MX2008008361A - Dsrna as insect control agent - Google Patents

Abstract

The present invention concerns methods for controlling insect infestation via RNAi- mediated gene silencing, whereby the intact insect cell(s) are contacted with a double-stranded RNA from outside the insect cell(s) and whereby the double-stranded RNA is taken up by the intact insect cell(s). In one particular embodiment, the methods of the invention are used to alleviate plants from insect pests. Alternatively, the methods are used for treating and/or preventing insect infestation on a substrate or a subject in need of such treatment and/or prevention. Suitable insect target genes and fragments thereof, dsRNA constructs, recombinant constructs and compositions are disclosed.

Description

dsARN AS AN INSECT CONTROL AGENT Field of the Invention The present invention relates to the field of silencing of genes mediated by double-stranded RNA (dsRNA) in insect species. More particularly, the present invention relates to genetic constructs designed for the expression of dsRNA that corresponds to novel target genes. These constructions are particularly useful in the control of insect pests mediated by RNAi. The invention further relates to methods for controlling insects, methods for preventing insect infestation and methods for down-regulation of gene expression in insects using RNAi.

Background of the Invention Insects and other pests can cause damage and even death by their bites or stings. Additionally, many pests transmit bacteria and other pathogens that cause malaria, yellow fever, encephalitis, and other diseases. The bubonic plague, or black death, if caused by bacteria that infect rats and other rodents. The compositions for controlling the infestations of microscopic pests have been provided in the form of compositions antibiotics, antiviral and antifungal. Methods for controlling infestations by pests, such as nematodes and insects, usually take the form of chemical compositions that are applied to surfaces on which the pests reside, or are administered to the infested animals in the form of pellets, powders, plagues or pests. capsules The control of insect pests or agronomically important crops is an important field, for example, insect pests that damage plants belonging to the Solanaceae family, especially potatoes (Solanum tuberosum), but also tomatoes (Solanum Lycopersicum), eggplant ( Solanum melongena), capsicums (Solanum capsicum), and belladonna (for example, Solanum aculeastrum, S. bulbocastanum, S. cardiophyllum, S. douglasii, S. dulcamara, S. lanceolatum, S. robustum and S. triquetrum) particularly the control of coleopteran pests. There has been substantial progress in a few decades towards the development of more efficient methods and compositions for controlling insect infestations in plants. Chemical pesticides have been very effective in eradicating pest infestations. Biological control using neem seed extract, (Azadirach ta indica) have azadirachtin as the main active ingredient. These insecticides can be Apply to a broad spectrum of insects. Act as a regulator of insect growth; azadirachtin prevents the insects from transforming by inhibiting the production of an insect hormone, ecdysone. Biological control using the Cry3A protein of the Bacillus thuringiensis tenebrionis and San Diego varieties, and derived insecticide proteins are alternatives to chemical control. The Bt toxin protein is effective in controlling larvae of Colorado potato beetles either as formulations sprayed on the foliage or expressed on the leaves of potatoes. An alternative biological agent is dsARN. During recent years, down-regulation of genes (also referred to as "gene silencing" in multicellular organisms by means of RNA interference or "RNAi" has become a well-established technique.) RNA interference or "RNAi" is a down-regulation process specific to gene expression sequences (also referred to as "gene silencing" or "RNA-mediated gene silencing") initiated by double-stranded RNA (dsRNA) that is complementary in sequence to a region of the target gene to regulate downwards (Fire, A. Genet Trains, Vol 15, 358-363, 1999, Sharp, PA Genes Dev. Vol. 15, 485-490, 2001).

In recent years, down-regulation of target genes in multicellular organisms by means of RNA interference (RNAi) has become a well-established technique. RNA interference or "RNAi" is a down-regulation process specific to gene expression sequence (also referred to as "gene silencing" or "RNA-mediated gene silencing") initiated by double-stranded RNA (dsRNA) that it is complementary in sequence to a region of the target gene for downward regulation (FIRE, A. Genet Trains, Vol. 15, 358-363, 1999; Sharp, P.A. Genes Dev. Vol. 15, 485-490, 2001). In recent years, down-regulation of target genes in multicellular organisms by means of RNA interference (RNAi) has become a well-established technique. Reference may be made to International Applications WO 99/32619 (Carnegie Institution) and WO 00/01846 (by the applicant). The silencing of dsRNA genes finds application in many different areas, such as, for example, gene silencing mediated by dsRNA in clinical applications (WO2004 / 001013) and in plants. In plants, the dsRNA constructs useful for gene silencing have also been designed to be separated and processed into short interfering RNA (siRNA).

Although the RNAi technique has generally been known in the art of plants, C. elegans and mammalian cells for some years, little is known to date about the use of RNAi to down regulate the expression of genes in insects. Since the filling and publication of applications WO 00/01896 and WO 99/32619, only a few applications have been published that relate to the use of RNAi to protect plants against insects. These include International Applications WO 01/37654 (DNA Plant Technologies), WO 2005/019408 (Bar Han University), WO 2005/049841 (CSIRO, Bayer Crop Science), WO 05/047300 (University of Utah Research Foundation) and the US request 2003/00150017 (Bureau and others). The present invention provides target genes and constructs useful in the control of insect pests mediated by RNAi. Accordingly, the present invention provides methods and compositions for controlling pest infestation by suppressing, delaying or in some way reducing the expression of genes within a particular pest.

Description of the Invention The present invention describes a non-compound or protein-based approach for the control of insect crop pests. The active ingredient is a nucleic acid, a double-stranded RNA (dsRNA), which can be Use as an insecticide formulation, for example, as a foliage spray. The dsRNA sequence corresponds to part or all of the essential insect gene and causes down regulation of the target insect via RNA interference (RNAi). As a result of the down regulation of mRNA, the dsRNA prevents the expression of the target insect protein and therefore causes death, decreased growth or sterility of the insect. The methods of the invention can find practical application in any area of technology where it is convenient to inhibit viability, growth, development, production of the insect or to decrease the pathogenicity or infectivity of the insect. The methods of the invention also find practical application where it is convenient to down-regulate the specific expression of one or more target genes in an insect. Particularly useful practical applications include, but are not limited to, (1) protecting plants from infestation of insect pests; (2) pharmaceutical or veterinary use in humans and animals (for example, to control, treat or prevent insect infections in humans and animals); (3) protective materials against damage caused by insects; (4) protection of perishable materials (such as food products, seeds, etc.) from damage caused by insects, and generally any application where it is necessary to control insects and / or where it is necessary to prevent the damage caused by insects. According to one embodiment, the invention relates to a method for controlling the growth of insects in a cell or an organism, to prevent the infestation of insects of a cell or an organism susceptible to insect infection, comprising the contact of the insects with a double-stranded RNA, wherein the double-stranded RNA comprises complementary temperate strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of a target gene for insects, so the double-stranded RNA is absorbed by the insect and therefore controls growth or prevents infestation. The present invention therefore provides novel nucleotide sequences isolated from insect target genes, said isolated nucleotide sequences comprising at least one nucleic acid sequence selected from the group comprising: (i) sequences represented by either SEQ.

ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198 , 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517 , 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481, or 2486, or the complement thereof; (ii) sequences that are at least 70%, preferably at least 75%, 80%, 85% 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical to a sequence represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NO: 1, 3, 5, 7, 9 , 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230 , 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 4 93, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or a complement thereof, or wherein the acid sequence nucleic is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 49 to 158, 275 to 472, 533 to 575, 621 to 767, 813 to 862, 908 to 1040, 1161 to 1571, 1730 at 2039, 2120 to 2338, 2384 to 2460, or a complement thereof, the nucleic acid sequences being useful for preparing the double-stranded RNA of the invention to control the growth of insects. "Pest control" as used in the present invention, means killing pests, or preventing the development of pests, or their growth or preventing pests from infecting or infesting. Pest control as used herein also covers controlling insect progeny (egg development). Pest control, as used in the present invention, also encompasses inhibiting the viability, growth, development or reproduction of the insect, or decreasing the pathogenicity or infectivity of the insect. The compounds and / or compositions described herein, can be used for maintain a healthy organism and can be used curatively, preventively or systematically to control pests or prevent the growth of insects or the development of infection or infestation. The particular pests provided by the present invention are insect pests. The insect control as used herein, therefore also encompass controlling the progeny of insects (such as the development of eggs, for example insect pests). Insect control as used herein also encompasses inhibiting the viability, growth, development or reproduction of the insect, or decreasing the pathogenicity or infectivity of the insect. In the present invention, insect control can inhibit a biological activity in an insect, resulting in one or more of the following attributes: reduction in feeding by the insect, reduction in viability of the insect, death of the insect, inhibition or differentiation and insect development, absence of or reduced capacity for safe reproduction by the insect, muscle formation, juvenile hormone formation, juvenile hormone regulation, regulation and transport of ions, maintenance of cell membrane potential, amino acid biosynthesis, amino acid degradation , cell membrane potential maintenance, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, sensitization of pheromones, formation of antennas, formation of the, formation, development and differentiation of legs, egg formation, larval maturation, formation of digestive enzymes, hemolymphatic synthesis, hemolymphatic maintenance, neurotransmission, cell division, energy metabolism, respiration, apoptosis , and any component of a cytoskeletal structure of eukaryotic cells, such as, for example, actins and tubulins. The compounds and / or compositions described herein, can be used to maintain a healthy organism and can be used curatively, preventively or systematically to control an insect or prevent insect growth or development or infection or insect infestation. Therefore, the invention may allow previously susceptible organisms to develop resistance against infestation by the insect organism. The term "complementary to at least part of" as used herein, means that the nucleotide sequence is completely complementary to the target nucleotide sequence on more than two nucleotides, for example on at least 15, 16, 17,18, 19, 20, 21, 22, 23, 24 or more contiguous nucleotides. According to a further embodiment, the invention relates to a method for downregulating the expression of a target gene in an insect, comprising contacting the insect with a double-stranded RNA, wherein the double-stranded RNA comprises complementary temperate strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of the target gene of insects to be down-regulated, so that the double-stranded RNA is absorbed in the insect and down-regulates the expression of the target gene of the insect. When the term "a" is used within the context of "a white gene", it means "at least one" white gene. The same applies to "a" white organism which means "at least one" white organism, and "an" RNA molecule or host cell meaning "at least one" RNA molecule or host cell. This is also detailed below. According to one embodiment, the methods of the invention are based on the uptake by the insect of double-stranded RNA present outside the insect (e.g., by feeding) and does not require the expression of double-stranded RNA within cells. of the insect. In addition, the present invention also encompasses methods as described above wherein the insect is contacted with a composition comprising the double-stranded RNA. Said double-stranded RNA can be expressed by a host cell or prokaryotic host organism (eg, but not limited to, a bacterium) or eukaryotic (for example, but not limited to, a yeast). The insect can be any insect, meaning any organism that belongs to the Animal Kingdom, more specific to the Phylum arthropoda, and to the Insect Class or the Arachnid Class. The methods of the invention apply to all insects that are susceptible to gene silencing by RNA interference and that can introduce double-stranded RNA from their immediate environment. The invention can also be applied to the insect at any stage in its development. Because the insects have a non-living exoskeleton, they can not grow to a uniform regime and instead grow in stages by periodically changing their exoskeleton. This process is called muda or ecdisis. The stages between seedlings are referred to as "stage" and these steps can be directed according to the invention. Also, live insect or juvenile eggs may also be directed in accordance with the present invention. Also, live insect or juvenile eggs may be directed in accordance with the present invention. All stages in the development cycle, which includes metamorphosis in pterygotes, can be directed in accordance with the present invention. Therefore, individual stages such as stages of development of larvae, pupae, nymphs, etc., can be directed.

In one embodiment of the invention, the insect may belong to the following orders; Acari, Araneae, Anoplura, Coleoptera, Collembola, Dermaptera, Dictyoptera, Diplura, Diptera, Embioptera, Ephemeroptera, Grylloblatodea, Hemiptera, Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mallophaga, Mecoptera, Neuroptera, Odonata, Orthoptera, Phasmida, Plecoptera, Protura, Psocoptera, Siphonaptera, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Trichoptera, and Zoraptera. In the preferred, but not limiting, embodiments and methods of the invention, the insect is selected from the group consisting of; (1) an insect that is a pest for plants, such as, but not limited to, Nilaparva ta spp. (e.g., N. l ugens (salt tamontes of brown plants)); Laodelphax spp. (eg, L. stria tell us (grasshopper of small coffee plants), Nephotet tix spp. (eg, N. virescens or N. cincticeps (green leafhopper), or N. nigropictus (grasshopper of rice leaf), Soga tella spp. (eg, S. furcifera (grasshopper of white-back plants), Blissus spp. (e.g., B. leucopterus leucopterus (bedbug), Scotinophoa spp. (v. gr., S. vermidula te (black rice tick), Acrostemum spp. (e.g., A hilare (green tick)), Parnara spp. (e.g., P. gutata ta (rice butterfly) Chilo spp. (E.g., C. suppressalis (stem weevil separated from rice), C. to uricil ius (gold-fringed stems weevil), or C. polychrysus (black stem stems); Chilotraea spp. (eg, C. polychrysa (rice stem weevil), Sesamia spp. (e.g., S. inferens (pink rice weevil), Trypoyza spp. (e.g., T. innota ta ( white rice weevil), or T. incertulas (yellow rice weevil), Cnaphalocrocis spp. (e.g., C. medinalis (rice leaf wrapper)), Agromyza spp. (e.g., A. oyzae (destroyer of leaves), or A parviconis (destroyer of leaves of corn stains)), Oia traea spp. (v.gr., 0. saccharalis (sugar cane weevil), or 0. gryiosella (maize weevil) east of the south), Narnaga spp. (e.g., N. aenescens (green rice caterpillar)), Xan thodes spp. (e.g., X. transverse (green caterpillar), Spodoptera spp. (v.gr) ., S. frugiperda (autumn worm), S. exigua (cane worm), S. líttoalis (climbing worm) or S. praefica (worm with yellow strips from the east)), Mythimna spp. (V.gr. , Mythmna (Pseudaletia) sepera ta (worm), Helicoverpa spp. (E.g., H. zea (corn worm), Colaspis spp. (E.g., C. brunnea (grape colapis), Lissohoptrus s pp. (e.g., L. oyzophilus (rice water weevil); Echinocnemus spp. (e.g., E. squamos (rice plant weevil), Oculodispa spp. (e.g., 0. armigera (rice hispa)) Oulema spp. (v. 0. oyzae (beetle leaves); Si tophilus spp. (eg, S. oyzae (rice weevil); Pachydiplosis spp. (e.g., P. oyzae (Gall mosquitoes) rice); Hydrellia spp. (eg, H. griseola (insects in the form of small rice leaves), or H. sasakii (rice stem maggot), Chloops spp. (e.g., C. oyzae (stem maggot); Oiabrotica spp. (v.gr., 0. virgifera virgifera (western corn rootworm), 0. barberí (northern corn rootworm), 0. undecimpuncta ta howardi (southern corn rootworm), O. virgifera zeae (Mexican corn rootworm); 0. bal tea ta (cucumber beetle with bands)); Ostrinia spp. (e.g., 0. nubilalís (European corn weevil), Agrotis spp. (e.g., Aipsilon (black worm), Elasmopalpus spp. (e.g., E. lignosell us (lower corn weevil); Melanotus spp. (worm wire); Cyclocephala spp. (e.g., C. boeales (northern masked beetles), or C. immaculata ta (masked beetles from the south); Popillia spp. (eg, F japonica (Japanese beetle), Chaetocnema spp. (e.g., C puli caria (corn fly beetle), Sphenophous spp. (eg, S. maídís (Billbug de maiz); Rhopalosiphum spp. (e.g., R. maidis (corn leaf aphids); Anuraphis spp. (e.g., A maidiradicis (aphids of corn roots)); Melanoplus spp. (e.g., M. femurrubrum (red-legged grasshopper) M. differen tialis (differential grasshopper) or M. sanguinipes (migratory grasshopper)); Hylemya spp. (e.g., H. platura (seedcon maggot)); Anaphothrips spp. (e.g., A. obscrurus (grass thrips)); Solenopsis spp. (e.g., S. milesta (thief ant)); or spp, (e.g., T. urticae (spider mites with two spots), T. cinnabarinus (carmine spider mites); Helícoverpa spp. (v. gr., H. zea (cotton worm), or H. armígera (American worm)); Pectinophoa spp. (e.g., P. gossypiella (pink worm)); Earias spp. (e.g., E. v t tella (spotted worm)); Heliothis spp. (e.g., H. virescens (tobacco worm)); Anthonomus spp. (e.g., A. gryis (Bole weevil)); Pseuda tomoscelis spp. (e.g., P. would be your (flying cotton grasshopper)); Trialeurodes spp. (e.g., T. abutiloneus (white fly with banded wings) T. vapoarioum (greenhouse whitefly)); Bemisia spp. (e.g., B. argentifol ti (white fly of silver leaves)); Aphis spp. (e.g., A. gossypii (cotton aphid)); Lygus spp. (e.g., L. lineolaris (tarnished plant bug) or L. hesperus (western tarnished plant bug)); Euschi stus spp. (e.g., E. conspersus (stinky bug Consperse)); Chloochroa spp. (e.g., C. sayi (stinky bug Say)); Nezara spp. (e.g., N. viridula (Southern green stink bug)); Thrips spp. (e.g., T. tabaci (onion tirps)); Frankliniella spp. (e.g., F. fusca (tobacco shoots), or F. occidentalis (western flower shoots)); Leptinotarsa spp. (eg, L. decemlinea ta (potato beetle), L. uncta (false potato beetle), or L. texana (Texan false potato beetle)); Lemma spp. (e.g., L. tril inea ta (three-layer potato beetle)); Epi trix spp. (e.g., E. cucumeris (potato fly beetle), E. hirtipennis (fly beetle), or E. tuberis (flying pipe beetle)); Epicauta spp. (e.g., E. vit ata (Blister beetle with smooth)); Phaedon spp. (e.g., P. cochleariae (mustard leaf beetle)); Epilachna spp. (e.g., E. varívetis (Mexican bean beetle)); Acheta spp. (e.g., A. domesticus (domestic grasshopper)); Empoasca spp. (e.g., E. fabae (potato grasshopper)); Myzus spp. (e.g., M. persi falls (green peach aphid)); For trioza spp. (e.g., P. cockerellí (psyllid)); Conoderus spp. (e.g., C. fallí (almond worm of southern fries), or C. vespertínus (worm-reared wire)); Phthoimaea spp. (e.g., P. operculel la (potato tuber worm)); Macrosiphum spp. (v. gr., M. eup ojíae (potato aphid)); Thyanta spp. (v. gr., T. pallidovirens (stinkworm with red back)); Phthoimaea spp. (v. gr., P. operculella (potato pipe worm)); Helicoverpa spp. (v. gr., H. zea (tomato worm); Keiferia spp. (v. gr., K. Iycopersicella (worm tomato bolt)); Limonius spp. (worm wire); Myuca spp. (v. gr., M. sixth (workworm), or M. quinquemacula ta (tomato worm)); Liriomyza spp. (v. gr., L. sa tivae, L. trí tolli or L. huidobrensis (leaf destroyer)); Drosophilla spp. (e.g., D. melanogaster, D. yakuba, D. pseudoobscura or D. simulans); Carabus spp. (v.gr., C. granula tus); Chironomus spp. (e.g., C. tentanus); Ctenocephalides spp. (e.g., C. felis (cat fly)); Diaprepes spp. (e.g., D. abbreviatus (root weevil)); Ips spp. (e.g., I. pini (pine engraver)); Tribolium spp. (e.g., T. castaneum (red soil beetle)); Glossina spp. (e.g., G. mosi tans (tsetse fly)); Anopheles spp. (e.g., A. gambiae (malaria mosquito)); Helicoverpa spp. (e.g., H. armígera (Boíl Africano worm)); Acyrthosiphon spp. (e.g., A. pisum (pea aphid)); Apis spp. (e.g., A. melifera (honey-producing bee)); Homalodisca spp. (e.g., H. coagulate you (bright-leaved grasshoppers)); Aedes spp. (e.g., A. aegypti (yellow fever mosquito)); Bombyx spp. (v. gr., B. moi (silkwom)); Locusta spp. (v. gr., L. migra toia (migratory locust)); Boophilus spp. (e.g., B. micropl us (cattle tick)); Acanthoscurria spp. (v.gr., A. gomesiana (red-haired chocolate bird eater)); Dipl optera spp. (e.g., D. puncta ta (pacific beetle cockroach)); Heliconius spp. (e.g., H. era to (passion red flower butterfly) or H. melpomene (butterfly Postman)); Curculio spp. (e.g., C. glyiu (beetle Acón)); Plutella spp. (e.g., P. xylostella (Diamondback moth)); Amblyomma spp. (e.g., A. variega tum (cattle tick)); Anteraea spp. (e.g., A. yamamai (silk moth)); and Armigeres spp. (v.gr., A. subalba tus); (2) an insect capable of infesting and harming humans and / or animals such as, but not limited to those with parts of the mouth that pierce and aspirate, as found in Hemiptera and some Hymenoptera and Dipetera such as mosquitoes, bees, moths, lice, flies and homigas, as well as members of Arachnidae such as ticks and mites, family class of Acariña (ticks and mites) v.gr., representatives of the families Amblyomma spp., Anocento spp., Argas spp., Boophilus spp., Cheyletiella spp., Choioptes spp., Demodex spp., Dermacento spp., Dermanyssus spp., Haemophysalis spp., Hyalomma spp., Ixodes spp., Lynxacarus spp., Mesostigma ta spp., Notoedres spp., Oni thodoos spp., Oni thonyssus spp., Otobius spp., Otodectes spp., Pneumonyssus spp., Psooptes spp., Rhipicephalus spp., Sarcoptes spp., Or Trombicula spp.; Anoplura (sucking and biting lice) v.gr., representatives of the species Bovícola spp., Haema topinus spp., Linogna thus spp., Menopon spp., Pediculus spp., Pemphi gus spp., Phylloxera spp., Or Solenopotes spp. .; Diptera (flies) e.g., representatives of the species Aedes spp., Anopheles spp., Calliphoa spp., Chrysomyia spp., Chrysops spp., Cochliomyia spp., Culex spp., Culicoides spp., Cuterebra spp., Derma tobia spp., Gastrophilus spp., Glossina spp., Haema tobia spp. , Haema topota spp., Hippobosca spp., Hypoderma spp., Lucilia spp., Lyperosia spp., Melophagus spp., Oestrus spp., Phaenicia spp., Phlebotomus spp., Phomia spp., Sarcophaga spp., Simulium spp., Stomoxys spp., Tabanus spp., Tannia spp. or Typula spp .; Mallophaga (biting lice) v.gr., representatives of the species Damalina spp., Felicola spp., Heterodoxus spp. or Trichodectes spp .; or Siphonaptera (wingless insects) v., representatives of the species Ceratophyllus spp., spp., Pulex spp., or Xenopsylla spp.; Cimicidae (true bugs) v.gr., representatives of the species Cimex spp., Tri tominae spp., Rhodinius spp., Or Tria toma spp. and (3) an insect that causes unwanted damage to substrates or materials, such as insects that attack food products, seeds, wood, paint, plastic, clothing, etc. (4) an insect or arachnid relevant to public health and hygiene, including domestic insects and ecto-parasites, such as, by way of example and without limitation, flies, spiders, mites, thrips, ticks, mites of red birds, homigas, cockroaches, termites, grasshoppers including homemade grasshoppers, silver fish, book lice, beetles, earwigs, mosquitoes and flies. The most preferred targets are cockroaches (Blattodea) such as but not limited to Bla tella spp. (e.g., Bla tella germanica (German cockroach)), Periplaneta spp. (e.g., Periplaneta americana (American cockroach) and Periplaneta australiasiae (Australian cockroach)), Blatta spp. (e.g., Bla tta oientalis (eastern cockroach)) and Supella spp. (e.g., Supella longipa lpa (brown-eyed cockroach); ants (Fomicoidea), such as but not limited to Solenopsis spp. (e.g., Solenopsis invicta (red-spotted ant)), Monomoium spp. (e.g., Monomoium pharaonis (pharaoh ant)), Camponotus spp. (e.g., Camponotus spp (carpenter ants)), lasius spp. (e.g., Lasius niger (small black ants)), Tetramoium spp. (e.g., Tetramoium caespitum (pavement ant)), Myrmica spp. (e.g., Myrmica rubra (red ant)), Fornica spp (wood ant), Crematogaster spp. (e.g., Crematogaster lineolata (Acrobat Ant)), Iridomyrmex spp. (e.g., Iridomyrmex humilis (Argentine ant)),. Pheidole spp. (large-headed ants), and Dasymutilla spp. (e.g., Dasymutilla occidentalis (Velvet ant)); termites (Isoptera and / or Termitidae) such as but not limited to Ami ermes spp. (e.g., Amitermes floidensis (ends with dark wings of Florida)), Reticulitermes spp. (e.g., Reticulitermes flavipes (eastern subterranean termite), Reticulitermes hesperus (western subterranean termite)), Coptotermes spp. (v.gr., Coptotermes fomosanus (subterranean termite Fomosan)), Incisitermes spp. (e.g., Incisitermes mino (western dry wood termite)), Neotermes spp. (e.g., Neotermes connexus (termite of forest trees)). In terms of "susceptible organisms", which benefit from the present invention, any organism that is susceptible to pest infestation is included. The pests of many different organisms, for example animals such as human beings, domestic animals (such as pests such as cats, dogs, etc.) and livestock (including sheep, cows, fences, chickens, etc.). In this context, preferred, less non-limiting embodiments of the invention, the insect or arachnid is selected from the group consisting of: (1) Mites: mites including ixodida (ticks) (2) Arachnida: Araceae (spiders) and Opilons (harvestman), examples include: Latrodectus mactans (black widow) and Loxosceles rectuse (Spider Rectuse Coffee). (3) Anoplura: louse, such as Pediculus humanus (4) Blattodea: cockroaches including German cockroach (Blatella germanica), of the periplaneta genus, including American cockroach (Periplaneta americana) and Australian cockroach (periplaneta australiasiae), of the Blattta genus, including eastern cockroach (Blatta orientalis) and Supella genus, including brown-banded cockroach (Supella longipalpa). A more preferred target is the German cockroach (Germanic Blattella). (5) Coleoptera: beetles, examples include: the Powderpost beetle family (family of Bostrichoidea); Dendroctonus spp. (Turpentine Black Beetle, Southern Pine Beetle, IPS Engraver Beetle); Carpet beetles (Anthrenus spp., Attagenus spp.); Old House Weevil (family of Cerambycidae: Hylotrupes bajulus); Anobium pnctatum; Tribolium spp (flour beetle); Trogoderma granarium (Khaptra beetle); Oryzephilus sarinamensis (Beetle Serrated of Grains) etc. (Worm of books). (6) Dermaptera: family of earwigs (7) Diptera: mosquitoes (Culicidae) and flies (Brachycera), examples are: Anophelinae such as Anofeles spp, and Culicinae such as Aedes fulvus; Tabanidae such as Tabanuus punctifer (Flyfly), Glossina morsitans morsitans (tsetse fly), drainage flies (Psychodidae) and Calyptratae such as Housefly (housefly), carnivorous flies (family of Sarcophagidae) etc. Heteroptera: bed bugs, such as Cemex lectularius (bed bugs) (9) Hymenoptera: wasps (Apocrypha), including ants (Formicoidea), bees (Apoidea): Solenopsis invicta (Red Fire Ant), Monomorium pharaonis (Ant pharaoh), Camponotus spp. (Carpenter ants), Lasius Niger (Small Black Homiga), Tetramorium caespitum (Pavement Ant), Myrmica rubra (Red ant), Formica spp (wood ants), Crematogaster leneolata (Ant Acrobat), Iridomyrmex humillis (Ant Argentina), Pheidole spp (Big headed ants), Western Dasymutilla (Velvet ant), etc. (10) Isopetera: termites, examples include: Amitermes floridensis (subterranean termite with dark wings of Florida), the subterranean subterranean termites (Reticulitermes flavipes), R. hesperus (Western Underground Termite), Coptotermes formosanus (Formosan Subterranean Termite), Incisitermes minor (Western Dry Wood Termite), Neotermes conenexus (Termite of Forest Trees) and Termitidae (11) Lepidoptera: moths, examples include: Tineidae & Oecophoridae such as Tineola bisselliella (Common Clothes Moth), and Pyralidae such as Pyralis farinalis (Food Moth), etc. (12) Psocoptera: bookiice (psocids) (13) Siphonaptera: flies such as PUlex irritans (14) Sternorrhyncha: aphids (Aphididae) (15) Zygentoma: silver fish, examples are: Thermobia domestica and Lepisma saccharina Pathogenic insects of plants Preferred according to the invention are plant pests and are selected from the group consisting of Leptinotarsa spp. (eg, L. decemlinea ta (Colorado potato beetle), L. uncta (false potato beetle), or L. texana (Texas false potato beetle), Nilaparva ta spp. (e.g. N. lugens (grasshopper of brown plants)); Laodelphax spp. (e.g., L. stria tell us (small green grasshopper); Nephotettix spp. (e.g., N. virescens or N. cincti ceps (grasshopper with green leaves), or N. nigropi ctus (grasshopper with rice leaf); Soga tella spp. (e.g., S. furcifera (plant grasshopper with white back); Chilo spp. (eg, C. suppressal ís (weevil in stems in rice strips), C. auricilius (gold-fringed stem weevil), or C. polychrysus (dark-headed stem weevil), Sesamia spp. (e.g., S. inferens (pink rice weevil); Tryporyza spp. (e.g., T. innota ta (white rice weevil), or T. incertulas (yellow rice weevil), Diabrotica spp. (e.g., D. virgifera virgifera (western corn worm), D. barberi (northern corn worm), D. undec impune ta ta howardi (southern corn worm), D. virgifera zeae (Mexican corn worm); Ostrinía spp. (e.g., 0. nubilalis (European corn weevil), Anaphothrips spp. (e.g., A. obscrurus (grass thrips), Pectinophora spp. (e.g., P. gossypiella (Boíl pink worm ), Heliothis spp. (Eg, H. virescens (working worm), Trialeurodes spp. (E.g., T. abutiloneus (white fly with banded wings) T. vaporar iorum (greenhouse whitefly) Bemisia spp. (e.g., B. argen tifoli (white fly with silver wings); Aphis spp. (e.g., A. gossypii (cotton aphid); Lygus spp. (e.g., L. Iíneolaris (disseminated plant bug) or L. hesperus (western disseminated plant bug), Euschistus spp. (e.g., E. conspersus (stinky bug consperse)); Chlorochroa spp. (eg, C. sayi (stinky insect Say); Nezara spp. (e.g., N. viridula (southern green stinking bug); Thrips spp. (e.g., T. tabaci (onion tirps); Frankliniel la spp. (eg, F. fusca (tobacco shoots), or F. occiden talis (western flower shoots), Myzus spp. (e.g.

M. persicae (green peach aphid); Macrosiphum spp. (v. gr., M. euphorbiae (potato aphid); Blissus spp. (e.g.

B. leucopterus leucopterus (bed bug)); Acrosternum spp. (e.g., A. hilare (stinky green bug)); Chilotraea spp. (e.g., C. polychrysa (rice weevil), Lissorhoptrus spp. (e.g., L. oryzophilus (rice water weevil); Rhopalosiphum spp. (eg, R. maidis (corn leaf aphid) and Anuraphis spp. (e.g., A. maidiradicis (corn root aphid) .According to a more specific modality, the methods of the invention can be applied to species of Leptinotarsa belongs to the family of Chrysomelidae or leaf beetles.Chrysomelida beetles such as Flea beetles and Corn Rootworms and Curculionidae such as alfalfa weevils are particularly important pests.Fleas beetles include a large number of small beetles that feed on leaves that feed on the leaves of a certain number of grasses, cereals, and herbs Flea beetles include a large number of genera (eg, Attica, Apphthona, Argopistes, Disonycha, Epitrix, Longitarsus, Prodagricomela, Sstena, and Phyllotreta). The Flea Beetle, Phyllotretaa cruciferae, also known as the Colza Flea Beetle, is a particularly important pest. Corn rootworms include species found in the genus Diabrotica (eg, D. undecimpunctata, D. undecimpunctata howardii, D. longicornis, D. virgifera and D. balteata). Corn rootworms cause extensive damage to corn and curcubitos. The WesLren Spotted Cucumber Beetle, D. undedimpunctata undecimpunctata, is a plague of curcubitos in the Alfalfa weevil of E.U.A. Western (also known as clover weevils) belong to the genus, Hypera (H. postica, H. brunnipennis, H. nigrirostris, H. punctata and H. meles), and are considered an important pest of legumes. The Egyptian alfalfa weevil, H. brunneipennis, is an important pest of alfalfa in E.U.A. western. There are more than 30 species of Leptinotarsa. The present invention therefore encompasses methods for controlling Leptinal species, more specific methods for killing insects, or preventing Leptinotarse insects from developing or growing, or preventing insects from infecting or infesting. Species of Leptinotarsa specific for control according to the invention include Colorful Potato Beetles (Leptonotarsa decemilineata (Say) and Beetle of Pope Faloss (Leptinotarse juncta (Say) CPB is a plague (serious) in our domestic potato (Solanum tuberosum), other potato species that have cultivated or wild tubers or without tubers (v.grf., S demissum, S. phyreja a. o.) and other plant species Solanáceas (nocturnal shadows) including: (a) tomato ucltivo species (several species of Lycopersicon), eggplant (Solanum melongena), peppers (several species of Capsicum), tobacco (several species of Nicotiana including ornamentals) and tomatillo ( Physalis species), (b) weed species, nettle of cballo (S. carolinense), common nocturnal shadows (S. dulcamara), belladonna (species Atropa), apple with spines (Datura species), Henbane (hyoscyamus species ) and Buffalo burr weed (S. rostratum). PFB is mainly found in horse nettle, but also occur in common belladonna, tomatillo and tomato with rind (Physalis species); The term "insect" encompasses insects of all types and all stages of development, including stages of egg, larvae or nymphs, pulp and adult. The present invention extends to methods described herein, wherein the insect is Leptinotarsa demineata (Colorado potato beetle) and the plant is potato, eggplant, tomato, pepper, tobacco, tomatillo or rice, corn or cotton. The present invention extends to methods described herein, wherein the insect is Phaedon cochleariae (mustard leaf beetle) and the plant is mustard, Chinese cabbage, green turnip, Swiss chard, or white cabbage. The present invention extends to methods as described herein, wherein the insect is Epilachna varivetis (Mexican bean beetle) and the plant is beans, field beans, garden beans, green beans, lima beans, mung beans, green bean, black bean, velvety bean, soy, cow bean, pigeon pea, clover, and alfalfa. The present invention extends to methods as described herein, wherein the insect is Anthonomus grandis (cotton boll weevil) and the plant is cotton. The present invention extends to methods as described herein, wherein the insect is Tribolium castaneum (red flour beetle) and the plant has the form of stored grain products such as flour, cereals, food, cookies, beans, species, pasta, cake flour, dry pet food, dried flowers, chocolate, nuts, seeds and dried museum specimens.

The present invention extends to methods as described herein, wherein the insect is Myus persice (aphids of green peach) and the plant is a tree such as Prunas, particularly peach, apricot and plum; a vegetable crop of the families Solanacea, Chenopodiaceae, Compositae, Cruciferae, and Cucurbitaceae, including worse not limited to, scallops, asparagus, beans, beet, broccoli, brussel squash, cabbage, carrot, cauliflower, melon, celery, corn, cucumber , fennel, cabbage, kohlrabi, turnip, eggplant, lettuce, mustard, okra, parsley, chirv, pea, pepper, potato, radish, spinach, squash, tomato, turnip, watercress, and watermelon; a crop field such as, but not limited to, tobacco, beet, sunflower; a crop of flowers or another ornamental plant. The present invention extends to methods described herein, wherein the insect is Nilaparvata lugens and the plant is a rice plant. The present invention extends to methods as described herein, wherein the insect is Plutella xylostella (Diamondback moth) and the plant is a Brassica species such as, but not limited to cabbage, Chinese cabbage, Brussels sprouts, cabbage , rapeseed, broccoli, cauliflower, turnip, mustard or radish. The present invention extends to methods as described herein, wherein the insect is Acheta domesticus (domestic grasshopper) and the plant is any plant described herein or any organic matter. In this context the term "plant" encompasses any plant material that is desired to be treated to prevent or reduce the growth of insects and / or insect infection. This includes, among other things, complete plants, nurseries, propagating or reproductive material such as seeds, cuts, grafts, explants, etc., and also cell and tissue cultures of the plant. The plant material must express or have the ability to express, the RNA molecule comprising at least one nucleotide sequence which is the RNA complement of, or represents the RNA equivalent to, at least part of the nucleotide sequence of the strand in a sense of at least one target gene of the pest organism, so that the RNA molecule is absorbed by a pest as the pest interacts with the plant, said RNA molecule being able to inhibit the target or downregulate the expression of the target gene by RNA interference. The blank gene can be any blank described herein, for example, a white gene that is essential for the viability, growth, development or reproduction of the pest. The present invention relates to any gene of interest in the insect (which may to be referred to herein as the "white gene") that can be down-regulated. The terms "down-regulation of gene expression" and "inhibition of gene expression" are used interchangeably and refer to a measurable and observable reduction in gene expression or complete abolition of detectable gene expression at the protein product level and / or mRNA product on gene expression can be calculated at least to be 30%, 40%, 50%, 60%, preferably 70? > , 80% or even more preferably 90% or 95% when compared to the normal expression of genes. Depending on the nature of the target gene, down-regulation or inhibition of gene expression in insect cells can be confirmed by phenotypic analysis of the whole insect or cell or by measurement of mRNA or protein expression using molecular techniques such as RNA solution hybridization, PCR, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microanalysis, antibody binding, enzyme linked immunosorbent assay (ELISA), Western analysis, radioimmunoassay (RIA), other immunoassays or fluorescence activated cell analysis (FACS).

