MX2008003931A - Modulation of glucocorticoid receptor expression - Google Patents

Abstract

Compounds, compositions and methods are provided for modulating the expression of glucocorticoid receptor. The compositions comprise antisense compounds, particularly antisense oligonucleotides which have particular in vivo properties, targeted to nucleic acids encoding glucocorticoid receptor. Methods of using these compounds for modulation of glucocorticoid receptor expression and for treatment of diseases are provided.

Description

MODULATION OF EXPRESSION OF THE GLUCOCORTICOID RECEPTOR SEQUENCE LIST In the present invention, a computer-readable form of the sequence listing is incorporated as a reference, into a disk, which contains the file name BIOL0065WOSEQ.txt, which is 37,122 bytes (measured in MS-DOS) and was created September 19, 2006.

FIELD OF THE INVENTION In the present invention, compounds, compositions and methods for the modulation of glucocorticoid receptor expression in a cell, tissue or animal are described.

BACKGROUND OF THE INVENTION Since increased gluconeogenesis is considered the main source of increased glucose production in diabetes, numerous therapeutic targets for the inhibition of hepatic glucose production have been investigated. Due to the ability of glucocorticoid receptor antagonists (also known as nuclear receptor 3 subfamily, group C, member 1; NR3C1; GCCR; GCR; GRL; glucocorticoid, lymphocyte) to improve diabetes in animal models, these compounds are among the potential therapies to be explored. However, there are systemic detrimental effects of glucocorticoid receptor antagonists / including HPA axis activation (Link, Curr Opin Investig Drugs, 2003, 4, 421-429). The increased activity of the HPA axis is associated with the suppression of the inflammatory action related to the immune system, which can increase the susceptibility to infectious agents and neoplasms. Conditions associated with the suppression of inflammation mediated by the immune system through defects in the HPA axis, or its target tissues, include Cushing's syndrome, chronic stress, chronic alcoholism and melancholic depression (Chrousos, N Engl J Med, 1995 , 332, 1351-1362). Therefore, it is of great value to develop antagonists of the specific glucocortocoid receptor of the liver and specific of the fat.

BRIEF DESCRIPTION OF THE INVENTION The present invention is directed to oligomeric compounds directed to and hybridizing with an acid molecule encoding GCCR which modulates GCCR expression. In the present invention, chimeric oligonucleotides referred to as "gapmers" are provided, comprising a deoxynucleotide region or "gap" (opening) flanked at each of the 5 'and 3' ends with "wings" comprised of one to four 2'- 0-methoxyethyl nucleotides. The deoxynucleotide regions of the oligonucleotides of the invention are comprised of more than ten deoxynucleotides, therefore the gapmers of the present invention have an "open-dilated" as compared to chimeric compounds comprising an opening region of ten deoxynucleotide, such as those exemplified in the US Publication 2005-0164271, which is incorporated herein by reference in its entirety. In some embodiments, compared to oligonucleotides having the same sequence comprising a ten deoxynucleotide region flanked at both 5 'and 3' ends with five 2'-O- (2-methoxyethyl) nucleotides, apertured-dilated oligonucleotides that they have a comparable or improved potency without improved accumulation of the oligonucleotide in the liver. Thus, embodiments of the present invention include aperture-dilated oligonucleotides directed to GCCR wherein the potency is comparable to or better than that of an oligonucleotide having the same sequence comprising a ten deoxynucleotide region flanked at both ends. 'and 3' with five 2'-0- (2-methoxyethyl) nucleotides without the improved accumulation of the oligonucleotide in target tissues. Another embodiment of the present invention includes aperture-dilated oligonucleotides directed to GCCR wherein the renal concentrations of said oligonucleotide are comparable to or diminished with respect to that oligonucleotide having the same sequence comprising a ten deoxynucleotide region flanked on both 'and 3' ends with five 2'-O- (2-methoxyethyl) nucleotides while maintaining or improving potency in target tissues such as the liver. Additionally, methods are provided for the modulation of GCCR expression in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the present invention. For example, in one embodiment, the compounds or compositions of the present invention can be used to reduce the expression of GCCR in cells, tissues or animals. In one embodiment, the present invention provides a method for treating a disease or condition mediated by the expression of glucocorticoid in an animal comprising contacting the animal with an effective amount of a compound of the invention. Diseases or conditions include diabetes, Type 2 diabetes, obesity, metabolic syndrome X, hypergiucemia, hyperlipidemia, or hepatic steatosis. In some embodiments, hyperlipidemia is associated with elevated lipids such as blood cholesterol or elevated triglycerides in the blood. Blood lipids include plasma lipids and serum lipids. Additionally, methods are provided for decreasing blood lipid levels, methods for reducing body fat mass, methods for lowering triglyceride levels in liver, and methods for improving insulin sensitivity in an animal by administering a compound of the invention.

A method for decreasing blood glucose levels in an animal comprising administering a compound of the invention is also provided. Blood glucose levels can be fasting or feeding glucose levels, and blood glucose levels include serum or plasma glucose levels. Additionally, methods are provided to increase insulin sensitivity and to inhibit the output of hepatic glucose. Another aspect of the present invention is a method for delaying or preventing the onset of an increase in blood lipid or blood glucose levels in an animal by administration of a compound of the invention. The present application also relates to the Application of E.U.A.

No. 60 / 718,684, which is incorporated as a reference in its entirety. The present application also relates to the Application of E.U.A. No. 11/231, 243 and PCT Application No. PCT / US2005 / 033837, each of which is incorporated herein by reference in its entirety.

DETAILED DESCRIPTION OF THE INVENTION Revision In the present invention, oligomeric compounds, including antisense oligonucleotides and other antisense compounds are disclosed for use in modulating the expression of nucleic acid molecules that they encode GCCR. This is achieved by providing oligomeric compounds that hybridize with one or more target nucleic acid molecules encoding GCCR. In accordance with the present invention are compositions and methods for the modulation of the expression of GCCR (also known as glucocorticoid receptor; subfamily of nuclear receptor 3, group C, member 1; GR; GRL; and NR3C1). Listed in Table 1 are the GENBANK® access numbers of the sequences that can be used to design the oligomeric compounds directed to GCCR. Oligomeric compounds of the invention include oligomeric compounds that hybridize with one or more white nucleic acid molecules shown in Table 1, as well as oligomeric compounds that hybridize with other nucleic acid molecules encoding GCCR. The oligomeric compounds can be directed to any region, segment, or site of the nucleic acid molecules encoding GCCR. Suitable target regions, segments, and sites include, but are not limited to, the 5'UTR, the start codon, the stop codon, the coding region, the 3'UTR, the 5'cap region (modified end towards 5 '), introns, exons, intron-exon junctions, exon-intron junctions, and exon-exon junctions.

