insertions

ATCC

26 This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study' This study This study This study This study This study This study This study This study 18 SMIO(pRT291) MM294(pPH1IJI) Contains plasmid pRT29I (TnphoA) derived from pRK29O selecting for Tetr and Ymr Contains Gmr plasmid pPl-III. which is in incompatible 3 Behlau et al., 1993, J. Bacteriol., 175:44~75-84 Lehrer et al., 1991, Cell, 64:229-30 tj Miller 'et al., 1989; Proc. Natl. Acad. Sci. USA, 86:5054-58 26 Miller et al., 1990, j. Bacteriol., 172:2485..90 37 Taylor et al., 1989, J. Bacteriol., 171:1870..78 TABLE 13 Comparison of pag::phoA activity in strains with wild type and null phoPloci.

Activity (Units of Apha Allele Logarithmic growth Stationary grLo wt h Fold PhoPI PhoP- PhoP+ PhoP- Reductjonb pagDl::TnphoA 32 2 79 9 16 pagEI::TnphoA 96 2 108 3 48 pagFl::TnphoA 89 4 276 10 22 pagGl::TnphoA 35 1 65 6 9pagHl::TnphoA 35 5 38 6 7 *pagIl::TnphoA 12 2 2 4 8 6 pagll::TnphoA 123 8 944 88 :**pagKJ::TnphoA 30 3 123 26 PagLl::TnphoA 7 1 35 4 7 *..PagMl::TnphoA 92 11 439 130 8 pag~fI::TnphoA 23 1 58 2 23 :pag0l::TnphoA 31 2 54 12 16 pagPl::TnphoA 38 1 27 3 38 09 9 00 a The AP activity values are presented in units as defined by Miller for B3-galactosidase 06*:0 00 The values arc representative of experiments (performed in duplicate) that were :':repeated on three separate occasions. PhoP+ denotes the pag::TnphoA insertion in straiin .:CS019 containing a wild type phoP locus. PhoP- denotes an isogenic strains carrying the phoPlOS::TnlO allele.

b Values of fold reducEion in enzymatic activity represent the decrease in AP activity on acquisition of the null phoPlOS allele. These were calculated from logarithmic growth phase cultures and rounded to the nearest whole number.

13 2 TABLE 14 The effects of pag:: phoA gene fusions on Salmonella mouse virulence.

Strain Genotype LDSO a MSI Reeec 1 4 028s Wild type <20 6.13 CS015 phoP1O02.:Tn 1O-cam 7.OxlO 5 0.40 2 CS1074 pagDl::TnphoA 4.x10 5 3 0.01 CS77 pagl::TnphoA 4.x10 3 4 0.56 This study S77pagKl::TnphoA 9.0X10 4 0.04 This study CS1845 pagMl::TnphoA 3.0x10 4 0.09 This study The 50% lethal dose was determined by intraperitoneal injection- of ten Mice oer :*.**.dilution using the method of Reed and Muench (3 1).

b C.The Macrophage Survival Index (MSI) was determined by dividing the mean S2almonella CFU recovered from macrophage cultures (performed in triplicate) 24 *:*hours after the addition of gentamicin by the mean Salmonella CFU recovered from S* macrophages 1 hour after gentainicin was added.

:16 Ki~er et al., 1979, J. Bacterial., 138:155-61 25 Miller et al., 1989, Proc. Natl. Acad. Sci. USA, 86:5054-58 -133- TABLE Plasmidds, sm-ains and relevent properties S f'Z'himrj stlan s Releven t e nocypsfiform ad on M.S j S ure ATCC14028 Wild type 3.90

ATCC

CS019 phoN2 zxx.6251Tn1Od-Cmq (31) CS585 CSOI19, pagD::TnphoA 0.002 (4) CS586 CS585; phoPlO5::TnJOd-Tet (4) JS G205 ATCC14O28, msgA::MudJ 0.01 This work JSG225 JSG205. phoPlO5::Tn]Od-Tet This work CS811 OSO 19, envE::TnphoA This work CS812 CS81 1. phoPlOS::TnJOd..Tet This work CS 100 ATCC14O28, phoP 105::TnlOd-Tet 0.01 devirhn.o Ti2r

S.

*6 S 0*O 0 00 0 0 000* *0 0* 6 0 0

S

0*e0e0 0 *0e0 00 *0 q0

S

5@ 6.04 4.

*0 0 0 540004 0 00* 000 0 00 0 0 OSS 4 JSG232 JSG234 JSG235 JSG244 CS099 Othe saionllac Ty2 Salmonella paratyphi

A

Salmonella pararyphi

C

Salmonella enrerjditis JSG2O5, envF::pGPP2 CSO 19, envF::pGPP2 JSG234, phoPl05::Tn1Od-Tet JSG2O5, phoPl05::Tn1Od-Tet ATC42;x32:TIO1A~o-(htil polA amber) Vi positive ATCC 9150 ATCC 13428 Clinical isolate This work This work This work Thiis work.

