MX2008003930A - Modulation of glucagon receptor expression - Google Patents

Abstract

Compounds, compositions and methods are provided for modulating the expression of glucagon receptor. The compositions comprise antisense compounds, particularly antisense oligonucleotides which have particular in vivo properties, targeted to nucleic acids encoding glucagon receptor. Methods of using these compounds for modulation of glucagon receptor expression and for treatment of diseases are provided.

Description

MODULATION OF THE EXPRESSION OF GLUCAGON RECEPTOR SEQUENCE LIST In the present invention a computer-readable form of the sequence listing is incorporated as a reference, into a disk, which contains the name of the file BIOL0066WOSEQ.txt, which is 29,184 bytes (measured in MS-DOS) and was created September 19, 2006.

FIELD OF THE INVENTION In the present invention, compounds, compositions and methods for the modulation of glucagon receptor expression in a cell, tissue or animal are described.

BACKGROUND OF THE INVENTION The maintenance of normal glycemia is a carefully regulated metabolic event. Glucagon, the 29 amino acid peptide responsible for maintaining blood glucose levels, increases the release of glucose from the liver by activating hepatic glycogenolysis and gluconeogenesis, and also stimulates lipolysis in adipose tissue. In the fasting state, when exogenous glucose is consumed leading to high blood glucose levels, insulin reverses the glucagon-mediated improvement of glycogenolysis and gluconeogenesis. In patients with diabetes, insulin is not available or is not completely effective. Although treatment for diabetes has traditionally focused on increasing levels of insulin, antagonism of glucagon function has been considered as an alternative therapy. Since glucagon exerts its physiological effects by signaling through the glucagon receptor (also known as GCGR or GR), the glucagon receptor has been proposed as a potential therapeutic target for diabetes (Madsen et al., Curr. Pharm Des., 1999, 5, 683-691). The glucagon receptor belongs to the superfamily of G protein-coupled receptors that have seven transmembrane domains. It is also a member of the smaller sub-family of homologous receptors that bind to peptides that are structurally similar to glucagon. The gene encoding the human glucagon receptor was cloned in 1994 and the analysis of the genomic sequence revealed multiple introns and an identity of 82% with respect to the rat glucagon receptor (Lok et al., Gene, 1994, 140, 203-209; MacNeil et al., Biochem. Biophys. Res. Commun., 1994, 198, 328-334). The cloning of the rat glucagon receptor gene also led to the description of multiple alternative processing variants (Maget et al., FEBS Lett, 1994, 351, 271-275). In the patent of E.U.A. 5,776,725 an isolated nucleic acid sequence is described isolated that encodes a human or rat glucagon receptor (Kindsvogel et al., 1998). The human glucagon receptor gene is located on chromosome 17q25 (Menzel et al., Genomics, 1994, 20, 327-328). A nonsense mutation of Gly to Ser in codon 40 in the glucagon receptor gene produces a 3-fold lower affinity for glucagon (Fujisawa et al., Diabetologia, 1995, 38, 983-985) and this mutation has been associated with various disease states, including non-insulin dependent diabetes mellitus (Fujisawa et al.5 Diabetologia, 1995, 38, 983-985), hypertension (Chambers and Morris, Nat. Genet, 1996, 12, 122), and central adiposity (Siani et al .. Obes. Res., 2001, 9, 722-726). Targeted alteration of the glucagon receptor gene in mice has shown that, despite the total absence of glucagon receptors and elevated plasma glucagon levels, the mice maintained a near-normal glycemia and lipidemia (Parker et al. al., Biochem. Biophys, Res. Commun., 2002, 290, 839-843).

BRIEF DESCRIPTION OF THE INVENTION The present invention is directed to oligomeric compounds directed to and hybridizing with an acid molecule encoding GCGR which modulates the expression of GCGR and possesses improved pharmacokinetics as compared to oligonucleotides directed to GCGR as compared to an opening region of 10- deoxynucleotides flanked at their 5 'and 3' ends with five 2'-0-methoxyethyl nucleotides. In the present invention, they are provided oligonucleotides referred to as "gapmers", comprising an "opening" deoxynucleotide region flanked at each of its 5 'and 3' ends with "wings" comprising one to four 2'-0- (2-methoxyethyl) nucleotides. The deoxynucleotide regions of the oligonucleotides of the invention are comprised of more than ten deoxynucleotides, therefore the gapmers of the present invention have an "open-dilated" as compared to chimeric compounds comprising an opening region of ten deoxynucleotide, such as those exemplified in the US Publication 2005-0014713, which is incorporated herein by reference in its entirety. It was found that the renal concentrations of the dilated-aperture oligonucleotides that target GCGR decreased with respect to those oligonucleotides having the same sequence but comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2'- O- (2-methoxyethyl) nucleotides while maintaining the good to excellent potency of the oligonucleotides in the liver. Therefore, embodiments of the present invention include apertured-dilated oligonucleotides directed to GCGR wherein the renal concentrations of said oligonucleotide decrease with respect to the oligonucleotides having the same sequence but comprising a ten deoxynucleotide region flanked at both ends. 'and 3 * with five 2'-0- (2-methoxyethyl) nucleotides. Another embodiment of the present invention includes apertured-dilated oligonucleotides directed to GCGR wherein the renal concentrations of said oligonucleotide are comparable with or are diminished with respect to an oligonucleotide having the same sequence but comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2'-0- (2-methoxyethyl) nucleotides while maintaining or improves the power in white tissues such as the liver. In some embodiments, compared to oligogonucleotides having the same sequence but comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2'-0- (2-methoxyethyl) nucleotides, the oligonucleotides of expanded aperture they have a comparable or improved potency without the improved accumulation of the oligonucleotide in the liver. Thus, embodiments of the present invention include extended-opening oligonucleotides that target GCGR wherein the potency is comparable to or better than that of an oligonucleotide having the same sequence but comprising a ten deoxynucleotide region flanked at both ends 5 'and 3' with five 2'-0- (2-methoxyethyl) nucleotides without the enhanced accumulation of nucleotides in the target tissues. Additionally, methods are provided for modulating the expression of GCGR in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the present invention. For example, in one embodiment, the compounds or compositions of the present invention can be used to reduce the expression of GCGR in cells, tissues or animals. The present invention includes a pharmaceutical composition comprising an antisense oligonucleotide of the invention and optionally a pharmaceutically acceptable carrier, diluent, excipient or enhancer. In one embodiment, the present invention provides a method for lowering blood glucose using the oligomeric compounds delineated in the present invention. In another embodiment, the present invention provides methods for increasing GLP-1 levels using the oligomeric compounds delineated in the present invention. In another embodiment, the present invention is directed to methods of improving or decreasing the severity of a condition in an animal comprising contacting said animal with an effective amount of an oligomeric compound or a pharmaceutical composition of the invention. In other modalities, the present invention is directed to methods for improving or decreasing the severity of a condition in an animal comprising contacting said animal with an effective amount of an oligomeric compound or a pharmaceutical composition of the invention so that the expression of GCGR it is reduced and the measurement of one or more physical indicators of said condition indicates a decrease in the severity of said condition. In some modalities, the disease or condition is a disease or metabolic condition. In some modalities, conditions include, but are not limited to, diabetes, obesity, insulin resistance, and insulin deficiency. In some modalities, diabetes is type 2 diabetes. In one modality, the condition is metabolic syndrome. In one modality, the Obesity is induced by diet. Methods for preventing delaying the onset of high blood glucose levels in an animal comprising administering to said animal a compound or pharmaceutical composition of the invention are also provided. A method to preserve the function of the beta cell is also provided. The present application also relates to the Application of E.U.A.