TABLE 1 White genes The locations in the target nucleic acid to which the active oligomeric compounds hybridize are referred to below as "validated blank segments" in the present invention. As used in the present invention, the term "validated blank segment" is defined as at least a portion of 8 nucleobases of a target region to which an active oligomeric compound is directed. While not wishing to be bound by theory, it is currently believed that these white segments represent portions of the target nucleic acid which are accessible for hybridization. The present invention includes oligomeric compounds that are chimeric compounds. An example of a chimeric compound is a gapmer having a 2'-deoxynucleotide region or an "opening" region flanked by non-deoxynucleotide or "wing" regions. Although we do not wish to stick to the theory, the gapmer aperture presents a substrate recognizable by RNase H when it binds to white RNA while the wings are not an optimal substrate but can confer other properties such as contribution to the stability of the duplex or advantageous pharmacokinetic effects. Each wing can be one or more monomers non-deoxy oligonucleotides. In a embodiment, the gapmer is comprised of a region of sixteen 2'-deoxynucleotides flanked at each of the 5 'and 3' ends by wings of two 2'-0- (2-methoxyethyl) nucleotides. This is referred to as a 2-16-2 gapmer. Therefore, the "motif of this chimeric oligomeric compound or gapmer is 2-16-2 In another embodiment, all the intemucleoside linkages are phosphorothioate linkages In another embodiment the gapmer cytosines are 5-methylcytosine. invention include oligomeric compounds comprising the sequences of 13 to 26 nucleotides in length comprising a deoxy nucleotide region greater than 10 nucleobases in length flanked at each of its 5 'and 3' ends with at least one 2'-O- ( 2-methoxyethyl) nucleotide Preferred "apertured-dilated" oligonucleotides comprise 11, 12, 13, 14, 15, 16, 17, or 18 deoxynucleotides in the opening portion of the oligonucleotide The preferred flanking regions towards 5 'and 3' comprise 1, 2, 3, or 42'-0- (2-methoxyethyl) nucleotides Preferred aperture-dilated gapmers have motifs including 1-18-1, 1-17-2, 2-17- 1, 2 -16-2, 3-14-3, and 4-12-4. In preferred embodiments the compounds oligomers are directed or hybridized with GCCR RNA. In another embodiment, oligomeric compounds reduce the expression of GCCR RNA. In other embodiments, the oligomeric compounds reduce the expression of the GCCR where the expression of the GCCR is reduced by at least 10%, by at least 20%, by at least 30%, by at least 35%, by at least 40%, in at least 45%, in at least 50%, in at least 55%, in at least 60%, in at least 65%, in less 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. The oligonucleotides of the present invention include those in which the renal concentrations of said oligonucleotide are decreased with respect to an oligonucleotide having the same sequence comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2'-O - (2-methoxyethyl) nucleotides. The oligonucleotides of the present invention include those in which the renal concentrations of said oligonucleotide are comparable with or are diminished with respect to those of an oligonucleotide having the same sequence comprising a region of ten deoxynucleotides flanked at both the 5 'and 3' ends. with five 2'-O- (2-methoxyethyl) nucleotides. Oligonucleotides of the present invention include those wherein the potency with respect to white reduction or a therapeutic effect is comparable to or better than that of an oligonucleotide having the same sequence comprising a ten deoxynucleotide region flanked at both 5 'ends and 3 'with five 2'-0- (2-methoxyethyl) nucleotides without the enhanced accumulation of oligonucleotide in target tissues. Preferred white tissues include liver, and adipose tissue. The present invention provides antisense oligonucleotides of 13 to 26 nucleobases in length directed towards a nucleic acid molecule encoding GCCR wherein the oligonucleotide comprises a first region, a second region, and a third region, wherein said first The region comprises at least 11 deoxynucleotides and wherein said second and third regions comprise 1 to 4 2'-0- (2-methoxyethyl) nucleotides, said second and third regions flanking the first region of the 5 'and 3' ends of said first region. region. In some embodiments, the oligonucleotides of the invention hybridize specifically with GCCR and reduce the expression of GCCR. In some embodiments, the "aperture" region comprises 11, 12, 13, 14, 15, 16, 17, or 18 nucleobases. In some embodiments, the antisense oligonucleotides are 20 nucleobases in length. Oligomeric compounds may comprise from about 8 to about 80 nucleobases (ie from about 8 to about 80 associated nucleosides), preferably from about 13 to about 26 nucleobases. One skilled in the art will appreciate that preferred oligomeric compounds contemplated include compounds that are 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleobases in length. The compounds of the invention include oligonucleotide sequences comprising at least the 8 consecutive nucleobases from the 5 'end of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive extension of the same oligonucleotide starting immediately upstream of the 5' end of the antisense compound which hybridizes specifically with the target nucleic acid and continuing until the oligonucleotide comprises about 13 to about 26 nucleobases). Other compounds are represented by the oligonucleotide sequences comprising at least the 8 consecutive nucleobases from the 3 'end of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive extension of the same oligonucleotide starting immediately downstream of the 3' end of the antisense compound which hybridizes specifically with the target nucleic acid and continuing until the oligonucleotide comprises about 13 to about 26 nucleobases). It is also understood that the compounds can be represented by the oligonucleotide sequences comprising at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative compound, and can be extended to either or both directions until the oligonucleotide contains about 13 nucleobases. to approximately 26 nucleobases. The oligonucleotides of the invention include antisense oligonucleotides of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCCR and comprising at least a portion of 8 nucleobases of SEQ ID NO: 34, 33, 35, 36, 37, 42, 45, 56, 61, 63, or 96. In one embodiment, the oligonucleotides of the invention are antisense oligonucleotides of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCCR and having the sequence of SEQ ID NO: 34, 33, 35, 36, 37, 42, 45, 56, 61, 63, or 96. In one modality, the oligonucleotides of the invention have the nucleobase sequence of SEQ ID NO: 37. The present invention provides antisense oligonucleotides comprising the nucleobase sequence of SEQ ID NO: 37. In one embodiment, the oligonucleotides of the invention comprise at least a portion of 8 nucleobases of the nucleobase sequence of SEQ ID NO: 37. In one embodiment, the present invention provides antisense oligonucleotides of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCCR and comprising at least a portion of 8 nucleobases of SEQ ID NO: 34, 33, 35, 36, 37, 42, 45, 56, 61, 63, or 96 wherein the oligonucleotide comprises a deoxynucleotide region of 12, 13, 14, 15, 16, 17, or 18 nucleobases in length which is flanked at their 5 'and 3' ends with 1 to 42'-0- (2-methoxyethyl) nucleotides and wherein the oligonucleotide specifically hybridizes with and reduces the expression of GCCR RNA. In a modality, the flanking regions are symmetrical (having the same number of nucleotides in the flanking region towards 5 'that in the flanking region towards 3'). In another embodiment, the flanking regions are not symmetric (they have a different number of nucleotides in the flanking region towards 5 'compared to the flanking region towards 3'). The antisense oligonucleotides of the invention may contain at least one modified intemucleoside linkage. The internucleoside bonds modified include phosphorothioate linkages. The antisense oligonucleotides of the invention may also contain at least one modified nucleobase. In preferred embodiments, at least one cytosine is a 5-methylcytosine. In other embodiments, the present invention includes antisense oligonucleotides having the nucleobase sequence of SEQ ID NO: 37, wherein the antisense oligonucleotide is characterized by a region of 12 deoxynucleotides flanked at its 5 'and 3' ends with four 2'- 0- (2-methoxyethyl) nucleotides, a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides, a region of 16 deoxynucleotides flanked at their 5 'and 3' ends 'with two 2'-0- (2-methoxyethyl) nucleotides, a region of 17 deoxynucleotides flanked at their 5' and 3 'ends with one or two 2'-0- (2-methoxyethyl) nucleotides, or a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide. In a particular embodiment, the antisense oligonucleotides have the nucleobase sequence of SEQ ID: 37, wherein the antisense oligonucleotide has a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine.

In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 37, wherein the antisense oligonucleotide has a region of 14 deoxynucleotides flanked at its 5 'and 3' ends with three 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 37, wherein the antisense oligonucleotide has a region of 16 deoxynucleotides flanked at its 5 'and 3' ends with two 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one intemucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 37, wherein the antisense oligonucleotide has a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-0 (2- methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one linknucleoside is a phosphorothioate bond. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 37, wherein the antisense oligonucleotide has a region of 18 deoxynucleotides flanked at its 5 'and 3' ends with a 2'-0 (2-methoxyethyl) nucleotide In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In another embodiment the antisense oligonucleotides comprise the nucleobase sequence of SEQ ID NO: 33. In one embodiment, the oligonucleotides of the invention comprise at least a portion of 8 nucleobases of the nucleobase sequence of SEQ ID NO: 33. In other modalities, the present invention includes the antisense oligonucleotides having the nucleobase sequence of SEQ ID NO: 33, wherein the antisense oligonucleotide is characterized by a region of 12 deoxynucleotides flanked at its 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides, a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides, a region of 16 deoxynucleotides flanked at their 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides, a region of 17 deoxynucleotides flanked at their 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides, or a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide. In a particular embodiment, the antisense oligonucleotides have the nucleobase sequence of SEQ ID NO: 33, wherein the antisense oligonucleotides have a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0 (2-methoxyethyl) ) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID NO: 33, wherein the antisense oligonucleotide has a region of 14 deoxynucleotides flanked at its 5 'and 3' ends with three 2'-0 (2-methoxyethyl) ) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 33, wherein the antisense oligonucleotide has a region of 16 deoxynucleotides flanked at its 5 'and 3' ends with two 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 33, wherein the antisense oligonucleotide has a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-0 (2- methoxyethyl) nucleotides. In a further embodiment, the antisense oligonucleotide hybridizes specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligogonucleotide has the nucleobase sequence of SEQ ID: 33, wherein the antisense oligonucleotide has a region of 18 deoxynucleotides flanked at its 5 'and 3' ends with a 2'-0 (2-methoxyethyl) nucleotide In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. The present invention provides antisense oligonucleotides comprising the nucleobase sequence of SEQ ID NO: 45. In one embodiment, the oligonucleotides of the invention comprise at least a portion of 8 nucleobases of the nucleobase sequence of SEQ ID NO: 45.

In other embodiments, the present invention includes antisense oligonucleotides having the nucleobase sequence of SEQ ID NO: 45, wherein the antisense oligonucleotide is characterized by a region of 12 deoxynucleotides flanked at its 5 'and 3' ends with four 2'- 0- (2-methoxyethyl) nucleotides, a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides, a region of 16 deoxynucleotides flanked at their 5 'and 3 ends 'with two 2'-0- (2-methoxyethyl) nucleotides, a region of 17 deoxynucleotides flanked at their 5' and 3 'ends with one or two 2'-0- (2-methoxyethyl) nucleotides, or a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide. In a particular embodiment, the antisense oligonucleotides have the nucleobase sequence of SEQ ID: 45, wherein the antisense oligonucleotides have a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligogonucleotide has the nucleobase sequence of SEQ ID: 45, wherein the antisense oligonucleotide has a region of 14 deoxynucleotides flanked at its 5 'and 3' ends with three 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 45, wherein the antisense oligonucleotide has a region of 16 deoxynucleotides flanked at its 5 'and 3' ends with two 2'-0 (2-nietoxethyl) nucleotides. In a further embodiment, the antisense oligonucleotide hybridizes specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 45, wherein the antisense oligonucleotide has a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-0 (2- methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 45, wherein the antisense oligonucleotide has a region of 18 deoxynucleotides flanked at its 5 'and 3' ends with a 2'-0 (2-methoxyethyl) nucleotide In a modality In addition, the antisense oligonucleotide hybridizes specifically with and reduces the expression of GCCR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. Also contemplated in the present invention is a pharmaceutical composition comprising an antisense oligonucleotide of the invention and optionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient. The compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to glucocorticoid activity mediated by GCCR. The embodiments of the present invention include methods for reducing the expression of GCCR in tissues or cells comprising contacting said cells or tissues with a pharmaceutical composition or an antisense oligonucleotide of the invention, methods for lowering blood glucose levels, triglyceride levels in blood, or blood cholesterol levels in an animal which comprises administering to said animal a pharmaceutical composition of the invention. Blood levels can be levels in plasma or serum. Also contemplated are methods for increasing insulin sensitivity, methods for lowering triglyceride levels in liver, and methods for inhibiting hepatic glucose output in an animal comprising administering to said animal a pharmaceutical composition of the invention. The increased sensitivity to Insulin can be indicated by a decrease in circulating insulin levels. Another aspect of the present invention is a method for reducing body fat mass in an animal. Other embodiments of the present invention include methods for the treatment of an animal having a disease or condition associated with expression of the glucocorticoid receptor comprising administering to said animal a therapeutically or prophylactically effective amount of an antisense oligonucleotide of the invention. The disease or condition can be a disease or metabolic condition. In some modalities, the disease or metabolic condition is diabetes, obesity, metabolic syndrome X, hypergiucemia, hyperlipidemia, or insulin resistance. In some modalities, the disease is Type 2 diabetes. In some modalities, obesity is induced by diet. In some modalities, hyperlipidemia is associated with elevated levels of blood lipids. The lipids include cholesterol and triglycerides. In one modality, the condition is hepatic steatosis. In some modalities, steatosis is steatohepatitis or non-alcoholic steatohepatitis. Methods for preventing or delaying the onset of elevated blood glucose levels or blood lipid levels in an animal are also provided. The compounds of the invention can be used to modulate the expression of GCCR in an animal in need thereof, such as a human. In a non-limiting modality, the methods include the passage of administering to said animal an effective amount of an antisense compound that reduces the expression of GCCR. In one embodiment, the antisense compounds of the present invention effectively reduce the levels or function of GCCR RNA. Because the reduction in GCCR mRNA levels can also lead to alteration in the protein products of GCCR expression, these resulting alterations can also be measured. The antisense compounds of the present invention that effectively reduce the levels or function of a GCCR RNA or protein expression products are considered an active antisense compound. In one embodiment, the antisense compounds of the invention reduce the expression of GCCR by causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at less 98%, at least 99%, or 100% as measured by an assay exemplified in the present invention.