The "target gene" can essentially be any gene that is convenient to be inhibited because it interferes with the growth or pathogenicity or infectivity of the insect. For example, if the method of the invention is to be used to prevent the growth and / or insect infestation that is preferred to select a target gene that is essential for the viability, growth, development or reproduction of the insect, or any gene that is implicated with pathogenicity or infectivity of the insect, so that specific inhibition of the target gene leads to a lethal phenotype or decreases or halts insect infestation. According to a non-limiting mode, the target gene is such that when its expression is down-regulated or inhibited using the method of the invention, the insect dies, or the reproduction or growth of the insect is stopped or retarded. This type of white genes is considered essential for the viability of the insect and is termed as essential genes. Therefore, the present invention encompasses a method as described herein, wherein the target gene is an essential gene. According to a further non-limiting mode, the target gene is such that when downregulated using the method of the invention, the infestation or infection by the insect, the damage caused by the insect and / or the ability of the insect to infest or infecting the host organisms and / or causing said damage is reduced. The terms "infest" and "infects" or "infestation" and "infection" are generally used interchangeably through it. This type of white genes is considered to be involved in the pathogenicity or infectivity of the insect. Therefore, the present invention extends to methods as described herein, wherein the target gene is involved in the pathogenicity or infectivity of the insect. The advantage of choosing the last type of white gene is that the insect is blocked to infect more plants or parts of plants and is inhibited to form additional generations. According to one modality, the white genes are conserved genes or genes specific for insects. In addition, any suitable double-stranded RNA fragment capable of directing RNA silencing or inhibition mediated by RNAi or RNA of an insect target gene can be used in the methods of the invention. In another embodiment, a gene is selected that is involved essentially in the growth, development and reproduction of a pest, (such as an insect). Illustrative genes include but are not limited to the structural subunits of ribosome proteins and a beta-coatamer gene, such as the CHD3 gene. Ribosomal proteins such as S4 (RpS4) and S9 (RpS9) are structural constituents of the ribosome involved in protein biosynthesis and are components of the small cytosolic ribosomal subunit, ribosomal proteins such as L9 and L19 are structural constituents of the ribosome involved in protein biosynthesis that is located on the ribosome. The beta coatamer gene in C. elegans encodes a protein that is a subunit of a multimeric complex that forms a membrane vesicle lining. Similar sequences have been found in various organisms such as Arabidopsis thaliana, Drosophil amelanogaster and Saccharomyces cerevisiae. Related sequences are found in various organisms such as Leptinotarsa decemlinea ta, Phaedon cochleariae, Epilachna varivestis, Anthonomus granáis, Tribolium castaneum, Myzus persicae, Nilaparvata lugens, Chilo suppressalis, Plutella xylostella and Acheta domesticus. Other target genes for use in the present invention can include, for example, those that play important roles in viabildiad, growth, development, reproduction and infectivity. These target genes include, for example, housekeeping genes, transcription factors and pest-specific genes or lethal killing mutations in Caenorhabditis or Drosophila. The target genes for use in the present invention may also be those that are from other organisms, e.g., insects and arachnids (e.g., Leptinotarsa spp., Phaedon spp., Epilachna spp., An thonomus spp., Tribolium spp., Myzus spp., Nilaparva ta spp., Chilo spp., Plutella spp., Or Acheta spp.). Preferred white genes include those specific in Table IA and orthologous genes from other target organisms, such as from other pest organisms. In the methods of the present invention, dsRNA is used to inhibit growth or interfere with the pathogenicity or infectivity of the insect. The invention therefore relates to isolated double-stranded RNA comprising tuned complementary strands, one of which has a nucleotide sequence that is complementary to at least part of a target nucleotide sequence of a target gene of an insect. The target gene can be any white gene described herein or a part thereof that exerts the same function. In accordance with one embodiment of the present invention, an isolated double-stranded RNA is provided comprising tuned complementary strands, one of which has a nucleotide sequence that is complementary to at least part of a nucleotide sequence of a target gene. insects, wherein the target gene comprises a sequence that is selected from the group comprising: (i) sequences that are at least 75% identical to a sequence represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158 , 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472 , 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040 , 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109 , 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672 , 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085 , 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof, and (ii) sequences comprising at least 17 contiguous nucleotides of any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 , 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259 , 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 a 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement of the same, or wherein the insect target gene is an insect ortholog of a gene comprising at least 17 nucleotides with tiguous of any of SEQ ID Nos 49 to 158, 275 to 472, 533 to 575, 621 to 767, 813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to 2338, 2384 to 2460, or the complement of the same. Determining from the analysis used to measure gene silencing, the inhibition of growth can be quantified by being greater than about 5%, 10% or more preferably about 20%, 25%, 33%, 50%, 60%, 75%, 80%, more preferably of about 90%, 95% or approximately 99% compared to a pest organism that has been treated with control dsRNA. According to another embodiment of the present invention, an isolated double-stranded RNA is provided, wherein at least one of said complementary tempered strands comprises RNA equivalent of at least one nucleotide sequence represented by at least any of SEQ ID NO. NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 165 2, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 a 2460, 2461, 2466, 2471, 2476 or 2481, or where at least one of the temperate complementary strands comprises the equivalent RNA of a fragment of at least 17 base pairs in length thereof, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23 or 24 base pairs in length of the same. If the method of the invention is used to specifically control the growth or infestation of a specific insect in or on a host cell or host organism it is preferred that the double-stranded RNA does not share any important homology with the host gene, or at least without something essential from the guest. In this context, it is preferred that the double-stranded RNA shows less than 30%, more preferably less than 20%, more preferably less than 10%, and even more preferably less than 5% nucleic acid sequence identity with any gene of the host cell,% sequence identity should be calculated across the full length of the double-stranded RNA region. If the genomic sequence data is available to the host organism, there may be cross-over sequence identity with the double-stranded RNA using standard bioinformatics tools. In one embodiment, there is no sequence identity between dsRNA and a host sequence in 21 contiguous nucleotides, which means that in this context it is preferred that 21 contiguous base pairs of dsRNA do not occur in the genome of the host organism. In other embodiment, at least there is approximately 10% or less than sequence identity of approximately 12.5% in 24 contiguous nucleotides of dsRNA with any nucleotide sequence of a host species. The double-stranded RNA comprises complementary temperate strands, one of which has a nucleotide sequence corresponding to a target nucleotide sequence of the target gene that will be down-regulated. The other strand of double-stranded RNA can be a pair of bases with the first strand. The term "white region" or "target nucleotide sequence" of the target insect gene may be any suitable region or nucleotide sequence of the gene. The target region should comprise at least 17, at least 18 at least 19 consecutive nucleotides of the target gene, more preferably at least 20 or at least 21 nucleotides and even more preferably at least 22, 23 or 24 nucleotides of the white gene. It is preferred that (at least part of) the double-stranded RNA will share 100% sequence identity with the target region of the target gene and insects. However, it will be appreciated that sequence identity of 100% over the entire length of the double-stranded region is not essential for inhibition of functional RNA. RNA sequences with insertions, deletions, and single point mutations in Relation to the target sequence have also been found to be effective for RNA inhibition. The terms "corresponding to" or "complementary to" are used interchangeably herein, and when the terms are used to refer to the sequence correspondence between the double-stranded RNA and the target region of the target gene, they will be interpreted accordingly, that is, it does not require absolutely 100% sequence identity. However, the% sequence identity between the double-stranded RNA and the target region will generally be at least 80% to 85% identical, preferably at least 90%, 95%, 96%, or more preferably at least 97%, 98% and even more preferably at least 99%. Two strands of nucleic acid are "substantially complementary" when they are at least 85% of their base pairs. The term "complementary" as used herein refers to DNA-DNA complementarity as DNA-RNA complementarity. In analogy with it, the term "RNA equivalent" means substantially that in the DNA sequence, the base "T" can be replaced by the base "U" normally present in ribonucleic acids. Although the dsRNA contains a sequence corresponding to the target region of the target gene, it is not absolutely essential for the entire dsRNA that corresponds to the sequence of the target region. For example, dsARN can contain non-short target regions that look towards the specific target sequence as long as such sequences do not affect the performance of dsRNA in RNA inhibition to a material grade. The dsRNA may contain one or more substitute bases in order to optimize performance in RNAi. It will be apparent to the expert how each of the dsRNA bases varies in turn and the resulting dsRNA activity test (e.g., in an appropriate in vitro test system) in order to optimize the performance of a dsRNA. dice. The dsRNA may also contain DNA bases, unnatural bases or unnatural base structure ligations or modifications of the structure of the sugar phosphate base, for example, to increase storage stability or increase resistance to degradation by nucleases. It has been previously reported that the formation of short interfering RNA (siRNA) of approximately 21 bp is convenient for effective gene silencing. However, Applicant applications have shown that the minimum length of dsRNA is preferably at least about 80-100 bp in order to efficiently absorb certain pest organisms. There are indications that in invertebrates such as free-living nematodes C. elegans or the parasitic nematode Meloidogyne incognita plants, these fragments longer are more effective in silencing genes, possibly due to a more efficient absorption of these long dsRNA by the invertebrate. It was also recently suggested that synthetic RNA duplexes consisting of blunt RNA or short RNA (sh) of 27 mer with 29 bp stems and 3 'pendants of 2 nt are more potent inducers of RNA interference than 21 mer siRNA. conventional Therefore, the molecules based on the targets identified above and being RNA from blunt or short forceps of 27 mer (sh) with stems of 29 bp and pendants 3 'of 2 nt are also included within the scope of the invention. Therefore, in one embodiment, the double-stranded RNA fragment (or region) itself will preferably be at least 17 bp in length, preferably 18 or 19 bp in length, more preferably at least 20 bp in length , more preferably of at least 21 bp, at least 22 bp, or at least 23 bp, or at least 24 bp, 25 bp, 26 bp or at least 27 bp in length. The terms "double-stranded RNA fragment" or "double-stranded RNA region" refer to a small entity of the double-stranded RNA corresponding to the target gene (or part thereof). Generally, double-stranded RNA is preferably between 17-1500 bp, even more preferably between about 80-1000 bp and even more preferably between about 17-27 bp or between about 80-250 bp; such as double-stranded RNA regions of approximately 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 27 bp, 50 bp, 80 bp, 100 bp, 150 bp, 200 bp, 250 bp, 30 bp, 2350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 900 bp, 100 bp, 1100 bp, 1200 bp, 1300 bp , 1400 bp 0 1500 bp. The upper limit on the length of the double-stranded RNA may be dependent on i) the requirement of the dsRNA that will be absorbed by the insect and ii) the requirement of dsRNA that will be processed within the cell in fragments that direct RNAi. The length chosen can also be influenced by the method of RNA synthesis and the mode of RNA delivery to the cell. Preferably the double-stranded RNA will be used in the methods of the invention will be less than 10,000 bp in length, more preferably 1000 bp or less, more preferably 500 bp or less, more preferably 300 bp or less, more preferably 100 bp or less. For any given target and insect gene, the optimal length of dsRNA for effective inhibition can be determined by the experiment. The double-stranded RNA can be completely or partially double-stranded. The double-stranded RNAs can partially include short single-stranded pendants at one or both ends of the double-stranded portion, as long as the RNA can still be absorbed by insects and directing RNAi. The double-stranded RNA may also contain internal complementary regions. The methods of the invention encompass the simultaneous or sequential provision of two or more RNA or double-stranded RNA constructs different from the same insect, so as to achieve the down-regulation or inhibition of multiple target genes or to achieve a more potent inhibition of a only white gene. Alternatively, multiple targets are struck by the provision of a double-stranded RNA that hits the multiple target sequences and a single target is more efficiently inhibited by the presence of more than one copy of the double-stranded RNA fragment corresponding to the target gene. . Therefore, in one embodiment of the invention, the double-stranded RNA construct comprises multiple regions of dsRNA, at least one strand of each dsRNA region comprising a nucleotide sequence that is complementary to at least part of a White nucleotide sequence of an insect white gene. According to the invention, the dsRNA regions in the RNA construct may be complementary to the same or different target genes and / or the dsRNA regions may be complementary to targets of the same or different insect species.

The terms "stroke" and "striking" are alternative words to indicate that at least one of the dsRNA strands is complementary to, and as such may bind to, the target gene or nucleotide sequence. In one embodiment, the double-stranded RNA region comprises multiple copies of the nucleotide sequence that is complementary to the target gene. Alternatively, the dsRNA hits more than one target sequence of the same target gene. The invention therefore encompasses isolated double-stranded RNA constructs comprising at least two copies of said nucleotide sequence complementary to at least part of a nucleotide sequence of an insect target. The term "multiple" in the context of the present invention means at least two, at least three, at least four, at least five, at least six, etc. The expressions "an additional white gene" or "at least one other white gene" means for example a second, third or fourth target gene, etc. dsRNA that hits more than one of the targets mentioned above, or a combination of dsRNAs other than the aforementioned targets are developed and used in the methods of the present invention. Accordingly, the present invention relates to an isolated double-stranded RNA construct comprising at least two copies of RNA equivalent to one of the nucleotide sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 a 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 a 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 a 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or at least two copies of the equivalent RNA of a fragment of at least 17 base pairs, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23, or 24 base pairs in length thereof. Preferably, said double-stranded RNA comprises the RNA equivalent of the nucleotide sequence as represented in SEQ ID NO 159 or 160, or a fragment of at least 17, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23, or 24 base pairs in length of the same. In a further embodiment, the invention relates to a double-stranded RNA construct comprising at least two copies of the RNA equivalent of the nucleotide sequence as represented by SEQ ID NO 159 or 160. Accordingly, the foregoing invention extends to methods as described herein, wherein the dsRNA comprises tuned complementary strands, one of which has a nucleotide sequence which is complementary to at least part of a target nucleotide sequence of an insect target gene, and which comprises the RNA equivalents of at least two nucleotide sequences independently chosen from each other. In one embodiment, the dsRNA comprises the RNA equivalents of at least two, preferably at least three, four or five, independently chosen nucleotide sequences of the sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or fragments thereof of at least 17 base pairs in length, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23 or 24 base pairs in length thereof. At least two nucleotide sequences may be derived from the white genes described herein. According to a preferred embodiment, dsRNA hits a target gene that is essential for the viability, growth, development or reproduction of the insect and hits at least one gene involved in pathogenicity or infectivity as described above. Alternatively, the dsRNA hits multiple genes in the same category, for example, the dsRNA hits at least 2 essential genes or at least 2 genes involved in the same cellular function. According to a further embodiment, the dsRNA hits at least 2 target genes, said target genes are involved in a different cellular function. For example, dsRNA hits two or more genes involved in protein synthesis (e.g., ribosome subunits), intracellular protein transport, separation of nuclear mRNA, or involved in one of the functions described in Table IA. Preferably, the present invention extends to the methods described herein, wherein said insect target gene comprises a sequence that is selected from the group consisting of: (i) sequences that are at least 75% identical to a sequence depicted by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188 , 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513 , 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795 , 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075 , 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587 , 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof, and (ii) sequences comprising at least 17 contiguous nucleotides of any of SEQ ID NO: 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208 , 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521 , 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 88.3, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 108 1, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof, or wherein said insect target gene is an orthologous insect of a gene comprising at least 17 nucleotides contiguous of any of SEQ ID NO: 49 to 158, 275 to 472, 533 to 575, 621 to 767, 813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to 2338, 2380 to 2460, or the complement of the same. The regions of dsRNA (or fragments) in a double-stranded RNA can be combined in the following manner: a) when the multiple dsRNA regions that target a single target gene are combined, they can be combined in the original order (ie, the order in which the regions are in the target gene) in the RNA construct, b) alternatively, the original order of the fragments can be ignored so that they are shuffled and combined altematively or deliberately in any order in the RNA construct of double strand, c) alternatively, a single fragment can be repeated several times, for example, from 1 to 10 times, eg, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times, in the construction of dsRNA, or d) the dsRNA regions (which target a single target or different gene) can be combined in the orientation of meaning or contradiction.

In addition, the target gene to be combined can be chosen from one or more of the following gene categories: e) "essential" genes or "pathogenicity genes" as described above encompass genes that are vital to one or more white insects and give as a result a lethal or severe phenotype (e.g., feeding, reproduction, growth), when they were silenced. The choice of a strong lethal white gene results in a potent RNAi effect. In the RNA constructs of the invention, multiple regions of dsRNA that target the same or different (very effective) lethal genes can be combined to further increase the potency, efficacy or speed of the RNAi effect in insect control. f) "weak" genes encompass target genes with a particularly interesting function in one of the cell routes described herein, but result in a phenotypic effect when silenced independently. In the RNA constructs of the invention, multiple regions of dsRNA that target a single or different weak gene can be combined to obtain a stronger RNAi effect. g) "insect-specific" genes encompass genes that have no substantial homologous counterpart in non-insect organisms as can be determined by bioinformatics homology searches, for example by BLAST searches.

The choice of a specific target gene for insects results in a specific RNAi effect for species with no effect or no substantial (adverse) effect on non-target organisms. h) "conserved genes" encompass genes that are conserved (at the amino acid level) between the target organism and non-target organisms. To reduce possible effects on the species that is not white, said effective but conserved genes are analyzed sequences and targets of the variable regions of these conserved genes are chosen to be targeted by the dsRNA regions in the RNA construct. In the present, it is evaluated. Conservation at the level of the nucleic acid sequence. Said variable regions therefore cover the less conserved sections, at the level of the nucleic acid sequence, of the conserved white genes. i) "conserved route" genes encompass genes that are involved in the same biological pathway or cellular process, or encompass genes that have the same functionality in different insect species that result in a powerful RNAi effect and more efficient insect control; j) alternatively, the RNA constructs according to the present invention are directed to multiple genes of different biological pathways, which result a broad cellular APNi effect and more efficient insect control. According to the invention, all regions of double-stranded RNA comprise at least one strand that is complementary to at least part or a portion of the nucleotide sequence of any white gene described herein. However, the provision of one of the double-stranded RNA regions comprises at least one strand that is complementary to a portion of the nucleotide sequence of any of the target genes described herein, the other double-stranded RNA region. The strand may comprise at least one strand that is complementary to a portion of any target insect gene (including known white genes). According to yet another embodiment of the present invention, an RNA or double stranded RNA construct is provided as described herein, further comprising at least one additional sequence and optionally an interleaver. In one embodiment, the additional sequence is selected from the group comprising (i) a sequence that facilitates the large-scale production of the dsRNA construct, (ii) a sequence that effects an increase or decrease in the stability of the dsRNA; (iii) a sequence that allows the binding of its other molecules to facilitate the absorption of RNA by insects; (iv) a sequence which is an aptamer that binds to a receptor or a molecule on the surface or in the cytoplasm of an insect to facilitate absorption, endocytosis and / or trancytosis by the insect; or (v) additional sequences to catalyze the process of dsRNA regions. In one embodiment, the interleaver is a conditional self-separating RNA sequence, preferably a pH sensitive interleaver or a hydrophobic sensitive interleaver. In one mode, in interleaver is an intron. In one embodiment, the multiple dsRNA regions of the double stranded RNA construct are connected by one or more interleavers. In another embodiment, the interleaver is present at a site in the RNA construct, separating the dsRNA regions from another region of interest. Different types of interleavers for dsRNA constructions are provided by the present invention. In another embodiment, the multiple dsRNA regions of the double stranded RNA construct are connected without interleavers. In a particular embodiment of the invention, the interleavers can be used to disconnect regions of smaller dsRNAs in the pest organism. Advantageously, in this situation the entanglement sequence may promote the division of a long dsRNA in regions of smaller dsRNAs under particular circumstances which give result in the release of separated dsRNA regions under these circumstances and leading to more efficient gene silencing by these smaller dsRNA regions. Examples of conditionally suitable automatic separation interleavers are RNA sequences that are automatically separated in higher pH concisions. Suitable examples of such RNA sequences are described by Borda et al. (Nucleic Acids Res. 2003 May 15, 2003; 31 (10): 2595-600), the document of which is incorporated herein by reference. This sequence originates from the catalytic core of ribozyme HH16 in the form of a hammerhead. In another aspect of the invention, an interleaver is located at a site in the RNA construct, separating the dsRNA regions from another, e.g., the additional sequence of interest, which preferably provides some additional function to the RNA construct. -. In a particular embodiment of the invention, the dsRNA constructs of the present invention are provided with an aptamer to facilitate absorption of the dsRNA by the insect. The aptamer is designed to attach a substance that is absorbed by the insect. Said substances can be of an origin of insects or plants. A specific example of an aptamer is an aptamer that binds to a transmembrane protein, for example, a transmembrane protein of an insect. Alternatively, the aptamer can bind to a metabolite (plant) or nutrient that is absorbed by the insect. Alternatively, the interleavers are automatically separated in the endosomes. This can be advantageous when the constructions of the present invention are absorbed by the insect via endocytosis or transcytosis, and are therefore shared in the endosomes of the insect species. Endosomes can have a low pH environment, leading to interlayer separation. The aforementioned crosslinkers that separate automatically under hydrophobic conditions are particularly useful in dsRNA constructions of the present invention when they are used to transfer from one cell to another via transit in a cell wall, for example when they cross the cell wall of a cell. insect plague organism. An intron can also be used as an interleaver. An "intron" as used herein may be an RNA sequence without encoding a messenger RNA. Particular suitable introns sequences for the constructions of the present invention are (1) U-rich (325-435%); (2) have an average length of 100 bp (varying between about 50 and about 500 bp) whose base pairs can be chosen randomly or can be based on known introns sequences; (3) start at the 5 'end with -AG: GT- or -CG: GR- and / or (4) have at their 3' end -AG: GC- or -AG: AA-. A non-complementary RNA sequence, which varies from about 1 base pair to about 10,000 base pairs, can also be used as an interlayer. Without wishing to be bound by any particular theory or mechanism, it is thought that double-stranded RNAs are absorbed by the insect from its immediate environment. The double-stranded RNA absorbed in the intestine and transferred to the epithelial cells of the intestine will be processed inside the cell in short double-stranded RNA, called small interfering RNA (siRNA), by the action of an endogenous endonuclease. The resulting siRNA then RNAi measured via the formation of a multi-component RNase complex called RISC or RNA interference silencing complex. In order to achieve down-regulation of a target gene within an insect cell the double-stranded RNA added to the outside of the cell wall can be any dsRNA or dsRNA construct that can be absorbed in the cell and then processed into the cell. cell in siRNA, which then the RNAi mediated, or the RNA added to the outside of the cell itself can be a siRNA that can be absorbed in the cell and thus direct RNAi.

The siRNAs are usually short double-stranded RNAs that have a length on the scale of 19 to 25 base pairs, or 20 to 24 base pairs. In the preferred embodiments, siRNA having 19, 20, 21, 22, 23, 24 or 25 base pairs and in particular 21 or 22 base pairs, corresponding to the target gene can be used to down-regulate. However, it is not intended that the invention be limited to the use of said siRNAs. SiRNAs may include double-stranded pendants at one or both ends, which face the double-stranded portion. In a particularly preferred embodiment, the siRNA may contain 3 'pendant nucleotides, preferably two 3' pendant thymidites (dTdT) or uridines (UU). Tt or UU 3 'pendants can be included in siRNA if the sequence of the target gene immediately upstream of the sequence included in the double-stranded part of dsRNA is AA. This allows the TT pendant or UU in siRNA to hybridize to the target gene. Although a Tt or UU 3 'pendant may also be included at the other end of siRNA, it is not essential for the white sequence running below the sequence included in the double stranded part of siRNA to have AA. In this context, siRNAs that are RNA / DNA chimeras are also contemplated. These chimeras include, for example, siRNA comprising a double-stranded RNA with 3 'DNA base pendants (e.g., dTdT), as discussed above, and also Double-stranded RNAs which are polynucleotides in which one or more of the RNA bases or ribonucleotides, or even all ribonucleotides in a whole strand, are replaced with DNA bases or deoxynucleotides. The dsRNA can be formed of two separate strands of RNA (dsnetido and contrasentido) that are quenched together by base pairs (non-covalent). Alternatively, dsRNA may have a stem-booster cycle or pincer structure, wherein two hardened strands of dsRNA are covalently linked. In this embodiment, sense and contradictory dsRNA are formed from different regions of a single polynucleotide molecule that is partially complementary automatically. RNAs having this structure are convenient in dsRNA to be synthesized by expression in vivo, for example, in a host cell or organism as discussed below, or by in vitro transcription. The precise nature and sequence of the "loop" that binds the two RNA strands is generally not material of the invention, except that it should not impair the ability of the double-stranded part of the molecule to mediate RNAi. Aspects of RNA "clamp" or "stem loop" for use in RNAi are generally known in the art (see for example WO 99/53050, in the name of CSIRO, the content of which is incorporated herein by reference). In other embodiments of the invention, the loop structure may comprise sequences of interlacing or additional sequences as described above. The double-stranded RNA or construct can be prepared in a manner known per se. For example, double-stranded RNAs can be synthesized in vitro using chemical or enzymatic RNA synthesis techniques well known in the art. In one approach the two separate RNA strands can be synthesized separately and then annealed to form double strands. In a further embodiment, double-stranded RNAs or constructs can be synthesized by intracellular expression in a host cell or organism of a suitable expression vector. This approach is discussed in more detail later. The amount of double-stranded RNA with which the insect is contacted in such a way that specific down-regulation of one or more genes is achieved. The RNA can be introduced in an amount that allows the supply of at least one copy per cell. However, higher doses of certain modalities (eg, at least 5, 10, 100, 500, or 1000 copies per cells) of double-stranded RNA may give more effective inhibition. For any given insect gene target, the optimal amount of dsRNA for effective inhibition can be determined by routine experimentation.

The insect can be contacted with the double-stranded RNA in any suitable form, allowing direct absorption of the double-stranded RNA by the insect. For example, the insect can be contacted with the double-stranded RNA in pure or substantially pure form, for example, an aqueous solution containing the dsRNA. In this embodiment, the insect can simply be "soaked" with an aqueous solution comprising the double-stranded RNA. In a further embodiment the insect can be contacted with the double-stranded RNA by spraying the insect with a liquid composition comprising the double-stranded RNA. Alternatively, the double-stranded RNA can be ligated to a feeding component of the insects, such that a food component for a mammalian pathogenic insect, in order to increase the absorption of the dsRNA by the insect. The double-stranded RNA can also be incorporated into the medium in which the insect develops or on or on a material or substrate that is infested by the insect and impregnated in a substrate or material susceptible to insect infestation. According to another embodiment, the dsRNA is expressed in a bacterial or fungal cell and the bacterial or fungal cell is absorbed or eaten by the insect species.

As illustrated in the examples, bacteria can be treated to produce either dsRNA or dsRNA constructs of the invention. These bacteria can be eaten by the insect species. When absorbed, the dsRNA can initiate an RNAi response, leading to degradation of the white mRNA and weakening or killing the feeding insect. Therefore, in a more specific embodiment, said RNA or double-stranded RNA construct is expressed by a host cell or host organism, bacterial or eucatrotic, such as a yeast. According to this embodiment, any bacterial or yeast cell capable of expressing dsRNA or dsRNA constructs can be used. The bacterium is selected from the group comprising gram negative and gram positive bacteria, such as, but not limited to, Escherichia spp. (e.g., E. coli), Bacillus spp. (e.g., B. thuringinesis), Rhizobium spp., Lactobacillus spp., Lactococcus spp., etc., Yeast can be chosen from the group comprising Saccharomyces spp., etc. Some bacteria have a very close interaction with the host plant, such as, but not limited to, symbiotic Rhizobium with the Leguminosea (for example Soya). Said recombinant bacteria can be mixed with the seeds (for example as a coating) and used as soil improvers.

Accordingly, the present invention also encompasses a cell comprising any of the nucleotide sequences or recombinant DNA constructs described herein. The invention further encompasses prokaryotic cells (such as, but not limited to, yeast cells or plant cells). Preferably said cell is a bacterial cell or a yeast cell and / or an ALCA cell. In other embodiments, the insect may be contacted with a corao composition, further described herein. The composition, in addition to the dsRNA or DNA contain additional excipients, diluents or vehicles. Preferred aspects of said compositions are described in greater detail below. Alternatively, the bacteria or yeast cells that produce dsRNA can be sprayed directly on the cultures. Therefore, as described above, the invention provides a host cell comprising an RNA construct and / or a DNA construct and / or an expression construct of the invention. Preferably, the host cell is a bacterial and yeast cell, but for example, it can be a virus. A virus such as baculovirus, which specifically infects insects, can be used. This ensures the safety of mammals, especially humans humans, since the virus will not infect the mammal, so that no unwanted RNAi effect will occur. The bacterial cell or yeast cell should preferably be inactivated before being used as a biological pesticide, for example when the agent is to be used in an environment where contact with humans or other mammals is likely (such as a kitchen). Inactivation can be achieved by any means, such as by heat treatment, treatment with phenol or formaldehyde for example, or by mechanical treatment. In a still alternative embodiment, an inactivated virus, such as a suitably modified baculovirus can be used for the purpose of supplying the dsRNA regions of the invention to mediate RNAi to the insect pest. Possible applications include intensive greenhouse crops, for example, crops that are less interesting from a GMO point of view, as well as broader field crops such as soybeans. This approach has several advantages, eg, since the problem of possible cutting by a plant host is not present, it allows the delivery of large fragments of dsRNA in the lumen of the intestine of the feeding pest.; the use of bacteria as insecticides does not imply the generation of transgenic crops, especially for certain crops where it is difficult to obtain transgenic variants; there is a broad and flexible application in which different crops can be treated simultaneously in the same field and / or can be directed simultaneously to different pests, for example by combining different bacteria that produce different dsRNAs. Another aspect of the present invention are target nucleotide sequences of the insect target genes described herein. Said white nucleotide sequences are particularly important for designating the dsRNA constructs according to the present invention. Said white nucleotide sequences are preferably at least 17, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23, or 24 nucleotides in length. Non-limiting examples of preferred white nucleotide sequences are given in the examples. According to one embodiment, the present invention provides an isolated nucleotide sequence that encodes a double-stranded RNA or double-stranded RNA construct as described herein. According to a more specific embodiment, the present invention relates to an isolated nucleic acid sequence consisting of a sequence represented by any of SEQ ID NO 49 to 158, 275 to 472, 533 to 575, 621 to 767, 8 3 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to 2338, 2384 to 2460, or a fragment of at least 17 preferably at least 18, 19, 20 or 21, more preferably at least 22, 23 or 24 nucleotides thereof. One of ordinary skill in the art will recognize that homologs of these target genes may find that these homologs are also useful in the methods of the present invention. The protein, or nucleotide sequences are probably homologous if they show an "important" level of sequence similarity or more preferably sequence identity. The truly homologous sequences are related by divergence of a common ancestral gene. The sequence homologs can be of two types: (i) where zoologists in different species are known as orthologs, eg, the genes -globin in mice and in humans are orthologs; (i) Paralogs are homologous genes within a single species, eg, the α- and β-globin genes in mice are paralogs. Preferred homologs are genes comprising a sequence which is at least about 85% or 87.5% even more preferably about 90%, still more preferably at least about 95% and still more preferably at least about 99% identical to one selected sequence of groups of sequences represented by SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188 , 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513 , 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795 , 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075 , 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587 , 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694 , 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 235 4, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof. Methods for determining sequence identity are routine in the field and include the use of Blast software and EMBOSS software (The European Molecular Biology Open Software Suite (2000), Rice, P. Longden, I. and Bleasby, A. Trends in Genetics 16, (6) pp. 276-277). The term "identity" as used herein refers to the relationship between sequences at the level of nucleotide The term "identical%" is determined by comparing optimally aligned sequences, e.g., two or more, over a comparison window wherein the portion of the sequence in the comparison window may comprise insertions or deletions compared to the reference sequence for optimal alignment of the sequences. The reference sequence does not include insertions or deletions. The reference window is chosen from at least 10 nucleotides contiguous to about 50, about 100 or about 150 nucleotides, preferably between about 50 to 150 nucleotides. "% identity" is then calculated by determining the number of nucleotides that are identical between the sequences in the window, dividing the number of identical nucleotides by the number of nucleotides in the window and multiplying by 100. Other homologs are genes that are alleles of a gene comprising a sequence as represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168 , 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488 , 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778 , 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056 , 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481. The most preferred homologs are genes that comprise at least minus a single nucleotide polymorphism (SNIP) compared to a gene comprising a sequence as represented by any of SEQ ID NO 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 4 83, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 a 2460, 2461, 2466, 2471, 2476 or 2481. According to another embodiment, the invention encompasses target genes that are insect orthologs of a gene comprising a nucleotide sequence as represented by any of SEQ ID NO: 1, 3 , 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215 , 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862 , 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061 , 1071, 107.3, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572 , 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688 , 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104 , 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481. By way of example, orthologs may comprise a nucleotide sequence as represented by any of SEQ ID NO: 49 to 123, 275 to 434, 533 to 562, 621 to 738, 813 to 852, 908 to 1010, 1161 to 1437, 1730 to 1987, 2120 to 2290, and 2384 to 2438, or a fragment of the same of at least 17, 18, 19, 20, 22, 23, 24, 25, 26 or 27 nucleotides. A non-limiting list of insect or arachnid orthologous genes or sequences comprising at least a 17 bp fragment of one of the sequences of the invention is given in Tables 4. According to another embodiment, the invention encompasses genes white that are orthologs of nematodes of a gene comprising a nucleotide sequence as represented by any of 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159 , 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473 , 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767 , 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041 , 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111 , 1113, 1161 to 1571, 15 72, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 248. By way of example, the nematode orthologs may comprise a nucleotide sequence as depicted in any of SEQ ID NO: 124 to 135, 435 to 446, 563 to 564, 739 to 751, 853, 854, 1011 to 1025, 1438 to 1473, 1988 to 2001, 2291 to 2298, 2439 or 2440, or a fragment of at least 17, 18, 19, 20 or 21 nucleotides thereof. According to another aspect, the invention therefore encompasses any of the methods described herein to control growth of nematodes in an organism, or to prevent the infestation of nematodes of an organism susceptible to infection of nematodes, comprising contacting cells of nematodes with a double-stranded RNA, wherein the double-stranded RNA comprises complementary, tempered strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of a target gene comprising a fragment of at least 17, 18, 19, 20, or 21 nucleotides of any of the sequences as depicted in SEC TD NO: 124 to 135, 435 to 446, 563 to 546, 739 at 751, 853, 854, 1011 to 1025, 1438 to 1473, 1988 to 2001, 2291 to 2298, 2439 or 2440, whereby the double-stranded RNA is absorbed by the nematode and therefore controls growth or prevents infestation. A non-limiting list of orthologous genes of nematodes or sequences comprising at least a 17 bp fragment of one of the sequences of the invention are given in Tables 5. According to another embodiment, the invention encompasses target genes that are Fungal orthologs of a gene comprising a nucleotide sequence as represented in any of 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163 , 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483 , 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773 , 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051 , 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 15 87, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481. By way of example, fungal orthologs may comprise a nucleotide sequence as depicted in any of SEQ ID NO: 136 to 158, 447 to 472, 565 to 575, 752 to 767, 855 to 862, 1026 to 1040, 1475 to 1571, 2002 to 2039, 2299 to 2338, 2441 to 2460, or a fragment of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 25 or 27 nucleotides thereof. According to another aspect, the invention therefore encompasses any of the methods described herein for controlling fungal growth in a cell or an infection, comprising contact with fungal cells with a double-stranded RNA, wherein the RNA of The double strand comprises complementary tempered strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of a target gene comprising a fragment of at least 17, 18, 19, 20, or 21 nucleotides of any of the sequences as depicted in SEQ ID NOs 136 to 158, 447 to 472, 565 to 575, 752 to 767, 855 to 862, 1026 to 1040, 1475 to 1571, 2002 to 2039, 2299 to 2338, 2441 to 2460, so the double-stranded RNA is absorbed by the fungus and therefore controls growth or prevents infestation. A non-limiting list of fungal orthologous genes or sequences that comprise at least a 17 bp fragment of one of the sequences of the invention is given in Tables 6. The term "regulatory sequence" should be taken in a broad context and refer to a nucleic acid capable of effecting the expression of the sequences at the which is linked operably. By the term mentioned above, promoters and nucleic acids or synthetic fusion molecules or derivatives thereof are included which activate or enhance the expression of a nucleic acid, such as the so-called or enhanced activators. The term "operably linked" as used herein refers to a functional ligation between the "promoter" sequence and the nucleic acid molecule of interest, so that the "promoter" sequence can initiate the transcription of the molecule of nucleic acids to produce the appropriate dsRNA. A preferred regulatory sequence is a promoter, which may be a constitutive or inducible promoter. Preferred promoters are inducible promoters to allow tight control of the expression of RNA molecules. Inducible promoters are preferred through the use of an appropriate chemical, such as IPTG. Alternatively, the transgene encoding the RNA molecule is placed under the control of a strong constitutive promoter. Preferably, any promoter that is used will direct the expression strong of RNA. The nature of the promoter used, in part, can be determined by the specific host cell used to produce RNA. In one embodiment, the regulatory sequence comprises a bacteriophage promoter such as T7, T3, SV40 or SP06 promoter, more preferably a T7 promoter. In still other embodiments of the present invention, other promoters useful for the expression of Pol I RNA polymerase, a Pol II RNA pol III. Other promoters derived from yeast or viral genes can also be used as appropriate. In an alternative embodiment, the regulatory sequence comprises a promoter selected from the well-known tac, trc and lac promoters. Suitable inducible promoters for use with bacterial hosts include β-lactamase promoter, phage promoters? of PL and CPR of E. coli and galactose promoter of E. coli, arabinose promoter and alkaline phosphatase promoter. Therefore, the present invention also encompasses a method for generating the RNA molecules or RNA constructs of the invention. This method comprises the steps of introducing (eg, by transformation, transfection or injection) a nucleic acid isolated a recombinant construct (DNA) of the invention into a host cell of the invention under conditions that allow the transcription of said nucleic acid or construction of recombinant DNA to produce RNA that acts to down-regulate a target gene of interest (when the host cell is ingested by the target organism or when a host cell or extract derived therefrom is absorbed by the target organism). Optionally, one or more transcription termination sequences or "terminators" can also be incorporated into the recombinant construction of the invention. The term "transcription termination sequence" encompasses a control sequence at the end of a transcriptional unit, which signals the 3 'process and polyadenylation of a primary transcript and transcription termination. The transcription termination sequence is useful to avoid reading through the transcript so that the RNA molecule is produced accurately in or by the host cell. In one embodiment, the terminator comprises a terminator T7, T3, SV40 or SP6, preferably a terminator T7. Other terminators derived from yeast or viral genes can also be used as appropriate. Additional regulatory elements, such as transcriptional or transnational enhancers, can be incorporated into the expression construct. The recombinant constructs of the invention may also include an origin of replication that is required for maintenance and / or replication at a specific cell site. An example is when an expression construct is required to stay in a cell bacterial as an episomal genetic element (e.g., plasmid or cosmid molecule) in a cell. Preferred origins of replication include, but are not limited to, fl-ori and colEl ori. The recombinant construct optionally may comprise a selectable marker gene. As used herein, the term "selectable marker gene" includes any gene, which confers a phenotype on a cell in which it is expressed to facilitate the identification and / or selection of cells, which are transfected or transformed, with a construction recombinant (expression) of the invention. Examples of suitable selectable markers include resistance gene against ampicillin (Ampr), tetracycline (Ter) gene, kanamycin (Kano), phosphinotricin, and chloramphenicol (CAT). Other suitable marker genes provide a metabolic characteristic, for example manA. Visual marker genes can also be used and include for example beta-glucuronidase (GUS), luciferase and green fluorescent protein (FGP). In still other embodiments of the present invention, other promoters useful for the expression of dsRNA are used and include, but are not limited to, promoters of a Poly RNA, a PoIII RNA, a PoIIII RNA, T7 RNA polymerase or RNA polymerase. of SP6. These promoters are normally used for the in vitro production of dsRNA, whose dsRNA then it is included in an anti-insecticidal agent, for example, in a liquid, spray or anti-insecticidal powder. Therefore, the present invention also encompasses a method for generating any RNA or double-stranded RNA constructs of the invention. This method comprises the steps of a. contacting an isolated nucleic acid or a recombinant DNA construct of the invention with cell-free components; or b. introducing (e.g., by transformation, transfection or injection) of an isolated nucleic acid or a recombinant DNA construct of the invention into a cell, under conditions that allow the transcription of said nucleic acid or recombinant DNA construct to produce the construction of dsRNA or RNA. Optionally, one or more transcription termination sequences can also be incorporated into the recombinant construct of the invention. The term "transcription termination sequence" encompasses a control sequence at the end of a transcriptional unit that signals the process of 31 and the polyadenylation of a primary transcript and transcription termination. Additional regulatory elements such as improved transcriptional or translational can be incorporated into the expression construction. The recombinant constructs of the invention may also include an origin of replication that is required for maintenance and / or replication in a specific cell type. An example is when an expression construct is required to stay in a bacterial cell as an episomal genetic element (e.g., plasmid or cosmid molecule) in a cell. The preferred origins of replication include, but are not limited to, fl-ori and colEl ori. The recombinant construct may optionally comprise a selectable marker gene. As used herein, the term "selectable marker gene" includes any gene, which confers a phenotype on a cell in which it is expressed to facilitate the identification and / or selection of cells, which are transfected or transformed, with a construction of expression of the invention. Examples of suitable selectable markers include resistance genes against ampicillin (Ampr), tetracycline genes (Ter), kanamycin (Kano), phosphinothricin, and chloramphenicol (CAT) Other suitable marker genes provide a metabolic characteristic, for example manA. Visual marker genes can also be used and include example beta-glucuronidase (GUS), luciferase and Green Fluorescent Protein (GFP). The present invention relates to methods for preventing the growth of insects in a plant or for preventing the infestation of insects of a plant. The plants that will be treated according to the methods of the invention include plants selected from the group comprising: alfalfa, apple, apricot, artichoke, asparagus, avocado, banana, barley, kidney beans, sugar cane, blackberry, blueberry, broccoli , zucchini, cabbage, cañola, carrot, tapioca, cauliflower, cereal, celery, cherry, citrus, ground nuts, tomatillo, kiwi fruit, lettuce, leek, lemon, lime, pine, corn, mango, melon, millet , mushrooms, walnuts, okra, onion, orange, ornamental plant or flower or tree, or papaya, parsley, pea, peach, peanut, pipe, pepper, persimmon, pineapple, banana, plum, pomegranate, potato, squash, purple cabbage, radish, rapeseed, raspberry, rice, rye, sorghum, soybean, soybean, spinach, strawberry, beet, sugarcane, sunflower, sweet potato, tangerine, tea, tobacco, tomato, wine, watermelon, wheat, yam, zucchini; preferably a potato, eggplant, tomato, pepper, tobacco, tomatillo, rice, corn or cotton plant, or a seed or pipe (e.g., alfalfa, apple, apricot, artichoke, asparagus, avocado, banana, barley, beans) , sugar cane, blackberry, blueberry, broccoli, zucchini, cabbage, cañola, carrot, tapioca, cauliflower, cereal, celery, cherry, citrus, ground nuts, tomatillo, kiwi fruit, lettuce, leek, lemon, lime, pine, corn, mango, melon, millet, mushrooms, walnuts, okra, onion, orange, ornamental plant or flower or tree, or papaya, parsley, pea, peach, peanut, pipe, pepper, persimmon, pineapple, banana, plum, pomegranate, potato, squash, purple cabbage, radish , rapeseed, raspberry, rice, rye, sorghum, soybean, soybean, spinach, strawberry, beet, sugar cane, sunflower, sweet potato, tangerine, tea, tobacco, tomato, wine, watermelon, wheat, yam, zucchini. The amount of white RNA that is absorbed, preferably by ingestion by the target organism is such that down-regulation of one or more genes is achieved. RNA can be expressed by the host cell in an amount that allows delivery of at least one copy per cell. However, in certain embodiments the higher doses (eg, at least 5, 10, 100, 500, or 1000 copies per cell of the target organism) of RNA can give more effective inhibition. For any given target gene and target organism, the optimal amount of RNA molecules targeted for effective inhibition can be determined by routine experimentation. The target organism can be contacted with the host cell that expresses the RNA molecule in any properly, to allow ingestion by the target organism. Preferably, the host cells expressing the dsRNA can be ligated to a food component of the target organisms in order to increase the absorption of the dsRNA by the target organism. Host cells expressing dsRNA may also be incorporated in the medium in which the target organism develops or in or on a material or substrate that is infested by a pest organism or impregnated in a substrate or material susceptible to infestation by an organism. of plague. In alternative embodiments, an appropriate extract derived from the host cells expressing the RNA molecule can be used in order to achieve down-regulation of a target gene in a target organism. Here, the extracts can be derived by any suitable means of lysis of the host cells expressing the RNA molecules. For example, techniques such as sound treatment, French press, freeze-thaw treatment and with lysosome (see Sambrook and Russell -Molecular Cloning: A laboratory manual - third edition and the references provided herein in Table 15-4) can used in order to prepare an extract of crude host cells (lysate). Additional purification of the extract can be carried out as appropriate as long as the ability of the extract to measure the regulation White descending white gene expression is not adversely affected. For example, affinity purification can be used. It may also be appropriate to add certain components to the extract, to avoid degradation of the RNA molecules. For example, RNase inhibitors can be added to extracts derived from host cells that express RNA. In one example, the target organism can be contacted with the host cell expressing the RNA in pure or substantially pure form, for example an aqueous solution containing the cell extract. In this embodiment, the target organism, especially pest organisms such as insects, can be simply "soaked" with an aqueous solution comprising the host cell extract. In a further embodiment the target organism can be contacted with the host cells expressing the RNA molecule by spraying the target organism with a liquid composition comprising the cell extract. If the method of the invention is used to specifically control the growth or infestation of a specific pest, it is preferred that the RNA expressed in the host cell does not share any significant homology with a gene or genes of an organism that is not a pest, in particularly the one that does not share any important homology with any essential gene of the organism that is not a pest. Therefore, the An organism that is not a pest is normally the organism susceptible to being infested by the pest and that is therefore protected from the pest according to the methods of the invention. Therefore, for example, the non-pest species may comprise a plant or a species of mammals. Preferably, the mammalian species is Homo sapiens. Species that are not white may also include animals other than humans that may be exposed to the organism or substrate protected from infestation. Examples include birds that can be fed in a protected plant and livestock and domestic animals such as cats, dogs, horses, cattle, chickens, pigs, sheep, etc. In this context, it is preferred that dsRNA display less than 30%, more preferably less than 20%, more preferably less than 10% and even more preferably less than 5% nucleic acid sequence identity with any organism gene susceptible or not White. The percentage of sequence identity should be calculated across the entire length of the target RNA region. If the genomic sequence data are available for the organism to be protected according to the invention or for any non-target organisms, there may be sequence identity cross-linked to the target RNA using normal bioinformatics tools. In one embodiment, there is no sequence identity between the RNA molecule and an organism gene without plague in 21 contiguous nucleotides, meaning that in this context, it is preferred that the 21 contiguous nucleotides of RNA do not occur in the genome of the non-pest organism. In another embodiment, there is less than about 10% or less than about 12.5% sequence identity in 254 contiguous nucleotides of the RNA with any nucleotide sequence of a non-pest species (susceptible). In particular, the orthologous genes of a non-pest species can be of particular note, since the essential genes of the pest organism can often be targeted in the methods of the invention. Therefore, in one embodiment, the RNA molecule has less than 12.5% sequence identity with the corresponding nucleotide sequence of an orthologous gene from a non-pest species. In a further embodiment, the invention relates to a composition for controlling the growth of insects and / or preventing or reducing insect infestation, comprising at least one double-stranded RNA, wherein the double-stranded RNA comprises complementary strands hardened, one of which has a nucleotide sequence that is complementary to at least part of a nucleotide sequence or at least one recombinant DNA construct as described herein. The invention also relates to a composition comprising at least minus a bacterial cell or yeast cell that expresses at least one double-stranded RNA or a double-stranded RNA construct as described herein, or that expresses at least one nucleotide sequence or a recombinant DNA construct as optionally described herein, the composition further comprises at least one suitable carrier, excipient or diluent. The target gene can be any white gene described herein. Preferably, the target gene of insects is essential for the viability, growth, development or reproduction of the insect. In another aspect the invention relates to a composition as described above, wherein the target gene of the insect comprises a sequence that is at least 75%, preferably at least 80%, 85%, 90%, more preferably at least less 95%, 98%, or 99% identical to a sequence selected from the group of sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 , 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259 , 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607 , 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896 , 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 204b, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement of the same, or wherein the insect target gene is an insect ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253 , 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement thereof. The present invention further relates to a composition comprising at least one double-stranded RNA, at least one double-stranded RNA construct, at least one nucleotide sequence, at least one recombinant DNA construct and / or at least one host cell (e.g., a bacterium or a yeast) expressing a dsRNA of the invention, or a virus encoding a dsRNA of the invention, optionally further comprising at least one carrier, excipient or diluent suitable. The composition can be in any physical form suitable for application to insects. The composition can have solid form (such as a powder, pellet or bait), liquid form (such as a spray) or gel form for example. According to a more preferred embodiment, the composition has a form suitable for ingestion by an insect. The composition may contain additional components that serve to stabilize the dsRNA and / or avoid the degradation of dsRNA during prolonged storage of the composition. The composition may also contain components that improve or promote the absorption of dsRNA by the insect. These may include, for example, chemical agents that generally promote the absorption of RNA in cells, e.g., lipofectamine, etc. The composition may also contain components that serve to preserve the viability of the host cells during prolonged storage. The composition may have any physical form suitable for application to insects, substrates, cells (e.g., plant cells), or to organisms infected by or susceptible to insect infection. In one embodiment, the composition can be provided in the form of a sprayer. Therefore, a human user can spray the insect or substrate directly with the composition. The present invention therefore relates to a sprayer comprising a composition comprising at least one bacterial cell or yeast cell expressing at least one double-stranded RNA or a double-stranded RNA construct as described in I presented; or which expresses at least one nucleotide sequence or a recombinant DNA construct as described herein. More specifically, the invention relates to a sprayer as defined above wherein the bacterial cell comprises at least one of the sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or a fragment thereof of at least 17 contiguous nucleotides. Preferably, the sprayer comprises at least one of the sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 a 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or a fragment thereof of at least 17 contiguous nucleotides. The invention also relates to a sprayer comprising at least one composition or comprising at least one host cell as described herein, and in addition at least one adjuvant and optionally at least one surfactant. The effectiveness of a pesticide may depend on the effectiveness of the sprayer application. Adjuvants can reduce or eliminate many application problems sprinkler associated with stability, solubility, incompatibility, suspension, foaming, flow, evaporation, volatilization, degradation, adhesion, penetration, surface tension and pesticide coverage. The adjuvants are designed to perform specific functions, including wetting, spraying, stickiness, reduced evaporation, reduced volatilization regulation, emulsification, dispersion, reduced sprinkler drip, and reduced foaming. No adjuvant can only perform these functions, but different compatible adjuvants can often be combined to simultaneously perform multiple functions. These chemicals, also called wetting agents and sprinklers, physically alter the surface tension of a sprinkler drop. For a pesticide to perform its function properly, a sprinkler drop may be able to wet the foliage and spray evenly on a leaf. Surfactants increase the area of pesticide coverage, thus increasing the exposure of the pest to the chemical. Surfactants are particularly important when a pesticide is applied to waxy or hairy sheets. Without proper wetting and spreading, dew drops often run off or do not adequately cover these surfaces. However, a lot of surfactant can cause excessive running or loss of deposit, thus reducing the effectiveness of pesticides. Pesticide formulations often contain surfactants to improve the suspension of the active ingredient of pesticides. This is especially true for formulations of emulsifiable concentrate (EC). As used herein, the term "adjuvant" means any non-pesticidal material added to a pesticide product or pesticide sprayer mixture to improve the mixing and stability of the products in the spray tank and the application. As further used herein, the term "surfactant" means a chemical that modifies surface tension. Surfactants can influence the wetting and spraying of liquids and can modify the dispersion, suspension or precipitation of a pesticide in water. There are surfactants are ionic (no electric charge), anionic surfactants (negative charge) and cationic surfactants (positive charge). In particular embodiments, host cells comprised in the sprayer are inactivated, for example, by heat inactivation or mechanical alteration (as discussed in more detail herein). The nature of the excipients and the physical form of the composition may vary dding on the nature or substrate to be treated. For example, the composition it can be a liquid that is brushed or sprayed onto or printed on the material or substrate that will be treated, or a coating or powder that is applied to the material or substrate that will be treated. Therefore, in one embodiment, the composition is in the form of a coating on a suitable surface that adheres to, and eventually is ingested by, an insect that comes into contact with the coating. According to a preferred embodiment, the sustr. It is an aplanta or crop that will be treated against the infestation of insect pests. The composition is then internalized or eaten by the insect from which RNA interference can mediate, thus controlling the insect. The sprayer is preferably a pressurized / aerosolized sprayer or a pump sprayer. The particles may be of suitable size so that they adhere to the substrate to be treated or to the insect, for example, to the exoskeleton, of the insect and / or arachnid and can be absorbed therefrom. In one embodiment, the composition has the shape of a bait. The bait is designed to attract the insect to come into contact with the composition. Upon contact with it, the composition is then internalized by the insect, by ingestion for example and mediates the RNAi to kill the insect. Said bait may comprise a food substance, such as a protein-based food, by example, fish food. Boric acid can also be used as a bait. The bait may depend on the species to which it is directed. A trader can also be used. The attractant can be a pheromone, such as a male or female pheromone for example. As an example, the pheromones referred to in the book "Insect Pheremones and their use in Pest Management" (Howse et al., Chapman and Hall, 1998) can be used in the invention. The attractant acts to bring the insect to the bait, and can target a particular insect or attract a full scale of insects. The tallow may have any suitable form such as a solid, paste, pellet or powder. Sebum can also be carried out by returning the insect to the colony. The bait can then act as a source of food for other members of the colony, thus providing effective control of a large number of insects and potentially a complete insect pest colony. This is an advantage associated with the use of double-stranded RNA or bacteria expressing the dsRNA of the invention, because the delayed action of RNAi-mediated effects on the pests allows the bait to be brought back to the colony, thus providing the maximum impact in terms of exposure to insects. Additionally, compositions that come in contact with insects may remain on the cuticle of the insect. When they are cleaned, either by cleaning individual insects or cleaning insects, the compositions can be ingested and therefore mediate their effects on the insect. This requires that the composition be sufficiently stable so that dsRNA or host cells expressing dsRNA remain intact and are capable of mediating RNAi even when exposed to external environmental conditions for a time, which, for example, may be a period of days. . The baits can be provided in a "lodging" or "trap" adequate. Such housings and traps are commercially available and existing traps can be adapted to include the compositions of the invention. Any housing or trap that may attract an insect to introduce it is included within the scope of the invention. Any housing or trap may be box-shaped for example, and may be provided in preformed condition or may be formed of folding cardboard, for example. Suitable materials for a housing or trap include plastics and coal, particularly corrugated cardboard. The dimensions suitable for said housing or trap, for example, are 7-15 cm wide, 15-20 cm long and 1.5 cm high. The internal surfaces of the traps can be lined with a sticky substance in order to restrict the movement of the insect once it is inside the trap. The housing or trap may contain a suitable interior passage portion which may contain the bait in place. A trap differs from a housing because the insect can not really get out of the trap after it has entered, while a shelter acts as a "feeding station" that provides the arachnid with a preferred environment in which to feed and feel security of predators. Accordingly, in a further aspect the invention provides an insect housing or trap containing a composition of the invention, which may incorporate any aspect of the composition described herein. It is contemplated that the "composition" of the invention may be provided as a "kit of parts" comprising the double-stranded RNA in a container and a diluent, excipient or vehicle suitable for the RNA-containing entity (such as a dsRNA or construction). of dsRNA, DNA construction, DNA expression construction) in a separate container; or comprising the host cells in a container and a suitable diluent, excipient, carrier or preservative for the host cell in a separate container. The invention also relates to the delivery of double-stranded RNA or host cells alone without any additional component. In the modalities the dsRNA or host cells they can be provided in a concentrated form, such as a concentrated aqueous solution. It can also be supplied in frozen form or in dried form by means of freezing or lyophilized form. The latter may be more stable for long-term storage and may be thawed and / or reconstituted with a suitable diluent immediately before use. The present invention further encompasses a method for controlling the growth of a pest organism and / or for preventing the infestation of a susceptible organism by the pest organism on a substrate comprising the application of an effective amount of any of the compositions and / or sprinklers as described in the foregoing to said substrate. The invention further encompasses a method for treating and / or preventing a disease or condition caused by a target organism, comprising administering to a subject in need of such treatment and / or prevention, a composition or a sprayer as described herein, in wherein up-regulation of the expression of the target gene in the target organism caused by the composition or sprayer is effective to treat and / or prevent the disease caused by the target organism. A white organism is a pest, in particular, an insect as described in more detail below.