No. 60 / 718,684, which is incorporated as a reference in its entirety. The present application also relates to the Application of E.U.A. No. 11/231, 243 and PCT Application No. PCT / US2005 / 033837, each of which is incorporated herein by reference in its entirety.

DETAILED DESCRIPTION OF THE INVENTION Revision In the present invention, oligomeric compounds, including antisense oligonucleotides and other antisense compounds are disclosed for use in modulating the expression of nucleic acid molecules encoding GCGR. This is achieved by providing oligomeric compounds that hybridize with one or more target nucleic acid molecules encoding GCGR. In accordance with the present invention are compositions and methods for the modulation of GCGR expression (also known as glucagon receptor or GR). Listed in Table 1 are the GENBANK® access numbers of the sequences that can be used to design the oligomeric compounds directed to GCGR. Oligomeric compounds of the invention include oligomeric compounds that hybridize with one or more target nucleic acid molecules shown in Table 1, as well as oligomeric compounds that hybridize with other nucleic acid molecules encoding GCGR. The oligomeric compounds can be directed to any region, segment, or site of the nucleic acid molecules encoding GCGR. Suitable target regions, segments, and sites include, but are not limited to, the 5'UTR, the start codon, the stop codon, the coding region, the 3'UTR, the 5'cap region (modified end towards 5 '), introns, exons, intron-exon junctions, exon-intron junctions, and exon-exon junctions.

TABLE 1 White genes The locations in the target nucleic acid to which the active oligomeric compounds hybridize are referred to below as "validated blank segments" in the present invention. As used in the present invention, the term "validated blank segment" is defined as at least one portion of 8 nucleobases of a target region to which an active oligomeric compound is directed. While not wishing to be bound by theory, it is currently believed that these white segments represent portions of the target nucleic acid which are accessible for hybridization. The present invention includes oligomeric compounds that are chimeric compounds. An example of a chimeric compound is a gapmer having a 2'-deoxynucleotide region or an "opening" region flanked by non-deoxynucleotide or "wing" regions. Although we do not wish to stick to the theory, the gapmer aperture presents a substrate recognizable by RNase H when it binds to white RNA while the wings are not an optimal substrate but can confer other properties such as contribution to the stability of the duplex or advantageous pharmacokinetic effects. Each wing can be one or more monomers non-deoxy oligonucleotides. In one embodiment, the gapmer is comprised of a region of sixteen 2'-deoxynucleotides flanked at each of the 5 'and 3' ends by the wings of two 2'-0- (2-methoxyethyl) nucleotides. This is referred to as a 2-16-2 gapmer. Therefore, the "motif of this chimeric oligomeric compound or gapmer is 2-16-2." In another embodiment, all the intemucleoside linkages are phosphorothioate linkages In another embodiment, the gapmer cytosines are 5-methylcytosine. invention include oligomeric compounds comprising the sequences of 13 to 26 nucleotides in length comprising a deoxy nucleotide region greater than 10 nucleobases in length flanked at each of its 5 'ends and 3 'with at least one 2'-0- (2-methoxyethyl) nucleotide. Preferred "apertured-dilated" oligonucleotides comprise 11, 12, 13, 14, 15, 16, 17, or 18 deoxynucleotides in the opening portion of the oligonucleotide. Antisense oligonucleotides of 20 nucleobases in length are also preferred. The preferred 5 'and 3' flanking regions comprise 1, 2, 3, or 42'-0- (2-methoxyethyl) nucleotides. Preferred aperture-dilated gapmers have motifs including 1-18-1, 1-17-2, 2-17-1, 2-16-2, 3-14-3, and 4-12-4. In preferred embodiments the oligomeric compounds are directed or hybridized with GCGR RNA. In another embodiment, the oligomeric compounds reduce the expression of GCGR RNA. In other embodiments, oligomeric compounds reduce the expression of GCGR where the expression of GCGR is reduced by at least 10%, by at least 20%, by at least 30%, by at least 35%, by at least 40%, in at least 50%, in at least 60%, in at least 70%, in at least 80%, in at least 90%, or in 100%. The oligonucleotides of the present invention preferably include those in which the renal concentrations of said oligonucleotide are decreased with respect to an oligonucleotide having the same sequence but comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2 ' -0- (2- methoxyethyl) nucleotides. The oligonucleotides of the present invention include those in which the renal concentrations of said oligonucleotide are comparable with or are decreased with respect to those of a oligonucleotide having the same sequence but comprising a region of ten deoxynucleotides flanked at both 5 'and 3' ends with five 2'-0- (2-methoxyethyl) nucleotides. Oligonucleotides of the present invention include those wherein the potency with respect to white reduction or a therapeutic effect is comparable to or better than that of an oligonucleotide having the same sequence comprising a ten deoxynucleotide region flanked at both 5 'ends and 3 'with five 2'-0- (2-methoxyethyl) nucleotides without the improved accumulation of oligonucleotide in tissues. The present invention provides antisense oligonucleotides of 13 to 26 nucleobases in length directed towards a nucleic acid molecule encoding GCGR wherein the oligonucleotide comprises a first region, a second region, and a third region, wherein said first region comprises at least 11 deoxynucleotides and wherein said second and third regions comprise 1 to 4 2'-0- (2-methoxyethyl) nucleotides, said second and third regions flanking the first region of the 5 'and 3' ends of said first region. In preferred embodiments, the oligonucleotides of the invention hybridize specifically with GCGR and reduce the expression of GCGR. In some embodiments, the "aperture" region comprises 11, 12, 13, 14, 15, 16, 17, or 18 nucleobases. In some embodiments, the antisense oligonucleotides are 20 nucleobases in length.