Antisense Mechanisms "Antisense mechanisms" are all those that include the hybridization of a compound with a target nucleic acid, wherein the result or effect of the hybridization is either target degradation or target occupancy with concomitant loss of velocity. the cellular machinery including, for example, transcription or alternative processing.

Targets As used in the present invention, the terms "white nucleic acid" and "nucleic acid molecule encoding GCCR" have been used for convenience to include DNA encoding GCCR, RNA (including pre-mRNA and mRNA or portions of the same) transcribed from said DNA, and also cDNA derived from said RNA.

Regions, Segments, and Sites The targeting process usually also includes determining at least one target region, segment, or site within the target nucleic acid for the antisense interaction to be performed in such a manner as to produce the desired effect, for example , modulation of the expression. "Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Segments are found within the target nucleic acid regions. The "segments" are defined as smaller portions or sub-portions of regions within a white nucleic acid. "Sites", as used in the present invention, are defined as unique positions of the nucleobase within a target nucleic acid. Once one or more target regions, segments or sites have been identified, the oligomeric compounds are designed which are sufficiently complementary with respect to the target, that is, they hybridize sufficiently well and with adequate specificity, to produce the desired effect.

Variants It is also known in the art that alternating transcripts of RNA can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants." More specifically, "pre-mRNA variants" are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA either in their initial or stop position and contain as many intronic as exonic sequences. After cleavage of one or more regions of exon or intron, or portions thereof during processing, the pre-mRNA variants produce smaller "mRNA vanes". Accordingly, mRNA variants are processed variants of pre-mRNA and each unique variant of pre-mRNA always produces a single variant of mRNA as a result of processing. These mRNA variants are also known as "alternative processing variants." If processing of the pre-mRNA variant does not occur then the pre-mRNA variant is identical to the mRNA variant. It is also known in the art that variants can be produced through the use of alternative signals to initiate or stop transcription or stoppage and that pre-mRNA and mRNA can possess more than one start codon or a stop cord. Variants that originate from a pre-mRNA or mRNA using alternative start codons are referred to as "alternative start variants" of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-mRNA or mRNA. A specific type of alternate stop variant is the "poIyA variant" in which the multiple transcripts produce results from the alternative selection of one of the "poIyA stop signals" by the transcription machinery, thus producing transcripts ending in unique sites poIyA. Consequently, the types of variants described in the present invention are also suitable white nucleic acids.

Modulation of target expression "Modulation" means a disturb of function, for example, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in expression. As another example, the modulation of the expression may include perturbation of the selection of the pre-mRNA processing site. "Expression" includes all the functions by means of which information encoded by a gene is converted into structures present and in operation in a cell. These structures include the transcription and translation products. "Modulation of the expression" means the disturb of said functions. "Modulators" are those compounds that modulate the expression of the GCCR and which comprise minus a portion of 8 nucleobases which is complementary to a validated target segment. The modulation of the expression of a target nucleic acid can be achieved through the alteration of any number of functions of the nucleic acid (DNA or RNA). The functions of the DNA to be modulated may include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or another type. The functions of the RNA to be modulated may include the translocation functions, which include, but are not limited to, translocation of the RNA to a translocation site of the protein, translocation of the RNA to sites within the cell which are distant from site of RNA synthesis, and translation of the protein from RNA. Functions of RNA processing that can be modulated include, but are not limited to, RNA processing to produce one or more RNA species, RNA modification, 3 'RNA maturation and catalytic activity or complex formation that includes RNA in which RNA can participate or can be facilitated by RNA. Modulation of expression may result in the increased level of one or more nucleic acid species or the decreased level of one or more nucleic acid species, either temporarily or by a steady state level of net. One result of such interference with the function of the target nucleic acid is the modulation of GCCR expression. Therefore, in a modality the modulation of the expression can mean the increase or decrease in white RNA or protein levels. In another embodiment, modulation of expression may mean an increase or decrease in one or more products of RNA processing, or a change in the ratio of two or more processing products.

Hybridization and complementarity "Hybridization" means the coupling of complementary chains of oligomeric compounds. Although not limited to a particular mechanism, the most common mechanism of coupling includes the formation of hydrogen bonds, which may be of the Watson-Crick, Hoogsteen type or hydrogen bonding type Hoogsteen reverse, between the nucleoside or nucleotide bases complementary (nucleobases) of the chains of the oligomeric compounds. For example, adenine and thymine are complementary nucleobases which are coupled through the formation of hydrogen bonds. Hybridization can occur under varying circumsts. An oligomeric compound is specifically hybridizable when there is an adequate degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target nucleic acid sequences under conditions in which specific binding is desired., that is, under physiological conditions in the case of in vivo tests or therapeutic treatment, and under conditions in which the tests will be carried out in the case of in vitro tests.

"Severe hybridization conditions" or "severe conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but with a minimum number of other sequences. Severe conditions depend on the sequence and will be different in different circumstances, and the "severe conditions" under which the oligomeric compounds hybridize with a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are investigated. . "Complementarity", as used in the present invention, refers to the ability of precise coupling between two nucleobases in one or two chains of the oligomeric compound. For example, if a nucleobase at a certain position of an antisense compound is capable of coupling through the formation of hydrogen bonds with a nucleobase at a certain position of a target nucleic acid, then the position of the hydrogen bond between the oligonucleotide and the White nucleic acid is considered a complementary position. The oligomeric compound and the DNA or RNA are complementary to each other when an appropriate number of complementary positions in each molecule are occupied by nucleobases that can form hydrogen bonds with each other. Therefore, "specifically hybridizable" and "complementarity" are terms which are used to indicate an adequate degree of precise coupling or complementarity in an adequate number of nucleobases in such a manner that the stable and specific binding occurs between the oligomeric compound and a white nucleic acid. It is understood in the art that the sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. In addition, an oligonucleotide can be hybridized in one or more segments in such a way that the intermediate or adjacent segments do not participate in the hybridization event (eg, a loop structure, inconsistency or hairpin structure). The oligomeric compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence complementarity with respect to a target sequence within the target nucleic acid sequence to which they are directed. For example, an oligomeric compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and therefore could be specifically hybridized, could present 90 percent complementarity. In this example, non-complementary remaining nucleobases can be grouped or spaced with complementary nucleobases and do not need to be contiguous with each other or with respect to complementary nucleobases. As such, an oligomeric compound which is 18 nucleobases in length that has 4 (four) non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid could have 77.8% general complementarity with the target nucleic acid and therefore could fall within the scope of the present invention. The percentage complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using the BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al. , J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Percent homology, sequence identity or complementarity can be determined by, for example, the Averaging program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wl), using the default settings, which they use the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

Oligomer Compounds The term "oligomeric compound" refers to a polymer structure capable of hybridizing to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and chimeric combinations thereof. The oligomeric compounds are routinely prepared in a linear fashion but may be joined or otherwise prepared to be circular. In addition, branched structures are known in the art. An "antisense compound" or "antisense oligomeric compound" refers to a oligomeric compound that is at least partially complementary to the region of a nucleic acid molecule with which it hybridizes and which modulates (increases or decreases) its expression. Consequently, although it can be said that all antisense compounds are oligomeric compounds, not all oligomeric compounds are antisense compounds. An "antisense oligonucleotide" is an antisense compound that is an oligomer based on nucleic acid. An antisense oligonucleotide can be chemically modified. Non-limiting examples of the oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, outer guide sequence oligonucleotides (EGS), alternating processors, and siRNA. As such, these compounds may be introduced in the form of single chains, double chains, circular elements, branched chains or hairpins and may contain structural elements such as protuberances or internal or terminal handles. The double-chain oligomeric compounds can be two hybridized chains to form double-chain compounds or a single chain with sufficient self-complementarity to allow hybridization and formation of a fully double or partially double-chain compound. The "chimeric" or "chimeric" oligomeric compounds in the context of this invention are single or double chain oligomeric compounds, such as oligonucleotides, which contain two or more chemically distinct regions, each comprising at least one unit monomeric, that is, a nucleotide in the case of an oligonucleotide compound. A "gapmer" is defined as an oligomeric compound, generally an oligonucleotide, having a 2'-deoxyoligonucleotide region flanked by non-deoxyoligonucleotide segments. The central region is referred to as the "opening." The flanking segments are referred to as the "wings." If one of the wings has zero non-deoxyoligonucleotide monomers, a "hemimer" is described.