The present invention further relates to the medical use of any of the double-stranded RNA, double-stranded RNA constructs, nucleotide sequences, recombinant DNA constructions or compositions herein. Insects and other arthropods can cause damage and even death from bites or stings. Most people die every year in the United States from bee and wasp stings than from snakebites. Many insects can transmit bacteria and other pathogens that cause diseases. During each war between countries, most people have been damaged or killed by diseases transmitted by insects that have been damaged or killed by bullets and bombs. The insects that bite men and domestic animals are mainly those with parts of the mouth to pierce-suck, as found in Heiptera and some Diptera. The greatest discomfort of a bite is a result of enzymes that pump the insect into the victim. Ticks and mites are different kinds of mites (Arachnid Class) that feed on the blood of animals. Ticks can also transmit viruses and other pathogens that cause diseases, including Lima disease and Rocky Mountain spotted fever. Other kinds of mites can cause scabies in humans, dogs, cats, and Other animals. Other Hemiptera include fern bugs, snout bugs, and Asian bugs, all of which have spikes to pierce their guests. The most painful bites among all insects are those of Asian bugs. Snout beetles cause Chagas disease in Central and South America. Caterpillars of some moths can "sting". Diptera are the most important order of insects that affect people. Flies that bite include many species of mosquitoes, black flies, biting mosquitoes, gadfly flies, and others. Many of these mordelonas flies are transmitters of diseases, such as the tse-tse fly that transmit African sleeping sickness. Flies with parts of spongy mouths, such as the housefly, also transmit bacteria and other pathogens that cause typhoid fever and other diseases. The worms screw and worms of flies are larvae of flies that invade the living tissue of animals. Mosquitoes transmit pathogens that cause malaria, yellow fever, encephalitis, and other diseases. Malaria is caused by a protozoan parasite that lives part of its life cycle in Anopheles mosquitoes and part of its cycle in humans. The plague, also known as bubonic plague or black death, is caused by bacteria that infect rats and other rodents. The main transmitter of this disease for humans is the mouse fly Eastern (Order Siphonaptera). Many bees, wasps, and ants (Order Hymenoptera) can cause color and even death from their bite. The deaths are usually a result of allergic reactions to the poison. Other main biting bugs include hornets, yellow wasps, and paper wasps. The bee producing Africanized honey, or bee "killer" is a strain of our bee producing domesticated honey. The two strains are almost identical in appearance. However, the Africanized strain is much more aggressive and will attack in larger numbers. In a specific embodiment, the composition is a pharmaceutical or veterinary composition for treating or preventing insect disease or infections of humans or animals, respectively. Said compositions will comprise at least one RNA or double-stranded RNA construct, or nucleotide sequence or recombinant DNA construct that encodes the RNA or double-stranded RNA construction, wherein the double-stranded RNA comprises hardened complementary strands, a of which it has a nucleotide sequence corresponding to a target nucleotide sequence of an insect target gene that causes disease or infection and at least one vehicle, excipient or diluent suitable for pharmaceutical use. The composition may be a composition suitable for topical use, such as application to the skin of a animal or human being, for example as a liquid composition that will be applied to the skin as drops, gel, spray, or by brushing, or a sprayer, ointment cream, etc. for topical application or as transdermal patches. Alternatively, the insect dsRNA is produced by bacteria (e.g., lactobacillus) or fungi (e.g., Sacharomyces spp.) Which can be included in food and which functions as an oral vaccine against insect infection. Other conventional pharmaceutical dosage forms can also be produced, including tablets, capsules, prescarlos, transdermal patches, suppositories, etc. The form chosen will depend on the nature of the target insect and therefore it is desired to treat the nature of the disease. In a specific embodiment, the composition can be a coating, paste or powder that can be applied to a substitute in order to protect said substrate from infection by insects and / or arachnids. In this embodiment, the composition can be used to protect any substrate or material that is susceptible to infection by, or damage caused by, the insect, for example, food products and other precede materials, and substrates such as wood. Houses and other wood products can be destroyed by termites, dust beetles, and carpenter ants. The subterranean termite and Formosan ends are the pests more serious domestic in the southern United States and tropical regions. Any harvested plant or animal product can be attacked by insects. Flour beetles, grain weevils, food moths and other pests of stored products will be fed grains, cereals, pet food, stored chocolate powder and almost everything in the pantry that is not protected. Clothes moth larvae eat clothing made from animal products, such as fur, silk and wool. Carpet beetle larvae eat animal and plant products, including leather, skin, cotton, stored grains and museum specimens. Book lice and silver fish are pests of bookstores. These insects eat the starchy glue in the joints of the books. Other insects that have invaded houses include cockroaches that eat almost everything. It is not known that cockroaches are specific transmitters of disease, but they contaminate food and have an unpleasant odor. They are very annoying and many pest control companies keep busy trying to control them. The most common cockroaches in homes, food stores, and restaurants include the German cockroach, the American cockroach, orient cockroach, and brown-banded cockroach. The nature of the excipients and the physical form of the composition may vary depending on the nature of the substrate that you want to treat. For example, the composition may be a liquid that is brushed or sprayed, or is implied in the material or substrate to be treated, or a coating that is applied to the material or substrate to be treated. The present invention further encompasses a method for treating and / or preventing insect infestation in a substrate comprising applying an effective amount of any of the compositions or sprays as described herein to said substrate. The invention further encompasses a method for treating and / or preventing an insect disease or condition, comprising administering to a subject in need of such treatment and / or prevention, any of the compositions or sprays as described herein comprising at least one double-stranded RNA or double-stranded RNA construct comprising tuned complementary strands, one of which has a nucleotide sequence that is complementary to at least part of a nucleotide sequence of an insect insect target gene that causes the disease or condition of the insect. According to a more specific embodiment, the composition or sprayer to be administered comprises and / or expresses at least one bacterial cell or yeast cell that expresses at least one double-stranded RNA or double-stranded RNA construct as described at the moment; or that comprises and / or expresses at least one nucleotide sequence or recombinant DNA construct as described herein, the RNA or nucleotide sequence being complementary to at least part of a nucleotide sequence of an insect insect target gene that causes the disease or condition of the insect. In another embodiment of the invention, compositions are used as an insecticide for a plant or for the propagation or reproductive material of a plant, such as in seeds. As an example, the composition can be used as an insecticide by spraying or applying it on plant tissue or by spraying or mixing it on the soil before or after emergence of the seedlings. In yet another embodiment, the present invention provides a method for treating and / or preventing the growth of insects and / or infestation of insects of a plant or propagation or reproductive material of a plant, comprising applying an effective amount of any of the compositions or sprinklers here described to a plant or to the propagation or reproductive material of a plant. In another embodiment the invention relates to the use of any double-stranded RNA or RNA construct or nucleotide sequence or recombinant DNA construct encoding the double-stranded RNA or RNA construct or at least one host cell (v. ., a bacterium or a yeast) expressing a dsRNA of the invention, or a virus encoding a dsRNA described herein, or any of the compositions or sprays comprising the same, used to control the growth of insects; to avoid infestation of plant insects susceptible to insect infection; or to treat the infection of plant insects. Specific plants that will be treated for insect infections caused by specific insect species are as described above and are covered by use. In a more specific embodiment, the invention relates to the use of a sprayer comprising at least one host cell or at least one host cell (e.g., a bacterium or a yeast) expressing dsRNA of the invention, or a virus encoding a dsRNA described herein, or any of the compositions comprising the same, to control the growth of insects, to prevent the infection of insects of plants susceptible to insect infection; or to treat plant insect infection. Preferably said host cells comprise at least one of the sequences represented by any of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 a 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or a fragment thereof of at least 17 contiguous nucleotides. In a further aspect, the invention also provides combinations of methods and compositions for preventing or protecting plants from infesting pests. For example, one means provides the use of a combination of the transgenic approach with methods that use double-stranded RNA molecules and compositions with one or more proteins of Bt insecticides or chemical (organic) compounds that are toxic to the white pest. Other means provide for the use of transgenic approach combination method using expression of double-stranded RNA molecules in bacteria or yeast and the expression of said insecticide proteins in the same or different bacteria or yeast. According to these approaches, for example, an insect can be targeted or killed using the RNAi-based method or technology while the other insect can be targeted or killed using the Bt insecticide or the chemical (organic) insecticide. Therefore, the invention also relates to any of the compositions, sprays or methods for treating plants described herein, wherein the composition comprises a cell or bacterium or yeast that expresses the RNA molecule and further comprises a pesticidal agent or comprises a bacterial cell or yeast cell comprising or expressing a pesticidal agent (the bacterial or yeast cell may be the same as or different from the first mentioned), said pesticidal agent selected from the group consisting of chemical insecticide (organic), a patatin, an insecticide protein from Bacillus thuringiensis, a Xenorhabdus insecticide protein, an insecticide protein Photorhabdus, an insecticidal protein Bacillus laterosporous, and an insecticidal protein Bacillus sphearicus. Preferably, the Bacillus thuringiensis insecticidal protein is selected from the group consisting of a Cryl, a Cry3, an TIC851, a Cry Etl70, a Cry22, a binary insecticidal protein CryET33 and CryET34, a binary insecticidal protein CryETdO and CryET76, a binary insecticidal protein TTC100 and TIC101, and a binary insecticidal protein PS149B1. The sprayer can be used in a greenhouse or in the field. Normal application regimes for biopesticity containing bacteria (e.g., as an emulsifiable suspension) amount to 15-100 liters / ha (10-40 liters / acre) for water-based sprinklers: comprising approximately 2.5-5 liter of formulated product (emulsifiable suspension) per hectare with the formulated product including approximately 25% (v / v) of 'bacterial cells' plus 75% (v / v)' other ingredients1. The number of bacterial cells is measured in units, e.g., one unit is defined as bacterial cells 109 in 1 ml. Depending on the crop density per hectare and the leaf surface per plant, one liter of formulated product comprises between 0.001 and 10000 units of bacteria, preferably at least 0.001, 0.003, 0.005, 0.007, 0.01, 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, 0.7 more preferably at least 1, 3, 5, 7, 10, 30, 50, 70, 100, 300, 500, 700, or more preferably at least 1000, 3000, 5000, 7000 or 10000 units of bacteria. For example, the normal plant density for potato crop plants is about 4.5 plants per square meter or 45,000 plants per hectare (they are planted in rows with row spacing at 75 cm and separation between plants within rows at 30 cm) . The present invention then relates to a sprayer comprising at least 0.001, 0.003, 0.005, 0.007, 0.01, 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, 0.7, more preferably at least 1, 3, 5, 7, 10 , 30, 50, 70, 100, 300, 500, 700, or more preferably at least 1000, 3000, 5000, 7000, or 10000 units of bacteria expressing at least one of the dsRNA molecules or dsRNA constructs described at the moment. The invention further relates to a kit comprising at least one double-stranded RNA, or double-stranded RNA construct, or nucleotide sequence, or recombinant DNA construct, or host cell, or composition or sprayer as described above to treat insect infection in plants. The equipment can be supplied with suitable instructions for use. The instructions can be printed in appropriate packaging in which other components are supplied or can be provided by a separate entity, which, for example, can be in the form of a sheet or brochure. The instructions can be rolled or folded, for example, when they are in a stored state and can be unwound and unfolded for the direct use of the remaining components of the equipment. The invention will also be understood with reference to the following non-limiting examples.

Brief Description of the Figures and Tables Figure 1-LD: The survival of L. decemlineta in artificial diet treated with dsRNA. The insects of the second stage of larvae were fed a diet treated with 50 μl of solution applied topically to dsRNA (targets or gfp control). The diet was replaced with a fresh diet containing dsRNA applied topically after 7 days. The number of surviving insects was evaluated on days 2, 5, 7, 8, 9, and 13. The percentage of surviving larvae was calculated in relation to day 0 (start of trial). LD006 White: (SEQ ID NO 178); LD007 White (SEQ ID NO 183); LD010 White (SEQ ID NO 188); LD011 White (SEQ ID NO 193); LD014 White (SEQ ID NO 198); gfp dsRNA (SEQ ID NO 235). Figure 2-LD: Survival of L. decemlineata in artificial diet treated with dsRNA. The insects of the second stage of larvae were fed a diet treated with 50 μl of solution applied topically to dsRNA (targets or gfp control). The diet was replaced with fresh diet only after 7 days. The number of surviving insects was evaluated on days 2, 5, 6, 7, 8, 9, 12, and 14. The percentage of survival larvae was calculated in relation to day 0 (start of test). LD001 White (SEQ ID NO 163); LD002 White (SEQ ID NO 168); LD003 White (SEQ ID NO 173); LD015 White (SEQ ID NO 215); LD016 White (SEQ ID NO 220); gfp dsRNA (SEQ ID NO 235).

Figure 3-LD: Average weight of L. decemlineta larvae on potato leaf discs treated with dsRNA. Larvae insects in the second stage were fed leaf discs treated with 20 μl of a solution applied topically (10 ng / μl) of dsRNA (Ld002 Blanco or gfp). After two days the insects were transferred to untreated levels every day. Figure 4-LD: Survival of L. decemlineata in artificial diet treated with shorter versions of dsRNA of white LD014 and dsARN concatamer. Larvae insects in the second stage were fed a diet treated with 50 μl of solution applied topically to dsRNA (gfp or whites). The number of surviving insects was evaluated on days 3, 4, 5, 6, and 7. The percentage of surviving larvae was calculated in relation to day 0 (start of analysis). Figure 5-LD: Survival of larvae of L. decemlineata in artificial diet treated with different concentrations of dsRNA of white LD002 (A), white LD007 (b), white LD010 (c), white LD011 (d), white LD014 (e) ), White LD015 (f), LD016 (g) and white LD027 (h). Larvae insects in the second stage were fed a diet treated with 50 μl of topically applied solution of dsRNA. The diet was replaced with a fresh diet containing dsRNA, typically applied after 7 days. The number of insects Survivors were evaluated at regular intervals. The percentage of surviving larvae was calculated in relation to day 0 (start of trial). Figure 6-LD: Effects of E. coli strains expressing dsAPN white LD010 on larval survival of Colorado potato beetle, Leptinotarsa decemlineata, over time. The two bacterial strains were tested in separate artificial diet based bioassays: (a) AB301-105 (DE3); the data points for pGBNJ003 and pGN29 represent average mortality values of 5 different bacterial clones, (b) BL21 (DE3), data points for pGBNJ003 and pGN29 represent average mortality values of 5 different and one single bacterial clone, respectively. The error bars represent normal deviations. Figure 7-LD: Effects of different clones of strains of E. coli (a) AB301-105 (DE3) and (b) BL21 (DE3) expressing white LD010 on larval survival of Colorado potato beetle, Leptinoarsa decemlineata, 12 days after the infestation. The data points are average mortality values for each clone for pGN29 and pGBNJ003. Clone 1 of AB301-105 (DE?) Harboring plasmid pGBNJ003 showed 100% mortality towards CPB at this time point. The error bars represent normal deviations. Figure 8-LD: Effects of different clones of strains of E. coli (a) AB301-05 (DES) and (b) BL21 (DE3) expressing LD010 target of dsRNA in growth and development of surviving larvae of Colorado potato beetle, Leptinotarsa deceml i neat, 7 days after infestation. The data points are weight% larval values for each clone (one clone for pGN29 and five clones for pGBNJ003) based on the data in Table 10. The diet only accounts for 100% by weight of the normal larvae. Figure 9-LD: The survival of larvae of Colorado potato beetle, Leptinotarsa decemlineata, in potato plants sprayed by double-stranded RNA producing bacteria 7 days after infestation. The number of surviving larvae was concentrated and expressed in terms of% mortality. The bacterial host strain used was the deficient strain of RNaselIT AB301-105 (DE3). The insect gene bank was LD010. Figure 10-LD: Growth / development delay of larvae survivors of the Colorado potato beetle, Leptinotarsa decemlineata, fed on potato plants sprayed with dsRNA-producing bacteria 11 days after infestation. The bacterial host strain used was the deficient strain of RNasalII Ab301-105 (DE3). The data figures represented as a percentage of normal larval weight; 100% of normal larvae weight given for diet only in treatment. The white insect gene was LD010. The error bars represent normal deviations.

Figure 11-LD: Resistance to potato damage caused by larvae of Colorado potato beetle, Leptiotarsa deceml neata, by double-stranded RNA producing bacteria 7 days after infestation. Left, the plant was sprayed with 7 units of bacteria AB301-105 (DE3) containing the plasmid GN29; Right, the plant was sprayed with 7 units of bacteria AB301-105 (DE3) containing the plasmid pGBNJ003. One unit was defined as the equivalent of 1 ml of a bacterial suspension at the OD value of 1 to 600 nm. The target of the insect gene was LD010. Figure 12-LD: Survival of adult L. decemlineata on potato leaf discs treated with dsRNA. The young adult insects were fed leaf discs treated with double-stranded RNA during the first two days and then placed in untreated potato foliage. The number of surviving insects was evaluated regularly; mobile insects registered as living insects and seemed to move normally; the dying insects registered as insects that were alive but seemed sick and slow moving, these insects could not stand on their own once placed on their backs. LD002 White (SEQ ID NO 168); LD010 White (SEQ ID NO 188); LD014 White (SEQ ID MO 198); LD016 White (SEQ ID NO 220); gfp dsRNA (SEQ ID NO 235).

Figure 13-LD: Effects of double-stranded white bacterial RNA produced against larvae of L. decemlineata. Fifty μl of an OD 1 suspension of heat-treated bacteria AB301-105 (DE3) expressing dsRNA (SEQ ID NO 188) was applied topically to the artificial solid diet in each well of a 48-well plate. The CPB larvae in stage L2 were placed in each well. On day 7, a photograph of the CPB larvae was taken on a plate containing (a) diet with bacteria expressing white double-stranded RNA, (b) diet with bacteria harboring the empty vector pGN29, and (c) only diet. Figure 14-LD: Effects on survival of CPB larvae and growth of different amounts of strain of inactivated E. coli AB301-105 (DE3) that hosts the plasmid pFBNJ003 applied topically to the foliage of potatoes before insect infestation. Ten Ll larvae were fed treating the potato for 7 days. The amount of bacterial suspension sprayed on the plants: 0.25 U, 0.08 U, 0.025 U, 0.008 U of 10 white and 0.25 U of pGN29 (negative control, also included Milli-Q water). One unit (U) was defined as the equivalent bacterial amount present in 1 ml of culture with an optical density value of 2 to 600 nm. A total volume of 1.6 ml was sprayed on each plant. The white insect gene was LD010.

Figure 15-LD: Resistance to potato damage caused by CPB larvae by strain of E. coli AB301-105 (DE3) inactivated by lodging the plasmid pGBNJ003 seven days after infestation, (a) water, (b) 0.25 U E. coli AB301-105 (DE3) harboring pGN29, (c) 0.025 U E. coli AB301-105 (DE3) harboring pGBNJ003, (d) 0.008 U E. coli AB301-105 (DE3) harboring pGBNJ003. One unit (U) is defined as the equivalent bacterial amount present in 1 ml of culture with an optical density value of 1 to 600 nm. A total volume of 1.6 ml was sprayed on each plant. The gene for the white insect was LD010. Figure 1-PC: Effects of ingested white dsRNA on survival and larval growth P. cochileariae. The neonatal larvae were fed with discs of rapeseed oil leaves treated with 25 μl of topically applied solution of 0.1 μg / ml dsRNA (targets or gfp control). After 2 days, the insects were transferred on leaf discs treated with fresh dsRNA. On day 4, the larvae of one replicate for each treatment were collected and placed in a petri dish containing untreated, fresh rape foliage. The insects were evaluated on days 2, 4, 7, 9 and 11. (a) Survival of E. varivestis larvae in rapeseed discs treated with dsRNA. The percentage of surviving larvae was calculated in relation to day 0 (start of the trial). (b) Average weights of P. cochleriae larvae on discs of rapeseed leaves treated with dsRNA. The insects of each replicate were weighed together and the average weight per larva was determined. The error bars represent normal deviations. White 1: SEQ ID NO 473: white 3: SEQ ID NO 478; white 5: SEQ ID NO: 483; white 10: SEQ ID NO: 488; white 14: SEQ ID NO: 493; white 126: SEQ ID NO: 498; white 27: SEQ ID NO: 503; gfp dsRNA: SEQ ID NO 235. Figure 2-PC: Survival of P. cochleariae in rapeseed discs treated with different concentrations of dsRNA from (a) white PC010 and (b) white PC027. The neonatal larvae were placed on leaf discs treated with 25 μl of solution applied topically to dsRNA. The insects were transferred to discs of fresh treated leaves on day 2. On day 4 for white PC010 and day 5 for white PC027, the insects were transferred to untreated leaves. The number of surviving insects was evaluated on days 2, 4, 7, 8, 9 and 11 for PC010 and 2, 5, 8, 9 and 12 for pC027. The percentage of surviving larvae was calculated in relation to day 0 (start of trial). Figure 3-PC: Effects of strain E. coli AB301-105 (DE3) expressing white PC010 of dsRNA in the survival of larvae of the mustard leaf beetle, P. cochleariae, over time. The data points for each treatment represent average mortality values of 3 different replicated The error bars represent normal deviations. Target 10: SEQ ID NO: 488. Figure 1-EV: Survival of E. varivestis larvae in bean leaf discs treated with dsRNA: The neonatal larvae were fed bean leaf discs treated with 25 μl of solution applied topically. 1 μg / μl of dsRNA (targets or gfp control). After 2 days, the insects were transferred on leaf discs treated with fresh dsRNA. On day 4, the larvae of a treatment were collected and placed in a plastic box containing fresh untreated bean foliage. The insects were evaluated for mortality on days 2, 4, 6, 8, and 10. The percentage of surviving larvae was calculated in relation to day 0 (start of trial). White 5: SEQ ID NO: 576; white 10: SEQ ID NO: 586; white 15: SEQ ID NO: 591; white 16: SEQ ID NO: 596; gfp dsRNA: SEQ ID NO 235. Figure 2-EV: Effects of white dsRNA ingested on adult survival E. varivestis and resistance to bean foliage insect damage. (a) Adult survival E. varivestis in bean leaf treated with dsRNA. The adults were fed bean leaf discs treated with 75 μl of topically applied solution of 0.1 μg / μl dsRNA (targets or gfp control). After 24 hours, the insects were transferred onto leaf discs treated with fresh dsRNA. After an additional 24 hours, adults from A treatment was recovered and placed in a plastic box containing fresh untreated whole bean plants seeded containing a plastic box. The insects were evaluated for mortality on days 4, 5, 6, 7, 8, and 11. The percentage of surviving adults was calculated in relation to day 0 (start of trial). White 10: SEQ ID NO: 586; white 15: SEQ ID NO: 591; white 16: SEQ ID NO: 596; gfp dsARN: SEQ ID NO 235. (b) Resistance to damage of bean foliage caused by adults of E. varivestis by sdARN. Complete plants containing insects from one treatment (see (a)) were visually checked for foliage damage on day 9. (i) blank 10; (ii) white 15; (iii) target 16; (iv) gfp dsARN; (v) not treated. Figure 1-CT: Survival of larvae T. castaneum in artificial diet treated with dsRNA of white 14. The neonate larvae were fed a diet based on a mixture of flour / milk with 1 mg of white dsRNA. The control was water (without daARN) in the diet. Four replicates of 10 first stages of larvae per replicate were performed for each treatment. The insects were evaluated for survival as means of average percentage on days 6, 17, 31, 45, and 60. The percentage of surviving larvae was calculated in relation to day 0 (start of trial). The error bars represent normal deviations. TC014 White: SEQ ID NO 878.

Figure 1-MP: Effect of white 27 ingested dsRNA on the survival of nymphs Myzus persicae. The first stages were placed in feeding chambers containing 50 μl of liquid diet with 2 μg / μl of dsRNA (target 27 or gfp control dsRNA). By treatment, 5 feeding chambers were established with 10 stages in each feeding chamber. The number of survivors was evaluated 8 days after the start of the bioassay. The error bars represent normal deviations. PM027 white: SEQ ID NO: 1061; gfp dsRNA: SEQ ID NO 235. Figure 1-NL: Survival of Nilaparvata lugens in artificial fluid diet treated with dsRNA. The nymphs of the first and second stage larvae were fed a diet supplemented with 2 mg / ml solution of dsRNA targets in separate bioassays: (a) NL002, NL005, NL010; (b) NL009, NL016; (c) NL014; NL018; (d) NL013; NL015; NL021 The survival of insects in whites was compared with the diet alone and the diet with gfp dsRNA control at the same concentration. The diet was replaced with a fresh diet containing dsAFIN every two days. The number of surviving insects was evaluated each day. Figure 2-NL: Survival of Nilaparvata lugens in artificial fluid diet treated with different concentrations of dsRNA NL002 white. The nymphs of the first to second stage larvae were fed with diet supplemented with 1, 0.2, 0.08 and 0.04 mg / ml (final concentration) of nL002. The diet was replaced with a fresh diet containing dsRNA every other day. The numbers of surviving insects were evaluated each day.

Examples Example 1: Silencing of C. elegans white genes in C. elegans in High Transferance Strain A broad genome bank of C. elegans was prepared in the pGN9A vector (WO 01/88121) between two promoters of T7 identical and terminators, directing their expression in the direction of sense and contradictory when expressing polymerase T7, which was induced by I PTG. This bank was transformed into bacterial strain AB301-105 (DE3) in 96-well plate format. For broad genome screening, these bacterial cells were fed to the C. elegans nuc-1 (el392) deficient nuclease strain. The feeding of dsRNA produced in bacterial strain AB301-105 (DE3), to worms of C. elegans nuc-1 (el392), was carried out in a 96 well plate format as follows: eggs of nuc-1 transferred to a separate plate and incubated simultaneously at 20 ° C for L-generation timing. 96-well plates were filled with 100 μl of liquid growth medium comprising IPTG and with 10 μl of bacterial cell culture of OD60ol AB301-105 (DE3) from the C. elegans dsRNA library that carries each vector with a genomic fragment of C. elegans for the expression of dsRNA. At each well, 4 of the synchronized Ll worms were added and incubated at 25 ° C for at least 4 to 5 days. These experiments were carried out in quadruplicate. In the sieve, 6 controls were used: - pGN29 = negative control, wild type - pGZl = unc-22 = agitator phenotype - pGZld - chitin synthase = lethal embryo - pGZ25 = pos-1 = lethal embryo - GZ59 = bly-4D = lethal acute - ACC = acetyl co-enzyme A carboxylase = acute lethal After 5 days, the phenotype of the worms C. elegans nuc-1 (el 392) fed with bacteria producing dsRNA were screened for lethality (acute or larval), lethality for the mother generation (Po), lethality (embryonic) for the first generation filial (Fl), or for growth retardation of Po as follows: (i) Acute Potality: They did not develop and are dead, this phenotype never gives progeny and it is observed very empty; (ii) (Larval) lethality of Po: PO died in a later stage to Ll, this phenotype never gives progeny. The larvae killed or dead adult worms are found in the wells; (iii) Leta ity for Fl: Ll has developed into adulthood and is still alive. This phenotype has no progeny. This may be due to sterility, embryonic lethality (dead eggs in the lower part of the well), embryonic arrest, larvae arrest (eventually ends up being lethal); (iv) Arrested in growth and growth retardation: Compared with a well with normal development and # normal progeny. For the white sequences presented in Table IA, it was concluded that the dsRNA-mediated silencing of the C. elegans white gene in nematodes, such as C. elegans, had a fatal effect on the growth and viability of the worm. Subsequent to the previous dsRNA silencing experiment, a more detailed phenotyping experiment was carried out in C. elegans in a high transfer 24-well plate format. The bank of dsRNA produced in bacterial strain AB301-105 (DE3), as described above, was fed to worms of C. elegans nuc-1 (el 392) in 24-well plates as follows: eggs nuc-1 transferred a separate plate and allowed to incubate simultaneously at 20 ° C for synchronization of the Ll generation. Subsequently 10 of the synchronized Ll worms were soaked in a mixture of 500 μl complete feeding medium S, comprising 5 μg / ml of cholesterol, 4 μl / ml of PEG and lmM IPTG, and 500 μl of bacterial cell culture of OD60ol AB301-105 (DE3) from the dsRNA bank of C. elegans carrying each vector with a genomic fragment of C. elegans for expression of dsARN. The soaked Ll worms were rolled for 2 hours at 25 ° C. After centrifugation and removal of 950 μl of the supernatant, 5 μl of the remaining and resuspended pellet (comprising approximately 10 to 15 worms) was transferred to the middle of each well of a 24-well plate, filled with a layer of agar broth: B. The inoculated plate was incubated at 25 ° C for 2 days. In the adult stage, an adult worm was left alone and incubated at 25 ° C for 2 days for inspection of its progeny. The other adult worms were inspected in situ on the original 24-well plate. These experiments were performed in quadruplicate. The detailed phenotypic sieve was repeated with a second batch of worms, the unit difference being that the worms of the second batch were incubated at 20 ° C for 3 days. The phenotype of worms fed with C. elegans dsRNA was compared with the phenotype of C. elegans nuc-1 (el232) worms fed the empty vector. Based on this experiment, it was concluded that the silencing of the white C. elegans genes represented in Table IA had a fatal effect on the growth and viability of the worm and that the target gene is essential for the viability of nematodes. Therefore these genes are good target genes to control (kill or prevent them from growing) nematodes via gene silencing mediated by dsRNA. Accordingly, the present invention encompasses the use of nematode orthologs of the C. elegans white gene above, to control infestation of nematodes, such as infestation of plant nematodes.

Example 2: Identification of Orthologs of D. melanogaster As described above in Example 1, numerous lethal sequences of C. elegans were identified and can be used to identify orthologs in other species and genera. For example, lethal sequences of C. elegans can be used to identify sequences of D. melanogaster orthologs. That is, each sequence of C. elegans can be challenged against a public database, such as GenBank, for orthologous sequences in D. melanogaster. The potential orthologs of D. melanogaster were selected, which share a high degree of sequence homology, (the E value preferably less than or equal to 1E-30) and the sequences are the best reciprocal jet strokes, the latter means that the sequences of different organisms (e.g., C. elegans and D. melanogaster) are each other superior jet shots. For example, the sequence C of C. elegans is compared against the sequences in D. melanogaster using BLAST. If sequence C has the sequence of D. melanogaster D is better beaten and when D is compared with all C. elegans sequences, it is also changed to be sequence C, so D and c are better reciprocal hits. This criterion is frequently used to define orthology, meaning similar sequences of different species, having a similar function. The sequence identifiers of D. melanogaster are represented in Table IA.

Example 3: Leptinotarsa decemlineata (Colorado potato beetle) A. Cloning of partial gene sequences of Leptinotarsa decemlineata High quality intact RNA was isolated from 4 different stages of larvae of Leptinotarse decemlineata (Colorado potato beetle; source: Jeroen van Schaik; focus CV Biologiche Gewasbescherming, Postubus 162, 6700 AD Wageningen, The Netherlands) using TRIzol Reagent (CA. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). The cDNA was generated using a commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate cDNA sequences comprising a portion of the LDOO1, LD002, LD003, LD006, LD007, LD010, LDOll, LD014, LD015, LD016, LC018 and LD027 genes, a series of PCR reactions with degenerate primers was carried out using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-LD, which shows Leptintase decemlineata target genes including indicator sequences and cDNA sequences obtained. These primers were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes. minutes at 72 ° C. The resulting PCR fragments were analyzed on agarose gel, verified (QiAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), cloned into the vector pCR8 / GW / mole (Cat. No. K2500 20, Invitrogen) and sequenced. The sequences of the resulting PCR products were represented by respective SEQ ID NO: s as given in Table 2-LD and are referred to as the partial sequences. The sequence of corresponding partial amino acids is represent by TD TD NOT respective as given in Table 3-LD, where the beginning of the reading frame is indicated in brackets.

B. Production of dsRNA from Leptinotarsa decemlineata genes. DsRNA was synthesized in milligram quantities using the commercially available T7 kit of the Ribomax ™ Express RNAi system (Cat. No. P1700, Promega). The separate single 5 'T7 RNA polymerase promoter patterns were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense pattern was generated using specific forward and reverse specific T7 primers. The sequences of the respective primers to amplify the one-way pattern for each of the target genes are given in Table 8-LD. The conditions in the PCR reactions were as follows: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 9 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. ° C. The T7 pattern was generated in contrasense using specific forward and reverse primers T7 specific in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the pattern in contrasense for each of the target genes are given in Table 8-LD. The resulting PCR products were analyzed on agarose gel and were purified by the PCR purification equipment (Quiaquick PCR Purification Kit, Cat. No. 28106, Qiagen) and NaC104 precipitation. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were annealed, treated with DNase and RNase, and purified by sodium acetate, following the manufacturer's instructions. The strand in the sense and the resulting deRNA for each of the target genes are given in Table 8-LD. Table 8-LD shows the sequences for preparing RNA fragments of the Leptinotarsa decemlineata target sequences and the concatamer sequences, including primer sequences.