Oligomeric compounds may comprise from about 8 to about 80 nucleobases (ie from about 8 to about 80 associated nucleosides), preferably from about 13 to about 26 nucleobases. One skilled in the art will appreciate that preferred oligomeric compounds contemplated include compounds that are 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleobases in length. The compounds of the invention include oligonucleotide sequences comprising at least the 8 consecutive nucleobases from the 5 'end of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive extension of the same oligonucleotide starting immediately upstream of the 5' end of the antisense compound which hybridizes specifically with the target nucleic acid and continuing until the oligonucleotide comprises approximately 13 to approximately 26 nucleobases). Other compounds are represented by the oligonucleotide sequences comprising at least the 8 consecutive nucleobases from the 3 'end of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive extension of the same oligonucleotide starting immediately downstream of the 3' end of the antisense compound which hybridizes specifically with the target nucleic acid and continuing until the oligonucleotide comprises about 13 to about 26 nucleobases). It is also understood that the compounds may be represented by oligonucleotide sequences comprising at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative compound, and may extend into either or both directions until the oligonucleotide contains about 13 to about 26 nucleobases. The present invention provides antisense oligonucleotides comprising the nucleobase sequence of SEQ ID NO: 2 or SEQ ID NO: 4. In preferred embodiments, the oligonucleotides of the invention comprise at least a portion of 8 nucleobases of the nucleobase sequence of SEQ ID NO: 2. NO: 2 or SEQ ID NO: 4. In a preferred embodiment, the present invention provides antisense oligonucleotides of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCGR and comprising at least a portion of 8 nucleobases of SEQ ID NO. : 2 or 4 wherein the oligonucleotide comprises a deoxynucleotide region of 12, 13, 14, 15, 16, 17, or 18 nucleobases in length which is flanked at its 5 'and 3' ends with 1 to 42'-0- (2-methoxyethyl) nucleotides and wherein the oligonucleotide specifically hybridizes with and reduces the expression of GCGR RNA. In one embodiment, the flanking regions are symmetric (having the same number of nucleotides in the flanking region towards 5 'as in the flanking region towards 3'). In another embodiment, the flanking regions are not symmetric (they have a different number of nucleotides in the flanking region towards 5 'compared to the flanking region towards 3'). In other embodiments, the present invention includes antisense oligonucleotides having the nucleobase sequence of SEQ ID NO: 4 or SEQ ID NO: 2, wherein the antisense oligonucleotide is characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3 ends. 'with four 2'-0- (2-methoxyethyl) nucleotides, a region of 16 deoxynucleotides flanked at their 5' and 3 'ends with two 2'-0- (2-methoxyethyl) nucleotides, a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides, or a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide The antisense oligonucleotides of the invention may contain at least one modified internucleoside linkage. Modified intemucleoside linkages include phosphorothioate linkages. In one embodiment, all internucleoside linkages in an antisense oligonucleotide are phosphorothioate linkages. The antisense oligonucleotides of the invention may also contain at least one modified nucleobase. In one embodiment, at least one cytosine is a 5-methylcytosine. In another embodiment, all cytosines are 5-methylcytosines. One embodiment of the present invention is an antisense oligonucleotide, 20 nucleobases in length, having the sequence of SEQ ID NO: 2, characterized by a region of 16-deoxynucleotides flanked in their 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides wherein each bond is a phosphorothioate bond and each cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotides have the nucleobase sequence of SEQ ID: 2, wherein the antisense oligonucleotide has a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 2, wherein the antisense oligonucleotide has a region of 14 deoxynucleotides flanked at its 5 'and 3' ends with three 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In an additional mode, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 2, wherein the antisense oligonucleotide has a region of 16 deoxynucleotides flanked at its 5 'and 3' ends with two 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 2, wherein the antisense oligonucleotide has a region of 17 deoxynucleotides flanked at its 5 'and 3' ends with one or two 2'-O (2- methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 2, wherein the antisense oligonucleotide has a region of 18 deoxynucleotides flanked at its 5 'and 3' ends with a 2'-0 (2-methoxyethyl) nucleotide In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotides have the nucleobase sequence of SEQ ID: 4, wherein the antisense oligonucleotide has a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0 (2-methoxyethyl) nucleotides. In a modality In addition, the antisense oligonucleotide hybridizes specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 4, wherein the antisense oligonucleotide has a region of 14 deoxynucleotides flanked at its 5 'and 3' ends with three 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 4, wherein the antisense oligonucleotide has a region of 16 deoxynucleotides flanked at its 5 'and 3' ends with two 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 4, wherein the antisense oligonucleotide has a region of 17 deoxynucleotides flanked in its 'and 3' ends with one or two 2'-0 (2-methoxyethyl) nucleotides. In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. In a particular embodiment, the antisense oligonucleotide has the nucleobase sequence of SEQ ID: 4, wherein the antisense oligonucleotide has a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0 (2-methoxyethyl) nucleotide In a further embodiment, the hybrid antisense oligonucleotide specifically with and reduces the expression of GCGR. In a further embodiment, at least one internucleoside linkage is a phosphorothioate linkage. In a further embodiment, at least one cytosine is a 5-methylcytosine. Also contemplated in the present invention is a pharmaceutical composition comprising an antisense oligonucleotide of the invention and optionally a carrier, pharmaceutically acceptable diluent, enhancer or excipient. The compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to the effects of glucagon mediated by GCGR. The embodiments of the present invention include methods for reducing the expression of GCGR in tissues or cells comprising contacting said cells or tissues with an antisense oligonucleotide. or pharmaceutical composition of the invention, methods for lowering blood glucose levels, blood triglyceride levels, or blood cholesterol levels in an animal comprising administering to said animal an antisense oligonucleotide or a pharmaceutical composition of the invention. Blood levels can be levels in plasma or serum. Also contemplated are methods for increasing insulin sensitivity, methods for increasing GLP-1 levels, and methods for inhibiting hepatic glucose output in an animal that comprises administering to said animal an antisense oligonucleotide or a pharmaceutical composition of the invention. invention. An increased sensitivity to insulin can be indicated by a reduction in circulating insulin levels. Other embodiments of the present invention include methods for the treatment of an animal having a disease or condition associated with glucagon activity via GCGR which comprises administering to said animal a therapeutically or prophylactically effective amount of an antisense oligonucleotide or a pharmaceutical composition of the invention. invention. The disease or condition can be a disease or metabolic condition. In some modalities, the disease or metabolic condition is diabetes, hyperglycemia, hyperlipidemia, metabolic syndrome X, obesity, primary hypergiucagonemia, insulin efficiency, or insulin resistance. In some modalities, diabetes is Type 2 diabetes. In some modalities, obesity is induced by diet. In some modalities, hyperlipidemia is associated with elevated levels of blood lipids. The lipids include cholesterol and triglycerides. In one modality, the condition is hepatic steatosis. In some modalities, steatosis is steatohepatitis or non-alcoholic steatohepatitis. Methods for preventing or delaying the onset of elevated blood glucose levels as well as methods for preserving beta-cell function in an animal using the oligomeric compounds delineated in the present invention are also provided. The compounds of the invention can be used to modulate the expression of GCGR in an animal in need of it, such as a human. In a non-limiting embodiment, the methods comprise the step of administering to said animal an effective amount of an antisense compound that reduces the expression of GCGR mRNA. In one embodiment, the antisense compounds of the present invention effectively reduce the levels or function of GCGR RNA. Because the reduction in GCGR mRNA levels can also lead to alteration in the protein products of GCGR expression, these resulting alterations can also be measured. The antisense compounds of the present invention that effectively reduce the levels or function of a GCGR RNA or protein expression products are considered an active antisense compound. In one embodiment, the antisense compounds of the invention reduce GCGR expression by causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, in at least 50%, in at least 60%, in at least 70%, in at least 75%, in at least 80%, in at least 85%, in at least 90%, in at least 95%, in at least 98%, in at least 99%, or in 100% as measured by an exemplified assay in the present invention. One skilled in the art possessing the antisense compounds illustrated in the present invention will be able, without experimentation, to identify additional antisense compounds.

Antisense Mechanisms "Antisense mechanisms" are all those that include the hybridization of a compound with a target nucleic acid, wherein the result or effect of the hybridization is either target degradation or target occupancy with concomitant loss of velocity. the cellular machinery including, for example, transcription or alternative processing.

Targets As used in the present invention, the terms "white nucleic acid" and "nucleic acid molecule encoding GCGR" have been used for convenience to include DNA encoding GCGR, RNA (including pre-mRNA and mRNA or portions of the same) transcribed from said DNA, and also cDNA derived from said RNA.

Regions, Segments, and Sites The targeting process usually also includes determining at least one target region, segment, or site within the target nucleic acid for the antisense interaction to be performed in such a manner as to produce the desired effect, for example , modulation of the expression. "Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. The segments are found within the target nucleic acid regions. The "segments" are defined as smaller portions or sub-portions of regions within a white nucleic acid. "Sites", as used in the present invention, are defined as unique positions of the nucleobase within a target nucleic acid. Once one or more target regions, segments or sites have been identified, the oligomeric compounds are designed which are sufficiently complementary to the target, ie, hybridize sufficiently well and with appropriate specificity, to produce the desired effect.