NAFLD The term "non-alcoholic fatty liver disease" (NAFLD) encompasses a spectrum of diseases ranging from the simple accumulation of triglycerides in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis. Nonalcoholic steatohepatitis (NASH) occurs from the progression of NAFLD beyond the deposition of triglycerides. A second effect capable of inducing necrosis, inflammation, and fibrosis is required for the development of NASH. Candidates for the second effect can be grouped into broad categories: factors that cause an increase in oxida stress and factors that promote the expression of proinflammatory cytokines. It has been suggested that increased triglycerides in the liver lead to increased oxida stress in the hepatocytes of animals and humans, indicating a potential cause-and-effect relationship between liver accumulation of triglycerides, oxida stress, and the progress of hepatic steatosis to NASH (Browning and Horton, J. Clin. Invest, 2004, 114, 147-152). Hypertriglyceridemia and fatty hyperacidemia can cause accumulation of triglycerides in peripheral tissues (Shimamura et al., Biochem, Biophys, Res. Commun., 2004, 322, 1080-1085). One embodiment of the present invention is a method for reducing lipids in the liver of an animal by administering a prophylactically or therapeutically effec amount of an oligomeric compound of the invention. Another embodiment of the present invention is a method for the treatment of hepatic steatosis in an animal by administering a prophylactically or therapeutically effec amount of an oligomeric compound of the invention. In some modalities, steatosis is steatohepatitis. In some modalities, steatosis is NASH.

Chemical modifications Modified and Alternating Nucleobases Oligomeric compounds of the invention also include variants in which a different base is present at one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, variants containing thymidine, guanosine or cytidine can be produced in this position. This can be done in any of the positions of the oligomeric compound. These compounds are then evaluated, using the methods described in the present invention to determine their ability to reduce the expression of GCCR mRNA. Oligomeric compounds may also include modifications or substitutions of the nucleobases (often referred to in the art as heterocyclic bases or simply as "bases"). As used in the present invention, the "unmodified" or "natural" nucleobases include the bases purine adenine (A) and guanine (G), and the bases pyrimidine thymine (T), cytosine (C) and uracil (U) . A "substitution" is the replacement of an unmodified or natural base with another unmodified or natural base. The "modified" nucleobases means other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, -propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C = C-CH 3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases , 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, -Is particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (1 H-pyrimido (5,4-b) (1,4) benzoxazin-2 (3 H) -one), phenothiazine cytidine (1 H-pyrimido (5, 4- b) (1, 4) benzothiazin-2 (3H) -one), G-Unions such as a substituted phenoxazine cytidine (for example 9- (2-aminoethoxy) -H-pihmido (5,4-b) (1, 4) benzoxazin-2 (3H) -one), carbazole cytidine (2H-pyrimido (4,5-b) indol-2-one), pyridoindole cytidine (H-pyrido (3 ', 2,: 4,5) pyrrolo (2,3-d) pyrimidin-2-one). Modified nucleobases may also include those in which the purine base or pyrimidine is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those described in U.S. Patent No. 3,687,808, those described in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Rroschwitz, J.I., ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those described by Sanghvi, Y.S., chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., ed., CRC Press, 1993. Some of these nucleobases are known to those skilled in the art to be suitable for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and substituted N-2, N-6 and 0-6 purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. It has been shown that 5-methylcytosine substitutions increase the stability of the nucleic acid duplex by 0.6-1.2 ° C and are substitutions of suitable bases, even more particularly when combined with modifications of 2'-0-methoxyethyl sugar. It is understood in the art that Modification of the base does not include such chemical modifications that produce substitutions in a nucleic acid sequence. Representative patents of the United States that teach the preparation of some of the aforementioned modified nucleobases as well as other modified nucleobases include, but are not limited to, U.S. Pat. previously mentioned 3,687,808, as well as the Patent of E.U.A .: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588 6,005,096; 5,681, 941; and 5,750,692. The oligomeric compounds of the present invention may also include polycyclic heterocyclic compounds in place of one or more of the naturally occurring portions of the heterocyclic bases. Numerous tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified chain to a white chain. The most studied modifications are directed to guanosines, therefore these have been called G-Unions or cytidine analogues. Representative cytosine analogs making 3 hydrogen bonds with a guanosine in a second chain include 1,3-diazafenoxazin-2-one (Kurchavov, et al, Nucleosides and Nucleotides, 1997, 16, 1837-1846), 1, 3 -diazaphenothiazine-2-one, (Lin, K.-Y .; Jones, RJ; Matteucci, MJ Am. Chem. Soc. 1995, 117, 3873-3874) and 6,7,8,9-tetrafluoro-1,3-diazafenoxazin-2-one (Wang, J .: Lin, K.-Y., Matteucci, M. Tetrahedron Lett.989, 39, 8385 -8388). Already incorporated within the oligonucleotides it was shown that these base modifications are hybridized with complementary guanine and also the last hybrid with adenine was shown to improve thermal stability by extending the interactions that are stacked (also see US Pre-Support publications). economic 20030207804 and 20030175906). Propulsive stabilizing properties have been observed additionally when an analog / cytosine substitute has an aminoethoxy portion attached to the rigid structure of 1,3-diazafenoxazin-2-one (Lin, K.-Y .; Matteucci, MJ Am. Chem. Soc. 1998, 120, 8531-8532). Binding studies demonstrated that a single incorporation could improve the affinity of binding to a model oligonucleotide with respect to its complementary white DNA or RNA with a? Tm of up to 18 ° C relative to 5-methyl cytosine (dC5 e), which is a high affinity enhancer for a particular modification. On the other hand, the gain in stability by the helix does not compromise the specificity of the oligonucleotides. Additional tricyclic heterocyclic compounds and methods for the use thereof which are suitable for use in the present invention are described in U.S. Patents 6,028,183, and 6,007,992. The improved binding affinity of the phenoxazine derivatives together with their unencumbered sequence specificity makes them analogous valuable nucleobases for the development of more powerful antisense-based drugs. In fact, promising data have been derived from in vitro experiments demonstrating that heptanucleotides containing substitutions in phenoxazine are capable of activating RNase H, improving cell uptake and exhibiting increased antisense activity (Lin, KY; Matteucci, MJ Am. Chem. Soc. 1998, 120, 8531-8532). The improved activity was even more pronounced in the case of G-junction, since a single substitution showed significant improvement in the in vitro potency of a 20-element 2'-deoxyphosphorothioate oligonucleotides (Flanagan, WM; Wolf, JJ .; Olson, P Grant, D., Lin, K.-Y .; Wagner, RW; Matteucci, M. Proc. Nati, Acad. Sci. USA, 1999, 96, 3513-3518). Additional modified polycyclic heterocyclic compounds useful as heterocyclic bases are described in but are not limited to, U.S. Pat. aforementioned 3,687,808, as well as US Patents: 4,845,205; 5,130,302; 5,134,066; 5,175,273 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681, 941, and Publication of E.U.A. Pre-economic support 20030158403.

Combinations The compositions of the invention may contain two or more oligomeric compounds. In another related embodiment, the compositions of the present invention may contain one or more antisense compounds, particularly oligonucleotides, directed to a first nucleic acid and one or more additional antisense compounds directed to a second target nucleic acid. Alternatively, the compositions of the present invention may contain two or more antisense compounds directed to different regions of the same target nucleic acid. Two or more combined compounds can be used together or sequentially.