This work

FDA

ATCC

ATCC

VRI

SMlOXpir thi-l dir-1Ileu.86 supE44 tonA2l lacYlrecA::RP4-2-Tc::Mu F- 0 8OdlacZAM15 A(lacZYA -argF) U 169endA I recA 1 hsdRl17deoR rhi- 1supE44?,.

gyrA96relA 1 Yersinia enterocoli-ica Cliical isolate N4GH bacteiiologyla Vibrio cholerae Clinical isolate- Peruvian epidemric -134- CamPYlobacterfe,..s Clnical isolate MGH bacteriology--ab Citrobaterfreun~i Clinical isolate MOB bacteriology lab Kiebsiella pneumoniae Clinical isolate MOB bacteriology lab Shigellafleaxnerj Clinical isolate 14GH bacteriology lab ShIgella sonnei Clinical isolate MOB bacteriology lab Alorganella morganii Clinical isolate MGH bacteriology lab Providencia saxrr.jj Clinical isolate MOB bacteriology lab *00. pWPL17 pBR322 containing a 2.8 Kb HpaI fraz-nent from pWP061 This wo[ 0pCAA9 pWPL17 containing a TnpohoA insertion in envF This wor pGP7O4 pir-dependent suicide vector (34) pGPP2 pGP'7O4 containing the cloned envF::phoA gene fusion This wor pWP06 1 Cosmid clone containing the pagC region (36) lot See. a MSI (macrophage survival index) is calculated by dividing the number of surviving organisms at 2 CC C hours post-infection by the number of cell asscociareci organisms present after the 30 minute infectior S* b MGHi, Massachusetts General Hospital, ATCC, American Type Culture Collection. FDA, Food a-r s~eeg Drug Administration, VRI, Virus Research Institute 4 Belden et al., 1989, Infect. Immun., 57:1-7 31 Miller et al., 1989, Proc. Natl. Acad. Sci. USA, 86:5054-58 34 Miller et al., 1988, J. Bacteriol., 170:2575-83 36 Pulkkjnen et al., 19'91, J. Bacteriol., 173:86-93 -135- TABLE 16 Strai n JSG205 JSG244 ISG226 JSG229 *.qJSG204.

-*O.JSG225 *000 SJSG234 .**:*.JSG235 go 0 AUcaline-phosphatase and B-galactosidase gene fusion activiry Relevent Genorvve gene fusion activitva rnsgA:MudJ 46 1 (B) phoPlO5::Tn]Od-Tet 415(B) msgA:MudJ envE::TnphoA phoPl05::TnIOd-Tet envE::TnphoA pagD::TnphoA 76(A) phoPIOS::TnlOd-Tet 9(A) pagD: :TnphoA envF::pGPP2 16(A) phoPlO5::TnlOd-Tet 19(A) envF: :pGPP2 msgA envF::pGPP21(A JSG232 0 AP (alkaline phosphatase) or B-gal (B-galactosidase) o 0

Claims (5)

1. A live Salmonella cell, or progeny thereof, in which there is inserted into a phoP regulatory region- regulated virulence gene a DNA comprising a sequence encoding a heterologous antigen, wherein said DNA lacks an antibiotic resistance gene.

2. The live Salmonella cell of Claim 1, wherein said DNA is inserted into said virulence gene by site-specific homologous recombination.

3. The live Salmonella cell of Claim 1, wherein said virulence gene is in the phoP regulatory region.

4. A live Salmonella cell in which there is inserted into a virulence gene a DNA comprising a sequence encoding a heterologous antigen, wherein said virulence gene is a 15 prg gene.

95. The live Salmonella cell of Claim 4, wherein said S. virulence gene is the prgH gene. 6. The live Salmonella cell of Claim 4, wherein said virulence gene is the prgA, prgB, prgC or prgE gene. 20 7. The live Salmonella cell of Claim 1, wherein said virulence gene is a pag gene. 8. The live Salmonella cell of Claim 7, wherein said pag gene is pagC. 9. The live Salmonella cell of Claim 1, wherein said 25 Salmonella cell carries a second mutation that attenuates virulence. 10. The live Salmonella cell of Claim 9, wherein said second mutation is an aro mutation. 11. The live Salmonella cell of Claim 1, wherein said sequence encoding a heterologous antigen is under the control of an environmentally regulated promoter. 12. The live Salmonella cell of Claim 1, wherein said Salmonella cell is of the species S. typhi. 13. The live Salmonella cell of Claim 1, further comprising a DNA sequence encoding T7 polymerase under SRAL-A the control of an environmentally regulated promoter, and H:\Emma\Keep\Specis\91365.9 8 .doc 20/03/00 137 a T7 transcriptionally sensitive promoter, said T7 transcriptionally sensitive promoter controlling the expression of said heterologous antigen. 14. A cell comprising a vector, wherein said vector comprises a pagC-encoding DNA into which is inserted a heterologous antigen-encoding DNA, wherein said heterologous antigen-encoding DNA lacks an antibiotic resistance gene. A cell comprising a vector, wherein said vector encodes the prgH gene product. 16. A method of vaccinating an animal, comprising administering to said animal the live Salmonella cell of Claim 1. 17. The method of Claim 16, wherein said live S 15 Salmonella cell is administered orally. 18. Use of a live Salmonella cell according to Claim 1 for the manufacture of a medicament for the vaccination of an animal. S19. A live salmonella cell according to Claim 1 or 20 Claim 4 substantially as hereinbefore described with reference to the examples. 9. 20. A cell according to Claim 14 substantially as hereinbefore described with reference to the examples. 21. A method according to Claim 16 substantially as 25 hereinbefore described with reference to the examples. o: DATED this 20th day of March 2000 THE GENERAL HOSPITAL CORPORATION and PRESIDENT AND FELLOWS OF HARVARD COLLEGE By Their Patent Attorneys GRIFFITH HACK Fellows Institute of Patent Attorneys of Australia H:\Emma\Keep\SpeciS\91365.98.doc 20/03/00