C. Screening of dsRNA targets using artificial diet for activity against Leptinotarsa decemlineata The artificial diet of Colorado potato beetle was prepared as follows (adapted from Gelman et al., 2001, J. Ins. Sec., Vol. 1, no. 7, 1-10): water and agar were separated automatically, and the remaining ingredients (shown in Table A below) were added when the temperature dropped to 55 ° C. At this temperature, the ingredients were mixed well before an aliquot of the diet was taken in 24-well plates (Nunc) with an amount of 1 ml of diet per well. The artificial diet was allowed to solidify by cooling to room temperature. The diet was stored at 4 ° C for up to three weeks.

Table A: Ingredients for Artificial Diet Fifty μl of a solution of dsRNA at a concentration of 1 mg / ml was applied topically in the artificial solid diet in the wells of the multi-well plate. The diet was dried in a laminar flow cabinet. By treatment, twenty-four Colorado potato beetle larvae (2nd stage), with two insects per well, were tested. The plates were stored in the posterior chamber of insects at 25 ± 2 ° C, 60% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. The beetles were evaluated as alive or dead every 1, 2 or 3 days. After seven days, for the targets LD006, LD007, LD010, LDOll, and LD014, the diet was replaced with fresh diet with dsRNA applied topically at the same concentration (1 mg / ml); for targets LDOOl, LD002, LD003, LD015, and LD016, the diet was replaced with rich diet richly. The dsRNA targets were compared to the diet alone or diet with topically applied dsRNA that corresponds to a fragment of the GFP (green fluorescent protein) coding sequence (SEQ ID NO: 235). The artificial feeding diet containing intact pure dsRNA to larvae of L. decemlineata resulted in significant increases in larval immortality as indicated in two separate bioassays (Figures 1-LD-2LD).

All tested dsRNAs ultimately resulted in 100% mortality after 7 to 14 days. The diet with or without GFP dsRNA maintained insects through bioanalysis with little or no mortality. Normally, in all the analyzes observed, the larvae in the second stage of CPB were fed normally in the diet with or without dsRNA for 2 days and were fused to the third stage of larvae. In this new stage of larvae, CPB were observed to significantly reduce or stop feeding, with an increase in mortality as a result.

D. Bioassay of dsRNA targets using potato leaf discs for activity against Leptinotarsa decemlineata An alternative bioanalysis method was used using potato leaf material instead of artificial diet as a food source for CPB. The disks of approximately 1.1 cm in diameter (or 0.95 cm2) were cut from leaves of potato plants from 2 to 3 weeks of age using an appropriately sized weevil. The treated leaf discs were prepared by applying 20 μl of a solution of 1 ng / μl of white dsARN LD002 or gfp of control dsRNA on the adaxial leaf surface. The leaflets were allowed to dry and were placed individually in 24 well of a multiple plate 24 wells (Nunc.). A single second stage of CPB larvae was placed in each well, which was then covered with paper handkerchief and a plastic lid. The plate containing the insects and leaf discs were kept in an insect chamber at 28 ° C with a photoperiod of 16 h of light / 8 h of darkness. The insects fed on leaf discs for 2 days after which the insects were transferred to a new plate containing discs of leaves treated in fresh. Then, the insects were transferred to a plate containing discs of untreated leaves every day until day 7. Insect mortality and weight classifications were recorded. The feeding of potato leaf discs with intact pure dsRNA applied to the surface of white LD002 to L. decemlineata larvae resulted in a significant increase in larval mortalities (ie, on day 7 all insects died; 100% mortality) while control gfp dsRNA had no effect on CPB survival. dsARN LDOOl white severely affected the growth of the larvae after 2 to 3 days while the larvae were fed with gfp dsRNA at the same concentration developed as normal (Figure 3-LD).

E. Screening of shorter versions of dsRNA using artificial diet for activity against Leptinotarsa decemlineata This example exemplifies the finding that the shorter dsRNA fragments (60 or 100 bp) by themselves or as concatamer constructions are sufficient to cause toxicity to the Colorado potato beetle. LD014, a target known to induce lethality in Colorado potato beetle, is selected for this example. This gene encodes an E subunit of V-ATPase (SEQ ID NO 15). A fragment of 100 base walls, LD014_F1, at position 195-294 in SEQ ID NO: 15 (SEQ ID NO 159) and a fragment of 60 base pairs, LD014_F2, at position 235-294 in SEQ ID NO 15 ( SEQ ID NO: 160) were additionally selected. See also Table 7-LD. Two concatemers of 300 base pairs, LD014_C1 and LD014_C2, were designated (SEQ ID NO: 161 and SEQ ID NO: 162).

LD'14_C1 contained 3 repeats of the fragment of 100 base pairs described above (SEQ ID NO: 159) and LD014_C2 contained 5 repeats of the 60 base pair fragment described above (SEQ ID NO 160). See also Table 7-LD. The LD014__F1 and LD_014F2 fragments were synthesized as sense and contradictory primers. These primers were annealed to create the double-stranded DNA molecules before cloning. The Xbal and Xmal restriction sites were included in the 5 'ends and 3 'of the initiators, respectively, to facilitate cloning. Concatamers were made as synthetic genes of 300 base pairs. The restriction sites of Xbal and Xmal were included at the 5 'and 3' ends of the synthetic DNA fragments, respectively, to facilitate cloning. The 4 DNA molecules, that is, the 2 only units (LD014__F1 &; LD014_F2) and the 2 concatamers (LD014_C1 &LD014_C2), were digested with Xbal and Xmal and subcloned into pBluescript II SK + aligned by Xbal and Xmal digestions, resulting in the recombinant plasmids of pl, p2, p3, and p4, respectively. Production of double-stranded RNA: dsRNA was synthesized using the commercially available RNAi T7 Ribomax ™ Express system (Cat. No. P1700, Promega). First, two 5 'T7 RNA polymerase promoter patterns were generated only in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For LD014_F1, the sense T7 pattern was generated using the specific T7 forward primer or GBM159 and the specific reverse primer OGBM164 (represented herein as SEQ ID NO: 204 and SEQ ID NO: 205, respectively) in a PCR reaction with The following conditions: 4 minutes at 95 ° C, followed or by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The T7 counter-sense pattern was generated using the specific forward primer oGBM163 and the T7-specific reverse primer 0GBMI6O (represented herein as SEQ ID NO 206 and SEQ ID NO: 207, respectively in a PCR reaction with the same conditions as described above, the resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (Qiaquick PCR Purification Kit, Cat. No. 28106, Qiagen) and NaC104 precipitation. Inverse T7 generated were mixed to transcribe and the resulting RNA strands were annealed, Dnasa and Rnasa treated, and purified by sodium acetate, following the manufacturer's instructions The strand in a sense of dsRNA resulting therefrom represented by SEQ ID NO. : 203. For LD014-F2, the T7 pattern in sense was generated using the T7 forward initiator specific 0GBMI6I and the specific inverse initiator 0GBMI66 (representative as set forth herein as SEQ ID NO 209 and SEQ ID NO 210, respectively, in a PCR reaction with the following conditions: 4 minutes at 95 ° C, followed by 35 cycles of 3 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The T7 pattern in contradictory was generated using the forward forward primer OGBM165 and the initiator Inverse T7 specific OGBM162 (represented herein as SEC TD NO: 211 and SEC TD NO: 212, respectively) in a PCR reaction with the same conditions as described above. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (Qiaquick PCR Purification Kit, No. 28106, Quiagen) and NaC104 precipitation. The generated forward and reverse T7 patterns were mixed to be transcribed and the resultant RNA strands were annealed. Dnasa and Rnasa were treated, and purified by sodium acetate, following the manufacturer's instructions. The resulting strand of dsRNA is represented herein by SEQ ID NO: 208. Also for the concatamers, the 5 'separate T7 RNA polymerase promoter patterns alone were generated in two separate PCR reactions, each reaction containing the white sequence in a different orientation relative to the T7 promoter. The recombinant plasmids p3 and p4 containing LD014__C1 and LD014_C2 were aligned with Xbal and Xmal, the two linear fragments for each construct were purified and used as a standard for the in vitro transcription analysis, using the T7 promoters looking at the cloning sites. Double-stranded RNA was prepared by in vitro transcription using the T7 RiboMAX ™ Express RNAi System (Promega). The strands in a sense of Resulting dsRNA for LD014_C1 and LD014: C2 were represented herein by SEC TD NO: 213 and 2114, respectively. The sequences short maps of white LD014 and concatamers could induce lethality in Leptinotarsa Decemlineata, as shown in Figure 4-LD.

F. Screening of dsRNA at different concentrations using artificial diet for activity against Leptinotarsa decemlineata 50 μl of a solution of dsRNA at ten-fold serial concentrations of 1 μg / μl (for white LD027 0.1 μg / μl) decreased to 0.01 ng / μl was normally applied in the artificial solid diet in the wells of a 24-well plate (Nunc.). The diet was dried in a laminar flow cabinet. By treatment, twenty-four Colorado potato beetle larvae (2nd stage) were tested, with two insects per well. The plates were stored in the posterior chamber of insects at 25 ± 2 ° C, 60% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. The beetles were evaluated as alive or dead at regular intervals until day 14. After seven days, the diet was replaced with fresh diet by applying dsRNA topically at the same concentrations. The dsRNA targets were compared only with the diet. Feeding artificial diet containing intact pure dsRNA from different targets for L. decemlineata resulted in high larval mortalities at concentrations as low as 0.1 to 10 ng dsRNA / μl as shown in Figure 5-LD.

G. Cloning of a CPB gene fragment into a vector suitable for bacterial production of active double-stranded RNA from insects. While any efficient bacterial promoter can be used, a DNA fragment corresponding to a target of the CPB gene was cloned into a vector for the expression of double-stranded RNA in a bacterial host (See WO 00/01846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-LD. The pattern used is the pCR8 / GW / mole vector containing any of the target sequences. The primers were used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, Sergio for 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Ct. No. 28706, Qiagen), blunt end cloned into vector of pGNA49A aligned with Srf I (reference to WO 0018812A1), and sequenced The sequence of the resulting PCR product corresponds to the sequence respective as given in Table 8.LD. The recombinant vector that hosts this sequence is called pGBNJ003. The sequences of the specific primers used for the amplification of the target gene fragment LD010 are provided in Table 8-LD (forward primer SEQ ID NO: 190). The pattern used was the vector pCR8 / GW / mole containing the sequence LD010 (SEQ ID NO 11). The primers were used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 12 ° C, followed by 10 minutes at 72 ° 'C. The resulting PCR fragment was analyzed on agarose gel, purified (QTAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), cloned blunt end in pGNA49A vector aligned with Srf I (reference to WO 00 / 188121A1) , and it was sequenced. The sequence of the resulting PCR product corresponds to SEQ ID NO 188 as given in Table 8-LD. The recombinant vector that hosts this sequence is named pGBNJOOS.

H. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3) and (2) BL21 (dE3) The procedures described below were followed in order to express levels of active double-stranded RNA for insects of white LD010 in bacteria A strain deficient in RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3). Transformation of B301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added and mixed gently in a 50 μl aliquot of competent chemically cooled E. coli strain in ice AB301-105 (DE3) or BL21 (DE3) . The cells were incubated on ice for 20 minutes before being subjected to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to 500 ml of conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours). Chemical indication of double-stranded RNA expression in AB301-10 (DES) and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in bacterial strain AB301-105 (DE3) or BL21 (DE3) was possible since all the genetic components for controlled expression are present. In the presence of chemical inducer isopropylthiogalactoside, or IPTG, T7 polymerase will direct the transcription of the target sequence in both directions of sense and sense since these are flanked by the T7 promoters oppositely oriented. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 1 fresh complete medium S (SCN medium plus 5 μg / ml cholesterol) supplemented with 100 μg / ml carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature. Heat Treatment of Bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of double-stranded RNA expressing bacteria is not a prerequisite for inducing toxicity to insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the supernatant discarded and the pellet subjected to 80 ° C for 20 minutes in Water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each cooling. The tubes were stored at -20 ° C until they were used.

I. Laboratory tests to test Escherichia coli expressing dsARN white LD010 against Leptinoarse decemlineata Two bioanalysis methods were used to test double-stranded RNA produced in Escherichia coli against Colorado potato beetle larvae: (1) bioassay based on artificial diet, and , (2) plant-based bioanalysis. Artificial Dietary Bioanalyses The artificial diet for the Colorado potato beetle was prepared as previously described in Example SC. Half a milliliter of diet was dispensed into each of the wells of a 48-well multiple well test plate (Nunc.). For each treatment, fifty μl of an OD 1 suspension of heat-treated bacteria (which is equivalent to approximately 5 x 107 bacterial cells) expressing dsRNA was applied topically in the solid diet in the wells and the plates were allowed to dry in a booth from laminar flow. By treatment, forty eight Colorado potato beetle larvae were tested in the 2nd. stage, one in each well containing diet and bacteria. Each row of a plate (ie 8 wells) was considered as a replicate. The plates were kept in the posterior chamber of insects at 25 + 2 ° C, 60 ± 5% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. After every 4 days, the beetles were transferred to a fresh diet containing bacteria applied topically. The beetles were evaluated as alive or dead every two or three days after the infestation. For the survivors, growth and development in terms of larval weight was recorded on day 7 after the infestation. For strain AB301-105 (DE3) of E. coli deficient of RNaselTI, bacteria containing plasmid pBGNJ003 and those containing the empty vector pGN29 (reference to WO 900 / 188121A1) were tested in bioassay for CPB toxicity. Bacteria harboring plasmid pGBNJ003 showed a clear increase in insect mortality over time, while little or no mortality was observed for pGN29 and diet control alone (Figures 6a-LD &7a-LD). The growth and development of potato Colorado beetle larvae survivors, 7 days after feeding on the artificial diet containing bacteria that expressing the white LDO'IO dsRNA, was severely impeded (Table 10-LD, Figur a8a-LD, Figure 13-LD). For strain E. coli BL21 (DE3), bacteria containing pGBNJ003 from plasmid and those containing empty vector pGN29 were tested against Colorado potato beetle larvae. Similar detrimental effects were observed in the feeding diet of larvae with bacteria BL21 (DE3) as for the strain deficient in ARNselil, AB301-105 (DES) (Figures 6b-LD and 7b-LD) .However, the number of survivors for the five clones it was higher for BL21 (DE3) than for AB301-105 (DE3), on day 12, the average mortality values were approximately 25% lower for this strain compared to the efficient strain of RNAseTT. Average weights of superviruses fed diets containing BL21 (DE3) expressing dsRNA that correspond to white LD010 were severely reduced (Table 10-LD, Figure 8b-LD) .Delay in growth and development of CPB larvae fed diets containing either of the two bacterial strains harboring the plasmid pGBNJ003 was directly correlated to feed inhibition since the excrement was not visible in the wells of the cooled plates from day 4 onwards when compare with the bacteria that host the empty vector pGN29 or the only plate with diet. This observation was similar to that in where CPB was implanted in double-stranded RNA transcribed in vitro applied topically to the artificial diet (see Example 3D); here, the feeding was stopped from day 2 onwards in the treated diet.

Plant-based bioanalysis Whole potato plants were sprayed with their pensions of chemically-induced bacteria expressing dsRNA before feeding the plants to CPB larvae. Potato plants of the "V-line" variety (Wageningen University) developed from piping to the split leaf stage 8-12 in a closed plant growth chamber with the following conditions: 25 ± 2 ° C, 60% humidity relative, photoperiod of light: darkness of 16: 8 hours. The plants were kept in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut up and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent larvae from escaping. Fifteen larvae of Colorado potato beetles were placed in stage Ll in each plant treated in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring plasmids pGBNJ003 (clone 1, Figure 7a-LD) or plasmid pGN29 (clone 1, see Figure 7a-LD). Different amounts of bacteria to plants: 66, 22, and 7 units, only one unit was defined as bacterial cells 109 in 1 ml of a bacterial suspension at the optical wavelength value of 1 to 600 nm. In each case, a total volume of 1.6 ml was sprayed into the plant with the help of a vaporizer. One plant was used per treatment in this trial. The number of survivors was counted and the weight of each survivor was recorded. Spraying the plants with a suspension of bacterial strain of E. coli AB301-105 (dE3) expressing white dsRNA of pBGNJ003 leads to a dramatic increase in insect mortality when compared to the pGN29 control. The mortality count was maintained when the amount of suspension of bacteria cells was diluted 9 times (Figure 9-LD). The average weights of the larval survivors on day 11 in plants sprayed with bacteria harboring the vector pBGNJ0O3 were approximately 10 times less than that of pGN29 (Figure 10-LD). Damage by feeding CPB larvae from the potato plant sprayed with bacteria containing the plasmid pBGNJ003 was greatly reduced when compared to the damage incurred in a potato plant sprayed with bacteria containing the empty vector pGN29 (Figure 11-LD) . These experiments showed that the double-stranded RNA corresponding to a white insect sequence produced in the deficient bacterial expression systems of RNaselIT or wild type is toxic to the insect in terms of substantial increases in insect mortality and growth / development retardation for larval survivors. It is also clear from these experiments that an exemplification for the effective protection of plants / crops from insect damage is provided by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

J. Different tests of suspension densities of Escherichia coli cultures expressing white LD010 of dsRNA against Leptinotarsa de lineata. Preparation and treatment of cultures are described in Example 3J. Three serial dilutions of cultures were applied starting from? .25 unit equivalents) of strain AB301-105 (DE3) deficient of Escherichia coli RNAselII expressing double-stranded RNA of white LD010 were applied to foliage of the potato plant of the 'Bintaje' variety in the split leaf stage 8-12. Ten Ll larvae of L. decemlineata were placed on plants treated with one plant per treatment. The classification for insect mortality and growth impediment was made on day 7 (ie, 7 days after infestation).

As shown in Figure 14-LD, the high mortality of CPB larvae (90 to 100%) was recorded after 1 week when the insects were fed with potato plants treated with a topical application by fine sprayer of heat-inactivated cultures. of E. coli containing plasmid pGBNJ003 (for the expression of white dsRNA 10) in densities 0.25, 0.08 and 0.025 bacterial units. At 0.008 units, approximately a third of the insects died, however, the surviving insects were significantly smaller than those in the control groups (E. coli containing the empty pGN20 vector and only water). The feeding damage by the CPB larvae of the potato plant sprayed with bacteria containing the plasmid pGBNJ003 at concentrations 0.025 or 0.008 units was greatly reduced when compared to the damage incurred in a potato plant sprayed with bacteria containing the vector empty pGN29 (Figure 15-LD).

K. Adults were extremely susceptible to white genes. The example provided below highlights the finding that adult insects (and not only larval stage insects) are extremely susceptible to orally ingested dsRNA that correspond to target genes.

Four banks were chosen for this experiment: blanks 2, 10, 14 and 16 (SEQ ID NOs 168, 188, 198 and 220, respectively). The dsRNA fragment GFP (SEQ ID NO 235) was used as a control Young adults (2 to 3 days old) were randomly chopped from our previous laboratory culture without bias towards the insect genus. Ten adults were chosen per treatment. The adults were previously fasted for at least 6 hours before the start of treatment. On the first day of treatment, each adult was fed four discs of potato leaves (diameter 1.5 cm 2) which were pretreated with a topical application of 25 μl of 0.1 μg / ml of white dsRNA (synthesized as described in Example 3A; topical application as described in example 3E) per disk. Each adult was confined to a small petri dish (diameter of 3 cm) in order to ensure that all insects ingested equal amounts of food and therefore received equal doses of dsRNA. The next day, each adult again fed four leaf discs treated as described above. On the third day, the ten adults per treatment were retrieved and placed together in a cage consisting of a plastic box (dimensions 30 cm x 20 cm x 15 cm) with a thin nylon mesh built into the lid to give good aeration . Inside the box, some of the moist filter paper was placed on the base. Some foliage of potato (not treated) was placed on top of the paper to keep the adults during the experiment. From day 5, regular evaluations were carried out, to count the number of dead, alive (mobile) or moribund insects. For dying insects, the adults were placed on their backs to check if they could turn by themselves within several minutes; an insect was considered moribund only if it could not turn on its own. The clear specific toxic effects of double-stranded RNA corresponding to different targets towards adults of Colorado potato beetle, Leptinotarsa decemlineata, were demonstrated in this experiment (Figure 16-LD). The double-stranded RNA corresponding to a gfp fragment showed no toxicity to adult CPB on the day of final titration (day 19). This experiment clearly showed that adult survival of CPB was severely reduced only after a few days of exposure to dsRNA when delivered orally. For example, for target 10, on day 5, 5 of 10 adults were dying (sick and slow moving); on day 6, 4 of 10 adults died with three of the dying survivors; on day 9 all adults were found dead. As a consequence of this experiment, the application of white double-stranded APN against pests of Insects can be extended to include the two living stages of an insect pest (ie, larvae and adults) that could cause extensive crop damage, as is the case with the Colorado potato beetle.

Example 4: Phaedon cochleariae (mustard leaf beetle) A. Cloning of a partial sequence of Phaedon cochleariae (mustard leaf beetle) genes PC001, P-C003, PC005, PC010, PC014, PC016 and PC027 via family CPR High quality intact RNA was isolated from the third stage larvae of Phaedon cochleariae (mustard leaf beetle, source: Dr. Carolina Muller, Julios-von-Sachs-Institute for Biosciences, Chemical Ecology Group, University of Wuerzburg, Joules - von-Sachs-Platz 3, D-97082 Wuerzburg, Germany) using TRIzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Meryland, USA) following the manufacturer's instructions. Genomic DNA present in the RNA preparation removed by DNase (Cat. Nr. 18700, Promega) treatment after manufacturer's instructions. The cDNA was generated using commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions.

To isolate the cDNA sequences comprising a portion of the genes PC001, PC003, PC005, PC010, PC014, PC106, and PC027, a series of PCR reaction with degenerate primers was performed using Amplitaq Gold (Coata No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-PC. These primers were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes. minutes at 72 ° C. The resulting PCR fragments were analyzed on the agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), cloned into the pCR4 / TOPO vector (Cat. No. K4530-20, Invitrogen ) and it was sequenced. The sequences of the resulting PCR products are represented by the respective TD TD NOs given in Table 2-PC and are referred to as partial sequences. The sequence of corresponding partial amino acids are represented by the respective SEQ IDs as given in Table 3-PC. Table 3-PC provides amino acid sequences of cDNA clones and the start of the reading frame is indicated on the supports.

B. Production of dsRNA from the Phaedon cochleariae dsRNA genes was synthesized in milligram quantities using the commercially available T7 kit of Ribomax ™ Express RNAi System (Cat. No. P1700, Promega). First, two 5 'T7 RNA polymerase promoter patterns were generated alone in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in sense was generated using specific T7 forward and specific inverse primers. The sequences of the respective primers to amplify the sense pattern for each of the target genes are given in Table 8-PC. Table 8-PC provides details for preparing dsRNA fragments of Phaedon cochleariae white sequences, including primer sequences. The conditions in the PCR reactions were as follows: 1 minute at 95 ° C, followed by 2 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The T7 pattern in contrasence was generated using specific forward and reverse T7 specific primers in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the contradictory pattern for each of the target genes are given in Table 8-PC. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification kit (Qiaquick PCR Purification Kit, Cat. No. 28106, Qiagen) and precipitation of NaC104. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were annealed, DNase and RNase were treated, and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resulting dsRNA for each of the target genes are given in Table 8-PC.

C. Laboratory tests of Myzus periscae infestation (green peach aphid) in transgenic Arabidopsis thaliana plants Generation of transgenic plants Arabidopsis thaliana plants were transformed using the deep floral method (Clough and Bent (1998) Flant Journal 16: 735 -743). The aerial parts of the plants were incubated for a few seconds in a solution containing 5% sucrose, C58C1 Rif cells from the Agrobacterium tumefacines strain resuspended from a nocturnal culture and 0.03% from the Silwet 1, -11 surfactant. After the inoculation, the plants were covered for 16 hours with a transparent plastic to keep moisture. To increase the transformation efficiency, the procedure was repeated after one week. The water supply stopped when the seeds matured and the dry seeds were harvested and treated with cold for two days. After sterilization, the seeds were seeded in a growth medium containing kanamycin for the selection of transformed plants. The selected plants were transferred to the land for the optimum production of T2 seeds.

Bioanalysis Transgenic Arabidopsis thaliana plants were selected allowing the segregation of T2 seeds to germinate in the appropriate selection medium. When the roots of these transgenics are well established they are transferred to the fresh artificial growth medium or soil and allowed to grow under optimal conditions. Whole transgenic plants were tested against nymphs of the green peach aphid (Myzus persicae) to show (1) a significant resistance to plant damage by the nymph feeding, (2) increased nymph mortality, and / or (3) weight decreased number of surviving nymphs (any other aberrant insect development).

C. Laboratory tests to test dsRNA targets, using rapeseed discs for activity against Phaedon cochleariae larvae The example provided below is an exemplification of the finding that mustard leaf beetle larvae (MLB) ) are susceptible to orally ingested dsRNA that corresponds to their own white genes. To test the different double-stranded RNA samples against MLB larvae, a leaf disk test was used using the rape leaf material as a food source (Brassica napus variety SW Oban; source: Nick Balaam, Sw Seed Ltd, 49 North Road, Abington, Cambridge, CB1 6AS, UK). The insect cultures were kept in the same variety of rape in the insect chamber at 25 ± 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16h of light / 8h of darkness. Discs approximately 1.1 cm in diameter (or 0.95 'cm) were cut from the leaves of rapeseed plants from 4 to 6 weeks of age using an appropriately sized weevil.The double-stranded RNA samples were diluted to 0.1 μg. / μl in Milli-Q water containing 0.05% Triton X-100. Discs of treated leaves were prepared by applying 25 μl of the diluted solution of dsARN PC001, PC005, PC010, PC014, PC016, white PC027 and gfp control dsARN or 0.05% Triton X-100 on the adaxial leaf surface The leaf discs were left dried and individually placed in each of the 24 wells of a 24-well manifold plate containing 1 ml of 2% gelled agar which helps to prevent the leaf disc from drying out. Two MLB larvae of neonates were placed in each well of the plate, which was covered with a multi-well plastic lid. The plaque (a treatment containing 48 insects) was divided into 4 replicates of 12 insects per replicate (each row). The plate containing the insects and leaf discs were kept in an insect chamber at 25 ± 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16 h of light / 8 h of darkness. The insects were fed leaf discs for 2 days after which they were transferred to a new plate containing discs of freshly treated leaves. After, 4 days after the start of the bioassay, the insects from each replicate were recovered and transferred to a petri dish containing untreated fresh rapeseed leaves. Larval mortality and average weight were recorded on days 2, 4, 7, 9 and 11. Larvae of P. cochleariae were fed on rapeseed leaves treated with intact pure white dsRNA, resulting in significant increases in larval mortalities. for all tested targets, as indicated in Figure 1 (a). The double-stranded RNA tested for white PC010 leads to mortality of 100% larvae on day 9 and for white PC027 on day 11. For all targets, the Significantly higher mortality values were reached on day 11 when they were purchased to control gfp dsRNA, 0.05% Triton X-100 alone or only untreated leaf: (average value in percent ± confidence interval with alpha 0.05) PC001 (94.4 ± 8.2 ); PC003 (86.1 ± 4.1); PC005 (83.3 ± 7.8); PC014 (63.9 and 20.6); PC016 (75.0 ± 16.8); gfp dsRNA (11.1 ± 0.2); 0.05% Triton X-100 (19.4 ± 10.5); only sheet (8.3 ± 10.5). The surviving larvae were evaluated based on their average weight. For all tested targets, mustard leaf beetle larvae had significantly reduced average weights after day 4 of bioanalysis; insects fed with gfp control dsARN or 0.05% Triton X-100 only developed normally, as for larvae that were only fed with leaves (Figure 1 (b) -PC).

E. Laboratory tests to screen dsRNA in different concentrations using rapeseed discs for activity against larvae Phaedon cochleariae Twenty-five μl of a dsRNA solution of PC010 or PC027 bank in ten-fold serial concentrations of 0.1 μg / μl below 0.1 ng / μl was applied topically to the rapeseed disk, as described in Example 4D above. As a negative control, 0.05% Triton X-100 it was only administered to the sheet disk. By treatment, twenty-four neonatal larvae, with two insects per well, were tested. The plates were stored in the entire posterior chamber of insects at 25 ± 2 ° C, 60 ± 5% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. On day 2, the larvae were transferred into a new plate containing discs of leaves treated with dsRNA. On day 4 for white PC010 and day 5 for white PC027, insects from each replicate were transferred to a petri dish containing abundant untreated leaf material. The beetles were evaluated as alive or dead on days 2, 4, 7, 8, 9, and 11 for white PC010, and 2, 5, 8, 9, and 12 for white PC027. The feeding of rapeseed discs containing intact pure dsRNA of the two different targets, PC010 and PC027, to larvae of P. cochleariae resulted in high mortalities at concentrations as low as 1 ng of the dsRNA / μl solution, as shown in the Figures 2 (a) and (b). The average mortality values as a percentage ± confidence interval with alpha 0.05 for different concentrations of dsRNA for white PC010 on day 11, 0 μg / μl: 8.3 ± 9.4; 0.1 μg / μl; 100; 0.01 μg / μl: 79.2 ± 20.6; 0.001 μg / μl: 58.3 ± 9.4; 0.0001 μg / μl: 12.5 ± 15.6; and for PC027 white on day 12, 0 μg / μl: 8.3 ± 9.4; 0.1 μg / μl: 95. 8 + 8.2; 0.01 μg / μl: 95.8 ± 8.2; 0.001 μg / μl: 83.3 ± 13.3; 0.0001 μg / μl: 12.5 ± 8.2.

F. Cloning of an MLB gene fragment into a vector suitable for bacterial production of active double-stranded RNA for insects. The following is an example of cloning a DNA fragment corresponding to a blank MLB gene in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for transcription efficient in bacteria, it can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of the target gene fragment PC010 are provided in Table 8-PC. The pattern used was the vector pCR8 / GW / mole containing the sequence of PC010 (SEQ ID NO 253). The primers were used in a descending PCR reaction with the following conditions: 1 minute at 95 ° C, followed by 20 cycles and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 2S706, Qiagen), cloned blunt end in pGNA49A vector aligned with Srf I (reference WO 00188121A1), and sequenced The sequence of the resulting PCR product corresponds to SEQ ID NO 488 as given in the Table 8-PC. The recombinant vector containing this sequence was named pGC JOOl.

G. Expression and production of a white double-stranded RNA in a strain of Escherichia coli AB301-105 (DE3) The procedures described below are followed in order to express adequate levels of active double-stranded RNA for insect white insects in bacteria In this experiment, a deficient strain of RNaselII, AB301-105 (DE3) was used. Three hundred ng of the plasma was added and mixed gently in a 50 μl aliquot of AB301-105 (DE3) strain of competent E. coli chemically cooled on ice. The cells were incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes. After which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature was added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to a 500 ml conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated in a Innova 4430 agitator (250 rpm) at 37 ° C during the night (16 a.m. to 6 p.m.).

Chemical induction of double-stranded RNA expression in AB301-105 (DES) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX, in strain AB301-105 (DE3) of bacteria was possible since all genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase will direct the transcription of the target sequence in the directions of sense and contradictory since they are flanked by T7 promoters that are oriented in an opposite direction. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite to induce insect toxicity due to RNA interference. The induced bacterial culture was centrifuged at 300 g at room temperature for 10 minutes, the discarded supernatant and the pellet subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in a total volume of 50 ml of 0.05% Triton X-100 solution. The tube was stored at 4 ° C until later use.

H. Laboratory tests to test Escherichia coli expressing the target dsRNA against Phaedon cochleariae Leaf disc bioanalysis The leaf disc bioanalysis method was used to test double-stranded RNA of white PC010 produced in Escherichia coli (from the plasmid pGCDJOOl) against larvae of the mustard leaf beetle. The leaf discs were prepared from rape foliage, as described in Example 4. Twenty μl of a bacterial suspension, with an optical density measurement of wavelength from 1 to 600 nm, was pipetted into each disc. The blade disc was placed in a well of a plate of 24 multiple wells containing 1 ml of gelled agar. Two neonatal larvae are added to each leaf disc. For each treatment, 3 replicates of 16 replicated neonate larvae were prepared. Plates were maintained in the posterior chamber of insects at 25 ± 2 ° C and 60 ± 5% relative humidity, with a photoperiod of light: darkness of 16-8 hours. On day 3 (ie, 3 days after starting the bioanalysis), the larvae were transferred to a new plate containing discs of fresh treated leaves (same dose). The leaf material was refreshed every day from day 5 onwards. The bioassay was classified as mortality and average weight. Negative controls were leaf discs treated with bacteria containing the plasmid pGN29 (empty vector) and leaf only. A clear increase in larval mortality of P. cochleariae over time was shown after the insects were fed on rapeseed leaves treated with a suspension of strain AB301-105 (DE3) of E. coli deficient in RNaselII containing the plasmid pGCDJOOl , whereas very little or no mortality was observed in the case of bacteria with the plasmid pGN29 or control only of leaves Figure 3-PC).

Plant-based bioanalysis Whole plants were sprayed with suspensions of chemically inactivated heat induced bacteria expressing ds? RN before feeding the plants to MLB. They developed from a closed plant growth chamber. The plants were placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base cut up and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent larvae from escaping. Fifteen larvae of Colorado potato beetles were placed in stage Ll in each plant treated in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring plasmids pGBNJ003 or plasmid pGN29. Different amounts of bacteria were applied to the plants: 66, 22, and 7 units, only one unit was defined as bacterial cells 109 in 1 ml of a bacterial suspension at the optical wavelength value of 1 to 600 nm. In each case, a total volume of 1 and 10 ml was sprayed into the plant with the help of a vaporizer. One plant was used per treatment in this trial. The number of survivors was counted and the weight of each survivor was recorded. Spraying the plants with a suspension of bacterial strain of E. coli AB301-105 (DE3) expressing white dsRNA of pBGNJ003 leads to a dramatic increase in mortalities of insects when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in the wild type or deficient RNaselII bacterial expression systems is toxic to the insect in terms of substantial increases in insect mortality and retardation in growth / development for larval survivors. It is also clear from these experiments that an exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a gene blanket. of insects.

Example 5: Epilachna varivetis (Mexican bean beetle) A. Cloning of partial gene sequences of Epilachna varivetis High quality intact RNA was isolated from 4 different stages of larvae of Epilachana varivetis (Mexican bean beetle, source: Thomas Dorsey, Supervising Entomologist, New Jersey Department of Agriculture, Division of Plant Industry, Bureau of Biological Pest Control, Phillip Alampli Beneficial Insect Laboratory, PO Box 330, Trenton, New Jersey 08625-0330, USA) using the TRTzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation was removed by the DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). CADN was generated using commercially available equipment (SuperScript ™ III reverse transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the genes EV005, EV009, EV010, EV015 and EV016, a series of PCR reactions with degenerate primers were performed using Amlitaq Gold (Cat. No. N8080240, Applied Biosystems) following the instructions manufacturer. The sequences of the degenerate primers used for the amplification of each of the genes are given in Table 2-EV, which exhibits white genes of Epilachna varivetis including primer sequences and obtained cDNA sequences. These primers were used in respective PCR reactions with the following conditions: for EV005 and EV009, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute at 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for EV014, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 7 minutes at 72 ° C; for EVO10 and EV016; 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute, at 54 ° C and 1 minute 40 seconds at 72 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments were analyzed on agarose gel, purified (QIAquick Gel Extraction Quote, Cat. No. 28706, Qiagen), cloned into the pCR4 / TOPO vector (Cat. No. K4530-20, Invitrogen) , and it was sequenced. The sequences of the resulting PCR products are represented by the respective SEQ ID NOS given in Table 2-EV and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NOs given in Table 3-EV, where the beginning of the reading frame is indicated in square brackets.

B. Production of dsRNA from the Epilachna varivetis genes. DsRNA was synthesized in amounts in milligrams using the commercially available RNA7 T7 Ribomaxtt? Xpress System (Cat. No. P1700, Promega). Two first 5 'T7 RNA polymerase promoter patterns were generated only separated into two separate REC reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in sense was generated using forward T7 primers Specific and specific reverse. The sequences of the respective primers to amplify the sense pattern for each of the target genes are given in Table 8-EV. The conditions in the PCR reactions were as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The T7 pattern in contradictory was generated using specific forward and reverse primers T7 specific in a PCR reaction with the same conditions as described above. The sequences of the respective primers amplifying the pattern in contradiction to each of the target genes are given in Table 8-EV. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification kit (Qiaquick PCR Purification Kit, Cat. No. 28106, Quiagen) and NaC104 precipitation. The generated forward and reverse T7 patterns were mixed to transcribe and the resulting RNA strands were annealed, DNase and RNase were treated, and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resulting dsRNA for each of the target genes is given in Table 8-EV.

C. Laboratory tests to test dsRNA targets using bean leaf discs for activity against larvae of Epilachna varivetis The example provided below is an example of the finding that Mexican bean beetle larvae (MBB) are susceptible to orally ingested dsRNA. to the white genes. To test the different samples of double-stranded RNA against MBB larvae, leaf disc analysis was used using green bean leaf material (Phaseolus vulgaris Montano variety, source: Aveve NV, Belgium) as a food source. The same variety of beans was used to maintain insect cultures in the insect chamber at 25 ± 2 ° C with 60 ± 5% relative humidity with a photoperiod of 16 h light / 8 h dark. The disks of approximately 1.1 cm in diameter (or 0.95 cm ") were cut from leaves of bean plants from 1 to 2 weeks of age using an appropriately sized weevil.The double-stranded RNA samples were diluted to 0.1 μg / μl in water Milli-Q containing 0.05% Triton X-100. Discs of treated leaves were prepared by applying 25 μl of diluted solution of Ev005, EvOlO, Ev015, Ev016 dsaRN white and gfp control dsARN or 0.05% Triton X-100 in The adaxial leaf surface The leaf discs were allowed to dry and were individually placed in each of the 24 wells of a 24-well multiplate containing 1 ml of gelled agar at the same time. 2% that helps prevent the blade disc from drying out. A single neonate MBB larva was placed in each well of a plate, which was then covered with a multi-well plastic lid. The plate was divided into 3 replicates of 8 insects per replica (row). The plate containing insects and leaf discs was kept in an insect chamber at 25 ± 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16 h of light / 8 h of darkness. The insects were fed on leaf discs for 2 days after which the insects were transferred to a new plate containing discs of freshly treated leaves. Then, 4 days after the start of the bioassay, the insects were transferred to a petri dish containing untreated fresh bean leaves every day until day 10. The mortality of the insects was recorded on day 2 and every two days thereafter. Feeding green bean leaves containing intact pure white dsARN applied to the surface of E. varivestis larvae resulted in significant increases in larval immortality as indicated in Figure 1. The double-stranded RNAs tested from the EVOlO, EV015 , and white EV016 led to 100% mortality after 8 days, while the soft EV005 dsARN took 10 days to kill all larvae. Most insects were fed discs of treated leaves containing gfp ds? control RN or only the surfactant Triton X-100 was sustained through bioanalysis (Figure 1-EV).

D. Laboratory tests to test dsRNA targets using bean leaf discs for adult activity of Epilachna varivestis The example provided below is an exemplification of the finding that adult Mexican bean beetles are susceptible to orally ingested dsRNA, corresponding to white genes. own. In a similar bioanalysis established for Mexican bean beetle larvae, adult MBBs were tested against double-stranded RNA applied topically to bean leaf discs. The test dsRNA of each EvOlO, Ev015, and white Ev016 was diluted in 0.05% Triton X-100 to a final concentration of 0.1 μg / μl. The bean leaf discs were treated by topical application of 30 μl of the solution of Test on each disk. The discs were allowed to dry completely before placing each of a 2% gelled agar portion in each well of a 24-well multi-well plate. Three-day-old adults recovered from the culture cages and were not fed for 7-8 hours before placing an adult in each well of the bioassay plate (thus, there are 24 adults per treatment) . The plates were kept in the posterior chamber of insects (under the same conditions as for MBB larvae for 24 hours) after which the adults were transferred to a new plate containing leaf discs treated with fresh dsRNA. After 24 hrs, the adults of each treatment were recovered and placed in a plastic box with dimensions of 30 cm x 10 cm containing two bean plants seeded in pots and untreated at 3 weeks of age. Insect mortality was evaluated from day 4 to day 11. The three white dsRNAs (EvOlO, Ev015, and Ev016) ingested by adults of Epilachna varivestis resulted in significant increases in mortality from day 4 (4 days after the start of the bioanalysis), as shown in Figure 2 (a) -EV. From day 5, dramatic changes were observed in feeding patterns between individually fed insects with bean leaf discs treated with white dsRNA and those that were fed discs containing control gsdN dsARN or Triton X-100 surfactant. The reductions in foliar damage by adult MBB from untreated bean plants were clearly visible for the three targets when compared with gfp dsRNA and surfactant only as control, either at several levels, the insects fed the target 15 caused less damage to the bean foliage (Figure 2 (b) -EV).

E. Cloning of an MBB gene fragment into a vector suitable for bacterial production of double-stranded RNA active for insects. The following is an example of cloning a DNA fragment corresponding to a target MBB gene in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a promoter of 7 or any another promoter for efficient transcription in bacteria (reference to WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-EV. The pattern used is the vector pCR8 / GW / mole containing any of the target sequences. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 12 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into the vector of pGNA49A aligned with Srf I (reference WO 00188121A1) and sequenced The sequence of the resulting PCR product corresponds to the sequence respective as given in Table 8-EV. The recombinant vector containing this sequence is called pGXXXOXX.

F. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3), and (2) BL21 (DE3). The procedures described below are followed in order to express adequate levels of active double-stranded RNA for insect white insects in bacteria. A deficient strain of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3).

Transformation of AB301-105 (DE3) and BL2KDE3) Three hundred ng of the plasmid were added to and mixed gently in an aliquot of 50 μl of competent chemically cooled E. coli strain AB301-105 (DE3) or BL21 (DE3). The cells were incubated in ice for 20 minutes before being subjected to treatment by heat shock of 37 ° C for 5 minutes, after which the cells were placed back on ice for an additional 5 minutes.

Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to a flask 500 ml conical containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX in the bacterial strain AB301-105 (DE3) or BL21 (DE3) is done possible since all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymers will drive the transcription of the target sequence in the direction of sense and sense since these are flanked by T7 promoters that are oriented in opposite directions. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete medium S (medium of SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin at 1 mM IPTG. Bacteria were induced during? at 4 hours at room temperature.

Heat treatment of bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. Nevertheless, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the supernatant was discarded and the pellet was subjected to 80 [deg.] C. for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each cooling. The tubes were stored at -20 ° C until they were used again.

G. Laboratory tests to test Escherichia coli expressing dsRNA targets against Epilachna vrivetis Complete plant-based bioassays with suspensions of chemically induced bacteria expressing dsRNA before feeding plants to MBB. There is growth in a closed chamber of plant growth. The plants Place in cages placing 500 ml plastic bottles down on the plant with the neck of the bottle firmly placed in the ground in a pot and the cut base covered with a thin nylon mesh to allow aeration, reduce the internal condensation and prevent the insect from escaping. MMB is placed in each treated plant in the cage. The plants are treated with a suspension of AB301-105 (DES) from E. coli harboring the plasmids containing plasmids of pBBNJOOl or plasmid of pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 1 of a bacterial suspension at a wavelength optical density value of 1 to 600 nm. In each case, a total volume of between 1 and 10 ml is sprayed into the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a suspension of AB301-105- (DE3) bacterial strains of E. coli expressing white dsRNA of pBXXXOXX leads to a dramatic increase in insect immortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems of type The wild or deficient RNaselII is toxic to the insect in terms of substantial increases in insect mortality and growth / development retardation for larval survivors. It is also clear from these experiments that exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

Example 6: Anthonomus grandis (cotton boll weevil) dsRNA was synthesized in milligram quantities using the commercially available equipment of the Ribomax ™ Express T7 RNAi System (Cat. No. P1700, Promega), first two patterns of T7 RNA polymerase promoter 5 'only separated were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in sense was generated using specific reverse inverse T7 primers and specific inverses. The sequences of the respective primers to amplify the pattern in the sense for each of the target genes are given in Table 8-AG. A demolition CPR was carried out from the following way: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C with a decrease in a temperature of 0.5 ° C per cycle and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C, Sergio for 10 minutes at 72 ° C. The T7 pattern in contradictory was generated using specific T7 reverse primers in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the counter-sense pattern for each of the target genes are given in Table 8-AG. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (Qiaquick PCR Purification Kit, Cat. No. 28106, Qiagen) and NaC104 precipitation. The generated T7 and inverse patterns were mixed to be transcribed and the resulting RNA strands were annealed, DNase and RNase treated, and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resulting dsRNA for each of the white genes are given in Table 8-AG.

C. Cloning a CBW gene fragment into a vector suitable for bacterial production of insect-active double-stranded RNA The following is an example for cloning a DNA fragment corresponding to a white CBW gene into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-AG. The pattern used is the vector pCR8 / GW / mole containing any white sequence. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquickk Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into SrGl-aligned pGNA49A vector (reference to WO000188121A1), and sequenced. The sequence of the resulting PCR product corresponds to the respective sequence as given in Table 8-AG. The recombinant vector containing this sequence is called pGXXXOXX.

D. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3), and (2) BL21 (DE3) The procedures described below are followed in order to express adequate levels of double RNA Active strand for white insect insects in bacteria. A deficient strain of RNaweTIT, AB301 -105 (DE3), is used in comparison with bacteria containing wild type RNaselII, BL21 (DES).

Transformation of AB301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added to and mixed gently in a 50 μl aliquot of strain AB301-105 (DE3) or BL21 (DE3) of chemically competent E. coli cooled in ice. The cells were incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature was added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of bacterial cell suspension was transferred to a 500 ml conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) and BL2KDE3) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX, in the bacterial strain AB301-105 (DE3) or BL21 (DE3) is made possible since all the genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, T7 polymerase will direct the transcription of the target sequence in the opposite direction and in the sense that these are flanked by opposite-oriented T7 promoters. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria The bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet on the test plates. However, the heat treatment of bacteria that express double RNA The strand is not a prerequisite for inducing toxicity to insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the supernatant was discharged and the pellet was subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each refresh. The tubes were stored at -20 ° C until further use.

E. Laboratory tests to test dsRNA targets expressing Escherichia coli against Anthonomus grandis Plant-based bioanalysis Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to CBW. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. CBW are placed on each treated plant in the cage. La's plants were treated with a suspension of E. coli AB301- 105 (DF, 3) which houses the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, wherein one unit was defined as 10 & bacterial cells in 1 ml of a bacterial suspension with an optical density value of wavelength from 1 to 600 nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from these experiments that an exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria that express double-stranded RNA corresponding to a target of insect gene.

Example 7: Triboluium castaneum (red flour beetle) A. Cloning of partial sequences of Tribolium castaneum High quality intact RNA was isolated from the different insect stages of Tribolum castaneum (red flour beetle: source: Dr. Lara Lord, Insect Investigations Ltd., Capital Business Park, Wenlooog, Cardiff, CF3 2PX, Wales, UK) using TRIzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. Genomic DNA in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). cDNA was generated using commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate cDNA sequences comprising a portion of genes TCOOl, TC002, TCOlO, TC014 and TC015, a series of PCR reactions with degenerate primers will be performed using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions .

The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-TC. These indicators were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minutes at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (TCOOl, TC014, TC015); 10 minutes at 95 ° C followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (TCOlO); 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 5 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C C (TCOlO); 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 7 minutes at 72 ° C (TC002). The resulting PCR fragments were analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), cloned into vector pCR8 / GW / TOPO (Cat. No. K2500-20, Invitrogen), and sequenced. The sequences of the resulting PCR products were represented by SEQ ID NOs as given in Table 2-TC and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by respective SEQ ID NOs as given in Table 3-TC.

B. Production of dsRNA from the Tribolium castaneum genes. DsRNA was synthesized in milligram amounts using the commercially available Ribomax ™ Express T7 RNAi system (Cat. No. P1700, Promega). The first two 5 'T7 RNA polymerase promoter patterns were generated alone separated into two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in one direction was generated using specific forward and reverse specific T7 primers. The sequences of the respective primers to amplify the sense pattern for each of the target genes are given in Table 8-TC. The conditions in the CPR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The T7 pattern in contradiction was generated using specific forward and reverse T7 specific primers in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the counter-sense pattern for each of the target genes are given in Table 8-TC. The resulting PCR products are analyzed on agarose gel and purified by the PCR purification equipment (Qiaquic RCP Purification Kit, Cat. No. 281106, Quiagen) and NaC104 precipitation. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were tuned, DNase and RNase were treated and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resulting dsRNA for each of the target genes are given in Table 8-TC.

C. Laboratory tests to test dsRNA targets, using artificial diet for activity against larvae Tribolium castaneum The example provided below is an exemplification of the finding that larvae of red flour beetle (RFB) are susceptible to orally ingested dsRNA that corresponds to own genes White. The red flour beetles, Tribolium castaneum, were kept in Insect Investigations Ltc. (origin: Imperial College of Science, Technology and Medicine, Silwood Park, Berkshire, UK). The insects were grown according to the company SOp / 251/01. In summary, the beetles were housed in jars or plastic tanks. These have an open top to allow ventilation. A piece of network was adapted on the part top and secured with an elastic band to prevent them from escaping. The posterior medium of larvae (flour) was placed in the container where the beetles are bred. The colonies of stored product beetles were kept in a room at controlled temperature at 25 ± 3 ° C with a light cycle: darkness of 16: 8 hours. The double-stranded RNA of TC014 white (with sequence corresponding to SEQ ID NO 799) was incorporated into a mixture of flour and milk powder (whole flour: milk powder in the ratio 4: 1) and allowed to dry during the night. Each replicate was prepared separately: 100 μl of a dsRNA solution of 10 μg / μl (1 mg dsRNA) was added to a mixture of 0.1 g flour / milk. The dried mixture was ground to a fine powder. The insects were kept inside petri dishes (55 nm in diameter), they were lined with a double layer of filter paper. The treated diet was placed between the two layers of filter paper. Ten mixed-sex larvae, from the first stage, were placed on each plate (replicated). Four replications were made for each treatment. The control was Milii-Q water. Evaluations (number of survivors) were conducted on a regular basis. During the test, the test conditions were 25 - 33 ° C and 20 - 25% relative humidity, with a photoperiod of light: darkness of 12:12 hours. Survival of T. castaneum larvae over time on artificial diet treated with dsARN TC014 white was significantly reduced when compared to diet with only control, as shown in Figure 1-TC.

C. Cloning of an RFB gene fragment into a vector suitable for bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target gene into a vector for double-stranded RNA expression. strand in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-TC. The pattern used is the vector pCR8 / GW / mole containing any white sequence. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), cloned blunt end in pGNA49A vector aligned with Srf I (reference WO00188121A1), and sequencing The sequence of Resulting PCR product corresponds to the sequence as given in Table 8-TC. The recombinant vector containing this sequence is called pGXXXOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3) and (2) BL21 (DE3) The procedures described below are followed in order to express adequate levels of Active double-stranded RNA for insect insects in bacteria. A deficient layer of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE32).

Transformation of AB301-105 (DE3) and BL2KDE3) Three hundred ng of the plasmid were added and mixed gently in a 50 μl aliquot of AB301-105 (DE3) or BL21 (DE3) strain of competent E. coli chemically cooled on ice. The cells were incubated on ice for 20 minutes before subjecting them to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature was added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour.

One hundred μl of the bacterial cell suspension was transferred to 500 ml of conical flask containing 150 m of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated in an Innova 4430 agitator (25 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) and BL2KDE3) Expression of double-stranded RNA from the recombinant vector, pGXXOXX, in the bacterial strain AB301-105 (DE3) or BL21 (dE3) is possible since all genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase directs the transcription of the target sequence in the opposite direction and sense, these flank by T7 promoters oriented opposite. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a Falcon tube. 50 ml and the culture was centrifuged at 300 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml cholesterol) supplemented with 100 μg / ml carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria The bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet on the test plates. Nevertheless, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the supernatant was discharged and the pellet was subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each refresh. The tubes were stored at -20 ° C until further use.

F. Laboratory tests to test dsRNA targets expressing Escherichia coli against Tribolium castaneum Plant-based bioassay Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before Feed the plants to RFB. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. RFB are placed on each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 10q bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 wavelength nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and retardation in growth / development for larval survivors. It is also clear from these experiments that exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

Example 8: Myzus persicae (green peach aphid) A. Cloning of partial sequences of Myzus persicae High quality intact RNAs were isolated from Myzus persicae nymphs (green peach aphid), source: Dr. Rachel Down, Insect &Pathogen Interact ions, Central Science Laboratory, Sand Hutton Cork, Y041 1LZ, UK) using TRIzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). cDNA was generated using commercially available equipment (Reverse Transcriptase SuperScript ™ TIT, Cat. No. 18080044, Tnvitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of genes MP001, MP002, MP010, MP016 and MP027, a series of PCR reactions with degenerate primers were performed using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-MP. These initiators were used in respective PCR reactions with the following conditions: for MP001, MP002 and MP016, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 40 seconds at 60 ° C with a decrease in temperature of 1 ° C per cycle and 1 minute 10 seconds at 72 ° C, followed by 30 cycles of 30 seconds at 95 ° C, 40 seconds at 50 ° C and 1 minute 10 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for MP010, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 3 minutes at 72 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments were analyzed on agarose gel, purified (QlAquick Gel Extraction Equipment, Cat. No. 28706, Quiagen), cloned in vector pCR8 / GW / TOPO (Cat. No. K2500-20, Invitrogen), and sequenced. The sequences of the resulting PCR products are represented by respective SEQ ID NOs as given in Table 2-MP and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by SEQ ID NOs as given in Table 3-MP.

B. Production of dsRNA from Myzus persicae genes DsRNA was synthesized in milligram quantities using the commercially available Ribomax ™ T7 RNAi system Express (Cat. No. P1700, Promega). The first two separate 5 'T7 RNA polymerase promoter patterns alone were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense pattern was generated using specific T7 specific inwards and specific reverse primers. The sequences of the respective primers by amplification of the sense pattern for each of the target genes is given in Table 8-MP. An elimination PCR was performed as follows: 1 minute at 95 ° C, 30 seconds at 55 ° C (for MPOOl, MP002, MP016, MP027 and gfp) or 30 seconds at 50 ° C (for MP010) with a decrease at a temperature of 0.5 ° C per cycle and 1 minute at 72 ° C, followed by 15 cycles of 3 seconds at 95 ° C, 30 seconds at 45 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. the T7 pattern in contra-sense was generated using forward and reverse primers T7 specific in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the pattern in contradiction to each target gene are given in Table 8-MP. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (Qiaquick PCR Purification Kit, No. 28106, Quiagen) and NaC104 precipitation. The generated forward and reverse T7 patterns were mixed to be transcribed and the resultant RNA strands were annealed. Dnasa and Rnasa were treated, and purified by sodium acetate, following the manufacturer's instructions. The resulting strand of dsRNA for each of the white genes is given in Table 8-MP.

C. Laboratory tests of infestation by myzus persicae (green peach aphid) in transgenic Arabidopsis thaliana plants Generation of transgenic plants Arabidopsis thaliana plants were transformed using the deep floral method (Clough and Bent (1998) Plant Journal 16: 735 -743). The aerial parts of the plants were incubated for a few seconds in a solution containing 5% sucrose, C58C1 Rif cells from the Agrobacte ium tumefaciens st resuspended from a nocturnal culture and 0.03% from the Silwet L-77 surfactant. After of the inoculation, the plants were covered for 16 hours with a transparent plastic to maintain humidity. To increase the transformation efficiency, the procedure was repeated after one week. The water supply stopped when the seeds matured and the dry seeds were harvested and treated with cold for two days. After sterilization, the seeds were seeded in a growth medium containing kanamycin for the selection of transformed plants. The selected plants were transferred to the land for the optimum production of T2 seeds.

Bioanalis Transgenic Arabidopsis thaliana plants were selected allowing the segregation of T2 seeds to germinate in the appropriate selection medium. When the roots of these transgenics are well established they are transferred to the fresh artificial growth medium or soil and allowed to grow under optimal conditions. Whole transgenic plants were tested against nymphs of the green peach aphid (Myzus persicae) to show (1) a significant resistance to plant damage by the nymph feeding, (2) increased nymph mortality, and / or (3) weight decreased number of surviving nymphs (any other aberrant insect development).

D. Laboratory tests to test dsRNA targets using artificial fluid diet for activity against Myzus persicae The liquid artificial diet for the green peach aphid, Myzus persicae, was prepared based on the diet suitable for pea aphids (Acyrthosiphon pisum), as was described by Bebía and others (1988) [Influence of the amino acid balance on the improvement or artificial fan diet for a biotype of Acyrthosiphon pisum (Horaoptera: Aphididae). Dog. J. Zool. 66: 2449-2453], but with some modifications. The amino acid component of the diet was prepared as follows: in mg / 100 ml, alanite 178.71, beta-alanine 6.22, arginine 244.9, asparagine 298.55, aspartic acid 88.25, cistern 29.59, glutamic acid 149.36, glutamine 445.61, glycine 166.56 , histidine 136.02, isoleucine 164.75, leucine 231.56, lysine hydrochloride 351.09, methionine 72.35, ornithine (HCl) 9.41, phenylalanine 293, proline 129.33, serine 124.28, threonine 127.16, tryptophan 42.75, tyrosine 38.63, L-valine 190.85. The amino acids were dissolved in 30 ml of H20 Milli-Q except for tyrosine which was first dissolved in a few drops of HCl IM before adding the amino acid mixture. The vitamin mixture component of the diet was prepared as a 5x concentrated material in the following manner: in mg / l, aminobenzoic acid 100, ascorbic acid 1000, biotin 1, calcium pantothenate 50, choline chloride 500, folic acid 10, aminoinositol 420, nicotinic acid 100, pyridoxine hydrochloride 25, riboflavin 5, vitamin 25 hydrochloride. Riboflavin was dissolved in 1 m H20 at 50 ° C and then added to the mixed vitamin material. An aliquot of vitamin mixture was taken in 20 ml per aliquot and stored at -20 ° C. An aliquot of the vitamin mixture was added to the amino acid solution. Sucrose and MgSO4.7H20 were added with the following amounts to the mixture: 20 g and 242 mg, respectively. The solution of the trace metal material was prepared as follows; in mg / 100 ml, CuS045H20 4.7, FeCl, .6H: 0 44.5, MnCl2.4H20 6.5, NaCl 25.4, ZnCl2 8.3. Ten ml of the trace metal solution and 250 mg of KHxP04 were added to the diet and Milli-Q water was added to a final liquid volume of 100 ml. The pH of the diet was adjusted to 7 with a KOH ÍM solution. The liquid diet was filtered-sterilized through a Millipore 0.22 μm filter disc. Aphids of green durzno (Myzus persicae; source: Dr. Rache. Down, Insect & Pathogen Interactions, Central Science Laboratory, St. Hutton, Cork, Y041 1LZ, UK) were bred in rape from 4 to 6 weeks of age (variety Brassica napus SW Oban; source: Nick Balaam, SW seed Ltd .., 49 North Road, Abington, Cambridge, CBl 6AS, UK) in frame cages of aluminum containing a 70 μm mesh in a controlled environment chamber with the following conditions: 23 ± 2 ° C and 60 ± 5% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. One day before starting the bioassay, adults were recovered from the breeding cages and placed in fresh rapeseed leaves fresh in a Petri dish and left overnight in the insect chamber, the next day, the nymphs of the first stage They were bitten and transferred to feeding chambers. A feeding chamber comprised 10 nymphs in the first stage placed in a small Petri dish (diameter of 3 cm) covered with a single layer of paraffin film and incubated under the same conditions as adult cultures. The diet with dsRNA was refreshed every day and the survival of insects was evaluated on day 8, that is, the 8th. Day after the start of bioanalysis. By treatment, 5 bioanalysis feeding chambers (replicated) were established simultaneously. The test and control dsRNA solutions (gfp) were incorporated into the diet at a final concentration of 2 μg / μl. The feeding chambers were maintained at 23 ± 2 ° C and 60 ± 5% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. A Mann-Qhitney test was determined by GraphPad Prism version 4 to establish whether the means differ significantly between white 27 (MP027) and gfp dsARN. In the bioanalysis, the liquid artificial feeding diet supplemented with intact pure dsRNA of target 27 (SEQ ID NO 1061) to Myzus persicae nymphs using a feeding chamber, resulted in a significant increase in mortality, as shown in Figure 1. The average percentage of survivors for target 27, gfp dsRNA and diet only for treatment were 2, 34 and 82, respectively. Comparison of blank 027 with gfp dsRNA groups using the Mann-Whitney test resulted in a P-value of a tail of 0.004 which indicates that the target mean 027 is significantly different (P <0.05) from the expected larger mean of gfp dsARN. The green peach aphids in the liquid diet with white incorporated 27 dsRNA were notoriously smaller than those that were fed on the diet alone or with control of gfp dsRNA (data not shown).

E. Cloning of a GPA gene fragment into a vector suitable for bacterial production of active double-stranded RNA for the insect The following is an example of cloning a DNA fragment corresponding to a target of GPA gene in a vector for the expression of double-stranded RNA in a bacterial host, although in the vector comprising a T7 promoter or any other promoter can be used for efficient transcription in bacteria, (reference WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-MP. The pattern used is the pCR8 / GW / topo vector containing any white sequence. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into vector pGNA49A aligned with Srf I (reference to WO00188121A1), and sequenced . The sequence of the resulting PCR product corresponds to the respective sequence as given in Table 8-MP. The recombinant vector containing this sequence is called pGXXXOXX.

Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB310-105 (DE3), and (2) BL21 (dE3) The procedures described below were followed in order to express adequate levels of RNA double strand active for insects of white LD010 in bacteria. A strain deficient in RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3). Transformation of B301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added and mixed gently in a 50 μl aliquot of competent chemically cooled E. coli strain in ice AB301-105 (DE3) or BL21 (DE3) . The cells were incubated on ice for 20 minutes before being subjected to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to 500 ml of conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours). Chemical indication of double-stranded RNA expression in AB301-105 (DE3) and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in bacterial strain AB301-105 (DE3) or BL21 (DE3) was possible since all the genetic components for controlled expression. In the presence of chemical inducer isopropi 1 t iogal actside, or IPTG, T7 polymerase will direct the transcription of the target sequence in both directions of sense and sense since these are flanked by the T7 promoters oppositely oriented. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 1 fresh complete medium S (SCN medium plus 5 μg / ml cholesterol) supplemented with 100 μg / ml carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature. Heat Treatment of Bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of double-stranded RNA expressing bacteria is not a prerequisite for inducing toxicity to insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the supernatant discarded and the pellet subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each cooling. The tubes were stored at -20 ° C until they were used.

G. Laboratory tests to test Escherichia coli expressing dsRNA targets against Myzus persicae Plant-based bioassays Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to GPA. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. CBW are placed on each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DES) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 10 and bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from these experiments that exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

Example 9: Nilaparvata lugens (Grasshopper of brown plants) A. Cloning of partial sequences of Nilaparvata lugens From high quality total RNA of Nilaparvata lugens (source: Dr. JA Gatehouse, Dep. Biological Sciences, Dirham Univesity, UK) cRNA was generated using a commercially available piece (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the protocol manufacturer. The sequences of the degenerate primers used for amplification of each of the genes is given in Table 2-NL. These primers were used in respective PCR reactions with the following conditions: for NL001: 5 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. for NL002: 3 minutes at 95 ° C, 10 minutes at 72 ° C; for NL003: 3 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 61 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL004: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 51 ° C and 1 minute at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C C; for nL006: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 5 ° C and 3 minutes 30 seconds at 72 ° C; for NL008 & NL014: 10 minutes at 95 ° C, followed by 40 cycles of SW seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for nL009, NL011, NL012 and NL019: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 12 ° C, followed by 10 minutes at 72 ° C; for nL010. 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes 30 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for nL013: 10 minutes at 9b ° C, followed by 40 cycles of 30 seconds at 95 ° C 1 minute at 54 ° C and 1 minute 10 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL015 and NL016; 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 40 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL01: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 35 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL021, NL022 and NL027: 10 minutes at 95 ° C, followed by 40 cycles of 30 minutes at 72 ° C; for nL021, NL022 and NL027L 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 45 seconds at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragments were analyzed on agarose gel, purified (QUIAquick Cat Gel Extraction Kit No. 28706, Quiagen), cloned into the vector pCR8 / GW / mole (Cat. No. K2500 20, Invitrogen), and sequenced. The sequences of the resulting PCR products were represented by respective TD TD nO as given in Table 2-NL and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by SEQ.sub.D.sub.D.sub.No, as discussed in Table 3-NL.

B. Cloning of a partial sequence of the Nilaparvata lugens gene NL023 NL023 via EST sequence From the high quality total RNA of the Nilaparvata lugens cDNA (source: Dr JA Gatehouse, Dep .. Biological Sciences, Dirham University, UK) were generated using a commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's protocol. A partial cDNA sequence, NL023, was amplified from Nilaparvata lugens cDNA corresponding to an EST sequence of Nilaparvata lugens in the GenBank public database with accession number CAH65679.2. To isolate the cDNA sequences comprising a portion of the NL023 gene, a series of PCR reactions with specific EST-based primers were performed using PerfectShot ™ Ex Taq (Cat. No. RR005A, Takara Bio Inc.) following the protocol of maker. For NL023, the specific primers OBGKW002 and OBGKW003 (represented herein as SEQ ID NO 1157 and SEQ ID NO 1158, respectively) were used in two independent PCR reactions with the following conditions: 3 minutes at 95 ° C, followed by 30 cycles of 30 seconds at 95 ° C, 30 seconds at 56 ° C and 2 minutes at 12 ° C. ° C, followed by 10 minutes at 72 ° C. The resulting PCR products were analyzed on agarose gel, purified (QIAquick® Gel Extract Kit, Cat. No. 28706, Quiagen), cloned into the pCR4-TOPO vector (Cat. No. K4575-40, Invitrogen ) and it was sequenced. The consensual sequence that results from the sequence of both PCR products is represented herein by SEQ ID NO 1111 and is referred to as the partial sequence of the NL013 gene. The corresponding partial amino acid sequence is represented in the present as SEQ ID NO 1112.

C. Production of dsRNA from Lilaparvata lugens genes DsRNA was synthesized in milligram amounts using the commercially available T7 kit of the Ribomax ™ Express RNAi system (Cat. No. P1700, Promega). The separate single 5 'T7 RNA polymerase promoter patterns were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in sense was generated using forward T7 primers Specific and specific reverse. The sequences of the respective primers to amplify the one-way pattern for each of the target genes are given in Table 8-NL. The conditions in the CR reactions were as follows: for NL001 and NL002: 4 minutes at 94 ° C, followed by 35 cycles of 30 seconds at 94 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed for 10 minutes at 12 ° C; for NL003: 4 minutes at 94 ° C, followed by 35 cycles of 30 seconds at 94 ° C, 30 seconds at 66 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL004, NL006,. NL008, NL009, NL010 and NL010: 4 minutes- at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C , for NL005 and NL016: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 57 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for nL007 and NL014: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 51 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL011, NL012 and NL022: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for N1013, NL015, NL018 and N1021: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for nL02S and NL027: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 52 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The T7 pattern in contradiction was generated using specific forward and reverse primers T7 specific in a PCR reaction with the same conditions described above. The sequences of the respective primers to amplify the counter-sense pattern for each of the target genes are given in Table 8-NL. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification kit (Quiaquick PCR Purification Kit, Cat. No. 28106, Quiagen). The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were annealed, DNase and RNase were treated, and purified by sodium acetate, following the manufacturer's instructions, but with the following modification: RNA was washed twice in 70 ° ethanol. The resulting strand of dsRNA for each of the genes is given in Table 8-NL. The standard DNA used for the PCR reactions with the T7 primers in the control of green fluorescent protein (gfp) was the plasmid pPD96.12 (The Fire Lab, http: // genome-www. Stanford , edu / group / FIRE /), which contains the gfp coding sequence of the wild type interspersed by 3 synthetic introns. Double-stranded RNA was synthesized using the commercially available T7 RiboMAX ™ Express RNAi system (Cat. No. P1700, Promega). Two first were generated 'separate T7 RNA polymerase promoter patterns alone were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For gfp, the T7 sense pattern was generated using the specific OGAU183 FW T7 primer and the specific OGAU182 RV primer (represented herein as SEQ ID NO 236 and SEQ ID NO 237, respectively) in a PCR reaction with the following conditions : 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The T7 pattern in contradictory was generated using the specific 0GAUI8I FW primer and the specific OGAU184 RV T7 primer (represented herein as SEQ ID NO 238 and SEQ ID NO 239, respectively) in a PCR reaction with the same conditions as described before. The resulting PCR products were analyzed on agarose gel and purified (QIAquick® PCR Purification Kit, Cat. No. 28106, Qiagen). The generated FW and RV T7 standards were mixed to be transcribed and the resulting RNA strands were annealed, treated with DNase and RNase, and purified by precipitation with sodium acetate and isopropanol, following the manufacturer's protocol, but with the following modification. The RNA pipette was washed twice in 70% ethanol. The strands in The sense of the resulting dsRNA is represented herein by SEQ ID NO 235.

D. Laboratory tests to screen dsRNA targets using liquid artificial diet for activity against Nilaparvata lugens Liquid artificial diet (MMD-1) was used for the brown rice planthopper of rice, Nílaparvata lugens, was prepared as described by Koyama (1988) [Artificial rearing and nut ional physiology of plant hoppers and leafhoppers (Homoptera: Delpahcidae and Deltocephalidae) in a holidic diet. Jara 22: 20-27], but with a change in the final sucrose concentration of the diet component: 14.4% (weight on volume). The diet components were prepared as separate concentrates: 10 x mineral material (stored at 4 ° C), 2 x amino acid material (stored at -20 ° C and 10 x vitamin material (stored at -20 ° C) I. Reserve components were mixed immediately before the single bioanalysis at 4/3 concentration to allow dilution with the dsRNA test solution (4x concentration), pH adjusted to 6.5, and filter sterilized in aliquots of approximately 500 μl. of rice coffee plant (Nilaparvata lugens) was raised in rice plants from two to three months of age (Oryza sativa cv Taichung Native 1) in a controlled environment chamber: 27 ± 2 ° C, 80% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. A feeding chamber comprised 10 nymphs of the first or second stage placed in a small petri dish (with a diameter of 3 cm) covered by a single layer of thinly stretched paraffin film M in which 50 μl of diet was added . The chamber was sealed with a second layer of paraffin film and incubated under the same conditions as adult cultures but without exposure to direct light. The diet with dsRNA was refreshed every two days and the surviving insects were evaluated daily. For treatment, 5 bioanalysis feeding chambers (replicated) were established simultaneously. The test and control dsRNA solutions (gfp) were incorporated into the diet at a final concentration of 2 rag / ral. The feeding chambers were maintained at 27 ± 2 ° C, 80% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. Insect survival data were analyzed using the Kaplan-Meier survival curve model and survival between groups was compared using the log classification test (Prism version 4.0). The feeding of the artificial liquid diet with intact pure dsRNA to Nilapavata lugens in Vitro using a feeding chamber resulted in significant increases in the mortality of the nymph as shown in FIG. four separate bioassays (Figures 1 (a) - (d) -NL; Tables 10-NL (a) - (d)) (Dirharn University). These results demonstrate that dsRNA, which corresponds to different essential BPH genes, showed significant toxicity to the brown rice grasshopper. The effect of gfp dsRNA on BPH survival in these bioassays does not differ significantly from the survival of those who are only treated with diet. Tables 10-NL (a) - (d) show a summary of the survival of Nilaparvata lugens in artificial diet supplemented with 2 mg / ml (final concentration) of the following targets; in Table 10-NL (a): NL002, NL003, NL005, NL010; in Table 10-NL (b): NL009, NL016 in Table 10-NL (c): NL014, NL018; and in Table 10-NL (d): NL013, NL015, NL021. In the survival analysis column, the effect of RNAi is indicated as follows: + = significantly decreased survival compared to gfp control dsRNA (alpha <0.05); - = difference not important in survival compared to control gfp dsRNA. Survival curves were compared between only diet and diet supplemented with dsRNA test, gfp of ARN and dsRNA test, and diet only and gfp dsARN) using the log classification test.

E. Laboratory tests to screen dsRNA at different concentrations using artificial diet for activity against Nilaparvata lugens Fifty μl of liquid artificial diet supplemented with different concentrations of white dsRNA NL002, namely 1, 0.2, 0.08 and 0.04 mg / ml (final concentration), it was applied to the brown grasshopper feeding chambers. The diet with dsaRN was refreshed every two days and the survival of insects was evaluated daily. By treatment, 5 bioanalysis feeding chambers (replicated) were established simultaneously. The feeding chambers were maintained at 27 ± 2 ° C, 80% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. The insect survival data were analyzed using the Kaplan-Meier survival curve model and the survival between groups was compared using the log classification test (Version Pism 4.0). Feeding artificial liquid diet supplemented with intact pure dsRNA from white NL002 at different concentrations resulted in significantly higher mortalities of BPhH at final concentrations of as low as 0.04 mg dsaRN per ml of diet when compared to survival only with diet, as is shown in Figure 2-NL and Table 11-NL. Table 11-NL summarizes the artificial diet feeding trial survival Nilaparvata lugens supplemented with 1. 0.2, 0.08 and 0.04 mg / ml (final concentration) of white NL002. In. the survival analysis column the effect of RNAi was indicated as follows: + = significantly decreased survival compared to control with diet only (alpha <0.05); - = there are no significant differences in survival compared to control that is only with diet. Survival curves are compared using the log classification test.

F. Cloning a BPH gene fragment into a vector suitable for bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target gene in a vector for the expression of Double-stranded RNA in a bacterial host, although any vector comprising a promoter T7 or any other promoter for efficient transcription in bacteria can be used (reference WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in the Table 8-NL. The pattern used is the vector pCR8 / GW / mole containing any white sequence. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, seconds at 55 ° C and 2 minutes at 72 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 12 ° Q., followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), blunt end cloned into vector of pGNA49A aligned with Srf I (reference to WO0Ú188121A1), and sequenced. The sequence of the resulting PCR product corresponds to the sequence as given in Table 8-NL. The recombinant vector containing this sequence is called pGXXXOXX.

G. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3) and (2) BL21 (DE3) The procedures described below are followed in order to express levels of active double-stranded RNA for insects of insect targets in bacteria. A deficient layer of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE32).

Three hundred ng of the plasmid was added and mixed gently in a 50 μl aliquot of competent chemically cooled E. coli strain in ice AB301-105 (DE3) or BL21 (DE3). The cells were incubated on ice for 20 minutes. minutes before subjecting them to heat shock treatment of 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to 500 ml of conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours). Chemical indication of double-stranded RNA expression in ABS01-105 (DES) and BL2KDE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in bacterial strain AB301-105 (DE3) or BL21 (DE3) was possible given that all genetic components are present for controlled expression. In the presence of isopropylthiogalactoside chemical inducer, or IPTG, T7 polymerase will direct the transcription of the target sequence in both directions of sense and sense since these are flanked by the opposite-oriented T7 promoters. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of broth LB fresh. Fifty ml of this culture was transferred to a Falcon tube of 50 rnl and the culture was then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 1 fresh complete medium S (SCN medium plus 5 μg / ml cholesterol) supplemented with 100 μg / ml carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature. Heat Treatment of Bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of double-stranded RNA expressing bacteria is not a prerequisite for inducing toxicity to insects due to RNA interference. The induced bacterial culture was centrifuged at 3000 g at room temperature for 10 minutes, the discarded supernatant and the pellet subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. Several tubes were prepared and used in the bioassay for each cooling. The tubes were stored at -20 ° C until they were used.

H. Laboratory Tests to Test Escherichia coli expressing dsARN white LD010 against Nilaparvata lugens Plant based bioassay Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to BPH. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. BPH are placed on each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 109 bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 wavelength nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded.

Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from these experiments that exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

Example 10: Chilo suppressalis (stems weevil in rice strips) A. Partial cloning of genes Chilo suppressalis via family CPR High quality intact RNA was isolated from 4 different stages of Chilo suppressalis larvae (stem weevil in rice strips) (using TRIzol Reagent (CAt. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). The cDNA was generated using commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate cDNA sequences comprising a portion of CSOOl genes, CS002, CS003, CS006, CS007, CS009, CS011, CS013, CS014, CS015, LC016 and CS018, a series of PCR reactions with degenerate primers was carried out using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-CS. These primers were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes. minutes at 72 ° C. The resulting PCR fragments were analyzed on agarose gel, verified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), cloned into the vector pCR8 / GW / mole (Cat. No. K2500 20, Invitrogen) and sequenced. The sequences of the resulting PCR products arerepresented by SEQ ID NO: respective as given in Table 2-CS and are referred to as the partial sequences. The sequence of corresponding partial amino acids are represented by SEQ ID NOs as given in Table 3-CS.

B. Production of dsRNA from Chilo suppressalis genes DsRNA was synthesized in milligram quantities using the commercially available T7 kit of the Ribomax ™ Express RNAi system (Cat. No. P1700, Promega). The separate single 5 'T7 RNA polymerase promoter patterns were generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense pattern was generated using specific forward and reverse specific T7 primers. The sequences of the respective primers to amplify the one-way pattern for each of the target genes are given in Table 8-CS. The conditions in the PCR reactions were as follows: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. ° C. The T7 pattern was generated in contradiction using specific forward primers and Inverse T7 specific in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the counter-sense pattern for each of the target genes are given in Table 8-CS. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (Quiaquick PCR Purification Kit, Cat. No. 28106, Qiagen) and NaC10 precipitation. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were annealed, treated with DNase and RNase, and purified by sodium acetate, following the manufacturer's instructions. The strand in the sense and the resulting RNA for each of the target genes are given in Table 8-CS.

C. Laboratory tests to test dsRNA targets using artificial diet for activity against Chilo suppressalis larvae Rice stem stem weevils, Chilo suppressalis, (origin: Syngenta, Stein, Switzrland) were kept on a modified artificial diet based on the one described by Kamano and Sato, 1985 (in: Handbook of Insect Rearing, Volumes I and II, P Singh and RF Moore eds., Elsevier Scince Publishers, Amsterdan and New Cork, 1985, pp. 448). In summary, a liter diet was constituted of as follows: 20 g of agar added to 980 ml of Milli-Q water and sterilized in an autoclave; the agar solution was cooled to approximately 55 ° C and the remaining ingredients were added and mixed vigorously: 40 g of corn flour (Polenta), 20 g of cellulose, 30 g of sucrose, 30 g of casein, 20 g of germ of wheat (toasted), 8 g of Wesson salt mixture, 12 g of Vanderzant vitamin mixture, 1.8 g of sorbic acid, 1.6 g of nipagine (methylparaben), 0.3 g of aureomycin, 0.4 g of cholesterol and 0.6 g of L -cisteina. The diet was cooled to approximately 45 ° C and poured into trays or breeding cups. The diet settled in horizontal laminar flow cabin. Sections of rice leaf with deposited eggs were removed from a cage by housing adult moths and drilled to the solid diet in the breeding dish or tray. The eggs were hatched and the neonate larvae were available for bioanalysis and the maintenance of insect cultures. During the trials and crianzas, the conditions were 28 + 2 ° C and 80 + 5% relative humidity, with a photoperiod of light: darkness of 16: 8 hours. The same artificial diet was used for the bioanalysis but in this case the diet was poured in the same way in plates of 24 multiple wells, each well containing 1 ml of diet. Once the diet settles, the test formulations are applied to the diet surface (2 cm2), at the regime of 50 μl of 1 μg / μl dsRNA of white. The dsRNA solutions were allowed to dry and two moth larvae were placed in the first stage in each well. After 7 days, the larvae were transferred to fresh-treated diet in multi-well plates. On day 14 (ie, 14 days after the start of bioanalysis) the number of live and dead insects was recorded and examined for abnormalities. Twenty-four larvae in total were tested by treatment. An alternative bioassay was carried out in which the treated rice leaves were fed to the neonate larvae of the stem weevil in rice strips. Sections of small leaves of the Indica Taichung native 1 variety were immersed in Triton X-100 0.05% solution containing 1 μg / μl of white dsRNA, allowed to dry and each section was placed in a well of a 24-plate multiple wells containing 2% gelled agar. Two neonates were transferred from the brood pan to each section of leaves treated with dsRNA (24 larvae per treatment). After 4 to 8 days, the larvae were transferred to sections of fresh treated rice leaves. The number of live and dead larvae was evaluated on days 4, 8, and 12; Any abnormality was also recorded.

D. Cloning of an SSB gene fragment into a vector suitable for bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a white MBB gene into a vector for expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-CS. The pattern used is the vector pCR8 / GW / mole containing any of the target sequences. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into the vector of pGNA49A aligned with Srf I (reference WO 00188121A1) and sequenced The sequence of the resulting PCR product corresponds to the respective sequence as given in Table 8-CS. The recombinant vector containing this sequence is called pGXXXOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3), and (2) BL21 (DE3). The procedures described below are followed in order to express adequate levels of active double-stranded RNA for insect white insects in bacteria. A deficient strain of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3).

Transformation of AB301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added to and mixed gently in an aliquot of 50 μl of strain AB301-105 (DE3) or BL21 (DE3) of competent chemically cooled E. coli. The cells were incubated on ice for 20 minutes before being subjected to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to a 500 ml conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml of antibiotic carbenicillin. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX, in strain AB301-105 (DE3) of bacteria was possible since all genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase will direct the transcription of the target sequence in the directions of sense and contradictory since they are flanked by T7 promoters that are oriented in an opposite direction. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite to induce insect toxicity due to RNA interference. The induced bacterial culture was centrifuged at 300 g at room temperature for 10 minutes, the discarded supernatant and the pellet subjected to 80 ° C for 20 minutes in a water bath.

After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. The tube was stored at -20 ° C until later use.

F. Laboratory tests to test Escherichia coli expressing dsRNA targets against Chilo supressalis Plant-based bioassay Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to SSB. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. SSB are placed on each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 109 bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 wavelength nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from In these experiments an exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to an insect gene target.

Example 11: Plutella xylostella (Diamondback moth) A. Cloning of partial sequences of Plutella xylostella High quality intact RNA was isolated from the different insect stages of Plutella xylostella (Diamondback moth: source: Dr. Lara Lord, Insect Investigations Ltd ., Capital Business Park, Wenlooog, Cardiff, CF3 2PX, Wales, UK) using TRIzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. Genomic DNA in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). cDNA was generated using commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate cDNA sequences comprising a portion of genes PXOOl, PX009, PX010, PX015 and PX016, a A series of PCR reactions with degenerate primers will be performed using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-PX. These indicators were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minutes at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (PXOOl, PX009, PX015, PX016); 10 minutes at 95 ° C followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (PX010). The resulting PCR fragments were analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), cloned into vector pCR8 / GW / TOPO (Cat. No. K2500-20, Invitrogen), and sequenced. The sequences of the resulting PCR products were represented by SEQ ID NOs as given in Table 2-PX and are referred to as the partial sequences. The corresponding partial aminoacid sequences are represented by respective SEQ ID NOs as given in Table 3-PX.

B. Production of dsRNA from the Plutella xylostella genes DsRNA was synthesized in amounts in milligrams using the commercially available Ribomax ™ Express T7 RNAi system (Cat. No. P1700, Promega). The first two 5 'T7 RNA polymerase promoter patterns were generated alone separated into two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in one direction was generated using specific forward and reverse specific T7 primers. The sequences of the respective primers to amplify the sense pattern for each of the target genes are given in Table 8-PX. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The T7 pattern in contradictory was generated using specific forward and reverse T7 specific primers in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the pattern in contradiction to each of the target genes are given in Table 8-PX. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (CPR Purification Kit).

Qiaquic, Cat. No. 281106, Quiagen) and precipitation of NaC104. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were tuned, DNase and RNase were treated and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resulting dsRNA for each of the target genes are given in Table 8-PX.

C. Laboratory tests to test dsRNA targets, using artificial diet for activity against Plutella xylostella larvae Diamond-back moths, Plutella xylostella, were maintained in Insect Investigations Ltd. (origin: Newcastle University, Newcstle-upon-Tyne, UK). The insects were bred in pumpkin leaves. Mixed-sex, first-stage larvae (approximately 1 day old) were selected for use in the trial. The insects were kept in Eppendorf tubes (1.5 ml capacity). The diet of commercially available Diamond-back moths (Bio-Serv, NJ, USA), prepared following the manufacturer's instructions, were placed on the top of each tube (0.25 ml capacity, 8 mm diameter). While it remained liquid, the diet was more uniform to remove excess and produce a smooth surface.