Combination therapy The compounds of the invention can be used in combination therapy, wherein an additive effect is achieved by the administration of one or more compounds of the invention and one or more other therapeutic / prophylactic compounds suitable for treating a condition. Suitable therapeutic / prophylactic compounds include, but are not limited to, glucose lowering agents, anti-obesity agents, and lipid-lowering agents. Agents that lower glucose include, but are not limited to hormones, hormone mimetics, or incretin mimetics (eg, insulin, including inhaled insulin, GLP-1 or GLP-1 analogs such as liraglutjda, or exenatide), DPP (IV) inhibitors, a sulphonylurea (eg, acetohexamide, chlorpropamide, toibutamide, tolazamide, glymepiride, a glipizide, glyburide, or a gliclazide), a biguanide (metformin), a meglitinide (eg, nateglinide or repaglinide), a thiazolidinedione, or other PPAR-gamma agonists (by example, pioglitazone or rosiglitazone), an alpha-glucosidase inhibitor (e.g., acarbose or miglitol), or an antisense compound not directed toward GCGR. Also included are dual PPAR agonists (eg, muraglitazar, which has been developed by Bristol-Myers Squibb, or tesaglitazar, which has been developed by Astra-Zeneca). Other treatments for diabetes in development are also included (for example, LAF237, which was developed by Novartis, MK.-0431, which was developed by Merck, or rimonabant, which was developed by Sanofi-Aventis). Anti-obesity agents include, but are not limited to, appetite suppressants (e.g. phentermine or Meridia ™), fat absorption inhibitors such as orlistat (e.g. Xenical ™), and modified forms of ciliary neurotrophic factor which inhibits signs of hunger that stimulate the appetite. Agents that lower lipids include, but are not limited to, resins that sequester bile salts (eg, cholestyramine, colestipol, and colesevelam hydrochloride), HMGCoA-reductase inhibitors (eg, lovastatin, pravastatin, atorvastatin, simvastatin, and fluvastatin), nicotinic acid, fibric acid derivatives (eg, clofibrate, gemfibrozil, fenofibrate, bezafibrate, and ciprofibrate), probucol, neomycin, dextrothyroxine, vegetable stanol esters, cholesterol absorption inhibitors (eg, ezetimibe), inhibitors of CETP (for example torcetrapib, and JTT-705), inhibitors of MTP (for example, implitapide), inhibitors of bile acid transporters (apical bile acid transporters dependent on sodium), regulators of hepatic CYP7a, inhibitors from ACAT (for example Avasimiba), therapeutic for estrogen replacement (e.g., tamoxigen), synthetic HDL (e.g. ETC-216), anti-inflammatories (e.g., glucocorticoids), or an antisense compound not directed toward GCGR. One or more of these drugs can be combined with one or more of the GCGR antisense inhibitors to achieve an additive therapeutic effect.

Oligomer synthesis Oligomerization of modified and unmodified nucleosides can be carried out routinely in accordance with the procedures in the literature for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA (Scahnge, Methods (2001), 23, 206-217, Gait et al., Applications of Chemically synthesized RNA RNA: Protein Interactions, Ed Smith (1998), 1-36, Gallo et al., Tetrahedron (2001), 57, 5707-5713) and US Publication No. US2005-0164271, which is incorporated herein by reference. The oligomeric compounds of the present invention can be conveniently and routinely made by well-known solid phase synthesis techniques. The equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other methods for such synthesis known in the art can be used additionally or alternatively. HE is well aware of the use of similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives.

Purification of the olymer and analysis The methods for the purification and analysis of the oligonucleotide are known to those skilled in the art. The methods of analysis include capillary electrophoresis (CE) and electrospray mass spectroscopy. Said methods of synthesis and analysis can be carried out in multiple well plates.

Non-limiting description and incorporation as reference Although certain compounds, compositions and methods of the present invention have been described with specificity in accordance with certain embodiments, the examples in the present invention serve only to illustrate the compounds of the invention and are not intended to limit the same. Each of the references, GENBANK® access number, and the like mentioned in the present application are incorporated herein by reference in their entirety.

EXAMPLE 1 Essay for the modulation of expression The modulation of GCCR expression can be assayed in a variety of ways known in the art. The levels of GCCR mRNA can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. RNA analysis can be carried out in total cellular RNA or poly (A) + mRNA by methods known in the art. Methods for RNA isolation are taught in, for example, Ausubel, F.M. et al, Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routinely performed in the art and taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative PCR (PCR) can be conveniently achieved using the commercially available ABI PRISM ™ 7700 sequence detection system, available from PE-Applied Biosystems, Foster City, CA and was used in accordance with the manufacturer's instructions. The levels of proteins encoded by GCCR can be quantified in numerous ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), ELISA or fluorescence activated cell selection (FACS). The antibodies directed to a protein encoded by GCCR can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, Ml), or can be prepared by conventional methods for antibody generation. Methods for the preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1 -1 1.12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997. Methods for immunoprecipitation are standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Analysis by Western blot (immunoblot) is standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1 -10.8.21, John Wiley & Sons, Inc., 1997. Immunosorbent assays associated with enzyme (ELISA) are standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-1 1.2.22, John Wiley & Sons, Inc., 1991. The effect of the oligomeric compounds of the present invention on the expression of the target nucleic acid can be evaluated in any of a variety of cell types with the proviso that the White nucleic acid is present at levels that can be measured. The effect of the oligomeric compounds of the present invention on the expression of the target nucleic acid can be determined routinely using, for example, PCR or Northern blot analysis. The cell lines are derived both from normal tissues and from cell types and from cells associated with various disorders (for example hyperproliferative disorders). Cell lines derived from multiple tissues and species can be obtained from the American Type Culture Collection (ATCC, Manassas, VA), the Japanese Cancer Research Resources Bank (Tokyo, Japan), or the Center for Applied Microbiology and Research ( Wiltshire, United Kingdom). Primary cells, or those cells that are isolated from an animal and not subjected to continuous culture, can be prepared according to methods known in the art or can be obtained from various commercial suppliers. Additionally, primary cells include those obtained from donor human subjects in a clinical setting (i.e., blood donors, surgical patients).

Cell types The effects of the oligomeric compounds on the expression of the target nucleic acid were evaluated in the HepG2 cells and in the rat primary hepatocytes.

HepG2 cells The hepatoblastoma cell line of human HepG2 was obtained from the American Type Culture Collection (Manassas, VA). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal bovine serum, 1 mM non-essential amino acids, and 1 mM sodium pyruvate (Invitrogen Life Technologies, Carlsbad, CA). Cells were passaged routinely by trypsinization and dilution when they reached approximately 90% confluency. Plates were prepared for culture with multiple wells for cell culture by coating with a 1: 100 dilution of rat tail type collagen type 1 (BD Biosciences, Bedford, MA) in phosphate buffered saline. The plates containing collagen were incubated at 37 ° C for about 1 hour, after which the collagen was removed and the wells were washed twice with saline with pH regulated with phosphate. The cells were seeded in 96-well plates (Falcon-Primary # 353872, BD Biosciences, Bedford, MA) at a density of approximately 8,000 cells / well for use in the oligomeric transfection experiments.

Primary rat hepatocytes: Rat primary hepatocytes were prepared from rats Sprague-Dawley from Charles River Labs (Wiimington, MA) and were routinely cultured in DMEM, with high glucose content (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, CA), 100 units per mL of penicillin, and 100 μg / mL of streptomycin (Invitrogen Life Technologies, Carlsbad, CA). The cells were seeded in 96-well plates (Falcon-Primaha # 353872, BD Biosciences, Bedford, MA) at a density of approximately 4,000-6,000 cells / well with treatment with the oligomeric compounds of the invention.

Treatment with the oligochemical compounds When the cells reached an appropriate confluence, they were treated with the oligonucleotide using a transfection method as described. Other reagents suitable for transfection known in the art include, but are not limited to, LIPOFECTAMINE ™, OLIGOFECTAMINE ™, and FUGENE ™. Other methods suitable for transfection known in the art include, but are not limited to, electroporation.

LIPOFECTIN ™ When the cells reach 65-75% confluence, they are treated with oligonucleotide. The oligonucleotide is mixed with LIPOFECTIN ™ Invitrogen Life Technologies, Carlsbad, CA) in Opti-MEM ™ -1 medium with reduced serum (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of the oligonucleotide and a concentration of LIPOFECTIN ™ of 2.5. or 3 μg / mL per 100 nM oligogonucleotide. This mixture of transfection is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, the wells were washed once with 100 μL of OPTI-MEM ™ -1 and then treated with 130 μL of the transfection mixture. Cells grown in 24-well plates or other standard plates for tissue culture were treated in a similar manner, using appropriate volumes of medium and oligonucleotide. Cells were treated and data was obtained in duplicate or triplicate. After about 4-7 hours of treatment at 37 ° C, the medium containing the transfection mixture was replaced with fresh culture medium. Cells were harvested 16-24 hours after treatment with the oligonucleotide.

CYTOFECTIN ™ When the cells reached 65-75% confluence, they were treated with the oligonucleotide. The oligonucleotide was mixed with CYTOFECTIN ™ (Gene Therapy Systems, San Diego, CA) in OPTI-MEM ™ -1 medium with reduced serum (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of the oligonucleotide and a concentration of CYTOFECTIN ™ of 2 or 4 μg / mL per 100 nM of the oligonucleotide. This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, the wells were washed once with 100 μL of OPTI-MEM ™ -1 and then treated with 130 μL of the transfection mixture. The cells grown in 24-well plates or other standard plates for tissue culture were treated in a similar manner, using appropriate volumes of medium and oligonucleotide. Cells were treated and data was obtained in duplicate or triplicate. After about 4-7 hours of treatment at 37 ° C, the medium containing the transfection mixture was replaced with fresh culture medium. Cells were harvested 16-24 hours after treatment with the oligonucleotide.

Control oligonucleotides The control oligonucleotides are used to determine the optimum concentration of the oligomeric compound for a particular cell line. In addition, when the oligomeric compounds of the invention are evaluated in oligomeric compound screening or phenotypic assays, the control oligonucleotides are evaluated in parallel with the compounds of the invention. In certain embodiments, the control oligonucleotides are used as negative control oligonucleotides, that is, as a method to measure the absence of an effect on the expression of the gene or phenotype. In alternative embodiments, the control oligonucleotides are used as positive control oligonucleotides, ie, as oligonucleotides that are known to affect the expression of the gene or phenotype. The control oligonucleotides are shown in table 2. "Target name" indicates the gene to which the oligonucleotide is directed. "White species" indicates the species in which the oligonucleotide is perfectly complementary to the mRNA White. "Reason" is indicative of the chemically distinct regions comprising the oligonucleotide. Certain compounds in Table 2 are chimeric oligonucleotides, composed of a central "opening" region consisting of 2'-deoxynucleotides, which is flanked on both sides (5 'and 3') by "wings". The wings are composed of 2'-0- (2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides. The "motif" of each gapmer oligonucleotide is illustrated in Table 2 and indicates the number of nucleotides in each opening and wing region, for example, "5-10-5" indicates a gapmer that has an opening region of 10 nucleotides flanked by 5-nucleotide wings. ISIS 29848 is a mixture of random oligomeric compound; its sequence is shown in table 2, where N can be A, T, C or G. The internucleosidic bonds (base structure) are phosphorothioate along all the oligonucleotides in table 2. The unmodified cytosines are indicated by "UC" in the nucleotide sequence; all other cytosines are 5-methylcytosines.