Variants It is also known in the art that alternating transcripts of RNA can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants." More specifically, "pre-mRNA variants" are transcripts produced from of the same genomic DNA that differ with respect to other transcripts produced from the same genomic DNA either in its initial or stop position and contain as many intronic as exonic sequences. After cleavage of one or more regions of exon or intron, or portions thereof during processing, the pre-mRNA variants produce smaller "mRNA variants". Accordingly, mRNA variants are processed variants of pre-mRNA and each unique variant of pre-mRNA always produces a single variant of mRNA as a result of processing. These mRNA variants are also known as "alternative processing variants." If processing of the pre-mRNA variant does not occur then the pre-mRNA variant is identical to the mRNA variant. It is also known in the art that variants can be produced through the use of alternative signals to initiate or stop transcription or stoppage and that pre-mRNA and mRNA can possess more than one start codon or a stop bead. Variants that originate from a pre-mRNA or mRNA using alternative start codons are referred to as "alternative start variants" of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-mRNA or mRNA. A specific type of alternate stop variant is the "poIyA variant" in which the multiple transcripts produce results from the alternative selection of one of the "poIyA stop signals" by the transcription machinery, thus producing transcripts that end up in unique poIyA sites. Consequently, the types of variants described in the present invention are also suitable white nucleic acids.

Modulation of target expression "Modulation" means a disturbance of function, for example, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in expression. As another example, the modulation of the expression may include perturbation of the selection of the pre-mRNA processing site. The "expression" includes all the functions by means of which an information encoded by a gene is converted to structures present and in operation in a cell. These structures include the transcription and translation products. "Modulation of the expression" means the disturbance of said functions. "Modulators" are those compounds that modulate GCGR expression and which comprise at least a portion of 8 nucleobases which is complementary to a validated blank segment. The modulation of the expression of a target nucleic acid can be achieved through the alteration of any number of functions of the nucleic acid (DNA or RNA). The functions of the DNA to be modulated may include replication and transcription. Replication and transcription, for example, it may be from an endogenous cellular template, a vector, a plasmid or other type of construct. The functions of the RNA to be modulated can include translocation functions, which include, but are not limited to, translocation of RNA to a translocation site of the protein, translocation of RNA to sites within the cell which are distant from the site of RNA synthesis, and the translation of the protein from RNA. Functions of RNA processing that can be modulated include, but are not limited to, RNA processing to produce one or more RNA species, RNA modification, 3 'RNA maturation and catalytic activity or complex formation that includes RNA in which RNA can participate or can be facilitated by RNA. Modulation of expression may result in the increased level of one or more nucleic acid species or the decreased level of one or more nucleic acid species, either temporarily or by a steady state level of net. One result of such interference with the function of the target nucleic acid is the modulation of GCGR expression. Therefore, in one embodiment the modulation of the expression may mean the increase or decrease in the levels of target RNA or protein. In another embodiment, modulation of expression may mean an increase or decrease in one or more products of RNA processing, or a change in the ratio of two or more processing products.

Hybridization and complementarity "Hybridization" means the coupling of complementary chains of oligomeric compounds. Although it is not limited to a Particular mechanism, the most common mechanism of coupling includes the formation of hydrogen bonds, which can be Watson-Crick type, Hoogsteen or hydrogen bonding type Hoogsteen reverse, between nucleoside bases or nucleotide complementary (nucleobases) of the chains of the oligomeric compounds. For example, adenine and thymine are complementary nucleobases which are coupled through the formation of hydrogen bonds. Hybridization can occur under varying circumstances. An oligomeric compound is specifically hybridizable when there is an adequate degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo tests or therapeutic treatment, and under conditions in which the tests will be carried out in the case of in vitro tests. "Severe hybridization conditions" or "severe conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but with a minimum number of other sequences. Severe conditions depend on the sequence and will be different in different circumstances, and the "severe conditions" under which the oligomeric compounds hybridize with a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are investigated. .

"Complementarity", as used in the present invention, refers to the ability of precise coupling between two nucleobases in one or two chains of the oligomeric compound. For example, if a nucleobase at a certain position of an antisense compound is capable of coupling through the formation of hydrogen bonds with a nucleobase at a certain position of a target nucleic acid, then the position of the hydrogen bond between the oligonucleotide and the White nucleic acid is considered a complementary position. The oligomeric compound and the DNA or RNA are complementary to each other when an appropriate number of complementary positions in each molecule are occupied by nucleobases that can form hydrogen bonds with each other. Therefore, "specifically hybridizable" and "complementarity" are terms which are used to indicate an adequate degree of precise coupling or complementarity in an appropriate number of nucleobases such that stable and specific binding occurs between the oligomeric compound and a white nucleic acid. It is understood in the art that the sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. further, an oligonucleotide can hybridize to one or more segments in such a way that the intermediate or adjacent segments do not participate in the hybridization event (eg, a loop structure, inconsistency or hairpin structure). The oligomeric compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence complementarity with respect to a target sequence within the target nucleic acid sequence to which they are directed. For example, an oligomeric compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and therefore could hybridize specifically, could have 90 percent complementarity. In this example, non-complementary remaining nucleobases can be clustered or spaced with complementary nucleobases and do not need to be contiguous with each other or with respect to complementary nucleobases. As such, an oligomeric compound which is 18 nucleobases in length having 4 (four) non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid could have 77.8% overall complementarity with the target nucleic acid and therefore could fall within the scope of the present invention. The percentage complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al. , J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage homology, sequence identity or complementarity can be determined through, for example, the Averaging program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wl), using the default settings, which use the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

Oliqomeric compounds The term "oligomeric compound" refers to a polymeric structure capable of hybridizing to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and chimeric combinations thereof. The oligomeric compounds are routinely prepared in a linear fashion but may be joined or otherwise prepared to be circular. In addition, branched structures are known in the art. An "antisense compound" or "antisense oligomeric compound" refers to an oligomeric compound that is at least partially complementary to the region of a nucleic acid molecule with which it hybridizes and which modulates (increases or decreases) its expression. Consequently, although it can be said that all antisense compounds are oligomeric compounds, not all oligomeric compounds are antisense compounds. An "antisense oligonucleotide" is an antisense compound that is an oligomer based on nucleic acid. An antisense oligonucleotide can be chemically modified. Non-limiting examples of the oligomeric compounds include initiators, probes, antisense compounds, oligonucleotides antisense, external guide sequence oligonucleotides (EGS), alternating processors, and siRNA. As such, these compounds may be introduced in the form of single chains, double chains, circular elements, branched chains or hairpins and may contain structural elements such as protuberances or internal or thermnal handles. The double-stranded oligomeric compounds can be two hybridized chains to form double-stranded or single-stranded compounds with sufficient self-complementarity to allow hybridization and "formation of a fully double or partially double-stranded compound." Chimeric oligomeric compounds "or" chimeras, "in the context of this invention, are single or double-chain oligomeric compounds, such as oligonucleotides, which contain two or more chemically distinct regions, each comprising at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. A "gapmer" is defined as an oligomeric compound, generally an oligonucleotide, having a 2'-deoxyoligonucleotide region flanked by non-deoxyoligonucleotide segments. The central region is referred to as the "opening." The flanking segments are referred to as the "wings." If one of the wings has zero non-deoxyoligonucleotide monomers, a "hemimer" is described.