Once the diet was established, the test formulations were applied to the surface of the diet at the 25 μl undiluted formulation (1 μg / μl dsRNA of targets) per replicate. The test formulations were allowed to dry and a moth larva was placed in the first stage in each tube. The larva was placed on the surface of the diet in the lid and the tube was carefully closed. The tubes were stored down on their lids so that each larva remained on the surface of the diet. Twice a week the larvae were transferred to new Eppendorf tubes with fresh diet. The insects were provided with diet treated during the first two weeks in the trial and then with untreated diet. Evaluations were conducted twice a week for a total of 38 days at which point all the larvae died. In each evaluation the insects were evaluated as alive and dead and examined for abnormalities. Forty replicas of larvae alone were made for each of the treatments. During the test, the conditions of the test are 23 to 26 ° C and 50 to 65% relative heat, with a photoperiod of light: darkness of 16: 8 hours.

D. Cloning of a DBM gene fragment into a vector suitable for bacterial production of active double-stranded RNA for insects The following is an example of cloning a DNA fragment corresponding to a target DBM gene in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any another promoter for efficient transcription in bacteria (reference to WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 8-PX. The pattern used is the vector pCR8 / GW / mole containing any of the target sequences. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into the vector of pGNA49A aligned with Srf I (reference WO 00188121A1) and sequenced The sequence of the resulting PCR product corresponds to the respective sequence as given in Table 8-PX. The recombinant vector containing this sequence is called pGXXXOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3), and (2) BL21 (DE3). The procedures described below are followed in order to express adequate levels of active double-stranded RNA for insect white insects in bacteria. A deficient strain of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3).

Transformation of AB301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added to and mixed gently in an aliquot of 50 μl of strain AB301-105 (DE3) or BL21 (DE3) of competent chemically cooled E. coli. The cells were incubated on ice for 20 minutes before being subjected to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to a 500 ml conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml of antibiotic. carbenicillin. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX, in strain AB301-105 (DE3) of bacteria was possible since all genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase will direct the transcription of the target sequence in the directions of sense and contradictory since they are flanked by T7 promoters that are oriented in an opposite direction. The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite to induce insect toxicity due to RNA interference. The induced bacterial culture was centrifuged at 300 g at room temperature for 10 minutes, the discarded supernatant and the pellet subjected to 80 ° C for 20 minutes in a water bath.

After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. The tube was stored at -20 ° C until later use.

F. Laboratory tests to test Escherichia coli expressing dsRNA targets against Chilo supressalis Plant-based bioassay Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to DBM. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. DBM are placed in each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 109 bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 wavelength nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded. Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from In these experiments an exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to an insect gene target.

Example 12: Acheta domesticus (garden grasshopper) A. Cloning of partial sequences of Acheta domesticus High quality intact RNA was isolated from the different stages of Acheta domesticus insects (garden grasshopper: source: Dr. Lara Senior, Insect Investigations Ltd., Capital Business Park, Wenlooog, Cardiff, CF3 2PX, Wales, UK) using TRIzol Reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. Genomic DNA in the RNA preparation was removed by DNase treatment following the manufacturer's instructions (Cat. No. 1700, Promega). cDNA was generated using commercially available equipment (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate cDNA sequences comprising a portion of genes ADOOl, AD002, AD009, AD015 and AD016, a A series of PCR reactions with degenerate primers will be performed using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 2-AD. These indicators were used in respective PCR reactions with the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minutes at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (ADOOl, AD009, AD015, AD016); 10 minutes at 95 ° C followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (AD010). The resulting PCR fragments were analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Quiagen), cloned into vector pCR8 / GW / TOPO (Cat. No. K2500-20, Invitrogen), and sequenced. The sequences of the resulting PCR products are represented by the respective SEQ ID NOs as given in Table 2-AD and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by respective SEQ ID NOs as given in Table 3-AD.

B. Production of dsRNA from Acheta domesticus genes DsRNA was synthesized in amounts in milligrams using the commercially available Ribomax ™ Express T7 RNAi system (Cat. No. P1700, Promega). The first two 5 'T7 RNA polymerase promoter patterns were generated alone separated into two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 pattern in one direction was generated using specific forward and reverse specific T7 primers. The sequences of the respective primers for amplifying the sense pattern for each of the target genes are given in Table 8-AD. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The T7 pattern in contradiction was generated using specific forward and reverse T7 specific primers in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the pattern in contrasense for each of the target genes are given in Table 8-AD. The resulting PCR products were analyzed on agarose gel and purified by the PCR purification equipment (CPR Purification Kit).

Qiaquic, Cat. No. 281106, Quiagen) and precipitation of NaC104. The generated forward and reverse T7 patterns were mixed to be transcribed and the resulting RNA strands were tuned, DNase and RNase were treated and purified by sodium acetate, following the manufacturer's instructions. The strand in the direction of the resultant dsRNA for each of the target genes are given in Table 8-AD.

C. Laboratory tests to test dsRNA targets, using artificial diet for activity against Acheta domesticus larvae. Homemade grasshoppers, Acheta domesticus, were maintained at Insect Investigations Ltd. (origin: Blades Bilogical Ltd., Kent, UK). The insects were raised in bran pellets and pumpkin leaves. Mixed-sex nymphs of equal size and not older than 5 days of age were selected for use in the trial. The double-stranded RNA was mixed with a diet of rodents in the form of pellets based on wheat (normal diet for rats and mice, B. &K Universal Ltd., Grimston, Aldbrough, Hull, UK). The diet, BK001P, contains the following ingredients in descending order by weight: wheat, soy, wheat feed, barley, pellet binder, rodent vitamin 5, fat blend, dicalcium phosphate, carbohydrates changed. The diet of rodents in the form of pellets was finally milled and treated with heat in a microwave oven before mixing, in order to inactivate any enzyme component. The entire diet of rodents is taken from the same batch in order to ensure consistency. The milled diet and dsRNA were uniformly mixed and formed into small pellets of equal weight, which allowed to dry overnight at room temperature. Samples of double-stranded RNA from the targets and control of gfp at the concentrations of 10 μg / μl were applied in the ratio of 1 g of ground diet plus 1 ml of dsRNA solution, thus resulting in an application regimen of 10 mg dsRNA per g pellet. The pellets were replaced weekly. The treated pellets were given to the insects during the first three weeks of the trial. Then, untreated pellets were provided. The insects were kept inside plastic containers with a lid (9 cm in diameter, 4.5 cm deep), ten per container. Each sand contains a treated bait pellet and a water source (soaked cotton wool ball), each placed in a separate small weight boat. The water is filled at free demand during the experiment. Evaluations were conducted at twice-weekly intervals, with no more than four days between evaluations, until all control insects dried or changed to adulthood (84 days). In each evaluation, the insects were evaluated as alive or dead, and examined for abnormalities. From day 46 onwards, once the change to adulthood began, all insects (living and dead) were evaluated as nymphs or adults. The surviving insects were weighed on day 55 of the trial. Four replicates were made for each of the treatments. During the test the test conditions are from 25 to 33 ° C and from 20 to 25% relative humidity, with a photoperiod of light: darkness of 12:12 hours.

D. Cloning of a HC gene fragment into a vector suitable for the bacterial production of active double-stranded RNA for insects. The following is an example of cloning a DNA fragment corresponding to a target HC gene in a vector for expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any another promoter for efficient transcription in bacteria (reference to WO 0001846). The sequences of the specific primers used for the amplification of target genes are provided in the Table 8-AD. The pattern used is the vector pCR8 / GW / to? O containing any of the target sequences. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment was analyzed on agarose gel, purified (QIAquick Gel Extraction Kit, Cat. No. 28706, Qiagen), blunt end cloned into the vector of pGNA49A aligned with Srf I (reference WO 00188121A1) and sequenced The sequence of the resulting PCR product corresponds to the respective sequence as given in Table 8-AD. The recombinant vector containing this sequence is called pGXXXOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB301-105 (DE3), and (2) BL21 (DE3). The procedures described below are followed in order to express adequate levels of active double-stranded RNA for insect white insects in bacteria. A deficient strain of RNaselII, AB301-105 (DE3), was used in comparison with bacteria containing wild type RNaselII, BL21 (DE3).

Transformation of AB301-105 (DE3) and BL21 (DE3) Three hundred ng of the plasmid were added to and mixed gently in a 50 μl aliquot of strain AB301-105 (DE3) or BL21 (DE3) of chemically competent E. coli chilled The cells were incubated on ice for 20 minutes before being subjected to heat shock treatment at 37 ° C for 5 minutes, after which the cells were again placed on ice for an additional 5 minutes. Four hundred fifty μl of SOC medium at room temperature were added to the cells and the suspension was incubated on a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μl of the bacterial cell suspension was transferred to a 500 ml conical flask containing 150 ml of liquid Luria-Bertani (LB) broth supplemented with 100 μg / ml carbenicillin antibiotic. The culture was incubated on an Innova 4430 shaker (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB301-105 (DE3) Expression of double-stranded RNA from the recombinant vector, pGXXXOXX, in strain AB301-105 (DE3) of bacteria was possible since all genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase will direct the transcription of the target sequence in the directions of sense and contradictory since they are flanked by T7 promoters that are oriented in an opposite direction.

The optical density at 600 nm of the bacterial culture overnight was measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. Fifty ml of this culture was transferred to a 50 ml Falcon tube and the culture was centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant was removed and the bacterial pellet was resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 mM IPTG. The bacteria were induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria were killed by heat treatment in order to reduce the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite to induce insect toxicity due to RNA interference. The induced bacterial culture was centrifuged at 300 g at room temperature for 10 minutes, the discarded supernatant and the pellet subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial pellet was resuspended in 1.5 ml of MilliQ water and the suspension was transferred to a microfuge tube. The tube was stored at -20 ° C until later use.

F. Laboratory tests to test Escherichia coli expressing dsRNA targets against Chilo supressalis Plant-based bioassay Whole plants were sprayed with suspensions of chemically induced bacteria expressing dsRNA before feeding the plants to HC. There is growth of a closed chamber of plant growth. The plants are placed in cages by placing a 500 ml plastic bottle down on the plant with the neck of the bottle placed firmly in the ground in a pot and the base open and covered with a fine nylon mesh to allow aeration, reduce internal condensation and prevent insects from escaping. HC are placed in each treated plant in the cage. The plants were treated with a suspension of E. coli AB301-105 (DE3) harboring the plasmids pGXXOXX or plasmid pGN29. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit was defined as 109 bacterial cells in 1 ml of a bacterial suspension with optical wavelength value of 1 to 600 wavelength nm. In each case, a total volume of between 1 and 10 ml was sprayed on the plant with the help of a vaporizer. One plant is used per treatment in this trial. The number of survivors is counted and the weight of each survivor is recorded.

Spraying plants with a bacterial strain suspension of E. coli AB301-015 (DE3) expressing white dsRNA of pGXXXOXX leads to a dramatic increase in insect mortality when compared to the pGN29 control. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in expression systems of wild-type or deficient RNasalII bacteria is toxic to the insect in terms of substantial increases in insect mortality and growth retardation. / development for larva survivors. It is also clear from these experiments that exemplification is provided for the effective protection of plants / crops from insect damage by the use of a sprayer of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

T, oo IV) or IV) -J N) N) - Table 1-NL Identification ID - SEQ ID SEC ID card dor Dm NO A NO AA Function (based on cantilever base) ribosomal protein S4 (RpS4), structural constituent of ribosome involved in biosynthesis of NL001 CG11276 1071 1072 protein that is a component of a small ribosomal subunit cytose ca N e NJ Table 1-PX N Table 2 -LD - Object IDFront initiator Reverse initiator 5 '- > 3 '5' - > 3 'cDNA sequence (strand in one direction) 5' - > 3 'SEQ ID NO 25 SEQ ID NO 26 SEQ ID NO 1 LD001 GGCCCCAAGA TAGCGGATGG GGCCCCAAGAAGCATTTGAAGCG I I I GAATGCCCCAAAAGCATGGATGTTGGATAAATTGG A T GAGGTGTTTTCGCACCTCGCCCATCTACAGGACCTCACAAATTGCGAGAGTCTTTGCCCTT GCATTTGAAG GCGDCCRTCR GGTGATCTTCCTACGTAACCGATTGAAGTATGCpTGACTAACAGCGAAGTTACTAAGATTG CG TG TTATGCAAAGGTTAATCAAAGTAGATGGAAAAGTGAGGACCGACTCCAATTACCCTGCTGG GTTTATGGATGTTATTACCATTGAAAAAACTGGTGAATTTTTCCGACTCATCTATGATGTTAA AGGACGA I I I GCAGTGCATCGTATTACTGCTGAGGAAGCAAAGTACAAACTATGCAAAGTC AGGAGGATGCAAACTGGCCCCAAAGGAATTCCCTTCATAGTGACACACGACGGCCGCACC ATCCGCTA NJ OO N3 OO Table 2-PC 0 rage 1 -EV c Front Initiator Id Reverse Initiator cDNA sequence (strand in direction) 5 '- > 3 'Obje5' - > 3 '5' - > 3 'SEQ ID NO tive EV005 523 SEQ ID NO 524 SEQ ID NO 513 TGCGATGCGG TCCTGCTTCTT TGCGATGCGGCAAGAAGAAGG I I I GGCTGGATCCTAATGAAATAACTGAAATTGCTAATACA CAARAARAAG SGYRGCRATW AACTCTAGACAAAACATCCGCAAACTGATTAAAGATGGTCTTATTATTAAAAAGCCTGTCGCG GTBTGG CGYTC GTGCATTCTCGTGCACGTGTACGCAAAAATACTGAAGCCCGCAGGAAAGGTCGTCATTGTG GATTTGGTAAAAGGAAAGGAACTGCAAATGCTAGGATGCCCAGAAAGGAATTATGGATTCAA CGTATGAGAGTTCTCAGAAGGTTATTGAAGAAATATAGGGAAGCTAAGAAAATTGATAGGCA TTTATACCATGCTTTATATATGAAAGCTAAGGGAAATGTATTCAAGAATAAGAGAGTAATGAT GGACTATATCCATAAAAAGAAGGCGGAGAAAGCACGTACAAAGATGCTCAATGATCAAGCT GATGCAAGGAGGCTGAAAGTCAAAGAGGCACGTAAGCGACGTGAAGAGCGTATCGCTACG 00 abla 2-AG N Front Initiator Id Initiator cDNA sequence (strand in direction) 5 '- > 3 'O - Goal 5' - > 3 'inverse 5' - > 3 'AG001 SEQ ID NO 611 SEQ ID NO 601 SEQ ID NO 612 CATTTGAAGCG CATTTGAAGCGTTTTGCTGCCCCCAAAGCATGGATGTTGGACAAATTGGGGGGTGTGTTCGCC TTTWRMYGCY CGCTTGTCCC CCAGGCCCTCCACCGGGCCACACAAGCTCAGGGAGTCCCTTCCATTAGTGATTTTCTTGCGTA CC GCTCCTCNGC CAGGTTGAAGTACGCCCTGACAAACTGTGAGGTGACCAAGATCGTTATGCAGAGACTTATTAG RAT GTCGACGGCAAAGTCAGGACTGATCCTAACTATCCTGCTGGATTCATGGATGTGATCACCATTA AAAAACTGGTGAATTCTTCCGTTTGATCTATGATGTTAAGGGAAGATTCACTATTCACAGGATCC TGCTGAAGAAGCAAAATACAAATTGTGCAAAGTCCGCAAGGTGCAAACCGGACCAAAAGGTAC CATTCTTGGTCACCCACGATGGTAGGACCATTAGGTACCCTGACCCAATGATCAAGGTAAACC ACCATCCAACTGGAAATCGCCACCTCAAAGATCCTGGACTTTATCAAATTCGAATCCGGCAACT GTGCATGATCACCGGAGGCAGGAATTTGGGTAGAGTGGGAACGGTAGTGAACAGGGAAAGGA TCCGGGATCATTCGATATTGTCCACATTAGGGACGCTAATGATCACGTGTTCGCCACTAGATTA ACAACGTATTCGTCATCGGTAAAGGAAGCAAAGCTTTCGTGTCTCTGCCAAGGGGCAAGGGAT GAAACTGTCCATCGCTG AG016 SEQ ID NO 619 SEQ ID NO 620 SEQ ID NO 609 GTGTCGGAGG GGAATAGGAT GTGTCGGAGGATATGTTGGGCCGAGTGTTCAACGGATCAGGAAAACCCATTGACAAAGGTCCTC ATATGYTGGGY GGGTRATRTC CAATCTTAGCCGAAGATTTCTTGGACATCCAAGGTCAACCCATCAACCCATGGTCGCGTATCTAC CG GTCG CCGGAAGAAATGATCCAGACCGGTATCTCCGCCATCGACGTGATGAACTCCATCGCGCGTGGG CAAAAAATCCCCATTTTCTCCGCGGCCGGTTTACCGCACAACGAAATCGCCGCCCAAATCTGTAG ACAGGCCGGTTTAGTCAAACTGCCGGGCAAATCGGTAATCGACGATCACGAGGACAATTTCGCC ATCGTGTTCGCCGCCATGGGTGTCAACATGGAAACCGCCCGTTTCTTCAAGCAGGACTTCGAAG AAAACGGTTCCATGGAGAACGTGTGTCTCTTCTTGAATTTGGCCAACGATCCCACCATCGAGAGA ATCATCACGCCCCGTTTGGCTCTGACCGCCGCCGAATTTTTGGCTTATCAATGCGAGAAACACGT GCTGGTTATCTTAACTGATATGTCTTCTTACGCCGAGGCTTTGCGTGAAGTATCCGCCGCCAGAG AAGAAGTACCCGGACGTCGTGGGTTCCCCGGTTACATGTACACCGATTTGGCCACCATTTACGA AAGAGCCGGTCGCGTTGAGGGTAGAAACGGTTCCATCACCCAGATTCCCATCTTGACTATGCCG AACGACGACATCACCCATCCTATTCC Table 2-MP Front Initiator Id 5 'Reverse Initiator Objective - > 3 '5' - > 3 'cDNA sequence (strand in sense) 5' - > 3 'MP001 SEQ ID NO: 898 SEQ ID NO: SEQ ID NO: 888 899 GGCCCCAAGAA GGCCCCAAGAAGCATTTGAAGCGTTTAAACGCACCCAAAGCATGGATGTTGGACAAATCGGG GCATTTGAAGC CGCTTGTCCC GGGTGTCTTCGCTCCACGTCCAAGCACCGGTCCACACAAACTTCGTGAATCACTACCGTTATT G GCTCCTCNGC GATCTTCTTGCGTAATCGTTTGAAGTATGCACTTACTGGTGCCGAAGTCACCAAGATTGTCAT RAT GCAAAGATTAATCAAGGTTGATGGCAAAGTCCGTACCGACCCTAATTATCCAGCCGGTTTTAT GGATGTTATATCTATCCAAAAGACCAGTGAGCACTTTAGATTGATCTATGATGTGAAAGGTCG TTTCACCATCCACAGAATTACTCCTGAAGAAGCAAAATACAAGTTGTGTAAAGTAAAGAGGGT ACAAACTGGACCCAAAGGTGTGCCATTTTTAACTACTCATGATGGCCGTACTATTCGCTACCC TGACCCTAACATCAAGGTTAATGACACTATTAGATACGATATTGCATCATCTAAAATTTTGGAT CATATCCGTTTTGAAACTGGAAACTTGTGCATGATAACTGGAGGTCGCAATTTAGGGCGTGTT GGTATTGTTACCAACAGGGAAAGACATCCAGGATCTTTTGATATTGTTCACATTAAGGATGCA MTGMCATATTTTTGCTACCCGGATGAAC TGTTTTTATTATTGGAAAAGGTCAAAAGAACT ACATTTCTCTACCAAGGAGTAAGGGAGTTAAATTGACTAT MP002 SEQ ID NO: 900 SEQ ID NO: SEQ ID NO: 890 901 GAGTTTCTTTA GAGTTTCTTTAGTAAAGTATTCGGTGGCAAAAAGGAAGAGAAGGGACCATCAACCGAAGATG GTAAAGTATTC GCAATGTCATC CGATACAAAAGCTTCGATCCACTGAAGAGATGCTGATAAAGAAACAAGAATTTTTAGAAAAAA GGTGG CATCAKRTCRT AAATTGAACAAG GTAGCGATAGCCAAAAAAAATGGTACAACTAATAAACGAGCTGCATTGC GTAC AAGCATTGAAGCGTAAGAAACGGTACGAACAACAATTAGCCCAAATTGATGGTACCATGTTAA CTATTGAACAACAGCGGGAGGCATTAGAAGGTGCCAACACAAATACAGCAGTATTGACTACC ATGAAAACTGCAGCAGATGCACTTAAATCAGCTCATCAAAACATGAATGTAGATGATGTACAT GATCTGATGGATGACATTGC MP010 SEQ ID NO: 902 SEQ ID NO: SEQ ID NO: 892 903 GTGGCTGCATA GTGGCTGCATACAGTTCATTACGCAGTATCAACATTCCAGTGGCTATAAACGAATTAGAGTCA CAGTTCATTAC CGCGGCTGCT CCACATTAGCTAGGAATTGGGCAGACCCTGTTCAGAATATGATGCATGTTAGTGCTGCATTTG GCAG CCATGAAYASY ATCAAGAAGCATCTGCCGTTTTAATGGCTCGTATGGTAGTGAACCGTGCTGAAACTGAGGATA TG GTCCAGATGTGATGCGTTGGGCTGATCGTACGCTTATACGCTTGTGTCAAAAATTTGGTGATT ATCAAAAAGATGATCCAAATAGTTTCCGATTGCCAGAAAACTTCAGTTTATATCCACAGTTCAT GTATCATTTAAGAAGGTCTCAATTTCTACAAGTTTTTAATAATAGTCCTGATGAAACATCATATT ATAGGCACATGTTGATGCGTGAAGATGTTACCCAAAGTTTAATCATGATACAGCCAATTCTGT ATAGCTATAGTTTTAATGGTAGGCCAGAACCTGTACTTTTGGATACCAGTAGTATTCAACCTGA TAAAATATTATTGATGGACACA I I I I I CCATATTTTGATATTCCATGGAGAGACTATTGCTCAAT N N L V N VD N VD V V Ni VD VD OR J o UJ or U U UJ or J o U) or UJ or -o Front Initiator Id 5 '- > Reverse Initiator 5 'Goal 3' - > 3 'cDNA sequence (strand in sense) 5' - > 3 'AD001 SEQ ID NO 2374 SEQ ID NO 2375 SEQ ID NO 2364 GGCCCCAAGAAGCA CGCTTGTCCCG GGCCCCAAGAAGCATTTGAAGCGTTTAAATGCTCCTAAAGCATGGATGTTGGACAA TTTGAAGCG ACTCGGAGGAGTATTCGCTCCTCGCCCCAGTACTGGCCCCCACAAATTGCGTGAA TGTTTACCTTTGGTGA CTCCTCNGCRA T I I I I I CTTCGCAATCGGCTCAAGTATGCTCTGACGAACTGT GAAGTAACGAAGATTGTTATGCAGCGACTTATCAAAGTTGACGGCAAGGTGCGAAC CGATCCGAATTATCCCGCTGGTTTCATGGATGTTGTCACCATTGAGAAGACTGGAG AGTTCTTCAGGCTGGTGTATGATGTGAAAGGCCGTTTCACAATTCACAGAATTAGT GCAGAAGAAGCCAAGTACAAGCTCTGCAAGGTCAGGAGAGTTCAAACTGGGCCAA U) or co AAGGTATTCCATTCTTGGTGACCCATGATGGCCGTACTATCCGTTATCCTGACCCA GTCATTAAAGTTAATGACTCAATCCAATTGGATATTGCCACTTGTAAAATCATGGAC CACATCAGATTTGAATCTGGCAACCTGTGTATGATTACTGGTGGACGTAACTTGGG TCGAGTGGGGACTGTTGTGAGTCGAGAACGTCACCCAGGCTCGTTTGATATTGTT CATATCAAGGATACCCAAGGACATACTTTTGCCACAAGATTGAATAATGTATTCATC ATTGGAAAAGCTACAAAGCCTTACATTTCATTGCCAAAGGGTAAGGGTGTGAAATT GAGTATCGCCGAGGAGCGGGACAAGCG UJ or VD UJ l- 'o OR) Table 3-PC UJ (-> IV) UJ t- > UJ Table 3-EV OR) Table 3-TC UJ I-1 n Table 3-MP u > h-1 Table 3-NL UJ I-1 ^ 1 U) CO U) VD Table 3-CS UJ O U) N3 UJ NJ UJ NJ U) U IV O (- C ) VD Table 4-PC OR C U) UJ ^ 1 U 0 V U U OR < u > .faith OR . 0 U) .fe VD U) cp O UJ Cp > UJ cp o u c.

U) cp Cp U) cp CT > C c c U c v Ul (, I-1 C c UJ < T \ .te u > Ln OR) OR U o U CT V Table 4-PX • OR C UJ CRAZY Table 4-PX L O U) 00 0 Table 5-SE Table 5-Te Table 5-NL U 0 U) co co UJ co UJ O Table 6-AG OR Table 6-MP UJ UJ UJ i-D U) cp UJ D T U) kD o kD OO UJ o o Table 6-AD or Table 7 -LD Target ID SEQ ID NO and DNA Sequence (strand in sense) 5 '- > 3 'fragment and concatemer constructs) SEQ ID NO 159 TCTAGAATGTTGAATCAGGCTCGATTGAAAGTATTGAAGGTTAGGGAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAA L0014J1 A CGACTTGGTCAGGTCACAAACGCCCGGG SEQ ID NO 160 L0014 F2 TCTAGAAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGCCCGGG SEQ ID NO 161 TCTAGAATGTTGAATCAGGCTCGATTGAAAGTATTGAAGGTTAGGGAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAA ACGACTTGGTCAGGTCACAAACGATGTTGAATCAGGCTCGATTGAAAGTATTGAAGGTTAGGGAAGATCACGTTCGTACCGTA CTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGATGTTGAATCAGGCTCGATTGAAAGTATTGAAGGTTAGGGAAG L0014 C1 ATCA CGTTCGTACCGTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGCCCGGG SEQ ID NO 162 TCTAGAAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGAAGATCACGTTCGTACC GTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAAAC GACTTGGTCAGGTCACAAACGAAGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGA L0014 C2 AGATCACGTTCGTACCGTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGCCCGGG Table 8-LD or LDDD7 SEQ ID NO 184 SEQ ID NO 185 SEQ ID NO 183 GCGTAATACGACTC CCTTTCAATGTCCAT GACTGGCGGTTTTGAACACCCTTCAGAAGTTCAGCACGAATGTATTCCTCAAG ACTATAGGGACTGG GCCACG CTGTCATTGGCATGGACATTTTATGTCAAGCCAAATCTGGTATGGGCAAAACG CGGTTTTGAACACC GCAGTGTTTGTTCTGGCGACACTGCAACAATTGGAACCAGCGGACAATGTTG C TTTACGTTTTGGTGATGTGTCACACTCGTGAACTGGCTTTCCAAATCAGCAAA GAGTACGAGAGGTTCAGTAAATATATGCCCAGTGTCAAGGTGGGCGTC I I I I I CGGAGGAATGCCTATTGCTAACGATGAAGAAGTATTGAAAAACAAATGTCCAC ACATTGTTGTGGGGACGCCTGGGCGTATTTTGGCGCTTGTCAAGTCTAGGAA SEQ ID NO 186 SEQ ID NO 187 GCTAGTCCTCAAGAACCTGAAACACTTCATTCTTGATGAGTGCGATAAAATGT GACTGGCGGTTTTG GCGTAATACGACTC TAGAACTGTTGGATATGAGGAGAGACGTCCAGGAAATCTACAGAAACACCCC AACACCC ACTATAGGCCTTTCA TCACACCAAGCAAGTGATGATGTTCAGTGCCACACTCAGCAAAGAAATCAGG ATGTCCATGCCACG CCGGTGTGCAAGAAATTCATGCAAGATCCAATGGAGGTGTATGTAGACGATG AAGCCAAATTGACGTTGCACGGATTACAACAGCATTACGTTAAACTCAAAGAA AATGAAAAGAATAAAAAATTATTTGAGTTGCTCGATGTTCTCGAATTTAATCAG GTGGTCA I I I I GTGAAGTCCGTTCAAAGGTGTGTGGCTTTGGCACAGTTGCT GACTGAACAGAATTTCCCAGCCATAGGAATTCACAGAGGAATGGACCAGAAA GAGAGGTTGTCTCGGTATGAGCAGTTCAAAGATTTCCAGAAGAGAATATTGGT AGCTACGAATCTCTTTGGGCGTGGCATGGACATTGAAAGG SEQ ID NO LDD1 D 189 SEQ ID NO 190 SEQ ID NO 188 GCGTAATACGACTC CTATCGGGTTGGAT GCTTGTTGCCCCCGAATGCCTTGATAGGGTTGATTACCTTTGGGAAGATGGTC ACTATAGGGCTTGTT GGAACTCG CAAGTGCACGAACTAGGTACCGAGGGCTGCAGCAAATCTTACGTTTTCCGAG GCCCCCGAATGC GGACGAAAGACCTCACAGCTAAGCAAGTTCAAGAGATGTTGGAAGTGGGCAG or UJ or or Cp or (T, or o 00 or D PC016 SEQ ID NO: 499 SEQ ID NO: 500 SEQ ID NO: 498 ACTGGTCATTCTTGA GCGTAATACGACTC ACTGGTCATTCTTGAGGATGTCAAGTTCCAAAATTCAATGAAATTGTCCAGCTCA GGATGTCAAGT ACTATAGGTTGGGC AATTGGCAGATGGAACTCTACGATCTGGACAAGTTTTGGAAGTCAGTGGATCAAA ATAGTCAAGATGGG GGCAGTTGTTCAGGTATTTGAAGGCACATCAGGTATTGATGCTAAGAACACGGTG GATCTGC TGTGAGTTCACTGGAGATATTCTAAGAACTCCAGTATCAGAAGATATGCTGGGAC GTGTCTTCAATGGATCAGGAAAACCCATTGATAAAGGTCCCCCGATCCTGGCTGA SEQ ID NO: 501 SEQ ID NO: 502 GGACTACCTCGACATCCAAGGACAGCCGATCAACCCGTGGTCGCGTATTTATCCC GCGTAATACGACTC TTGGGCATAGTCAA GGATGACCATGAAGACAACTTTGCTATTGTGTTTGCTGCTATGGGTGTCAACATG ACTATAGGACTGGT GATGGGGATCTGC GAAACTGCCAGGTTCTTCAAGCAGGACTTCGAAGAGAACGGCTCGATGGAGAAC GTGTGTCTGTTCTTGAACTTGGCCAACGATCCGACCATCGAGCGCATCATCACGC CGCGTTTGGCTCTGACGGCCGCCGAATTCTTGGCCTACCAGTGCGAGAAGCACG TGCTGGTCATCTTGACCGACATGTCGTCGTACGCGGAGGCGTTGCGTGAGGTGT CTGCCGCTCGAGAAGAAGTGCCCGGCCGTAGGGGTTTCCCCGGTTACATGTACA CCGATCTGGCCACCATTTACGAGCGCGCCGGTCGTGTGGAGGGCCGCAACGGC TCCATCACGCAGATCCCCATCTTGACTATGCCCAA PC027 SEQ ID NO: 503 SEQ ID NO: 504 SEQ ID NO: 505 CAAGCTAACTTGAAAGTACTACCAGAAGGAGCTGAAATCAGAGATGGAGAACGTT CAAGCTAACTTGAAA GCGTAATACGACTC TGCCAGTCACAGTAAAGGACATGGGAGCATGCGAGATTTACCCACAAACAATCCA GTACTACCAGAAGG ACTATAGGTTTTGGA ACACAACCCCAATGGGCGGTTTGTAGTGGTTTGTGGTGATGGAGAATACATAATA ATTGAAGGCAATACT TACACGGCTATGGCCCTTCGTAACAAAGCATTTGGTAGCGCTCAAGAATTTGTATG CGATCAG GGCACAGGACTCCAGTGAATATGCCATCCGCGAATCCGGATCCACCATTCGAATC TTCAAGAATTTCAAAGAAAAAAAGAATTTCAAGTCCGACTTTGGTGCCGAAGGAAT SEQ ID NO: 506 SEQ ID NO: 507 CTATGGTGGTTTTCTCTTGGGTGTGAAATCAGTTTCTGGCTTAGCTTTCTATGACT GCGTAATACGACTC TTTTGGAATTGAAGG GGGAAACGCTTGAGTTAGTAAGGCGCATTGAAATACAGCCTAGAGCTATCTACTG ACTATAGGCAAGCT CAATACTCGATCAG GTCAGATAGTGGCAAGTTGGTATGCCTTGCTACCGAAGATAGCTATTTCATATTGT AACTTGAAAGTACTA CCTATGACTCTGACCAAGTCCAGAAAGCTAGAGATAACAACCAAGTTGCTGAAGA CCAGAAGG TGGAGTGGAGGCTGCCTTTGATGTCCTAGGTGAAATAAATGAATCCGTAAGAACA GGTCTTTGGGTAGGAGACTGCTTCATTTACACAAACGCAGTCAACCGTATCAACTA CTTTGTGGGTGGTGAATTGGTACTATTGCACATCTGGACCGTCCTCTATATGTCC TGGGCTATGTACCTAGAGATGACAGGTTATACTTGGTTGATAAAGAGTTAGGAGTA GTCAGCTATCNAATTGCTATTATCTGTACTCGAATATCAGACTGCAGTCATGCGACGAGACTTCCCAACGGCTGATCGAGTATTGCCTTCAATTCCAAAA I-1 NJ 4 ^ h-1 Cp CT TC015 SEQ ID NO 884 SEQ ID NO 885 SEQ ID NO 883 GCGTAATACGACTC TCGGATTCGCCGGC CGATACAGTGTTGCTGAAAGGGAAGCGGCGGAAAGAGACCGTCTGCATTGTGCT ACTATAGGCGATAC TAATTTAC GGCCGACGAAAACTGCCCCGATGAGAAGATCCGGATGAACAGGATCGTCAGGAA AGTGTTGCTGAAAG TAATCTACGGGTTAGGCTCTCTGACGTCGTCTGGATCCAGCCCTGTCCCGACGTC GGAAG AAATACGGGAAGAGGATCCACGTTTTGCCCATCGATGACACGGTCGAAGGGCTC GTCGGAAATCTCTTCGAGGTGTACTTAAAACCATACTTCCTCGAAGCTTATCGACC AATCCACAAAGGCGACGTTTTCATCGTCCGTGGTGGCATGCGAGCCGTTGAATTC SEQ ID NO 886 SEQ ID NO 887 AAAGTGGTGGAAACGGAACCGTCACCATATTGTATCGTCGCCCCCGATACCGTCA CGATACAGTGTTGC GCGTAATACGACTC TCCATTGTGACGGCGATCCGATCAAACGAGAAGAAGAGGAGGAAGCCTTGAACG TGAAAGGGAAG ACTATAGGTCGGAT CCGTCGGCTACGACGATATCGGCGGTTGTCGCAAACAACTCGCACAAATCAAAGA TCGCCGGCTAATTT AATGGTCGAATTACCTCTACGCCACCCGTCGCTCTTCAAGGCCATTGGCGTGAAA AC CCACCACGTGGTATCCTCTTGTACGGACCTCCAGGTACCGGTAAAACTTTAATCG CACGTGCAGTGGCCAACGAAACCGGTGCTTTCTTCTTCTTAATCAACGGTCCCGA AATTATGAGTAAATTAGCCGGCGAATCCGA tt-. ^ 1 NJ O NJ NJ UJ 4 ^ NJ -i.