TABLE 2 Control oligonucleotides for testing the cell line, selection of the oligomeric compound and phenotypic assays n in The concentration of the oligonucleotide used varies from cell line to cell line. To determine the optimal concentration of the oligonucleotide for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. Positive controls are shown in Table 2. For example, for human and non-human primate cells, the positive control oligonucleotide can be selected from ISIS 336806, or ISIS 18078. For mouse or rat cells the oligonucleotide positive control can be, for example, ISIS 15770. The concentration of the positive control oligonucleotide resulting in an 80% reduction of the white mRNA, for example, rat Raf kinase C for ISIS 15770, was then used as the selection concentration for the novel oligonucleotides in subsequent experiments for that cell line. If an 80% reduction is not achieved, then the lowest concentration of the positive control oligonucleotide resulting in a 60% reduction in the target mRNA is used as the oligonucleotide selection concentration in subsequent experiments for that cell line. If a 60% reduction is not achieved, that particular cell line is considered to be unsuitable for oligonucleotide transfection experiments. The concentrations of the antisense oligonucleotides are used in the present invention from 50 nM to 300 nM when the antisense oligonucleotide is transfected using a liposome reagent and 1 μM to 40 μM when the antisense oligonucleotide is transfected by electroporation.

EXAMPLE 2 Real-time quantitative PCR analysis of GCCR mRNA levels Quantification of GCCR mRNA levels was achieved by quantitative real-time PCR using the ABI PRISM ™ 7600, 7700, or 7900 sequence detection system (PE-Applied Biosystems, Foster City, CA) in accordance with the instructions manufacturer. Quantities of the target gene obtained by RT, real-time PCR were normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantification of total RNA using RiboGreen ™ (Molecular Probes, Inc. Eugene, OR). Total RNA was quantified using RiboGreen ™ RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). 170 μL of RiboGreen ™ working reagent (RiboGreen ™ reagent diluted 1: 350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was pipetted into a 96-well plate containing 30 μL of purified cellular RNA. The plate was read on a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm. The expression of GAPDH was quantified by RT, real-time PCR, either simultaneously with the quantification of the blank or separately. For simultaneous measurement with the measurement of target levels, the series of primers-probes specific to the target gene to be measured were evaluated for their ability to be "complexed" with a GAPDH amplification reaction before quantitative PCR analysis. The complex formation refers to the detection of multiple DNA species, in this case the target and the endogenous control GAPDH, in a single tube, which requires that the series of primers-probes for GAPDH do not interfere with the amplification of the target. The probes and primers for use in real-time PCR were designed to hybridize with the target-specific sequences. Methods for initiator and probe design are known in the art. The design of the primers and the probe for use in real-time PCR can be carried out using commercially available software, for example Primer Express®, PE Applied Biosystems, Foster City, CA. The primers and probes and the target nucleic acid sequences to which they hybridize are presented in Table 4. Target-specific PCR probes have FAM covalently attached to the 5 'end and TAMRA or MGB covalently bound to the 3' end, in where FAM is the fluorescent dye and TAMRA or MGB is the eliminating dye. After isolation, the RNA was subjected to the reverse transcriptase (RT) sequential reaction and real-time PCR, both carried out in the same well. Reagents for RT and PCR were obtained from Invitrogen Life Technologies (Carlsbad, CA). The RT, real-time PCR was carried out in the same well by the addition of 20 μL of PCR cocktail (pH regulator for PCR 2.5x less MgCI2, 6.6 mM MgCl2, 375 μM of each of dATP, dCTP, dCTP and dGTP, 375 nM of each of the forward primer and reverse primer, 125 nM of the probe, 4 units of RNase inhibitor, 1.25 units of PLATINUM® Taq, 5 units of MuLV reverse transcriptase, and ROX 2.5x dye) to 96-well plates containing 30 μL of a total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48 ° C. After a 10 minute incubation at 95 ° C to activate the PLATINUM® Taq, 40 cycles of a PCR protocol were carried out in two steps: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes (hybridization / extension). The compounds of the invention were evaluated for their effect on the levels of human white mRNA by quantitative real-time PCR as described in other examples in the present invention, using a serial design of primer-probes to hybridize with the GCCR of human. For example: Forward Launcher: TTGACATTTTGCAGGATTTGGA (incorporated in the present invention as SEQ ID NO: 17) Reverse Launcher: CCAAGGACTCTCATTCGTCTCTTT (incorporated in the present invention as SEQ ID NO: 18) and the PCR probe: FAM-TTTCTTCTGGGTCCCC-MGB (incorporated in the present invention as SEQ ID NO: 19), wherein FAM is the fluorescent dye and MGB is a dye non-fluorescent eliminator.

The compounds of the invention were evaluated for their effect on rat mRNA levels by quantitative real-time PCR as described in other examples in the present invention, using a serial design of primer-probes to hybridize with rat GCCR. . For example: Forward Launcher: AAACAATAGTTCCTGCAGCATTACC (incorporated in the present invention as SEQ ID NO: 20) Reverse Initiator: CATACAACACCTCGGGTTCAATC (incorporated in the present invention as SEQ ID NO: 21) and the PCR probe: FAM-ACCCCTACCTTGGTGTCACTGCT-TAMRA (incorporated herein as SEQ ID NO: 22), wherein FAM is the fluorescent dye and TAMRA is the dye eliminator. The compounds of the invention can be evaluated for their effect on the levels of mouse target mRNA by quantitative real-time PCR as described in other examples in the present invention, using a series of primer-probes designed to hybridize to the mouse GCCR. . For example: Forward Launcher: GACATCTTGCAGGATTTGGAGTT (incorporated in the present invention as SEQ ID NO: 23) Reverse Initiator: AACAGGTCTGACCTCCAAGGACT (incorporated in the present invention as SEQ ID NO: 24) and the PCR probe: FAM-CGGGTCCCCAGGTAAAGAGACAAACGA-TAMRA (incorporated in the present invention as SEQ ID NO: 25), wherein FAM is the fluorescent dye and TAMRA is the eliminating dye.

EXAMPLE 3 Antisense inhibition of human GCCR expression by gapmers 5-10-5 A series of the oligomeric compounds was designed to target the different regions of human GCCR, using the published sequences cited in Table 1. The compounds are shown in Table 3. All the compounds in Table 3 are chimeric oligonucleotides (" gapmers ") of 20 nucleotides in length, composed of a central" opening "region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3') by" wings "of five nucleotides. The wings are composed of 2'-0- (2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides. The internucleoside bonds (base structure) are phosphorothioate throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines. The sequence of the oligonucleotide is shown in table 3, and in the white site which is in the first position (more towards 5 ') in the white sequence to which the compound binds. The compounds were analyzed for their effect on mRNA levels of the target gene by quantitative real-time PCR as described in other examples in the present invention, using a design of the primer-probe series to hybridize with human GCCR. The data are averages from three experiments in which the HepG2 cells were treated with 50 nM of the oligomeric compounds described using LIPOFECTIN ™. A reduction in expression was expressed as the percent inhibition in Table 3. If present, "N.D." indicates "not determined". The target regions to which these oligomeric compounds are inhibitors are referred to in the present invention as "validated target segments." TABLE 3 Inhibition of human GCCR mRNA levels by gapmers 5-10-5 or s > and The gapmer oligonucleotides 5-10-5 shown in Table 3 are preferred which achieve a reduced expression of GCCR by at least 30%. The target segments to which these preferred sequences are complementary are referred to in the present invention as "preferred target segments" and are therefore preferred for targeting by the compounds of the present invention. Another aspect of the present invention is an antisense compound directed to GCCR comprising a portion of 8 nucleobases of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 , 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113 wherein said hybrid compound specifically with and reduces the expression of GCCR. In one embodiment the antisense compound is an antisense oligonucleotide, 20 nucleobases in length characterized by a region of 10-deoxynucleotides flanked at its 5 'and 3' ends with five 2'-0- (2-methoxyethyl) nucleotides. In one embodiment, all internucleoside linkages are phosphorothioate linkages. In one embodiment, all cytosines are 5-methylcytosines.