NAFLD The term "non-alcoholic fatty liver disease" (NAFLD) covers a spectrum of diseases ranging from the simple accumulation of triglycerides in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis. Nonalcoholic steatohepatitis (NASH) occurs from the progression of NAFLD beyond the deposition of triglycerides. A second effect capable of inducing necrosis, inflammation, and fibrosis is required for the development of NASH. Candidates for the second effect can be grouped into broad categories: factors that cause an increase in oxidative stress and factors that promote the expression of proinflammatory cytokines. It has been suggested that increased triglycerides in the liver lead to increased oxidative stress in the hepatocytes of animals and humans, indicating a potential cause-and-effect relationship between hepatic triglyceride accumulation, oxidative stress, and the progress of steatosis. liver disease to NASH (Browning and Horton, J. Clin. Invest, 2004, 114, 147-152). Hypertriglyceridemia and fatty hyperacidemia can cause accumulation of triglycerides in peripheral tissues (Shimamura et al., Biochem, Biophys, Res. Commun., 2004, 322, 1080-1085). One embodiment of the present invention is a method for reducing lipids in the liver of an animal by administering a prophylactically or therapeutically effective amount of an oligomeric compound of the invention. Another embodiment of the present invention is a method for the treatment of hepatic steatosis in a animal by administering a prophylactically or therapeutically effective amount of an oligomeric compound of the invention. In some modalities, steatosis is steatohepatitis. In some modalities, steatosis is NASH.

Chemical modifications Modified and Alternating Nucleobases Oligomeric compounds of the invention also include variants in which a different base is present at one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, variants containing thymidine, guanosine or cytidine can be produced in this position. This can be done in any of the positions of the oligomeric compound. These compounds are then evaluated, using the methods described in the present invention to determine their ability to reduce the expression of GCGR mRNA. Oligomeric compounds may also include modifications or substitutions of the nucleobases (often referred to in the art as heterocyclic bases or simply as "bases"). As used in the present invention, the "unmodified" or "natural" nucleobases include the bases purine adenine (A) and guanine (G), and the bases pyrimidine thymine (T), cytosine (C) and uracil (U) . A "substitution" is the replacement of an unmodified or natural base with another unmodified base or natural. The "modified" nucleobases mean other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, -propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C = C-CH 3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases , 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, -Is particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (1 H-pyrimido, 4-b) (1, 4) benzoxazin-2 (3H) -one), phenothiazine cytidine (1 H -pyrimido (5,4-b) (1,4) benzothiazin-2 (3H) -one), Unions -G such as a substituted phenoxazine cytidine (for example 9- (2-aminoethoxy) -H-pyrimido (5,4-b) (1,4) benzoxazin-2 (3H) -one), carbazole cytidine (2H-pyrimido) (4,5-b) indole-2-one), pyridoindol cytidine (H-pyrido (3 ', 2': 4,5) pyrrolo (2,3-d) pyrimidin-2-one). Modified nucleobases may also include those in which the purine base or pyrimidine is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those described in U.S. Patent No. 3,687,808, those described in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Rroschwitz, J.I., ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those described by Sanghvi, Y.S., chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., ed., CRC Press, 1993. Some of these nucleobases are known to those skilled in the art to be suitable for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and substituted N-2, N-6 and 0-6 purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. It has been shown that 5-methylcytosine substitutions increase the stability of the nucleic acid duplex by 0.6-1.2 ° C and are substitutions of suitable bases, even more particularly when combined with modifications of 2'-0-methoxyethyl sugar. It is understood in the art that modification of the base does not include such chemical modifications that produce substitutions in a nucleic acid sequence. Representative patents of the United States that teach the preparation of some of the aforementioned modified nucleobases as well as other modified nucleobases include, but are not limited to, U.S. Pat. previously mentioned 3,687,808, as well as U.S. Patent No. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525.71 1; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,681, 941; and 5,750,692.

The oligomeric compounds of the present invention may also include polycyclic heterocyclic compounds in place of one or more of the naturally occurring portions of the heterocyclic bases. Numerous tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified chain to a white chain. The most studied modifications are directed to guanosines, therefore these have been called G-Unions or cytidine analogues. Representative cytosine analogs making 3 hydrogen bonds with a guanosine in a second chain include 1,3-diazafenoxazin-2-one (Kurchavov, et al, Nucleosides and Nucleotides, 1997, 16, 1837-1846), 1, 3 -diazaphenothiazine-2-one, (Lin, K.-Y .; Jones, RJ; Matteucci, MJ Am. Chem. Soc. 1995, 117, 3873-3874) and 6,7,8,9-tetrafluoro-1, 3-diazafenoxazin-2-one (Wang, J .; Lin, K.-Y., Matteucci, M. Tetrahedron Lett., 1998, 39, 8385-8388). Already incorporated within the oligonucleotides it was shown that these base modifications are hybridized with complementary guanine and also the last hybrid with adenine was shown to improve thermal stability by extending the interactions that are stacked (also see US Pre-Support publications). economic 20030207804 and 20030175906). Propeller-stabilizing properties have been further observed when an analog / cytosine substitute has an aminoethoxy moiety attached to the rigid structure of 1,3-diazafenoxazin-2-one (Lin, K.-Y .; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532). Binding studies demonstrated that a single incorporation could improve the affinity of binding to a model oligonucleotide with respect to its complementary white DNA or RNA with a? Tm of up to 18 ° C relative to 5-methyl cytosine (dC5 e), which is a high affinity enhancer for a particular modification. On the other hand, the gain in stability by the helix does not compromise the specificity of the oligonucleotides. Additional tricyclic heterocyclic compounds and methods for the use thereof which are suitable for use in the present invention are described in U.S. Patents 6,028,183, and 6,007,992. The improved binding affinity of phenoxazine derivatives together with their uncommitted sequence specificity makes them valuable analogs of nucleobases for the development of more potent antisense-based drugs. In fact, promising data have been derived from in vitro experiments demonstrating that heptanucleotides containing substitutions in phenoxazine are able to activate RNase H, improve cell uptake and exhibit increased antisense activity (Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532). The improved activity was even more pronounced in the case of G-junction, since a single substitution was shown to significantly improve the in vitro potency of a 20-element 2'-deoxyphosphorothioate oligonucleotides (Flanagan, W.M., Wolf, JJ; Olson, P .; Grant, D .; Lin, K.-Y .; Wagner, R. W .; Matteucci, M. Proc. Nati Acad. Sci. USA, 1999, 96, 3513-3518). Additional modified polycyclic heterocyclic compounds useful as heterocyclic bases are described in but are not limited to, U.S. Pat. aforementioned 3,687,808, as well as US Patents: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681, 941, and Publication of E.U.A. Pre-economic support 20030158403.

Combinations The compositions of the invention may contain two or more oligomeric compounds. In another related embodiment, the compositions of the present invention may contain one or more antisense compounds, particularly oligonucleotides, directed to a first nucleic acid and one or more additional antisense compounds directed to a second target nucleic acid. Alternatively, the compositions of the present invention may contain two or more antisense compounds directed to different regions of the same target nucleic acid. Two or more combined compounds can be used together or sequentially.