NL027 SEQ ID NO: 1678 SEQ ID NO: 1679 SEQ ID NO: 1677 GCGTAATACGACTCA CAATCCAGTTTTTA AGAAGACGGCACGGTGCGTATTTGGCACTCGGGCACCTACAGGCTGGAGTCCTC CTATAGGAGAAGACG CAGTTTCGTGC GCTGAATTATGGCCTCGAAAGAGTGTGGACCATTTGCTGCATGCGAGGATCCAAC GCACGGTGCG AATGTGGCTCTTGGCTACGACGAAGGCAGCATAATGGTGAAGGTGGGTCGGGAG GAGCCGGCCATCTCGATGGATGTGAACGGTGAGAAGATTGTGTGGGCGCGCCAC SEQ ID NO: 1680 SEQ ID NO: 1681 TCGGAGATACAACAGGTCAACCTCAAGGCCATGCCGGAGGGCGTCGAAATCAAA AGAAGACGGCACGGT GCGTAATACGACT GATGGCGAACGACTGCCGGTCGCCGTTAAGGATATGGGCAGCTGTGAAATATAT GCG CACTATAGGCAAT CCGCAGACCATCGCTCATAATCCCAACGGCAGATTCCTAGTCGTTTGTGGAGATG CCAGTTTTTACAGT GAGAGTACATAATTCACACATCAATGGTGCTAAGAAATAAGGCGTTTGGCTCGGC TTCGTGC CCAAGAGTTCATTTGGGGACAGGACTCGTCCGAGTATGCTATCAGAGAAGGAACA TCCACTGTCAAAGTATTCAAAAACTTCAAAGAAAAGAAATCATTCAAGCCAGAATTT GGTGCTGAGAGCATATTCGGCGGCTACCTGCTGGGAGTTTGTTCGTTGTCTGGAC TGGCGCTGTACGACTGGGAGACCCTGGAGCTGGTGCGTCGCATCGAGATCCAAC CGAAACACGTGTACTGGTCGGAGAGTGGGGAGCTGGTGGCGCTGGCCACTGAT GACTCCTACTTTGTGCTCCGCTACGACGCACAGGCCGTGCTCGCTGCACGCGAC GCCGGTGACGACGCTGTCACGCCGGACGGCGTCGAGGATGCATTCGAGGTCCTT GGTGAAGTGCACGAAACTGTAAAAACTGGATTG Table 5-ES Front Initiator Id 5 '- > Reverse Initiator 5 'Sequence dsARN ONA (strand in direction) 5' - > 3 'Object 31 > 3 'NJ cn CS001 SEQ ID NO: 2041 SEQ ID NO: 2042 SEQ ID NO: 2040 TAAAGCATGGATGTT GCGTAATACGACTC TAAAGCATGGATGTTGGACAAACTGGGTGGCGTGTACGCGCCGCGGCCGTCGAC GGACAAACTGGG ACTATAGGGGTGAG CGGCCCCCACAAGTTGCGCGAGTGCCTGCCGCTGGTGATCTTCCTCAGGAACCG TCGCACGCCCTTGC GCTCAAGTACGCGCTCACCGGAAATGAAGTGCTTAAGATTGTAAAGCAGCGACTT ATCAAAGTTGACGGCAAAGTCAGGACAGACCCCACATATCCCGCTGGATTTATGG SEQ ID NO: 2043 C SEQ ID NO: 2044 ATGTTGTTTCCATTGAAAAGACAAATGAGCTGTTCCGTCTTATATATGATGTCAAAG GCGTAATACGACTCGGTGAGTCGCACGC GCAGATTTACTATTCACCGTATTACTCCTGAGGAGGCTAAATACAAGCTGTGCAAG ACTATAGGTAAAGC CCTTGCC GTGCGGCGCGTGGCGACGGGCCCCAAGAACGTGCCTTACCTGGTGACCCACGA ATGGATGTTGGACA CGGACGCACCGTGCGATACCCCGACCCACTCATCAAGGTCAACGACTCCATCCA AACTGGG GCTCGACATCGCCACCTCCAAGATCATGGACTTCATCAAGTTTGAATCTGGTAAC CTATGTATGATCACGGGAGGCCGTAACTTGGGGCGCGTGGGCACCATCGTGTCC CGCGAGCGACATCCCGGGTCCTTCGACATCGTGCATATACGGGACTCCACCGGA CATACCTTCGCTACCAGATTGAACAACGTGTTCATAATCGGCAAGGGCACGAAGG CGTACATCTCGCTGCCGCGCGGCAAGGGCGTGCGACTCACC NJ -J NJ VD di UJ or Table 8-PX U) I-1 UJ NJ Table 8-AD .6. UJ UJ UJ Table 9-LD Clamp Sequence Id 5 * - > 3 'Target LD002 SEQ ID NO: 240 GCCCTTGCAATGTCATCCATCATGTCGTGTACATTGTCCACGTCCAAGTTTTTATGGGCTTTCTTAAGAGCTTCAGCTGCATTTTTCAT AGATTCCAATACTGTGGTGTTCGTACTAGCTCCCTCCAGAGCTTCTCGTTGAAGTTCAATAGTAGTTAAAGTGCCATCTATTTGCAAC GATTTTTTTCTAATCGCTTCTTCCGCTTCAGCGCTTGCATGGCCGCTCAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATAT CACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCT GACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAA ACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACMTTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATA TTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCA GGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAG GCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGC TGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGA CGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAG AATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCG TTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCT TCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATAT GACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTT CACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCT 4b. CATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGG J TGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATG Cp AGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTGAGCGGCCATGCAAGCGCTGA AGCGGAAGAAGCGATTAGAAAAAAATCAGTTGCAAATAGATGGCACTTTAACTACTATTGAACTTCAACGAGAAGCTCTGGAGGGAG CTAGTACGAACACCACAGTATTGGAATCTATGAAAAATGCAGCTGAAGCTCTTAAGAAAGCCCATAAAAACTTGGACGTGGACAATG TACACGACATGATGGATGACATTGCAAGGGC SEQ ID NO: 241 LD008 GCCCTTGGAGCGAGACTACAACAACTATGGCTGGCAGGTGTTGGTTGCTTCTGGTGTGGTGGAATACATCGACACTCTTGAAGAAG AAACTGTCATGATTGCGATGAATCCTGAGGATCTTCGGCAGGACAAAGAATATGCTTATTGTACGACCTACACCCACTGCGAAATCC ACCCGGCCATGATCTTGGGCGTTTGCGCGTCTATTATACCTTTCCCCGATCATAACCAGAGCCCAAGGAACACCTACCAGAGCGCT ATGGGTAAGCAAGCTATGGGGGTCTACATTACGAATTTCCACGTGCGGATGGACACCCTGGCCCACGTGCTATACTACCCGCACAA ACCTCTGGTCACTACCAGGTCTATGGAGTATCTGCGGTTCAGAGAATTACCAGCCGGGATCAACAGTATAGTTGCTATTGCTTGTTA TACTGGTTATAATCAAGAAGATTCTGTTATTCTGAACGCGTCTGCTGTGGAAAGAGGATTTTTCCGATCCGTGTTTTATCGTTCCTATA AAGATGCCGAATCGAAGCGAATTGGCGATCAAGAAGAGCAGTTCGAGAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATAT CACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCT GACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAA ACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATA TTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCA GGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAG GCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGC TGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGA CGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAG AATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCG TTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCT TCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATAT GACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTT CACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCT CT, CATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGG TGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATG AGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGGCCCTTCTCGAACTGCTCTTCTTGATCGCCAAT TCGCTTCGATTCGGCATCTTTATAGGAACGATAAAACACGGATCGGAAAAATCCTCTTTCCACAGCAGACGCGTTCAGAATAACAGA ATCTTCTTGATTATAACCAGTATAACAAGCAATAGCAACTATACTGTTGATCCCGGCTGGTAATTCTCTGAACCGCAGATACTCCATA GACCTGGTAGTGACCAGAGGTTTGTGCGGGTAGTATAGCACGTGGGCCAGGGTGTCCATCCGCACGTGGAAATTCGTAATGTAGA CCCCCATAGCTTGCTTACCCATAGCGCTCTGGTAGGTGTTCCTTGGGCTCTGGTTATGATCGGGGAAAGGTATAATAGACGCGCAA ACGCCCAAGATCATGGCCGGGTGGATTTCGCAGTGGGTGTAGGTCGTACAATAAGCATATTCTTTGTCCTGCCGAAGATCCTCAGG ATTCATCGCAATCATGACAGTTTCTTCTTCAAGAGTGTCGATGTATTCCACCACACCAGAAGCAACCAACACCTGCCAGCCATAGTTG TTGTAGTCTCGCTCCAAGGGC SEQ ID NO: 242 L0D09 GCCCTTCCGAAG GGATGTGAAGGGTACTTACGTATCCATACACAGTTCAGGCTTCAGAGATTTTTTATTGAAACCAGAAATTCTAA GAGCTATAGTTGACTGCGGTTTTGAACACCCTTCAGAAGTTCAGCACGAATGTATTCCTCAAGCTGTCATTGGCATGGACATTTTATG TCAAGCCAAATCTGGTATGGGCAAAACGGCAGTGTTTGTTCTGGCGACACTGCAACAATTGGAACCAGCGGACAATGTTGTTTACGT TTTGGTGATGTGTCACACTCGTGAACTGGCTTTCCAAATCAGCAAAGAGTACGAGAGGTTCAGTAAATATATGCCCAGTGTCAAGGT GGGCGTCTTTTTCGGAGGAATGCCTATTGCTAACGATGAAGAAGTATTGAAAAACAAATGTCCACACATTGTTGTGGGGACGCCTGG GCGTATTTTGGCGCTTGTCAAGTCTAGGAAGCTAGTCCTCAAGAACCTGAAACACTTCATTCTTGATGAGTGCGATAAAATGTTAGAA CTGTTGGATATGAGGAGAGACGTCCAGGAAATCTACAGAAACACCCCTCACACCAAGCAAGTGATGATGTTCAGTGCCACACTCAG CAAA GAAATCAGGCCGGTGTGCAAGAAATTCATGCAAGATCCAATGGAGGTGTATGTAGACGATGAAGCCAAATTGACGTTGCACGGATT ACAACAGCATTACGTTAAACTCAAAGAAAATGAAAAGAATAAAAAATTATTTGAGTTGCTCGATGTTCTCGAATTTAATCAGGTGGTCA TTTTTGTGAAGTCGTTCAAAGGTGTGTGGCTTTGGCACAGTTGCTGACTGAACAGAATTTCCCAGCCATAGGAATTCACAGAGGAAT GGACCAGAAAGAGAGGTTGTCTCGGTATGAGCAGTTCAAAGATTTCCAGAAGAGAATATTGGTAGCTACGAATCTCTTTGGGCGTG GCATGGACATTGAAAGGGTCAACATTGTCTTCAACTATGATATGCCAGAGGACTCCGACACCTACTTGCATCGAAGGGCGAATTCAC CAGCTTTCTTGTACAAAGTGGTATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTG ATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAA TAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGT AGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCT AAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAAT GGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTT i AAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGT J ATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCA TCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCC TATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAA TATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGG TTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCG TAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAA ATTTATGCTACTC LD010 SEQ ID NO: 243 GCCCTTCGCCATTGGGCGATGGTTTCGCCATGGAATATCAGAATCTGGAAGAACGTGTCCATGAGCAGAATTCTATCGGGTTGGA TGGAACTCGTATCCAAAAGCACAGGTTCTGGTGGTCCATTGAAACTGTAGCTGTAGAGTATCGGCTGATCATGATCAGCGACTGC GTGAGGTCTTCGCGCATAAGCATGTGCCTGTAGAAGGACGTTTCGTCGGGAGAATTGTTAAACACCTGCAGGAACTGTGACCTTC TCAAATGGTACATGAACTGCGGGTAGAGGCTGAAGTTTTCGCCCAAGCGGAACGAATTCGGGTCGTCCTTGTTATATTCGCCGAA TTTCTGGCACAGACGTATCAACATCCTATCGACCCATCTCAAAACATCAGGGCTATCGTCTGATTCCGCTCTGTAAACTGCCATCC TCGCCATTATCACTGCGGCTGCCTCCTGATCGAATCCAGCACTGACATGATGTATATTAGCGGAAGCATCGGCCCAGTTTCTAGC AACTGTCGTTACTCGGATCCTCTTCTGGCCACTAGCATGCTGATATTGCGTGATGAACTGTATGCAGCCCCTTCCCCCTTGAGGTA TGGGAGCGGAATGTTGGTTGACGACCTCGAAGAACAAGGCCATGGTAGTACTTGGAGTTACCGTACACATTTTCCACTGGACCGT GTTACCCATTCCTATTTCGGTGTCGGAAACCAAAGGATTCTTCACATTCAACGAAACACAAGATCCAATACCGCCTTGAATTTTCAA CTCCCTGGAACACTTGACCCTCCAGAGTACCATTAAATGCCATCTTCAGCTCGTTTTTCTGATCTTTCGAAAATATGCGCTGGAAC GTTTGCTTGAACAGGGAAGAATTGAACGAGTCGCCCATGACCATATGTCCCCCTGTTGAATTACAACACTGTTTCATCTCCATCAA TCCTGTCTGATCCAAAGCGCATGAATATATGTCAACGCAGTGGCCATTCGTTGCTGCTCTCATCGCTAAATTATCATAGTGCTTGAT TGCTTTCTTCATGTATTTGGCATTGTCTTTTTGGATGTCGTGGTGAGATCTGATAGGTTGCTTCAGATCATCATTCAAGACTTGACC AGGGCCTTGAGAGCAAGGTCCTCCAACGAATAGCATGACCCTGCACCAGTATTGGCGTATGTGCACTCCAACAACCCAATGGCTA TCGATAAAGCTGTCCCGGTCGATCTAAGGGCGCATTTGCCTTGGTGGACAGGCCATGGGTCTCTTTGCAACTCTCCAATAAGATC AGTGAGGTTCATGTCGCATTTCGAGAT GGGTTGAAGGAACCTGCTTCCTGGTGGCGTAGGAGCTTGCTGGAGTGCTCCAGGCCTCATGGGTTGTCCTGGTTGTTGAGGAGC AGGTTGAGCACTTACTGCGGCTCTGCCCACTTCCAACATCTCTTGAACTTGCTTAGCTGTGAGGTCTTTCGTCCCTCGGAAAACGT AAGATTTGCTGCAGCCCTCGGTACCTAGTTCGTGCACTTGGACCATCTTCCCAAAGGTAATCAACCCTATCAAGGCATTCGGGGG CAACAAGCTCAAAGACATCTGCAACGAATCCTTGAGAGAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATATCACTAGTG u > 00 CGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGC AAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCAT TAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCT ACAATGTTCAAAGA ACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAA ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCT CAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCC TTTATTCACATTCTTGCCCGCCTGATGAAGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGT GTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTT TCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGT CTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGG GCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGG CAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAA TAAAGTCTCATA CCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTA GAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAA AATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGA AACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATC CCGCG GGATATCGACCACTTTGTACAAGAAAGCTGGTCGAATTCGCCCTTCTCTCAAGGATTCGTTGCAGATGTCTTTGAGCTTGTTGCCC CCGAGCCTTGATAGGGTTGATTACCTTTGGGAAGATGGTCCAAGTGCACGAACTAGGTACCGAGGGCTGCAGCAAATCTTACGTT TTCCGAGGGACGAAAGACCTCACAGCTAAGCAAGTTCAAGAGATGTTGGAAGTGGGCAGAGCCGCAGTAAGTGCTCAACCTGCT CCT CAACAACCAGGACAACCCATGAGGCCTGGAGCACTCCAGCAAGCTCCTACGCCACCAGGAAGCAGGTTCCTTCAACCCATCTCG AAATGCGACATGAACCTCACTGATCTTATTGGAGAGTTGCAAAGAGACCCATGGCCTGTCCACCAAGGCAAATGCGCCCTTAGAT CGACCGGGACAGCTTTATCGATAGCCATTGGGTTGTTGGAGTGCACATACGCCAATACTGGTGCCAGGGTCATGCTATTCGTTGG AGGACCTTGCTCTCAAGGCCCTGGTCAAGTCTTGAATGATGATCTGAAGCAACCTATCAGATCTCACCACGACATCCAAAAAGACA i UJ ATGCCAAATACATGAAGAAAGCAATCAAGCACTATGATAATTTAGCGATGAGAGCAGCAACGAATGGCCACTGCGTTGACATATAT TCATGCGCTTTGGATCAGAC AGGATTGATGGAGATGAAACAGTGTTGTAATTCAACAGGGGGACATATGGTCATGGGCGACTCGTTCAATTCTTCCCTGTTCAAGC AAACGTTCCAGCGCATATTTTCGAAAGATCAGAAAAACGAGCTGAAGATGGCATTTAATGGTACTCTGGAGGGTCAAGTGTTCCAG GGAGTTGAAAATTCAAGGCGGTATTGGATCTTGTGTTTCGTTGAATGTGAAGAATCCTTTGGTTTCCGACACCGAAATAGGAATGG GTAACACGGTCCAGTGGAAAATGTGTACGGTAACTCCAAGTACTACCATGGCCTTGTTCTTCGAGGTCGTCAACCAACATTCCGCT CCCATACCTCAAGGGGGAAGGGGCTGCATACAGTTCATCACGCAATATCAGCATGCTAGTGGCCAGAAGAGGATCCGAGTAACG ACAGTTGCTAGAAACTGGGCCGATGCTTCCGCTAATATACATCATGTCAGTGCTGGATTCGATCAGGAGGCAGCCGCAGTGATAA TGGCGAGGATGGCAGTTTACAGAGCGGAATCAGACGATAGCCCTGATGTTTTGAGATGGGTCGATAGGATGTTGATACGTCTGTG CCAGAAATTCGGC GAATATAACAAGGACGACCCGAATTCGTTCCGCTTGGGCGAAAACTTCAGCCTCTACCCGCAGTTCATGTACCATTTGAGAAGGT CACAGTTCCTGCAGGTGTTTAACAATTCTCCCGACGAAACGTCCTTCTACAGGCACATGCTTATGCGCGAAGACCTCACGCAGTC GCTGATCATGATCCAGCCGATACTCTACAGCTACAGTTTCAATGGACCACCAGAACCTGTGCTTTTGGATACGAGTTCCATCCAAC CCGATAGAATTCTGCTCATGGACACGTTCTTCCAGATTCTGATATTCCATGGCGAAACCATCGCCCAATGGCGAAGGGC LD011 SEQ ID NO: 244 GCCCTTGTGGAAGCAGGGCTGGCATGGCGACAAATTCTAGATTGGGATCACCAATAAGCTTCCTAGCTAGCCATAGGAAAGGCTT CTCAAAGTTGTAGTTAGATTTGGCAGAGATATCATAGTACTGCAAATTCTTCTTCCTATGAAAGACAATACTTTTCGCTTTTTACTTTT CTGTCTTTGATGTCAACCTTGTTCCCGCA GTACTATCGGGATATTTTCACAGACTCTGACAAGATCTCTGTGCCAATTTGGTACA TTCTTGTATGTAACTCTGGAAGTTACATCAAACATGATAATAGCACACTGTCCCTGAATGTAATATCCATCACGGAGACCACCAAAC TTCTCCTGACCGGCAGTGTCCCATACATTGAACCGAATAGGGCCCCTGTTTGTATGGAAGACCAGAGGATGGACTTCAACTCCCA AAGTAGCTACATATCTTTTTTTCAMTTCACCAGTCATATGACGTTTCACAAATGTCGTTTTTCCAGTACCTCCATCTCCGACCAACAC ACACTTGAAAGTGGGAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGAC CATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGA AGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAG TATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTT GCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGA GAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATG TACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTAT TCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTT CACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCT ACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTC AGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCA AATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAG AATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAA AGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAA i GACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGT i TTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCA OR AATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTG CTTCTGATCCCGCGGGATATCGGACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCCCACTTTCAAGTGTGTGTTGGTC GGAGATGGAGGTACTGGAAAAACGACATTTGTGAAACGTCATATGACTGGTGAATTTGAAAAAAGATATGTAGCTACTTTGGGAGT TGAAGTCCATCCTCTGGTCTTCCATACAAACAGGGGCCCTATTCGGTTCAATGTATGGGACACTGCCGGTCAGGAGAAGTTTGGT GGTCTCCGTGATGGATATTACATTCAGGGACAGTGTGCTATTATCATGTTTGATGTAACTTCCAGAGTTACATACAAGAATGTACCA AATTGGCACAGAGATCTTGTCAGAGTCTGTGAAAATATCCCGATAGTACTTTGCGGGAACAAGGTTGACATCAAAGACAGAAAAGT AAAAGCGAAAAGTATTGTCTTTCATAGGAAGAAGAATTTGCAGTACTATGATATCTCTGCCAAATCTAACTACAACTTTGAGAAGCC TTTCCTATGGCTAGCTAGGAAGCTTATTGGTGATCCCAATCTAGAATTTGTCGCCATGCCAGCCCTGCTTCCACAAGGGC LD014 SEQ ID NO: 245 GCCCTTCGCAGATCAAGCATATGATGGCTTTCATTGAACAAGAGGCAAACGAAAAGGCAGAAGAAATCGATGCCAAGGCCGAGGA AGAATTTAATATTGAAAAGGGGCGCCTTGTTCAGCAACAACGTCTCAAGATTATGGAATATTATGAGAAGAAAGAGAAACAGGTCG AACTCCAGAAAAAAATCCAATCGTCTAACATGTTGAATCAGGCTCGATTGAAAGTATTGAAGGTTAGGGAAGATCACGTTCGTACC GTACTAGAGGAGGCGCGTAAACGACTTGGTCAGGTCACAAACGACCAGGGAAAATATTCCCAAATCCTGGAAAGCCTCATTTTGC AGGGATTATATCAGCTTTTTGAGAAAGATGTTACCATTCGAGTTCGGCCCCAGGACCGAGAACTGGTCAAATCCATCATTCCCACC GTCACGAACAAGTATAAAGATGCCACCGGTAAGGACATCCATCTGAAAATTGATGACGAAATCCATCTGTCCCAAGAAACCACCG GGGGAATCGACCTGCTGGCGCAGAAAAACAAAATCAAGATCAGCAATACTATGGAGGCTCGTCTGGAGCTGATTTCGCAGCAACT TCTGCCCGAGATCCGAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATATCACTAGTGCGGCCGCCTGCAGGTCGACCAT ATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGT TAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTAT AATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCA TCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAA AAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACC TATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCAC ATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACC CTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACAC ATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCC AATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATA TTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATG CTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTC ^ TCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACG ATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTAT GCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATC ATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTC TGATCCCGCGGGATATCGACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCGGATCTCGGGCAGAAGTTGCTGCGAAAT CAGCTCCAGACGAGCCTCCATAGTATTGCTGATCTTGATTTTGTTTTTCTGCGCCAGCAGGTCGATTCCCCCGGTGGTTTCTTGGG ACAGATGGATTTCGTCATCAATTTTCAGATGGATGTCCTTACCGGTGGCATCTTTATACTTGTTCGTGACGGTGGGAATGATGGAT TTGACCAGTTCTCGGTCCTGGGGCCGAACTCGAATGGTAACATCTTTCTCAAAAAG CTGATATAATCCCTGCAAAATGAGGCTTTCCAGGATTTGGGAATATTTTCCCTGGTCGTTTGTGACCTGACCAAGTCGTTTACGCG CCTCCTCTAGTACGGTACGAACGTGATCTTCCCTAACCTTCAATACTTTCAATCGAGCCTGATTCAACATGTTAGACGATTGGATTT TTTTCTGGAGTTCGACCTGTTTCTCTTTCTTCTCATAATATTCCATAATCTTGAGACGTTGTTGCTGAACAAGGCGCCCCTTTTCAAT ATTAAATTCTTCCTCGGCCTTGGCATCGATTTCTTCTGCCTTTTCGTTTGCCTCTTGTTCAATGAAAGCCATCATATGCTTGATCTGC GAAGGGC LD016 SEQ ID NO: 246 GCCCTTGGAATAGGATGGGTAATGTCGTCGTTGGGCATAGTCAATATAGGAATCTGGGTGATGGATCCGTTACGTCCTTCAACAC GGCCGGCACGTTCATAGATGGTAGCTAAATCGGTGTACATGTAACCTGGGAAACCACGACGACCAGGCACCTCTTCTCTGGCAG CAGATACCTCACGCAAAGCTTCTGCATACGAAGACATATCTGTCAAGATGACCAAGACGTGCTTCTCACATTGGTAAGCCAAGAAT TCGGCAGCTGTCAAAGCCAGACGAGGTGTAATAATTCTTTCAATGGTAGGATCGTTGGCCAAATTCAAGAACAGGCAGACATTCTC CATAGAACCGTTCTCTTCGAAATCCTGTTTGAAGAACCTACTGTTTCCATGTTAACACCCATAGCAGCGAAAACAATAGCAAAGTTA TCTTCATGATCATCAAGTACAGATTTACCAGGAATCTTGACTAAACCAGCCTGTCTACAGATCTGGGCAGCAATTTCATTGTGAGG CAGACCAGCTGCAGAGAAAATGGGGATCTTCTGACCACGAGCAATGGAGTTCATCACGTCAATAGCTGTAATACCCGTCTGGATC ATTTCCTCAGGATAG ATACGGGACCACGGATTGATTGGTTGACCCTGGATGTCCAAGAAGTCTTCAGCCAAAATTGGGGGACCTTTGTCGATGGGTTTTC CTGATCCATTGAAAACACGTCCCAACATATCTTCAGAAACAGGAGTCCTCAAMTATCTCCTGTGMTTCAC GCGGTGTTTTTGG CGTCGATTCCTGATGTGCCCTCGAACACTTGAACCACAGCTTTTGACCCACTGACTTCCAGAACTTGTCCCGAACGTATAGTGCCA TCAGCCAGTTTGAGTTGTACGATTTCATTGTACTTGGGGAACTTAACATCTTCGAGGATTACCAGAGGACCGTTCACACCAGACAC AGTCAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCT GCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGA GACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAA TTCGACAATTTG ACTTTCAAGAGTAGGCTMTGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAA TTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGT TGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGA TATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGC TCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGC AAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGT TACGGTGAAMCCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGT i TTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCT NJ GATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGC GATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTAT TCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCT GGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTT CTGTCATCTTACTAMCAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCA CTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACA GAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTT TGTACAAGAAAGCTGGGTCGAATTCGCCCTTGACTGTGTCTGGTGTGAACGGTCCTCTGGTAATCCTCGAAGATGTTAAGTTCCC CAAGTACAATGAAATCGTACAACTCAAACTGGCTGATGGCACTATACGTTCGGGACAAGTTCTGGAAGTCAGTGGGTCAAAAGCT GTGGTTCAAGTGTTCGAGGGCACATCAGGAATCGACGCCAAAAACACCGCTTGTGAATTCACAGGAGATATTTTGAGGACTCCTG TTTCTGAAGATATGTTGGGACGTGTTTTCAATGGATCAGGAAAACCCATCGACAAAGGTCCCCCAATTTTGGCTGAAGACTTCTTG GACATCCAGGGTCAACCAATCAATCCGTGGTCCCGTATCTATCCTGAGGAAATGATCCAGACGGGTATTACAGCTATTGACGTGAT GAACTCCATTGCTCGTGGTCAGAAGATCCCCATTTTCTCTGCAGCTGGTCTGCCTCACAATGAAATTGCTGCCCAGATCTGTAGAC AGGCTGGTTTAGTCAAGATTCCTGGTAAATCTGTACTTGATGATCATGAAGATAACTTTGCTATTGTTTTCGCTGCTATGGGTGTTA ACATGGAAACAGCTAGGTTCTTCAAACAGGATTTCGAAGAGAACGGTTCTATGGAGAATGTCTGCCTGTTCTTGAATTTGGCCAAC GATCCTACCATTGAAAGAATTATTACACCTCGTCTGGCTTTGACAGCTGCCGAATTCTTGGCTTACCAATGTGAGAAGCACGTCTT GGTCATCTTGACAGATATGTCTTCGTATGCAGAAGCTTTGCGTGAGGTATCTGCTGCCAGAGAAGAGGTGCCTGGTCGTCGTGGT TTCCCAGGTTACATGTACACCGATTTAGCTACCATCTATGAACGTGCCGGCCGTGTTGAAGGACGTAACGGATCCATCACCCAGA TTCCTATATTGACTATGCCCAACGACGACATTACCCATCCTATTCCAAGGGC LD027 SEQ ID NO 2486 GGGAGCAGACGATCGGTTGGTTAAAATCTGGGACTATCAAAACAAAACGTGTGTCCAAACCTTGGAAGGACACGCCCAAAACGTAA CCGCGGTTTGTTTCCACCCTGAACTACCTGTGGCTCTCACAGGCAGCGAAGATGGTACCGTTAGAGTTTGGCATACGAATACACAC AGATTAGAGAATTGTTTG TTATGGGTTCGAGAGAGTGTGGACCATTTGTTGCTTGAAGGGTTCGAATAATGTTTCTCTGGGGTATG ACGAGGGCAGTATATTAGTGAAAGTTGGAAGAGAAGAACCGGCAGTTAGTATGGATGCCAGTGGCGGTAAAATAATTTGGGCAAGG CACTCGGAATTACAACAAGCTAATTTGAAGGCGCTGCCAGAAGGTGGAGAAATAAGAGATGGGGAGCGTTTACCTGTCTCTGTAAAA GATATGGGAGCATGTGAAATATACCCTCAAACAATCCAACATAATCCGAATGGAAGATTCGTTGTAGTATGCGGAGACGGCGAATAT ATCATTTACACAGCGATGGCTCTACGGAACAAGGCTTTTGGAAGCGCTCAAGAGTTTGTCTGGGCTCAGGACTCCAGCGAGTATGC CATTCGCGAGTCTGGTTCCACAATTCGGATATTCAAAAACTTCAAAGAAAGGAAGAACTTCAAGTCGGATTTCAGCGCGGAAGGAAT CTACGGGGGTTTTCTCTTGGGGATTAAATCGGTGTCCGGTTT CGTTTTACGATTGGGAAACTTTGGACTTGGTGAGACGGATTGA AATACAACCGAGGGCGGTTTATTGGTCTGACAAATTAGTCTGTCTCGCAACGGAGGACAGCTACTTCATCCTTTCTTATGA TTCGGAGCAAGTTCAGAAGGCCAGGGAGAACAATCAAGTCGCAGAGGATGGCGTAGAGGCCGCTTTCGATGTGTTGGGGGAAATG AACGAGTCTGTCCGAACCCAGCTTTCTTGTACAAAGTGGTGATATCCCGCGGGATCAGAAGCAACCTCATGGAAATGATGAGGTAA GGTTTCATACTCTTGCCTCTTCTTACGGCTTTCTGTGTCTTCACTGTAAGTTTCTATGATTTGAGCCACCAATATATATGCTCTGGTGT GCTGAGTTATGTTTATCTGGTCACGCTTAGTGGGTAAAATTATGCTTATTTTAGCATAAACTTTAATGAGATTAGGTTTTGTATCACAC CGATCTTTAGTTGTTTAGTAAGATGACAGAAATTCTTGGTAAAACACTCTAAATCGTCTTCTTTAGTGAAGTTTTCCTTAGAGTAGCAT AAATTTTGGCTTTTTTCTTGATGGTTGAATAAGGTGGCACTTGTTGGTATGAGACTTTATTGAGAGTCATATTAAGCTGATCCACGCGT TTACGCCCCGCC CTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGATGAACCTGAATCGC CAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGT TTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGT TTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACG TTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTC CGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGC CGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGAT GAATTTGATGGCCATAGGGGTTTAGATGCAACTGTTTCTTTGAACATTGTAGAAATATATAAAGATTTTACATTAGCCTACTCTTGAAA GTCAAATTGTCGAATTTGATTATATTATACTCTAGAGGTGATATTAGTTAATGAGTTTATACTCGGTTATTTACAGCTTATTCATATACC AGTTAACGTGTCTCATATATTCTAACTTCTTAGCATTTAACGTGTTTGCAGGTCAGCTTGACACTGAACATAACAGCATCACTAGTGC GGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATATACCACTTTGTACAAGAAAGCTGGTCGAATTC GCCCTTTCGGACAGACTCGTTCATTTCCCCCAACACATCGAAAGCGGCCTCTACGCCATCCTCTGCGACTTGATTGTTCTCCCTGGC CTTCTGAACTTGCTCCGAATCATAAGAAAGGATGAAGTAGCTGTCCTCCGTTGCGAGACAGACTAATTTTCCACTGTCAGACCAATAA ACCGCCCTCGGTTGTATTTCAATCCGTCTCACCAAGTCCAAAGTTTCCCAATCGTAAAACGTTAAACCGGACACCGATTTAATCCCCA AGAGAAAACCCCCGTAGATTCCTTCCGCGCTGAAATCCGACTTGAAGTTCTTCCTTTCTTTGAAGTTTTTGAATATCCGAATTGTGGA ACCAGACTCGCGAATGGCATACTCGCTGGAGTCCTGAGCCCAGACAAACTCTTGAGCGCTTCCAAAAGCCTTGTTCCGTAGAGCCA TCGCTGTGTAAATGATATATTCGCCGTCTCCGCATACTACAACGAATCTTCCATTCGGATTATGTTGGATTGTTTGAGGGTATATTTCA CATGCTCCCATATCTTTTACAGAGACAGGTAAACGCTCCCCATCTCTTATTTCTCCACCTTCTGGCAGCGCCTTCAAATTAGCTTGTT GTAATTCCGAGTGCCTTGCCCAAATTATTTTACCGCCACTGGCATCCATACTAACTGCCGGTTCTTCTCTTCCAACTTTCACTAATATA CTGCCCTCGTCATACCCCAGAGAAACATTATTCGAACCCTTCAAGCAACAAATGGTCCACACTCTCTCGAACCCATAATTCAAACAAT TCTCTAATCTGTGTGTATTCGTATGCCAAACTCTAACGGTACCATCTTCGCTGCCTGTGAGAGCCACAGGTAGTTCAGGGTGGAAAC AAACCGCGGTTACGTTTTGGGCGTGTCCTTCCAAGGTTTGGACACACGTTTTGTTTTGATAGTCCCAGATTTTAACCAACCGATCGTC TGCTCCC Table 9-PC Clamp Sequence Id 5 '- > 3 'target PC001 SEQ ID NO: 508 AGATTCAAATTTGATGTAGTCAAGAATTTTAGATGTAGCAATTTCCATTTGAATTGTGTCATTCACTTTGATGTTGGGGTCAGGGTAA CGAATGGTTCTGCCATCATGTGTTACCAAAAATGGGATTCCTTTGGGACCAGTTTGGACTCTCCTTACTTTACAC CTTGTATTTT GCCTCTTCAGCTGTAATACGGTGCACAGCAAATCTTCCTTTAACATCATAGATCAGACGGAAAAATTCACCAGTCTTCTCAATAGTA ATGACATCCATGAAACCAGCAGGGTAATTAGAATCAGTCCTCACTTTACCATCAACTTTGATCAACCTTTGCATGACAATTTTAGTG ACTTCACTGTTTGTAAGGGCATACTTCAGCCTGTTACGAAGGAAAATCACTAAAGGCAGGGATTCGCGCAACTTGTGAGGCCCGG TGGATGGACGAGGGGCGAAGACACCCCCCAATTTGTCCAACATCCATGCAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTG GTGATATCACTAGTGCGGCC GCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACA CGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTA ATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATG TTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAG GAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAG TCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTT TATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGAT ATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATT TCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAAT ATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTT TTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCT TCCATGTCGGCAGAATGCTTAATGAATTACAACAGTAC TGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATA TGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAA CTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTA 4 ^ Ji ATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATAT ATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATT TCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTGCATGGATGTTGGA CAAATTGGGGGGTGTCTTCGCCCCTCGTCCATCCACCGGGCCTCACAAGTTGCGCGAATCCCTGCCTTTAGTGATTTTCCTTCGT AACAGGCTGAAGTATGCCCTTACAAACAGTGAAGTCACTAAAATTTCATGCAAAGGTT GATCAAAGTTGATGGTAAAGTGAGGACTGATTCTAATTACCCTGCTGGTTTCATGGATGTCATTACTATTGAGAAGACTGGTGAATT TTTCCGTCTGATCTATGATGTTAAAGGAAGATTTGCTGTGCACCGTATTACAGCTGAAGAGGCAAAATACAAGTTGTGTAAAGTAAG GAGAGTCCAAACTGGTCCCAAAGGAATCCCATTTTTGGTAACACATGATGGCAGAACCATTCGTTACCCTGACCCCAACATCAAAG TGAATGACACAATTCAAATGGAAATTGCTACATCTAAAATTCTTGACTACATCAAATTTGAATCT PC010 SEQ ID NO: 509 CTCTCAAGGATTCTTTGCAGATGTCGCTCAGCCTATTACCGCCCAACGCGTTGATTGGATTGATCACGTTCGGAAAAATGGTGCAA GTCCACGAACTGGGTACCGAAGGCTGCAGCAAGTCGTACGTGTTCTGTGGAACGAAAGATCTCACCGCCAAGCAAGTCCAGGAG ATGTTGGCATTGGAAAAGGGTCACCAAATCCCCAACAACAGCCAGGGCAACCTGGGCGGCCAGGGCAGAATCCCCAAGCTGCCC CTGTACCACCGGGGAGCAGATTCTTGCAGCCCGTGTCAAAATGCGACATGAACTTGACAGATCTGATCGGGGAGTTGCAGAAAGA CCCTTGGCCCGTACATCAGGGCAAAAGACCTCTTAGATCCACAGGCGCAGCATTGTCCATCGCTGTCGGCCTCTTAGAATGCACC TATCCGAATACGGGTGGCAGAATCATGATATTCTTAGGAGGACCATGCTCTCAGGGTCCCGGCCAGGTGTTGAACGACGATTTGA AGCAGCCCATCAGGTCCCATCATGACATACACAAAGACAATGCCAAGTACATGAAGAAGGCTATCAAACATTACGATCACTTGGCA ATGCGAGCTGCCACCAACAGCCATTGCATCGACATTTACTCCTGCGCCCTGGATCAGACGGGACTGATGGAGATGAAGCAGTGC TGCAATTCCACCGGAGGGCACATGGTCATGGGCGATTCCTTCAATTCCTCTCTATTCAAACAAACCTTCCAGCGAGTGTTCTCAAA AGACCCGAAGAACGACCTCAAGATGGCGTTCAACGCCACCTTGGAGGTGAAGTGTTCCAGGGAGTTAAAAGTCCAAGGGGGCAT CGGCTCGTGCGTGTCCTTGAACGTTAAAAGCCCTCTGGTTTCCGATACGGAACTAGGCATGGGGAATACTGTGCAGTGGAAACTT TGCACGTTGGCGCCGAGCTCTACTGTGGCGCTGTTCTTCGAGGTGGTTAACCAGCATTCGGCGCCCATACCACAGGGAGGCAGG GGCTGCATCCAGCTCATCACCCAGTATCAGCACGCGAGCGGGCAAAGGAGGATCAGAGTGACCACGATTGCTAGAAATTGGGCG GACGCTACTGCCAACATCCACCACATTAGCGCTGGCTTC GACCAAGAAGCGGCGGCAGTTGTGATGGCCCGAATGGCCGGTTACAAGGCGGAATCGGACGAGACTCCCGACGTGCTCAGATG GGTGGACAGGATGTTGATCAGGCTGTGCCAGAAGTTCGGAGAGTACAATAAAGACGATCCGAATTCGTTCAGGTTGGGGGAGAA CTTCAGTCTGTATCCGCAGTTCATGTACCATTTGAGACGGTCGCAGTTTCTGCAGGTGTTCAATAATTCTCCTGATGAAACGTCGTT TTATAGGCACATGCTGATGCGTGAGGATTTGACTCAGTCTTTGATCATGATCCAGCCGATTTTGTACAGTTACAGCTTCAACGGGC CGCCCGAGCCTGTGTTGTTGGACACAAGCTCTATTCAGCCGGATAGAATCCTGCTCATGGACACTTTCTTCCAGATACTCATTTTC CATGGAGAGACCATTGCCCAATGGCGAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCC TGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTT AAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATAT CACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCA AAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAG CTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAG p TTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTATCC GGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGG GATAGTGTTCACCCTTGTTACACCGTTTTCCATGGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGG CAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTT TTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCAC CATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCAT GTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACT CTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCA CTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTC ATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTG GTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCA TGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCGCCATTGGGCAATGGTC TCTCCATGGAAAATGAGTATCTGGAAGAAAGTGTCCATGAGCAGGATTCTATCCGGCTGAATAGAGCTTGTGTCCAACAACACAG GCTCGGGCGGCCCGTTGAAGCTGTAACTGTACAAAATCGGCTGGATCATGATCAAAGACTGAGTCAAATCCTCACGCATCAGCAT GTGCCTATAAAACGACGTTTCATCAGGAGAATTATTGAACACCTGCAGAAACTGCGACCGTCTCAAATGGTACATGAACTGCGGAT ACAGACTGAAGTTCTCCCCCAACCTGAACGAATT CGGATCGTCTTTATTGTACTCTCCGAACTTCTGGCACAGCCTGATCAACATCCTGTCCACCCATCTGAGCACGTCGGGAGTCTCGT CCGATTCCGCCTTGTAACCGGCCATTCGGGCCATCACAACTGCCGCCGCTTCTTGGTCGAAGCCAGCGCTAATGTGGTGGATGTT GGCAGTAGCGTCCGCCCAATTTCTAGCAATCGTGGTCACTCTGATCCTCCTTTGCCCGCTCGCGTGCTGATACTGGGTGATGAGC TGGATGCAGCCCCTGCCTCCCTGTGGTATGGGCGCCGAATGCTGGTTAACCACCTCGAAGAACAGCGCCACAGTAGAGCTCGGC GCCAACGTGCAAAGTTTCCACTGCACAGTATTCCCCATGCCTAGTTCCGTATCGGAAACCAGAGGGCTTTTAACGTTCAAGGACA CGCACGAGCCGATGCCCCCTTGGACTTTTAACTCCCTGGAACACTTCACCTCCAAGGTGGCGTTGAACGCCATCTTGAGGTCGTT CTTCGGGTCTTTTGAGAACACTCGCTGG GGTTTGTTTGAATAGAGAGGAATTGAAGGAATCGCCCATGACCATGTGCCCTCCG GTGGAATTGCAGCACTGCTTCATCTCCATCAGTCCCGTCTGATCCAGGGCGCAGGAGTAAATGTCGATGCAATGGCTGTTGGTGG CAGCTCGCATTGCCAAGTGATCGTAATGTTTGATAGCCTTCTTCATGTACTTGGCATTGTCTTTGTGTATGTCATGATGGGACCTGA TGGGCTGCTTCAAATCGTCGTTCAACACCTGGCCGGGACCCTGAGAGCATGGTCCTCCTAAGAATATCATGATTCTGCCACCCGT ATTCGGATAGGTGCATTCTAAGAGGCCGACAGCGATGGACAATGCTGCGCCTGTGGATCTAAGAGGTCTTTTGCCCTGATGTACG GGCCAAGGGTCTTTCTGCAACTCCCCGATCAGATCTGTCAAGTTCATGTCGCATTTTGACACGGGCTGCAAGAATCTGCTCCCCG GTGGTACAGGGGCAGCTTGGGGATTCTGCCCTGGCCGCCCAGGTTGCCCTGGCTGTTGTTGGGGATTTGGTGACCCTTTTCCAA TGCCCAACATCTCCTGGACTTGCTTGGCGGTGAGATCTTTCGTTCCACAGAACACGTACGACTTGCTGCAGCCTTCGGTACCCAG TTCGTGGACTTGCACCATTTTTCCGAACGTGATCAATCCAATCAACGCGTTGGGCGGTAATAGGCTGAGCGACATCTGCAAAGAAT CCTTGAGAG PC014 ISEO ID NO: 510 CGCAGATCAAACATATGATGGCTTTCATTGAACAAGAAGCCAATGAGAAAGCAGAAGAAATCGATGCCAAGGCAGAGGAGGAATT CAACATTGAAAAAGGGCGTTTAGTCCAGCAACAGAGACTCAAGATCATGGAGTACTACGAGAAAAAGGAGAAGCAAGTCGAACTT CAAAAGAAAATTCAGTCCTCTAATATGTTGAATCAGGCTCGTTTGAAGGTGCTGAAAGTGAGAGAGGACCATGTCAGAGCAGTCCT GGAGGATGCTCGTAAAAGTCTTGGTGAAGTAACCAAAGACCAAGGAAAATACTCCCAAATTTTGGAGAGCCTAATCCTACAAGGAC TGTTCCAGCTGTTCGAGAAGGAGGTGACGGTCCGCGTGAGACCGCAAGATAGGGACTTGGTTAGGTCCATCCTGCCCAACGTCG CTGCCAAATACAAGGACGCCACCGGCAAAGACATCCTACTCAAGGTGGACGATGAGTCGCACCTGTCTCAGGAGATCACCGGAG GCGTCGATCTGCTCGCTCAGAAGAACAAGATCAAGATCAGCAACACGATGGAGGCTAGGTTGGATCTGATCGCTCAGCAATTGGT GCCCGAGATCCGAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCA TATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAG TTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTA T TAT TCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGC ATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAA AAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTAC CTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCA CATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCAC CCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACA CATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGC CAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAAT ATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCT GTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGAT CAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACT CTAAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGA TACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACC AGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTT ACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCGGA TCTCGGGCACCAATTGCTGAGCGATCAGATCCAACCTAGCCTCCATCGTGTTGCTGATCTTGATCTTGTTCTTCTGAGCGAGCAGA TCGACGCCTCCGGTGATCTCCTGAGACAGGTGCGACTCATCGTCCACCTTGAGTAGGATGTCTTTGCCGGTGGCGTCCTTGTATT TGGCAGCGACGTTGGGCAGGATGGACCTAACCAAGTCCCTATCTTGCGGTCTCACGCGGACCGTCACCTCCTTCTCGAACAGCT GGAACAGTCCTTGTAGGATTAGGCTCTCCAAAATTTGGGAGTATTTTCCTTGGTCTTTGGTTACTTCACCAAGACTTTTACGAGCAT CCTCCAGGACTGCTCTGACATGGTCCTCTCTCACTTTCAGCACCTTCAAACGAGCCTGATTCAACATATTAGAGGACTGAATTTTCT TTTGAAGTTCGACTTGCTTCTCCTTTTTCTCGTAGTACTCCATGATCTTGAGTCTCTGTTGCTGGACTAAACGCCCTTTTTCAATGTT GAATTCCTCCTCTGCCTTGGCATCGATTTCTTCTGCTTTCTCATTGGCTTCTTGTTCAATGAAAGCCATCATATGTTTGATCTGCG PC016 I SEQ ID NO: 511 TTGGGCATAGTCAAGATGGGGATCTGCGTGATGGAGCCGTTGCGGCCCTCCACACGACCGGCGCGCTCGTAAATGGTGGCCAG ATCGGTGTACATGTAACCGGGGAAACCCCTACGGCCGGGCACTTCTTCTCGAGCGGCAGACACCTCACGCAACGCCTCCGCGTA CGACGACATGTCGGTCAAGATGACCAGCACGTGCTTCTCGCACTGGTAGGCCAAGAATTCGGCGGCCGTCAGAGCCAAACGCGG CGTGATGATGCGCTCGATGGTCGGATCGTTGGCCAAGTTCAAGAACAGACACACGTTCTCCATCGAGCCGTTCTCTTCGAAGTCC TGCTTGAAGAACCTGGCAGTTTCCATGTTGACACCCATAGCAGCAAACACAATAGCAAAGTTGTCTTCATGGTCATCCAGCACAGA CTTGCCAGGTACTTTGACCAAGCCAGCCTGCCTACAAATCTGGGCTGCAATCTCATTGTGGGGCAGCCCAGCGGCGGAGAAGAT CGGAATCTTCTGCCCTCTGGCGATAGAGTTCATCACGTCGATGGCCGTGATCCCAGTCTGGATCATTTCCTCGGGATAAATACGC GACCACGGGTTGATCGGCTGTCCTTGGATGTCGAGGTAGTCCTCAGCCAGGATCGGGGGACCTTTATCAATGGGTTTTCCTGATC CATTGAAGACACGTCCCAGCATATCTTCTGATACTGGAGTTCTTAGAATATCTCCAGTGAACTCACACACCGTGTTCTTAGCATCAA TACCTGATGTGCCTTCAAATACCTGAACAACTGCCTTTGATCCATGACTTCCAAAACTTGTCCAGATCGTAGAGTTCCATCTGCCAA TTTGAGCTGGACAATTTCATTGAATTTTGGAAACTTGACATCCTCAAGAATGACCAGTAAGGGCGAATTCGACCCAGCTTTCTTGTA i CAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTAT GTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGT AAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGA GTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGT TGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGA GAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATG TACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTAT TCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTT CACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCT ACACATATATTCGCAAGAT GTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAG TTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGA CAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAA CAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTG CCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTA CCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATA ATTTTACCCACTAAGCGTGAC CAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAA GAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAA GCTGGGTCGAATTCGCCCTTACTGGTCATTCTTGAGGATGTCAAGTTTCCAAAATTCAATGAAATTGTCCAGCTCAAATTGGCAGA TGGAACTCTACGATCTGGACAAGTTTTGGAAGTCAGTGGATCAAAGGCAGTTGTTCAGGTATTTGAAGGCACATCAGGTATTGATG CTAAGAACACGGTGTGTGAGTTCACTGGAGATATTCTAAGAACTCCAGTATCAGAAGATATGCTGGGACGTGTCTTCAATGGATCA GGAAAACCCATTGATAAAGGTCCCCCGATCCTGGCTGAGGACTACCTCGACATCCAAGGACAGCCGATCAACCCGTGGTCGCGT ATTTATCCCGAGGAAATGAT CCAGACTGGGATCACGGCCATCGACGTGATGAACTCTATCGCCAGAGGGCAGAAGATTCCGATCTTCTCCGCCGCTGGGCTGCC CCACAATGAGATTGCAGCCCAGATTTGTAGGCAGGCTGGCTTGGTCAAAGTACCTGGCAAGTCTGTGCTGGATGACCATGAAGAC AACTTTGCTATTGTGTTTGCTGCTATGGGTGTCAACATGGAAACTGCCAGGTTCTTCAAGCAGGACTTCGAAGAGAACGGCTCGAT GGAGAACGTGTGTCTGTTCTTGAACTTGGCCAACGATCCGACCATCGAGCGCATCATCACGCCGCGTTTGGCTCTGACGGCCGC CGAATTCTTGGCCTACCAGTGCGAGAAGCACGTGCTGGTCATCTTGACCGACATGTCGTCGTACGCGGAGGCGTTGCGTGAGGT GTCTGCCGCTCGAGAAGAAGTGCCCGGCCGTAGGGGTTTCCCCGGTTACATGTACACCGATCTGGCCACCATTTACGAGCGCGC CGGTCGTGTGGAGGGCCGCAACGGCTCCATCACGCAGATCCCCATCTTGACTATGCCCAA PC027 SEQ ID NO: 512 GGGCCAAGCACAGCGAAATGCAGCAAGCTAACTTGAAAGCACTACCAGAAGGAGCTGAAATCAGAGATGGAGAACGTTTGCCAG TCACAGTAAAGGACATGGGAGCATGCGAGATTTACCCACAAACAATCCAACACAACCCCAATGGGCGGTTTGTAGTGGTTTGTGG TGATGGAGAATACATAATATACACGGCTATGGCCCTTCGTAACAAAGCATTTGGTAGCGCTCAAGAATTTGTATGGGCACAGGACT CCAGTGAATATGCCATCCGCGAATCCGGATCCACCATTCGAATCTTCAAGAATTTCAAAGAAAAAAAGAATTTCAAGTCCGACTTTG co GTGCCGAAGGAATCTATGGTGGTTTTCTCTTGGGTGTGAAATCAGTGTCTGGCTTAGCTTTCTATGACTGGGAAACGCTTGAGTTA GTAAGGCGCATTGAAATACAGCCTAGAGCTATCTACTGGTCAGATAGTGGCAAGTTGGTATGCCTTGCTACCGAAGATAGCTATTT CATATTGTCCTATGACTCTGA CCAAGTCCAGAAAGCTAGAGATAACAACCAAGTTGCCGAAGATGGAGTGGAGGCTGCCTTTGATGTCCTAGGTGAAATAAATGAA TCCGTAAGAACAGGTCTTTGGGTAGGAGACTGCTTCATTTACACAAACGCAGTCAACCGTATCAACTACTTTGTGGGTGGTGAATT GGTAACTATTGCACATCTGGACCGTCCTCTATATGTCCTGGGCTATGTACCTAGAGATGACAGGTTATACTTGGTTGATAAAGAGT TAGGAGTAGTCAGCTATCAATTGCTATTATCTGTACTCGAATATCAGACTGCAGTCATGCGACGAGACTTCCCAACGGCTGATCGA GTATTGCCTTCAATTCCAAAAGAACACCGCACTAGGGTGGCACAAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATA TCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAG CTGACCTG CAAACACGTTAAATGCTAAGAAGTTAGAATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCA TTAACTAATATCACCTCTAGAGTATAATATAATCA TTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTC TAC TGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGG AGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGG CATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAG CTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCA CGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTA TTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCG CCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTG TGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATC AGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCT AAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGT CATCTTACTA CMCTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAA GCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAA GCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTA CAAGAAAGCTGGGTCGAATTCGCCCTTTGTGCCACCCTAGTGCGGTGTTCTTTTGGAATTGAAGGCAATACTCGATCAGCCGTTG GGAAGTCTCGTCGCATGACTGCAGTCTGATATTCGAGTACAGATAATAGCAATTGATAGCTGACTACTCCTAACTCTTTATCAACCA AGTATAACCTGTCATCTCTAGGTACATAGCCCAGGACATATAGAGGACGGTCCAGATGTGCAATAGTTACCAATTCACCACCCACA AAGTAGTTGATACGGTTGACTGCGTTTGTGTAAATGAAGCAGTCTCCTACCCAAAGACCTGTTCTTACGGATTCATTTATTTCACCT AGGACATCAAAGGCAGCCTCCACTCCATCTTCGGCAACTTGGTTGTTATCTCTAGCTTTCTGGACTTGGTCAGAGTCATAGGACAA 4i TATGAAATAGCTATCTTCGGTAGCAAGGCATACCAACTTGCCACTATCTGACCAGTAGATAGCTCTAGGCTGTATTTCAATGCGCC i TTACTAACTCAAGCGTTTCCCAGTCATAGAAAGCTAAGCCAGACACTGATTTCACACCCAAGAGAAAACCACCATAGATTCCTTCG VD GCACCAAAGTCGGACTTGAAATTCTTTTTTTCTTTGAAATTCTTGAAGATTCGAATGGTGGATCCGGATTCGCGGATGGCATATTCA CTGGAGTCCTGTGCCCATACAAATTCTTGAGCGCTACCAAATGCTTTGTTACGAAGGGCCATAGCCGTGTATATTATGTATTCTCC ATCACCACAAACCACTACAAACCGCCCATTGGGGTTGTGTT GGATTGTTTGTGGGTAAATCTCGCATGCTCCCATGTCCTTTACTGTGACTGGCAAACGTTCTCCATCTCTGATTTCAGCTCCTTCTG GTAGTGCTTTCAAGTTAGCTTGCTGCATTTCGCTGTGCTTGGCCC MP001 SEC ID NO: 1066 GTTTAAACGCACCCAAAGCATGGATGTTGGACAAATCGGGGGGTGTCTTCGCTCCACGTCCAAGCACCGGTCCACACAAACTTCG TGAATCACTACCGTTATTGATCTTCTTGCGTAATCGTTTGAAGTATGCACTTACTGGTGCCGAAGTCACCAAGATTGTCATGCAAAG ATTAATCAAGGTTGATGGCAAAGTCCGTACCGACCCTAATTATCCAGCCGGTTTTATGGATGTTATATCTATCCAAAAGACCAGTGA GCACTTTAGATTGATCTATGATGTGAAAGGTCGTTTCACCATCCACAGAATTACTCCTGAAGAAGCAAAATACAAGTTGTGTAAAGT AAAGAGGGTACAAACTGGACCCAAAGGTGTGCCATTTTTAACTACTCATGATGGCCGTACTATTCGCTACCCTGACCCTAACATCA AGGTTAATGACACTATTAGATACGATATTGCATCATCTAAAATTTTGGATCATATCCGTTTTGAAACTGGAAACTTGTGCATGATAAC TGGAGGTCGCAATTTAGGGCGTGTTGGTATTGAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCG GCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAA ACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTA ACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTAC AATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGC TAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATT TCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAA GTTTTATCCGGCCTTTATTCACATTC TTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTG TTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATA TTCGCAAGATGTGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCC TGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACG CAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATG AATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACC AACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTAGA GTGTTTTACCAA GAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTT i cp ACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAG or ACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCAC CACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCAATACCAACACGCCCTAAATTGCGACCTCCAGTTATCATGCACAAGTTT CCAGTTTCAAAACGGATATGATCCAAAATTTTAGATGATGCAATATCGTATCTAATAGTGTCATTAACCTTGATGTTAGGGTCAGGG TAGCGAATAGTACGGCCATCATGAGTAGTTAAAAATGGCACACCTTTGGGTCCAGTTTGTACCCTCTTTACTTTACACAACTTGTAT TTTGCTTCTTCAGGAGTAATTCTGTGGATGGTGAAACGACCTTTCACATCATAGATCAATCTAAAGTGCTCACTGGTCTTTTGGATA GATATAACATCCATAAAACCGGCTGGATAATTAGGGTCGGTACGGACTTTGCCATCAACCTTGATTAATCTTTGCATGACAATCTTG GTGACTTCGGCACCAGTAAGTGCATACTTCAAACGATTACGCAAGAAGATCAATAACGGTAGTGATTCACGAAGTTTGTGTGGACC GGTGCTTGGACGTGGAGCGAAGACACCCCCCGATTTGTCCAACATCCATGCTTTGGGTGCGTTTAAAC MP002 SEQ ID NO: 1067 GCTGATTTAAGTGCATCTGCTGCAGTTTTCATGGTAGTCAATACTGCTGTATTTGTGTTGGCACCTTCTAATGCCTCCCGCTGTTGT TCAATAGTTAACATGGTACCATCAATTTGGGCTAATTGTTGTTCGTACCGTTTCTTACGCTTCAATGCTTGCAATGCAGCTCGTTTAT TAGTTGTACCAI l i l l I GGCTATCGCTACTTCTTGTTCAA I I I I I I I CTAAAAATTCTTGTTTCTTTATCAGCATCTCTTCAGTGG ATCGAAGCTTTTGTATCGCATCTTCGGTTGATGGTCCCTTCTCTTCCTTTTTGCCACCAAGGGCGAATTCGACCCAGCTTTCTTGTA CAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTAT GTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTGGTATATGAATAAGCTGT AAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTAGGCTA ATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAATTCAATGAACGCTAAGCT GATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCA TCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAA GACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTAT GGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCAT CGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGC CTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGC CAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATT CAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCG GGGCGTAAACGCGTGGATCGCTTAATATGACTCTCAATAAAGTCTCATACCAACAGTGCCACCTTATTCAACCATCAAGAAAAAA GCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACA ACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAA ACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGG 4-. CAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGT Cp CGAATTCGCCCTTGGTGGCAAAAAGGAAGAGAAGGGACCATCAACCGAAGATGCGATACAAAAGCTTCGATCCACTGAAGAGATG CTGATAAAGAAACAAGAATTTTTAGAAAAAAAAATTGAACAAGAAGTAGCGATAGCCAAAAAAAATGGTACAACTAATAAACGAGCT GCATTGCAAGCATTGAAGCGTAAGAAACGGTACGAACAACAATTAGCCCAAATTGATGGTACCATGTTAACTATTGAACAACAGCG GGAGGCATTAGAAGGTGCCAACACAAATACAGCAGTATTGACTACCATGAAAACTGCAGCAGATGCACTTAAATCAGC MP010 SEQ ID NO: 1068 CAGACCCTGTTCAGAATATGATGCATGTTAGTGCTGCATTTGATCAAGAAGCATCTGCCGTTTTAATGGCTCGTATGGTAGTGAAC CGTGCTGAAACTGAGGATAGTCCAGATGTGATGCGTTGGGCTGATCGTACGCTTATACGCTTGTGTCAAAAATTTGGTGATTATCA AAAAGATGATCCAAATAGTTTCCGATTGCCAGAAAACTTCAGTTTATATCCACAGTTCATGTATCATTTAAGAAGGTCTCAATTTCTA CAAGTTTTTAATAATAGTCCTGATGAAACATCATATTATAGGCACATGTTGATGCGTGAAGATGTTACCCAAAGTTTAATCATGATAC AGCCAATTCTGTATAGCTATAGTTTTAATGGTAGGCCAGAACCTGTACTTTTGGATACCAGTAGTATTCAACCTGATAAAATATTATT GATGGACACATTTTTCCATATTTTGATATTCCATGGAGAGACTATTGCTCAATGGAGAGCAATGGATTATCAAAATAGACCAGAGTA TAGTAACCTCAAGCAGTTGCTTCAAGCCCCCGTTGATGATGCTCAGGAAATTCTCAAAACTCGATTCCCAATGCAAGGGCGAATTC GACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGC ACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATATGAGACACGTTAACTG GTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGA CTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCATCAAAT TCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTT GATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGAT ATTACGGCCTTTTTAAAGACCGTAA AGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGA AAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGG AGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCC TAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGA CAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCAT CATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAA CGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATT TATGCTACTCTAAG GAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAA AACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAG CATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCT CATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTGCATTGGG AATCGAGTTTTGAGAATTTCCTGAGCATCATCAACGGGGGCTTGAAGCAACTGCTTGAGGTTACTATACTCTGGTCTATTTTGATAA TCCATTGCTCTCCATTGAGCAATAGTCTCTCCATGGAATATCAAAATATGGAAAAATGTGTCCATCAATAATATTTTATCAGGTTGAA TACTACTGGTATCCAAAAGTACAGGTTCTGGCCTACCATTAAAACTATAGCTATACAGAATTGGCTGTATCATGATTAAACTTTGGG TAACATCTTCACGCATCAACATGTGCCTATAATATGATGTTTCATCAGGACTATTATTAAAAACTTGTAGAAATTGAGACCTTCTTAA i cp ATGATACATGAACTGTGGATATAAACTGAAGTTTTCTGGCAATCGGAAACTATTTGGATCATCTTTTTGATAATCACCAAATTTTTGA NJ CACAAGCGTATAAGCGTACGATCAGCCCAACGCATCACATCTGGACTATCCTCAGTTTCAGCACGGTTCACTACCATACGAGCCAT TAAAACGGCAGATGCTTCTTGATCAAATGCAGCACTAACATGCATCATATTCTGAACAGGGTCTG MP016 SEQ ID NO: 1069 GTTTTCAATGGCAGTGGAAAGCCGATAGATAAAGGACCTCCTATTTTGGCTGAAGATTATTTGGATATTGAAGGCCAACCTATTAAT CCATACTCCAGAACATATCCTCAAGAAATGATTCAAACTGGTATTTCAGCTATTGATATCATGAACTCTATTGCTCGTGGACAAAAA ATTCCAATATTTTCAGCTGCAGGTTTACCACATAATGAGATTGCTGCTCAAATTTGTAGACAAGCTGGTCTCGTTAAAAAACCTGGT AAATCAGTTCTTGACGATCATGAAGACAATTTTGCTATAGTATTTGCTGCTATGGGTGTTAATATGGAAACAGCCAGATTCTTTAAA CAAGATTTTGAGGAAAATGGTTCAATGGAGAATGTTTGTTTGTTCTTGAATTTAGCTAATGATCCTACTATTGAGCGTATCATTACAC CACGAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGA CCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATA TGAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATC AAATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACC CCTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCAC TGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCA GACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGC CCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTAC ACCGTTTTCCATGAGCAAACTGAAACG TTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAA CCTGGCCTATTTCCCTA GGGTrrATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAA CGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTG GCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCA GGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAG AAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTAC TAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACC AGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAG AAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAG CTGGGTCGAATTCGCCCTTCGTGGTGTAATGATACGCTCAATAGTAGGATCATTAGCTAAATTCAAGAACAAACAAACATTCTCCAT TGAACCATTTTCCTCAAAATCTTGTTTAAAGAATCTGGCTGTTTCCATATTAACACCCATAGCAGCAAATACTATAGCAAAATTGTCT TCATGATCGTCAAGMCTGATTTACCAGGTTTTTTAACGAGACCAGCTTGTCTACAAATTTGAGCAGCAATCTCATTATGTGGTAAA CCTGCAGCTGAAAATATTGGAATTTTTTGTCCACGAGCAATAGAGTTCATGATATCAATAGCTGAAATACCAGTTGAATCATTTCTT GAGGATATGTTCTGGAGTATGGATT AATAGGTTGGCCTTCAATATCCAAATAATCTTCAGCCAAAATAGGAGGTCCTTTATCTATCGGCTTTCCACTGCCATTGAAAAC MP027 SEQ ID NO: 1070 CCAAAAATACCATCTGCTCCACCTTCTGGTTTAAAAGACTTTTTTTCTTTAAAATTTTTAAAAACTTTGATTGTAGAAGAATTTTCTCT AATGGCATACTCAGAATCAGAAGACCATACAAAATCCTGAGCGGAGCCAAATGCTTTATTACGCAAAGCCATTGATGTATATATAAT ATACTCTCCATCACCACATACTACTAAAAATCTACCATTCGGATTATGAGATATTGACTGTGGATAAATTTCACAGCTACCCATGTCT TTAACTTGTATTGGTAAACGTTCACCATCTTTGATTTCGGCTCCTTCTGCTTGAAGCATCGCTTTAAGGTTAGCTTGTTGAATTTCAC TATGACGTGCCCAAACAATTTTACCCCCATGAACATCCATTGACATTGCTGGCTCTTCACGACCAACTTTAACCATTATACTTCCTT CATCATAACCTAGAGCTACATTATTAGATCCCCGTAAGCAACAGATTGTCCATACACGTTCTAACCCATAGTTTAATGATGATTCTA ATCGATAAGTACCAGAATGCCAAATTCTGACGGTACCATCTTCTGAGCCAGTTAACACGATGGGAAGTTCTGGATGGAAACAAACG AGCAAGGGCGAATTCGACCCAGCTTTCTTGTACAAAGTGGTGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGAC CTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTGTCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATAT 4i > GAGACACGTTAACTGGTATATGAATAAGCTGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCA Cp UJ AATTCGACAATTTGACTTTCAAGAGTAGGCTAATGTAAAATCTTTATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCC CTATGGCCATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACT GGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAG ACCGTTCAGCTGGATATTACGGCCT TTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAAT TCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACG TTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAA CCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAA CGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTG GCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCA GGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAG AAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGATTTAGAGTGTTTTACCAAGAATTTCTGTCATCTTAC TAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACC AGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAG AAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAG CTGGGTCGAATTCGCCCTTGCTCGTTTGTTTCCATCCAGAACTTCCCATCGTGTTAACTGGCTCAGAAGATGGTACCGTCAGAATT TGGCATTCTGGTACTTATCGATTAGAATCATCATTAAACTATGGGTTAGAACGTGTATGGACAATCTGTTGCTTACGGGGATCTAAT AATGTAGCTCTAGGTTATGATGAAGGAAGTATAATGGTTAAAGTTGGTCGTGAAGAGCCAGCAATGTCAATGGATGTTCATGGGGG TAAAATTGTTTGGGCACGTCATAGTGAAATTCAACAAGCTAACCTTAAAGCGATGCTTCAAGCAGAAGGAGCCGAAATCAAAGATG GTGAACGTTTACCAATACAAGTTAAAGACATGGGTAGCTGTGAAATTTATCCACAGTCAATATCTCATAATCCGAATGGTAGATTTT TAGTAGTATGTGGTGATGGAGAGTATATTATATATACATCAATGGCTTTGCGTAATAAAGCATTTGGCTCCGCTCAGGATTTTGTAT 4 ^ (i GGTCTTCTGATTCTGAGTATGCCATTAGAGAAAATTCTTCTACAATCAAAGTTTTTAAAAATTTTAAAGAAAAAAAGTCTTTTAAACCA 4-.