EXAMPLE 4 Antisense inhibition of human GCCR expression by opening-dilated oligonucleotides In accordance with the present invention, open-dilated oligonucleotides having the same sequences as the compounds described in Table 4 were also evaluated. All compounds in Table 4 are "gapmers" oligonucleotides of 20 nucleotides in length , composed of a central "opening" region consisting of 16 2'-deoxynucleotides, which is flanked on both sides (5 'and 3') by "wings" of two-nucleotides. The wings are composed of 2'-O- (2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides. The internucleoside bonds (base structure) are phosphorothioate throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines. The sequence of the oligonucleotide is shown in Table 4, and the target site which is the ppmera portion (plus 5 ') in the target sequence to which the compound binds. Compounds 2-16-2 were analyzed for their effect on mRNA levels of the target gene by quantitative real-time PCR as described in the present invention. The data were averaged from three experiments in which the HepG2 cells were treated with 50 nM of the oligomeric compounds described using LIPOFECTIN ™. A reduction in expression is expressed as the percent inhibition in Table 4. If present, "N.D." indicates "not determined". The target regions to which these oligomeric compounds are inhibitors are referred to in the present invention as "validated target segments." TABLE 4 -saw c » O) CD - i o The oligonucleotides 2-16-2 shown in Table 4 are preferred which reduce the expression of GCCR by at least 30%. The target segments to which these preferred sequences are complementary are referred to in the present invention as "preferred target segments" and are therefore preferred for targeting by the compounds of the present invention. Another aspect of the present invention is an antisense compound directed towards GCCR which comprises a portion of 8-nucleobases of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113 wherein said hybrid compound specifically with and reduces the expression of GCCR. In one embodiment the antisense compound is an oligonucleotide antisense of 20 nucleobases in length characterized by a region of 16 deoxynucleotides flanked at their 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. In one embodiment, all internucleoside linkages are phosphorothioate linkages. In one embodiment, all cytosines are 5-methylcytosines.

EXAMPLE 5 Cross Oligonucleotides of Species Directed to GCCR Some oligonucleotides described in the previous example are complementary hybrid species and are therefore expected to reduce the expression of the glucocorticoid receptor between species. The sequence of said species cross oligonucleotides is shown in Table 5, and the ISIS numbers of the version 5-10-5 motif and the version 2-16-2 motif of the oligonucleotide. Also indicated for each sequence is the target site which is the first position (plus 5 ') in the human target sequence (NM DOCM TO.I, incorporated in the present invention as SEQ ID NO: 1) to which binds the compound. Complementarity is indicated for GCCR mRNA of human, cynomolgus monkey, rat, and mouse ("yes" means perfect complementarity and "1 mm" means an inconsistency from perfect complementarity).

TABLE 5 Cross-species oligonucleotides targeted to GCCR EXAMPLE 6 Antisense inhibition of human and rat GCCR mRNA levels - dose-response studies with gapmers 5-10-5 In a further embodiment of the present invention, eleven oligonucleotides were selected for further dose-response studies. The primary hepatocytes of rat were treated with 5, 10, 25, 50, 100 or 200 MICROM of ISIS 180274, ISIS 180275, ISIS 180276, ISIS 180281, ISIS 180304, ISIS 361137, ISIS 361141, ISIS 361151, ISIS 361156, ISIS 345198 , ISIS 361137 or the negative control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, incorporated in the present invention as SEQ ID NO: 14), and mRNA levels were measured as described in other examples in the present invention. ISIS 141923 is a 5-10-5 gapmer comprising an opening of ten deoxynucleotides flanked by 2'-MOE wings and a phosphorothioate base structure. All cytosines are 5-methylcytosines. The untreated cells served as the control against which the data were normalized. The results of these studies are shown in table 6. The levels of target mRNA were measured by real-time PCR as described in the present invention. The data are the averages of three experiments and are expressed as percentage inhibition in relation to the untreated control.

TABLE 6 Dose-dependent inhibition of GCCR expression in rat primary hepatocytes In a further embodiment of the present invention, the same oligonucleotides were tested in the human HepG2 cell line for their ability to reduce the expression of GCCR mRNA at the indicated doses. The untreated cells served as the control against which the data were normalized. The results of these studies are shown in table 7.

The levels of white mRNA were measured by real-time PCR as described in the present invention. The data are the averages of three experiments and are expressed as percentage inhibition in relation to the untreated control.

TABLE 7 Dose-dependent inhibition of GCCR expression in HepG2 cells As shown in Table 6 and Table 7, antisense oligonucleotides targeting GCCR are effective in reducing the levels of both human and rat target mRNA in a dose-dependent manner.

EXAMPLE 7 Antisense inhibition of rat GCCR mRNA levels studies dose response in vivo with gapmers 5-10-5 Five of the gapmer motif oligonucleotides 5-10-5 (ISIS 180281, ISIS 361137, ISIS 345198, ISIS 180304, and ISIS 361141) were evaluated at various doses in rats for its ability to reduce the levels of GCCR mRNA in the liver. The eight-week-old Sprague Dawley rats were divided into treatment groups that received doses of 50, 25 or 12.5 mg / kg of one of the indicated oligonucleotides via injection. Each treatment group was comprised of four animals, and dosed twice a week for 3 weeks. Animals injected with saline alone served as a control group. The animals were evaluated weekly for standard blood parameters (ALT / AST, cholesterol, triglycerides, and glucose). The animals were sacrificed at the end of the study and the liver tissue was collected and analyzed for blank reduction using the real-time PCR analysis methods described in the present invention. The results are shown in Tables 8a and 8b (separate experiments) as the percent reduction in the GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides.

TABLE 8a GCCR antisense oligonucleotides by rat selection in vivo TABLE 8b GCCR antisense oligonucleotides by rat selection in vivo The data in Tables 8a and 8b show that antisense oligonucleotides directed to GCCR are effective in reducing in vivo expression in a dose-dependent manner. ISIS 345198 (GTCAAAGGTGCTTTGGTCTG; SEQ ED NO: 37) was chosen for further evaluation in structure-activity experiments focusing on the optimization of the aperture. This compound is perfectly complementary to the glucocorticoid receptor RNA of mouse, rat, human, monkey, rabbit and guinea pig.

EXAMPLE 8 Antisense inhibition of GCCR mRNA levels in vivo - aperture optimization study A series of oligomeric compounds was designed to be directed to GCCR with varying sizes of the deoxynucleotide of the apertures and wings 2'- MOE. Each of the oligonucleotides evaluated has the same nucleobase sequence (GTCAAAGGTGCTTTGGTCTG, incorporated in the present invention as SEQ ID NO: 37) and is therefore directed to the same segment of SEQ ID NO: 1 (nucleobases 689 to 709). As shown in example 5, this oligonucleotide is also perfectly complementary to rat GCCR. The compounds are shown in Table 9. The plain text indicates a deoxynucleotide, and nucleobases designed in bold, the underlined text are 2'-0- (2-methoxyethyl) nucleotides. The internucleoside linkages are phosphorothioate throughout the text, and all the cytosines are 5-methylcytosines. The "motif" of each compound indicative of the chemically distinct regions comprising the oligonucleotide is indicated in Table 9.

TABLE 9 Antisense compounds targeting rat GCCR Male nine-week-old Sprague-Dawley rats were treated twice a week for three weeks at doses of 50, 25, 12. 5, and 6.25 mg / kg of the oligonucleotides present in Table 9. Animals injected with saline alone served as controls. Each treatment group was comprised of four animals and the animals were monitored weekly for plasma transaminases, lipids, glucose levels and body weight gain. As expected for normal animals, no substantial alterations in glucose were observed.

The baseline levels (before the start of treatment) of plasma cholesterol (CHOL) and triglyceride (TRIG) levels and the levels measured in week 3 are shown in Table 10 in mg / dL as the average for each treatment group.

TABLE 10 Effect of oligonucleotides directed to GCCR on plasma lipid levels in normal rats As shown in Table 10, treatment with antisense oligonucleotides directed to GCCR causes dose-dependent decreases in cholesterol and triglyceride levels. Therefore, one embodiment of the present invention is a method for decreasing blood lipid levels in an animal comprising administering to said animal an apertured-dilated oligonucleotide. In a preferred embodiment, the apertured-dilated oligonucleotide has the sequence of SEQ ID NO: 37. In other preferred embodiments, the aperture-dilated oligonucleotide is ISIS 372339, ISIS 377130, or ISIS 377131. At the end of the study, the animals were sacrificed, the organ weights were measured, and the tissues were collected for the determination of the reduction of the white and the concentration of the oligonucleotide. White adipose tissue was analyzed for blank reduction using the real-time PCR analysis method described in the present invention. The results are shown in Tables 11 a, 11 b, and 11 c (separate experiments) as the percentage reduction in the GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides. Tissues from animals treated with each open-dilated oligonucleotide were tested for target reduction throughout tissues from animals treated with oligonucleotide motif 5-10-5 for comparison.

TABLE 11a In vivo reduction of GCCR levels in white adipose tissue with oligonucleotides 2-16-2 TABLE 11 b In vivo reduction of GCCR levels in white adipose tissue with oligonucleotides 3-14-3 TABLE 11c In vivo reduction of GCCR levels in white adipose tissue with oligonucleotides 4-12-4 Liver tissue was also analyzed for blank reduction using the real-time PCR analysis methods described in the present invention. The results are shown in Tables 12a, 12b, and 1 2c (separate experiments) as the percentage reduction in the GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides. Tissues from animals treated with each open-dilated oligonucleotide were tested for target reduction to along tissues from animals treated with the oligonucleotide motif 5-10-5 for comparison.

TABLE 12a In vivo reduction of GCCR levels in liver with oligonucleotides 2-16-2 TABLE 12b In vivo reduction of GCCR levels in liver with oligonucleotides 3-14-3 TABLE 12c In vivo reduction of GCCR levels in liver with oligonucleotides 4-12-4 As shown in Tables 11 a, 11 b, and 11 c, all of the apertured-dilated oligonucleotides evaluated were effective in reducing the levels of GCCR in a dose-dependent manner in vivo. In addition, apertured-dilated oligonucleotides show a tendency toward greater potency than the 5-10-5 gapmer in the liver. In addition, to determine the effects of altering the size of the opening on the pharmacokinetics, the concentration of the oligonucleotide in the kidney and liver was determined. Methods for determining the concentration of the oligonucleotide in tissues are known in the art (Geary et al., Anal Biochem, 1999, 274, 241 -248). The total oligonucleotide is the sum of all the metabolites of the oligonucleotides detected in the tissue. The total concentration and the concentration of the full length oligonucleotide (in μg / g) in the liver of animals treated with the indicated oligonucleotide at the indicated concentration is shown in square 2.