Combination therapy The compounds of the invention can be used in combination therapy, wherein an additive effect is achieved by the administration of one or more compounds of the invention and one or more other therapeutic / prophylactic compounds suitable for treating a condition. Suitable therapeutic / prophylactic compounds include, but are not limited to, glucose lowering agents, anti-obesity agents, and lipid-lowering agents. Agents that lower glucose include, but are not limited to hormones, hormone mimetics, or incretin mimetics (eg, insulin, including inhaled insulin, GLP-1 or GLP-1 analogues such as liraglutjda, or exenatide), DPP (IV) inhibitors, a sulphonylurea (eg, acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, glyburide or a gliclazide), a biguanide (metformin), a meglitinide (eg, nateglinide or repaglinide), a thiazolidinedione or other PPAR-gamma agonists (e.g., pioglitazone or rosiglitazone), an alpha-glucosidase inhibitor (e.g., acarbose or miglitol), or an antisense compound not directed toward GCGR. Also included are dual PPAR agonists (eg, muraglitazar, which has been developed by Bristol-Myers Squibb, or tesaglitazar, which has been developed by Astra-Zeneca). Other treatments for diabetes in development are also included (for example, LAF237, which was developed by Novartis, MK.-0431, which was developed by Merck, or rimonabant, which was developed by Sanofi-Aventis). The anti-aging agents obesity include, but are not limited to, appetite suppressants (for example phentermine or Meridia ™), fat absorption inhibitors such as orlistat (for example Xenical ™), and modified forms of ciliary neurotrophic factor which inhibits the signals of hunger that stimulate the appetite. Agents that lower lipids include, but are not limited to, resins that sequester bile salts (eg, cholestyramine, colestipol, and colesevelam hydrochloride), HMGCoA-reductase inhibitors (eg, lovastatin, pravastatin, atorvastatin, simvastatin, and fluvastatin), nicotinic acid, fibric acid derivatives (eg, clofibrate, gemfibrozil, fenofibrate, bezafíbrato, and ciprofibrate), probucol, neomycin, dextrothyroxine, vegetable stanol esters, cholesterol absorption inhibitors (eg, ezetimibe), inhibitors of CETP (for example torcetrapib, and JTT-705), inhibitors of MTP (for example, implitapide), inhibitors of bile acid transporters (apical bile acid transporters dependent on sodium), regulators of hepatic CYP7a, inhibitors of ACAT (for example Avasimiba), therapeutic for estrogen replacement (for example, tamoxigen), synthetic HDL (for example ETC-216), antiinflamat orios (for example, glucocorticoids), or an antisense compound not directed towards GCGR. One or more of these drugs can be combined with one or more of the GCGR antisense inhibitors to achieve an additive therapeutic effect.

Synthesis of the oliqomer Oligomerization of the modified and unmodified nucleosides can be carried out routinely in accordance with the procedures in the literature for DNA (Protocols for Oligonucleotides and Analogs, Ed. AgrawaI (1993), Humana Press) and / or RNA (Scaringe, Methods (2001), 23, 206-217, Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed Smith (1998), 1-36, Gallo et al., Tetrahedron ( 2001), 57, 5707-5713) and US Publication No. 2005-0014713, which is incorporated herein by reference. The oligomeric compounds of the present invention can be conveniently and routinely made by well-known solid phase synthesis techniques. The equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other methods for such synthesis known in the art can be used additionally or alternatively. It is well known to use similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives.

Purification of oliqomer and analysis Methods for purification and analysis of the oligonucleotide are known to those skilled in the art. The methods of analysis include capillary electrophoresis (CE) and mass spectroscopy by electroaspersion. Said methods of synthesis and analysis can be carried out in multiple well plates.

Non-limiting description and incorporation as reference Although certain compounds, compositions and methods of the present invention have been described with specificity in accordance with certain embodiments, the examples in the present invention serve only to illustrate the compounds of the invention and are not intended to limit the same. Each of the references, GENBANK® access number, and the like mentioned in the present application are incorporated herein by reference in their entirety.

EXAMPLE 1 Essay for the modulation of expression The modulation of GCGR expression can be tested in a variety of ways known in the art. GCGR mRNA levels can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. RNA analysis can be carried out in total cellular RNA or poly (A) + mRNA by methods known in the art. Methods for RNA isolation are taught in, for example, Ausubel, F.M. et al, Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1 -4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routinely performed in the art and taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative PCR (PCR) can be conveniently achieved using the commercially available ABI PRISM ™ 7700 sequence detection system, available from PE-Applied Biosystems, Foster City, CA and used in accordance with the manufacturer's instructions. The levels of proteins encoded by GCGR can be quantified in numerous ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), ELISA or fluorescence activated cell selection (FACS). Antibodies directed to a protein encoded by GCGR can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, Ml), or can be prepared by conventional methods for antibody generation. Methods for the preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-1 1.12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1 -11.11.5, John Wiley & Sons, Inc., 1997.

Methods for immunoprecipitation are standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1 -10.16.11, John Wiley & Sons, Inc., 1998. Analysis by Western blot (immunoblot) is standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-1 1.2.22, John Wiley & Sons, Inc., 1991. The effect of the oligomeric compounds of the present invention on the expression of the target nucleic acid can be evaluated in any of a variety of cell types with the proviso that the target nucleic acid is present at levels that are can measure The effect of the oligomeric compounds of the present invention on the expression of the target nucleic acid can be determined routinely using, for example, PCR or Northern blot analysis. The cell lines are derived both from normal tissues and from cell types and from cells associated with various disorders (for example hyperproliferative disorders). Cell lines derived from multiple tissues and species can be obtained from the American Type Culture Collection (ATCC, Manassas, VA), the Japanese Cancer Research Resources Bank (Tokyo, Japan), or the Center for Applied Microbiology and Research (Wiltshire, United Kingdom). Primary cells, or those cells that are isolated from an animal and not subjected to continuous culture, can be prepared according to methods known in the art or can be obtained from various commercial suppliers. Additionally, primary cells include those obtained from donor human subjects in a clinical setting (i.e., blood donors, surgical patients).

Cell types The effect of the oligomeric compounds on the expression of the target nucleic acid was evaluated in the HepG2 cells. The hepatoblastoma cell line of human HepG2 was obtained from the American Type Culture Collection (Manassas, VA). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal bovine serum, 1 mM non-essential amino acids, and 1 mM sodium pyruvate (Invitrogen Life Technologies, Carlsbad, CA). The cells were passaged routinely by trypsinization and dilution when they reached approximately 90% confluency. Plates were prepared for culture with multiple wells for cell culture by coating with a 1: 100 dilution of rat tail type collagen type 1 (BD Biosciences, Bedford, MA) in phosphate buffered saline. The plates that Contain collagen were incubated at 37 ° C for about 1 hour, after which the collagen was removed and the wells were washed twice with saline with pH regulated with phosphate. The cells were seeded in 96-well plates (Falcon-Primary # 353872, BD Biosciences, Bedford, MA) at a density of approximately 8,000 cells / well for use in the transfection experiments with the oligomeric compound.

Treatment with the oliqomeric compounds When the cells reached an appropriate confluence, they were treated with the oligonucleotide using a transfection method as described. Other reagents suitable for transfection known in the art include, but are not limited to, LIPOFECTAMINE ™, OLIGOFECTAMINE ™, and FUGENE ™. Other methods suitable for transfection known in the art include, but are not limited to, electroporation.