GAAGGTGGAGCAGATGGTATTTTTGG Table 10-LD = data where it was analyzed using the Kaplan-Meier survivor curve analysis Tables 10-NL (b) = data where it was analyzed using the Kaplan-Meier survivor curve analysis Alpha < 0.05 Tables 10-NL (c) = data where it was analyzed using the Kaplan-Meier survivor curve analysis Alpha < 0.05 Tables 10-NL (d) = data where it is analyzed using Kaplan-Meier survival curve analysis Table 11-NL = data where it is analyzed using Kaplan-Meier survival curve analysis 2alfa < 0.05

Claims (37)

1. - an isolated nucleotide sequence comprising a nucleic acid sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 , 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240 to 247, 249, 251, 253 , 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596 , 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888 , 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1066 to 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095 , 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637 , 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 170 0, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement thereof,

(ii) sequences which are at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical to the sequence represented by any of SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240 to 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1066 to 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement thereof, and (iii) sequences comprising at least 17 contus nucleotides of any of the sequences

represented by SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160-163, 168, 173, 178, 183, 188, 193 , 198, 203, 208, 215, 220, 225, 230, 240 to 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783, 788, 793 , 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, 1066 to 1071 , 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577 , 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690 , 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106 , 2108, 2120 to 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476, 2481 or 2486, or the complement thereof, or wherein the nucleic acid sequence is an ortholog a gene comprising at least 17 contus nucleotides of any of SEQ ID NOs 49 to 158, 275 to 472, 533 to 575, 621 to 767, 813 to 862, 908 to 1040, 1161 to 1571, 1730 to 2039, 2120 to 2338, 2384 to 2460, or the complement thereof.

2. - A double-stranded ribonucleotide sequence of the expression of a polynucleotide sequence of claim 1, wherein the ingestion of the ribonucleotide sequence by a plant insect inhibits the growth of the insect pest.

3. The ribonucleotide sequence produced from the expression of a polynucleotide sequence of claim 1, wherein the ingestion of the sequence inhibitory expression of a nucleotide sequence substantially complementary to the sequence.

4. A composition comprising a ribonucleotide sequence according to claim 2 or 3, and further comprising at least one adjuvant and optionally at least one surfactant.

5. A composition comprising at least one

Double stranded RNA, a strand which has a nucleotide sequence that is complementary to at least a part of a nucleotide sequence selected from a group of sequences as defined in claim 1 and optionally also comprises at least one race appropriate, excipient or diluent.

6. A cell transformed with a polynucleotide comprising a nucleic acid sequence as defined in claim 1, optionally operably linked to a regulatory sequence.

1 . - The cell of claim 6, wherein the cell is a prokaryotic cell, such as a GRAM-positive or GRAM-negative bacterial cell or wherein the cell is a eukaryotic cell, such as a yeast cell or an algal cell .

8. The cell of claim 7, wherein the cell is a bacterial cell.

9. The cell of claim 7, wherein the cell is a yeast cell.

10. A composition comprising at least one bacterial cell or a yeast cell comprising at least one polynucleotide as defined in claim 1.

11. The composition of claim 10, wherein the yeast cell or Bacterial is inactivated or killed, for instance by heat treatment or mechanical treatment.

12. A composition comprising at least one yeast or bacterial cell that expresses at least one double-stranded RNA, a strand of which has a nucleotide sequence that is complementary to at least a part of the sequence of nucleotide selected from a group of sequences as defined in claim 1 and optionally further comprises at least one suitable race, excipient or diluent.

13. The composition of any of claims 5 or 10 to 12, said composition further comprising at least one pesticidal agent selected from a group consisting of chemical insecticide, a patatin, an insecticidal protein Bacillus thuringinesis, an insecticidal protein Xenorhabdus, a protein insecticidal

Photorhabdus, an insecticidal protein Bacillus terosporous and an insecticidal protein Bacillus sphearicus, the pesticidal agents have been activated against the same plant insect pest as defined in claim 2 or where the pesticidal agent is activated against one or other pests of plant insect. 14. The composition of any of claims 10 to 12, said composition further comprising at least one pesticidal agent selected from a group consisting of chemical insecticide, a patatin, an insecticidal protein Bacillus thuringinesis, an insecticidal protein Xenorhabdus, a protein insecticidal Photorhabdus, an insecticidal protein Bacillus terosporous and an insecticidal protein Bacillus sphearicus, pesticidal agents have been activated against the same plant insect pest as defined in claim 2 or where the pesticidal agent is activated against one or other pests of plant insect.

15. - A composition of any of claims 5 or 10 to 12, said composition further comprising at least one pesticidal agent selected from a group consisting of chemical insecticide, a patatin, an insecticidal protein Bacillus thuringinesis, an insecticidal protein Xenorhabdus, an insecticidal protein Photorhabdus, an insecticidal protein Bacillus laterosporous and an insecticidal protein Bacillus sphearicus, the pesticidal agents have been activated against the same plant insect pest as defined in they claimed 2 or where the pesticidal agent is activated against one or more other plant insect pests.

16. The composition of any of claims 13 to 15 wherein the insecticidal protein Bacillus thuringiensis is selected from a group consisting of a Cryl, a Cry3, an TIC851, a CryET170, a Cry22, a binary insecticidal protein CryET33 and CryET34, a binary insecticidal protein CryET80 and CryET76 a binary insecticidal protein TIC100 and TIC101, and a binary insecticidal protein PS149B1.

17. The composition of any of claims 13 to 16, as an agent for killer insects.

18. The composition of any of claims 13 to 16, for use as a medicament for preventing at least or treating a human or animal body from insect infestation.

19. A sprayer comprising at least one composition according to any of claims 10 to 18, and optionally further comprising at least one adjuvant and at least one surfactant.

20. A housing or trap or bait for a pest that contains a composition as defined in claims 10 to 18.

21. The use of a composition of any of claims 10 to 18, a sprayer claim 19 or a housing, trap or bait of claim 20 for killing or inhibiting the growth of an insect chosen from a group comprising Leptinotarsa spp. (e.g. L. decemilinea ta. Colorado potato beetle) L. j uncta (false potato beetle), and L. texana (Texano false potato beetle), and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide having a nucleotide sequence selected from a group comprising:

(i) sequences represented by any of SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 a

158, 159, 160 to 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240 to 246, or 2486, or the complement thereof, (ii) sequences which are at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical to the sequence represented by any of SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158,

159, 160 to 163, 168, 173, 178, 183, 188, 193 ,. 198, 203, 208, 215, 220, 225, 230, 240 to 246, or 2486, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 to 158, 159, 160 to 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240 to 246, or 2486, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ. NOs 49 to 158, or the complement thereof.

22. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of the

claim 20 to kill or inhibit the growth of an insect chosen from a group comprising Phaedon spp. (eg P cochleariae (mustard plant beetle)) and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide has a sequence of nucleotide selected from a group comprising: (i) sequences represented by any of SEC

ID NOs 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 512, or the complement thereof, (ii) sequences that have identity of at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% with the sequence represented by any of SEQ ID NOs 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 512, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 247, 249, 251, 253, 255, 257, 259, 275 to 472, 473, 478, 483, 488, 493, 498, 503, 508 to 512, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least

17 contiguous nucleotides of any of SEQ ID NOs 275 to 472, or the complement thereof.

23. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 for killing or inhibiting the growth of an insect chosen from a group comprising Epilachna spp. (e.g., E. varivetis (Mexican bean beetle) ), and wherein the nucleic acid in the composition comprises a polynucleotide, or wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide having a nucleotide sequence selected from a group comprising: i) sequences represented by either SEC

ID NOs 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591 to 596, or the complement thereof, (ii) sequences that are at least 70%, preferably at least 75% , 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical to the sequence represented by any of SEQ ID NOs 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591 or 596, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences

represented by SEQ ID NOs 513, 515, 517, 519, 521, 533 to 575, 576, 581, 586, 591 or 596, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene that it comprises at least 17 contiguous nucleotides of any of SEQ ID NOs 533 to 575, or the complement thereof.

24. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 to kill or inhibit the growth of an insect chosen from a group that comprises Anthonomus spp (e.g., A granáis (bore weevil)), and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide has a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783 or 788, or the complement thereof, (ii) sequences having identity of at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98 % or 99% with the sequence represented by any of SEQ ID NOs

601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783 or 788, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences depicted by SEQ ID NOs 601, 603, 605, 607, 609, 621 to 767, 768, 773, 778, 783 or 788, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 621 to 767, or the complement thereof.

25. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 for killing or inhibiting the growth of an insect chosen from a group that comprises Tribolium spp (eg T castaneum (red flower beetle)), and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide has a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878 or 883,, or the complement of it,

(ii) sequences having identity of at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% with the sequence represented by any of SEQ ID NOs 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878 or 883, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 793, 795, 797, 799, 801, 813 to 862, 863, 868, 873, 878 or 883, or the complement thereof, or wherein the acid sequence nucleic is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 813 to 862, or the complement thereof.

26. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 to kill or inhibit the growth of an insect chosen from a group that comprises Myzus spp (eg M persicae (green peach aphid)), and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said

The polynucleotide has a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, or 1066 at 1070, or the complement thereof, (ii) sequences having identity of at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical with the sequence represented by any of SEQ ID NOs 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061, or 1066 to 1070, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 888, 890, 892, 894, 896, 908 to 1040, 1041, 1046, 1051, 1056, 1061 , or 1066 to 1070, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any d e SEQ ID NOs 908 to 1040, or the complement thereof.

27. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 to kill or inhibit the growth of an insect chosen from a group that comprises Nilaparva ta spp (eg N lugens (grasshopper coffee)), and

- wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide having a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103 ,. 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672 or 1677, or 1066 to 1070, or the complement thereof, (ii) sequences having at least 70% identity, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% with the sequence represented by any of SEQ ID NOs 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1 101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627 , 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672 or 1677, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences

represented by SEQ ID NOs 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1 101, 1103, 1105, 1107, 1109, 1111, 1113, 1161 to 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672 or 1677, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 1161 to 1571, or the complement thereof.

28. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 to kill or inhibit the growth of an insect chosen from a group that includes Chilo spp (eg C suppressalis (stem borer in rice strips), C a uricilius (Gold-fringed stem borer), or C polychrysus (black head stem borer)), and - where the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide having a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698,

1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090 or 2095, or the complement thereof, (ii) sequences that are at least 70 %, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% identical to the sequence represented by any of SEQ ID NOs 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090 or 2095, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 1071, 1073, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698 , 1700, 1702, 1704, 1730 to 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090 or 2095, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of c Any of SEQ ID NOs 1730 to 2039, or the complement thereof.

29. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 to kill or inhibit the growth of a

insect chosen from a group comprising Plutella spp (e g

P xylostella (diamontback moth)), and wherein the nucleic acid in the composition comprises a polynucleotide, or wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide having a selected nucleotide sequence of a group comprising: (i) sequences represented by any of SEQ ID NOs 2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344,

2349, 2354 or 2359,, or the complement thereof, (ii) sequences having at least 70% identity, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95% 96%, 97%, 98% or 99% with the sequence represented by any of SEQ ID NOs

2100, 2102, 2104, 2106, 2108, 2120 to 2338, 2339, 2344, 2349,

2354 or 2359, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEQ ID NOs 2100, 2102, 2104, 2106, 2108,

2120 to 2338, 2339, 2344, 2349, 2354 or 2359, or the complement thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 2120 a 2338, or the complement thereof.

30. - The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 for killing or inhibiting the growth of an insect chosen from a group comprising Acheta spp (e.g., A domesticus (domestic grasshopper)), and - wherein the nucleic acid in the composition comprises a polynucleotide, or - wherein a bacterium or yeast cell in the composition comprises or expresses a polynucleotide, said polynucleotide has a nucleotide sequence selected from a group comprising: (i) sequences represented by any of SEQ ID NOs 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof, (ii) sequences having identity of at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98% or 99% with the sequence represented by any of SEQ ID NOs 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement thereof, and (iii) sequences comprising at least 17 contiguous nucleotides of any of the sequences represented by SEC ID NOs 2364, 2366, 2368, 2370, 2372, 2384 to 2460, 2461, 2466, 2471, 2476 or 2481, or the complement

thereof, or wherein the nucleic acid sequence is an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs 2384 to 2460, or the complement of it.

31. The use of a composition of any of claims 10 to 18, a sprayer of claim 19 or a housing, trap or bait of claim 20 in a pharmaceutical or veterinary application.

32.- A method for preventing insect growth in a plant or for preventing insect infestation of a plant comprises applying a composition of any of claims 10 to 18 or a sprayer of claim 19 to the plant.

33.- A method for improving the yeast, comprises applying to a plant an effective amount of a composition of any of claims 10 to 18 or a sprinkler of claim 19.

34.- The method of claim 32 or 33, where the plant is chosen from a group comprising alfalfa, apple, apricot, artichoke, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, Brussels, cabbage, cañola, carrot, tapioca, cauliflower, a cereal, celery, cherry, citrus, clemintina, coffee, corn, cotton, cucumber, eggplant, endive,

eucalyptus, fig, grape, grapefruit, cachuate, cherry tomato, kivi, lettuce, leek, lemon, lime, pine, corn, mango, melon, millet, mushroom, dried fruit, okra, onion, orange, an ornamental plant or flower tree, papaya, parsley, pea, peach, peanut, peat, pepper, persimmon, pineapple, banana, plum, pomegranate, potato, squash, radish, radish, rapeseed, raspberry, rice, rye, sorghum, soybeans, soybeans, spinach, strawberry, beet, sugar cane, sunflower,, sweet potato, tangerine, tea, tobacco, tomato, wine, watermelon, wheat, yam and zucchini.

35. The method according to any of claims 32 to 34 wherein the insect is selected from a group comprising of Leptinotarsa spp. (eg, L. decemlinea ta (potato beetle), L. uncta (false potato beetle), or L. texana (Texan false potato beetle)); Lemma spp. (e.g., L. trilinea ta (three-layer potato beetle)); Epi trix spp. (e.g., E. cucumeris

(potato fly beetle), E. hirtipennis (fly beetle), or E. tuberis (flying pipe beetle)); Epicauta spp. (e.g., E. vi tta ta (Blister beetle with smooth)); Phaedon spp. (e.g., P. cochleariae (mustard leaf beetle)); Nilaparva ta spp. (e.g., N. lugens (salt tamontes of brown plants)); Laodelphax spp. (e.g., L. stria tell us (small coffee planthopper); Nephotet tix spp. (e.g., N.

virescens or N. cincticeps (green leafhopper), or N. nigropictus (grasshopper leafhopper); Soga tella spp. (e.g., S. furcifera (grasshoppers of white-back plants), Blissus spp. (e.g., B. leucopterus leucopterus (chinche), Scotinophoa spp. (e.g., S. vermidula te (tick) black rice), Acrosternum spp. (e.g., A hilare (green tick)), Parnara spp. (e.g., P. guttata (rice butterfly), Chilo spp. (e.g., C .. suppressalis (stems weevil separated from rice), C. auricilius (gold-fringed stems weevil), or C. polychrysus (black stem stems); Chilotraea spp. (e.g., C. polychrysa (weevil of rice stems), Sesamia spp. (e.g., S. inferens (pink rice weevil), Trypoyza spp. (e.g., T. innota ta (white rice weevil), or T. incertulas ( yellow rice weevil), Cnaphalocrocis spp. (e.g., C. medinalis (rice leaf wrapper)), Agromyza spp. (e.g., A. oyzae (leaf destroyer), or A parviconis (destroyer) of leaves of corn stains)), Oia traea spp. (v.gr., 0. saccharalis (sugarcane weevil), or 0. gryiosella (boll weevil) e corn from the south east); Narnaga spp. (e.g., N. aenescens (green rice caterpillar)); Xanthodes spp. (e.g., X. transverse (green caterpillar), Spodoptera spp. (e.g., S. frugiperda (autumn worm), S. exigua (cane worm), S. li ttoalis (climbing worm) or S. praefica (worm with eastern yellow strips); Mythimna spp. (E.g., Mythmna (Pseudaletia) sepera ta (worm);

Helicoverpa spp. (e.g., H. zea (corn worm), Colaspis spp. (e.g., C. brunnea (grape colapis), Lissohoptrus spp. (e.g., L. oyzophilus (water weevil of rice), Echinocnemus spp. (e.g., E. squamos (rice plant weevil), Oclodispa spp. (e.g., 0. armigera (rice hispa)) Oulema spp. , 0. oyzae (leaf beetle), Si tophilus spp. (E.g., S. oyzae (rice weevil);

Pachydiplosis spp. (eg, P. oyzae (Gall mosquitoes from rice), Hydrellia spp. (eg, H. griseola (insects in the form of small leaves of rice), or H. sasakii (rice stem maggot) Chloops spp. (Eg, C. oyzae (stem maggot), Oiabrotica spp. (V. 0. virgifera virgifera (western corn rootworm), 0. barberi (corn rootworm) from the north), 0. undecimpuncta ta howardi (southern corn rootworm), 0. virgifera zeae (Mexican corn rootworm), 0. bal tea ta (cucumber beetle with bands), Ostrinia spp. v. 0. nubilalis (European corn weevil), Agrotis spp. (e.g., Aipsilon (black worm), Elasmopalpus spp. (e.g., E. lignosellus (lower maize weevil), Melanotus spp. (wireworm) Cyclocephala spp. (e.g., C. jboeales (northern masked beetles), or C. immacula ta

(masked beetles from the south); Popillia spp. (e.g., P. japonica (Japanese beetle), Chaetocnema spp. (e.g., C. pulicaria (corn fly beetle), Sphenophous spp. (e.g., S. maidis (Billbug de maiz) Rhopalosiphum spp.

(e.g., R. maidis (corn leaf aphids), Anuraphis spp.

(e.g., A maidiradicis (roots of maize aphid));

Melanoplus spp. (e.g., M. femurrubrum (red-legged grasshopper) M. differen tialis (differential grasshopper) or M. sanguinipes (migratory grasshopper)); Hylemya spp.

(e.g., H. platura (seedcon maggot)); Anaphothrips spp.

(e.g., A. obscrurus (grass thrips)); Solenopsis spp.

(e.g., S. milesta (thief ant)); or spp, (e.g., T. urticae (spider mites with two spots), T. cinnabarinus (carmine spider mites), Helicoverpa spp. (v. gr., H. zea

(cotton worm), or H. armigera (American worm));

Pectinophoa spp. (e.g., P. gossypiella (pink worm));

Earias spp. (e.g., E. vi ttella (spotted worm)); Heliothis spp. (e.g., H. virescens (tobacco worm)); Anthonomus spp. (e.g., A. gryis (Bole weevil)); Pseuda tomoscelis spp.

(e.g., P. seria ser (cotton flying grasshopper));

Trialeurodes spp. (e.g., T. abutiloneus (white fly with banded wings) T. vapoarioum (greenhouse whitefly));

Bemisia spp. (e.g., B. argentifol ti (white fly of silver leaves)); Aphis spp. (e.g., A. gossypii (cotton aphid)); Lygus spp. (e.g., L. lineolaris (tarnished plant bug) or L. hesperus (western tarnished plant bug)); Euschistus spp. (e.g., E. conspersus (stinky bug Consperse)); Chloochroa spp. (e.g., C. sayi (stinky bug Say)); Nezara spp. (v.gr., N. viridula (Bicho

smelly southern green)); Thrips spp. (e.g., T. tabaci (onion tirps)); Frankliniella spp. (e.g., F. fusca (tobacco shoots), or F. occidentalis (western flower shoots)); Epilachna spp. (e.g., E. varivetis (Mexican bean beetle)); Acheta spp. (e.g., A. domesticus (domestic grasshopper)); Empoasca spp. (e.g., E. fabae (potato grasshopper)); Myzus spp. (e.g., M. persicae (green peach aphid)); For trioza spp. (e.g., P. cockerelli (psyllid)); Conoderus spp. (e.g., C. fallí (almond worm of southern potatoes), or C. vespertinus (wire worm of work)); Phthoimaea spp. (e.g., P. operculella (potato tuber worm)); Macrosiphum spp. (v. gr., M. euphobiae (potato aphid)); Thyanta spp. (v. gr., T. pallidovirens (stinkworm with red back)); Phthoimaea spp. (v. gr., P. operculella (potato tuber worm)); Helicoverpa spp. (v. gr., H. zea (tomato worm), Keiferia spp. (v. gr., K. Iycopersicella (worm tomato bolt)), Limonius spp. (wire worm), Myuca spp. (v. gr. ., M. sixth (worm), or M. quinquemacula ta (tomato worm)), Liriomyza spp. (V. Gr., L. sa tivae, L. trí tolli or L. huidobrensis

(leaf destroyer)); Drosophilla spp. (e.g., D. melanogaster, D. yakuba, D. pseudoobscura or D. simulans);

Carabus spp. (v.gr., C. granula tus); Chironomus spp. (v.gr.,

C. tentanus); Ctenocepha lides spp. (e.g., C. felis (cat fly)); Diaprepes spp. (v.gr., D. abbrevia tus (weevil of

estate)); Ips spp. (e.g., I. pini (pine engraver)); Triboli um spp. (e.g., T. castaneum (red soil beetle)); Glossina spp. (e.g., G. mosi tans (tsetse fly)) Anopheles spp. (e.g., A. gambiae (malaria mosquito)) Helicoverpa spp. (e.g., H. armigera (African Boilworm)) Acyrthosiphon spp. (e.g., A. pisum (pea aphid)) Apis spp. (e.g., A. melifera (honey-producing bee)) Homalodisca spp. (e.g., H. coagulate you (bright-leaved grasshoppers)); Aedes spp. (e.g., A. aegypti (yellow fever mosquito)); Bombyx spp. (v. gr., B. moi (silkwom)); Locusta spp. (v. gr., L. migra toia (migratory locust)); Boophilus spp. (e.g., B. microplus (cattle tick)); Acanthoscurria spp. (v.gr., A. gomesiana (red-haired chocolate bird eater)); Diploptera spp. (e.g., D. puncta ta (pacific beetle cockroach)); Heliconius spp. (e.g., H. era to (butterfly of red passion flower) or H. melpomene (butterfly Postman)); Curculio spp. (e.g., C. glyium (Acón beetle)); Plutella spp. (e.g., P. xylostella (Diamondback moth)); Ambiyomma spp. (e.g., A. variega tum (cattle tick)); Anteraea spp. (e.g., A. yamamai (silk moth)); and Armigeres spp. (v.gr., A. subalba tus).

36.- A method for preventing the growth of an insect on a substrate comprising applying a composition of any of claims 10 to 18, or a sprayer of claim 19 to the substrate.

37. - A method for treating and / or preventing a disease or a condition caused by a target organism, comprises administering to a subject in need of such treatment and / or prevention, a composition of any of claims 10 to 18, or a sprayer of claim 19.