TABLE 12 As shown in Table 12, the full length oligonucleotide levels in the liver are comparable or reduced for ISIS 372339 and ISIS 377130 compared to ISIS 345198. Coupled with the white reduction as shown in Table 11, this data show that the improved potency of the opening-dilated compounds is not due to the improved accumulation of the compound in the liver. Therefore, preferred oligonucleotides of the present invention include aperture-dilated oligonucleotides that show an improved potency or comparable power with respect to white reduction to the corresponding 5-10-5 gapmer without the improved accumulation of the compound in a target tissue. In some modalities, white tissue is adipose and in some modalities, white tissue is liver.

Claims (75)

NOVELTY OF THE INVENTION CLAIMS

1. - An antisense oligonucleotide of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCCR and comprising at least a portion of 8 nucleobases of SEQ ID NO: 34, 33, 35, 36, 37, 42, 45, 56, 61, 63, or 96, wherein the oligonucleotide comprises a deoxynucleotide region of 12, 13, 14, 15, 16, 17, or 18 nucleobases in length which is flanked at its 5 'and 3' ends with 1 to 42 ' -0- (2-methoxyethyl) nucleotides and wherein the oligonucleotide specifically hybridizes with and reduces the expression of GCCR.

2. The antisense oligonucleotide according to claim 1, further characterized in that the number of nucleotides flanking the deoxynucleotide region at the 5 'and 3' ends is the same.

3. The antisense oligonucleotide according to claim 1, further characterized in that the number of nucleotides flanking the deoxynucleotide region at the 5 'and 3' ends is not the same.

4. The antisense oligonucleotide according to claim 1, further characterized in that at least one internucleoside bond is a phosphorothioate bond.

5. - The antisense oligonucleotide according to claim 1, further characterized in that at least one cytosine is a 5-methylcytosine.

6. The antisense oligonucleotide according to claim 1, further characterized in that it has the nucleobase sequence of SEQ ID NO: 37.

7. The antisense oligonucleotide according to claim 6, further characterized by a flanked 16 deoxynucleotide region. at its 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides.

8. The antisense oligonucleotide according to claim 7, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

9. The antisense oligonucleotide according to claim 7, further characterized in that at least one cytosine is a 5-methylcytosine.

10. The antisense oligonucleotide according to claim 6, further characterized by a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides.

11. The antisense oligonucleotide according to claim 10, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

12. - The antisense oligonucleotide according to claim 10, further characterized in that at least one cytosine is a 5-methylcytosine.

13. The antisense oligonucleotide according to claim 6, further characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides.

14. The antisense oligonucleotide according to claim 13, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

15. The antisense oligonucleotide according to claim 13, further characterized in that at least one cytosine is a 5-methylcytosine.

16. The antisense oligonucleotide according to claim 6, further characterized by a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotides.

17. The antisense oligonucleotide according to claim 16, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

18. The antisense oligonucleotide according to claim 16, further characterized in that at least one cytosine is a 5-methylcytosine.

19. The antisense oligonucleotide according to claim 6, further characterized by a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides.

20. The antisense oligonucleotide according to claim 19, further characterized in that at least one n-nucleoside bond is a phosphorothioate bond.

21. The antisense oligonucleotide according to claim 19, further characterized in that at least one cytosine is a 5-methylcytosine.

22. The antisense oligonucleotide according to claim 1, further characterized in that it has the nucleobase sequence of SEQ ID NO: 33.

23. The antisense oligonucleotide according to claim 22, further characterized by a flanked 16 deoxynucleotide region. at its 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides.

24. The antisense oligonucleotide according to claim 23, further characterized in that at least one internucleoside bond is a phosphorothioate bond.

25. The antisense oligonucleotide according to claim 23, further characterized in that at least one cytosine is a 5-methylcytosine.

26. The antisense oligonucleotide according to claim 22, further characterized by a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides.

27. The antisense oligonucleotide according to claim 26, further characterized in that at least one internucleoside bond is a phosphorothioate bond.

28. The antisense oligonucleotide according to claim 26, further characterized in that at least one cytosine is a 5-methylcytosine.

29. The antisense oligonucleotide according to claim 22, further characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides.

30. The antisense oligonucleotide according to claim 29, further characterized in that at least one internucleoside bond is a phosphorothioate bond.

31. The antisense oligonucleotide according to claim 29, further characterized in that at least one cytosine is a 5-methylcytosine.

32. The antisense oligonucleotide according to claim 22, further characterized by a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide.

33. The antisense oligonucleotide according to claim 32, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

34. The antisense oligonucleotide according to claim 32, further characterized in that at least one cytosine is a 5-methylcytosine.

35.- The antisense oligonucleotide according to claim 22, further characterized by a region of 17 deoxynucleotides flanked at their 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides.

36. The antisense oligonucleotide according to claim 35, further characterized in that at least one internucleoside bond is a phosphorothioate bond.

37. The antisense oligonucleotide according to claim 35, further characterized in that at least one cytosine is a 5-methylcytosine.

38.- The antisense oligonucleotide according to claim 1, further characterized in that it has the nucleobase sequence of SEQ ID NO: 45.

39.- The antisense oligonucleotide according to claim 38, further characterized by a flanked 16 deoxynucleotide region. at its 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides.

40. The antisense oligonucleotide according to claim 39, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

41. The antisense oligonucleotide according to claim 39, further characterized in that at least one cytosine is a 5-methylcytosine.

The antisense oligonucleotide according to claim 38, further characterized by a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides.

43. The antisense oligonucleotide according to claim 42, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

44. The antisense oligonucleotide according to claim 42, further characterized in that at least one cytosine is a 5-methylcytosine.

45. The antisense oligonucleotide according to claim 38, further characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides.

46. The antisense oligonucleotide according to claim 45, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

47. The antisense oligonucleotide according to claim 45, further characterized in that at least one cytosine is a 5-methylcytosine.

48. The antisense oligonucleotide according to claim 38, further characterized by a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotides.

49.- The antisense oligonucleotide according to claim 48, further characterized in that at least one intemucleoside bond is a phosphorothioate linkage.

50.- The antisense oligonucleotide according to claim 48, further characterized in that at least one cytosine is a 5-methylcytosine.

51. The antisense oligonucleotide according to claim 38, further characterized by a region of 17 deoxynucleotides flanked at their 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides.

52. The antisense oligonucleotide according to claim 51, further characterized in that at least one internucleoside bond is a phosphorothioate linkage.

53. The antisense oligonucleotide according to claim 51, further characterized in that at least one cytosine is a 5-methylcytosine.

54. - A pharmaceutical composition comprising the antisense oligonucleotide according to claim 1 and occasionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient.

55.- A method for reducing the expression of the glucocorticoid receptor in a cell or tissue comprising contacting said tag or tissue with the pharmaceutical composition according to claim 54.

56.- The method according to claim 55, characterized further because the tissue is fatty or liver tissue.

57.- The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for treating a disease or condition mediated by the expression of glucocorticoid in an animal.

58. The use as claimed in claim 57, wherein the disease or condition is diabetes, obesity, metabolic syndrome X, hypergiucemia, or hyperlipidemia.

59.- The use as claimed in claim 57, wherein the disease is Type 2 diabetes.

60.- The use as claimed in claim 57, further characterized because the disease is hyperlipidemia associated with high blood cholesterol or levels elevated triglycerides in blood.

61. - The use as claimed in claim 57, wherein the condition is hepatic steatosis.

62.- The use as claimed in claim 61, wherein the steatosis is steatohepatitis.

63.- The use as claimed in claim 61, wherein the steatosis is non-alcoholic steatohepatitis.

64.- The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for lowering blood glucose levels in an animal.

65.- The use as claimed in claim 64, wherein the animal is a human.

66. The use as claimed in claim 64, wherein the blood glucose levels are fasting blood glucose levels.

67.- The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for lowering blood lipid levels in an animal.

68.- The use as claimed in claim 67, wherein the blood lipid levels are blood cholesterol levels.

69. The use as claimed in claim 67, wherein the blood lipid levels are triglyceride levels in blood.

The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for lowering triglyceride levels in the liver in an animal.

71. - The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for reducing body fat mass in an animal. 72.- The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for reducing the improved sensitivity to insulin in an animal. 73.- The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for inhibiting the output of hepatic glucose in an animal. The use of the pharmaceutical composition according to claim 54 for the manufacture of a medicament useful for delaying or preventing the onset of an increase in blood lipid or blood glucose levels in an animal. The use of a compound according to claim 1 in combination with an antidiabetic agent selected from the group comprising PPAR agonists including PPAR-gamma agonists, dual-PPAR or pan-PPAR, inhibitors of dipeptidyl peptidase (IV ), GLP-1 analogs, insulin and insulin analogues, insulin secretagogues, SGLT2 inhibitors, human amylin analogues including pramiintide, glucokinase activators, biguanides and alpha-glucosidase inhibitors for the manufacture of a drug Useful for treating an animal that has a metabolic disease or condition.