LIPOFECTIN ™ When the cells reach 65-75% confluence, they are treated with oligo nucleotide. The oligonucleotide is mixed with LIPOFECTIN ™ Invitrogen Life Technologies, Carlsbad, CA) in Opti-MEM ™ -1 medium with reduced serum (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of the oligonucleotide and a concentration of LIPOFECTIN ™ of 2.5. or 3 μg / mL per 100 nM of the oligonucleotide. This mixture of transfection is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, the wells were washed once with 100 μL of OPTI-MEM ™ -1 and then treated with 130 μL of the transfection mixture. Cells grown in 24-well plates or other standard plates for tissue culture were treated in a similar manner, using appropriate volumes of medium and oligonucleotide. Cells were treated and data was obtained in duplicate or triplicate. After about 4-7 hours of treatment at 37 ° C, the medium containing the transfection mixture was replaced with fresh culture medium. Cells were harvested 16-24 hours after treatment with the oligonucleotide.

CYTOFECTIN ™ When the cells reached 65-75% confluence, they were treated with the oligonucleotide. The oligonucleotide was mixed with CYTOFECTIN ™ (Gene Therapy Systems, San Diego, CA) in OPTI-MEM ™ -1 medium with reduced serum (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of the oligonucleotide and a concentration of CYTOFECTIN ™ of 2 or 4 μg / mL per 100 nM of the oligonucleotide. This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, the wells were washed once with 100 μL of OPTI-MEM ™ -1 and then treated with 130 μL of the transfection mixture. The cells grown in 24-well plates or other standard plates for tissue culture were treated in a similar manner, using appropriate volumes of medium and oligonucleotide. Cells were treated and data was obtained in duplicate or triplicate. After about 4-7 hours of treatment at 37 ° C, the medium containing the transfection mixture was replaced with fresh culture medium. Cells were harvested 16-24 hours after treatment with the oligonucleotide.

Control Oligonucleotides The control oligonucleotides are used to determine the optimal concentration of the oligomeric compound for a particular cell line. In addition, when the oligomeric compounds of the invention are evaluated in oligomeric compound screening or phenotypic assays, the control oligonucleotides are evaluated in parallel with the compounds of the invention. In certain embodiments, the control oligonucleotides are used as negative control oligonucleotides, that is, as a method to measure the absence of an effect on the expression of the gene or phenotype. In alternative embodiments, the control oligonucleotides are used as positive control oligonucleotides, i.e., as oligonucleotides that are known to affect the expression of the gene or phenotype. The control oligonucleotides are shown in table 2. "Target name" indicates the gene to which the oligonucleotide is directed. "White species" indicates the species in which the oligonucleotide is perfectly complementary to the mRNA White. "Reason" is indicative of the chemically distinct regions comprising the oligonucleotide. Certain compounds in Table 2 are chimeric oligonucleotides, composed of a central "opening" region consisting of 2'-deoxynucleotides, which is flanked on both sides (5"and 3 ') by" wings. "The wings are composed of '-0- (2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides The "motif" of each gapmer oligonucleotide is illustrated in table 2 and indicates the number of nucleotides in each region opening and wing, for example, "5-10-5" indicates a gapmer that has an opening region of 10 nucleotides flanked by 5-nucleotide wings ISIS 29848 is a mixture of random oligomeric compound, its sequence is shown in Table 2, where N can be be A, T, C or G. The intemucleoside bonds (base structure) are phosphorothioate along all the oligonucleotides in Table 2. The unmodified cytosines are indicated by "UC" in the nucleotide sequence, all the other cytosines are 5-methylcytosines.

TABLE 2 Control oligonucleotides for testing the cell line, selection of the oligomeric compound and phenotypic assays or The concentration of the oligonucleotide used varies from cell line to cell line. To determine the optimal concentration of the oligonucleotide for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. Positive controls are shown in Table 2. For example, for human and non-human primate cells, the positive control oligonucleotide can be selected from ISIS 336806, or ISIS 18078. For mouse or rat cells the oligonucleotide positive control can be, for example, ISIS 15770. The concentration of the positive control oligonucleotide resulting in an 80% reduction of the target mRNA, for example, rat Raf kinase C for ISIS 15770, was then used as the selection concentration for the novel oligonucleotides in subsequent experiments for that cell line. If an 80% reduction is not achieved, then the lowest concentration of the positive control oligonucleotide resulting in a 60% reduction in the target mRNA is used as the oligonucleotide selection concentration in subsequent experiments for that cell line. If a 60% reduction is not achieved, that particular cell line is considered to be unsuitable for oligonucleotide transfection experiments. The concentrations of the antisense oligonucleotides are used in the present invention from 50 nM to 300 nM when the antisense oligonucleotide is transfected using a liposome reagent and 1 μM to 40 μM when the antisense oligonucleotide is transfected by electroporation.

EXAMPLE 2 Real-time quantitative PCR analysis of GCGR mRNA levels Quantification of GCGR mRNA levels was achieved by quantitative real-time PCR using the ABI PRISM ™ 7600, 7700, or 7900 sequence detection system (PE-Applied Biosystems, Foster City, CA) in accordance with the instructions manufacturer. Quantities of the target gene obtained by RT, real-time PCR were normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantification of total RNA using RiboGreen ™ (Molecular Probes, Inc. Eugene, OR). Total RNA was quantified using RiboGreen ™ RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). 170 μL of RiboGreen ™ working reagent (RiboGreen ™ reagent diluted 1: 350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was pipetted into a 96-well plate containing 30 μL of purified cellular RNA. The plate was read on a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm. The expression of GAPDH was quantified by RT, real-time PCR, either simultaneously with the quantification of the blank or separately. For simultaneous measurement with the measurement of target levels, the series of primers-probes specific to the target gene to be measured were evaluated for their ability to be "complexed" with a GAPDH amplification reaction before quantitative PCR analysis. The complex formation refers to the detection of multiple DNA species, in this case the target and the endogenous control GAPDH, in a single tube, which requires that the series of primers-probes for GAPDH do not interfere with the amplification of the target. The probes and primers for use in real-time PCR were designed to hybridize with the target-specific sequences. Methods for initiator and probe design are known in the art. The design of the primers and the probe for use in real-time PCR can be carried out using commercially available software, for example Primer Express®, PE Applied Biosystems, Foster City, CA. The primers and probes and the target nucleic acid sequences to which they hybridize are presented in Table 4. Target-specific PCR probes have FAM covalently linked to the 5 'end and TAMRA or MGB covalently bound to the 3' end., where FAM is the fluorescent dye and TAMRA or MGB is the eliminating dye. After isolation, RNA was subjected to sequential reverse transcriptase (RT) and real-time PCR, both carried out in the same well. Reagents for RT and PCR were obtained from Invitrogen Life Technologies (Carlsbad, CA). The RT, real-time PCR was carried out in the same well by the addition of 20 μL of PCR cocktail (pH regulator for PCR 2.5x less MgCI2, 6.6 mM MgCl2, 375 μM of each of dATP, dCTP, dCTP and dGTP, 375 nM of each of the forward primer and reverse primer, 125 nM of the probe, 4 units of RNase inhibitor, 1.25 units of PLATINUM® Taq, 5 units of MuLV reverse transcriptase, and ROX 2.5x dye) to 96-well plates containing 30 μL of a total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48 ° C. After a 10 minute incubation at 95 ° C to activate the PLATINUM® Taq, 40 cycles of a PCR protocol were carried out in two steps: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes (hybridization / extension). The compounds of the invention can be evaluated for their effect on the levels of human white mRNA by quantitative real-time PCR as described in the present invention, using a serial design of primer-probes to hybridize with the human GCGR. For example: Forward Launcher: TGCGGTTCCCCGTCTTC (incorporated in the present invention as SEQ ID NO: 21) Reverse Launcher: CTTGTAGTCTGTGTGGTGCATCTG (incorporated in the present invention as SEQ ID NO: 22) and the PCR probe: FAM-CATCTTCGTCCGCATCG-MGB (incorporated in the present invention as SEQ ID NO: 23), wherein FAM is the fluorescent dye and MGB is a dye non-fluorescent eliminator.

The compounds of the invention were evaluated for their effect on the levels of rat white mRNA by quantitative real-time PCR as described in other examples in the present invention, using a serial design of primer-probes to hybridize with rat GCGR . For example: Forward Launcher: CAGTGCCACCACAACCTAAGC (incorporated in the present invention as SEQ ID NO: 24) Reverse primer: AGTACTTGTCGAAAGTTCTGTTGCA (incorporated herein as SEQ ID NO: 25) and the PCR probe: FAM-TGCTGCCCCCACCTACTGAGCTG-TAMRA ( incorporated in the present invention as SEQ ID NO: 26), wherein FAM is the fluorescent dye and TAMRA is the eliminating dye. The compounds of the invention can be evaluated for their effect on monkey white mRNA levels by quantitative real-time PCR as described in other examples in the present invention, using a series of probe-primers designed to hybridize to monkey GCGR . For example: Forward Launcher: ACTGCACCCGCAACGC (incorporated in the present invention as SEQ ID NO: 27) Reverse Launcher: CACGGAGCTGGCCTTCAG (incorporated in the present invention as SEQ ID NO: 28) and the PCR probe: FAM-ATCCACGCGAACCTGTTTGTGTCCTT-TAMRA (incorporated in the present invention as SEQ ID NO: 29), wherein FAM is the fluorescent dye and TAMRA is the eliminating dye. Another example of a series of primer-probes designed to hybridize with monkey GCGR is: Forward Launcher: GAACCTTCGACAAGTATTCCTGCT (incorporated herein by reference as SEQ ID NO: 30) Reverse primer: GGGCAGGAGATGTTGGCC (incorporated herein by reference as SEQ ID NO. : 31) and the PCR probe: FAM-CCAGACACCCCCGCCAATAACA-TAMRA (incorporated in the present invention as SEQ ID NO: 32), wherein FAM is the fluorescent dye and TAMRA is the eliminating dye.

EXAMPLE 3 Design of "opening-dilated" antisense oligonucleotides directed to GCGR of human A series of the oligomeric compounds was designed to be directed to human GCGR (Genbank accession number: NM_000160.1, incorporated in the present invention as SEQ ID NO: 1), using varying sizes of "opening" deoxynucleotide and "wings" "2'-MOE. Each of the oligonucleotides is 20 nucleotides in length and has the sequence of nucleobases (GCACTTTGTGGTGCCAAGGC, incorporated in the present invention as SEQ ID NO: 2), and therefore directed to the same segment of SEQ ID NO: 1 (nucleobases 532 to 551). The compounds are shown in Table 3. The plain text indicates a deoxynucleotide, and nucleotides designated with bold, the underlined text are 2'-0- (2'-methylethyl) nucleotides. The internucleoside bonds are phosphorothioate throughout the structure, and all the cytosines are 5-methylcytosines. The "motif" of each compound is indicated in Table 3, indicative of the chemically distinct regions comprising the oligonucleotide.

TABLE 3 Antisense compounds that target GCGR from human The gapmer 5-10-5, ISIS 310457, was evaluated for its ability to reduce levels of white mRNA in vitro. HepG2 cells were treated with ISIS 310457 using methods such as those described in the present invention. ISIS 310457 was analyzed for its effect on human glucagon receptor mRNA levels by quantitative time PCR real and was found to reduce GCGR expression by approximately 96%.

EXAMPLE 4 Design of "dilated aperture" antisense oligonucleotides directed to rat GCGR A series of oligomeric compounds to be targeted to rat (Genbank accession number: M96674.1, incorporated in the present invention as SEQ ID NO: 3) were designed with varying sizes of the "opening" deoxynucleotide and the "wings" 2 '. -MOE Each of the oligonucleotides evaluated has the same nucleobase sequence (GCACTTTGTGGTGCCAAGGT, incorporated in the present invention as SEQ ID NO: 4), and is therefore directed to the same segment of SEQ ID NO: 3 (nucleobases 402 to 421). The segment directed by the rat oligonucleotides corresponds to the segment of human GCGR directed by ISIS 310457 (SEQ ID NO: 2). The compounds are shown in Table 4. The plain text indicates a deoxynucleotide, and nucleotides designated with bold, the underlined text are 2'-0- (2'-methylethyl) nucleotides. The internucleoside bonds are phosphorothioate throughout the structure, and all the cytosines are 5-methylcytosines. The "motif" of each compound, indicative of the chemically distinct regions comprising the oligonucleotide, is indicated in Table 4.

TABLE 4 Antisense compounds targeting rat GCGR EXAMPLE 5 Effects of antisense oligonucleotides directed to GCGR - rat study in vivo In accordance with the present invention, oligonucleotides designed to be targeted to rat GCGR were evaluated in vivo. Male Sprague Dawley rats, eight weeks old, were injected with 50, 25, 12.5, or 6.25 mg / kg of ISIS 356171, ISIS 357368, ISIS 357369, ISIS 357370, ISIS 357371, ISIS 357372, or ISIS 357373 2 times a the week for 3 weeks for a total of 6 doses. The animals injected with saline served as a control. Each of the oligonucleotides evaluated had the same nucleobase sequence (GCACTTTGTGGTACCAAGGT, incorporated in the present invention as SEQ ID NO: 4), and the chemistry and motif of each compound is described above. After the treatment period, the rats were sacrificed and the levels of the target nucleic acid in the liver were evaluated. RNA isolation and quantification of the level of expression of the target mRNA was carried out as described by other examples in the present invention using RIBOGREEN ™. The RNA from each treatment group was tested throughout the RNA from the treatment group with ISIS 356171. The results are presented in Tables 5a, 5b, 5c, 5d, 5e, and 5f as a percentage of the Control levels treated with saline.

TABLE 5a Reduction of target levels in the liver of rats treated with the 2-16-2 antisense oligonucleotides directed to GCGR TABLE 5b Reduction of white levels in the liver of rats treated with the antisense oligonucleotides 3-14-3 directed to GCGR TABLE 5c Reduction of white levels in the liver of rats treated with antisense oligonucleotides 4-12-4 directed to GCGR TABLE 5d Reduction of white levels in the liver of rats treated with antisense oligonucleotides 1-17-2 directed to GCGR TABLE 5e Reduction of target levels in the liver of rats treated with antisense oligonucleotides 1-18-1 directed to GCGR TABLE 5f Reduction of white levels in the liver of rats treated with deoxy uniform oligonucleotides directed to GCGR As shown in tables 5a, 5b, 5c, 5d, and 5e the "opening-dilated" antisense oligonucleotides were effective in reducing GCGR levels in vivo in a dose-dependent manner. Therefore, one embodiment of the present invention is a method for reducing the expression of GCGR levels in an animal that comprises administering an antisense oligo nucleotide directed to GCGR. In one embodiment, the antisense oligonucleotide comprises an opening of 16 deoxynucleotides flanked at both 5 'and 3' ends with two 2'-0- (2-methoxyethy!) Nucleotides. In addition, the concentration of the oligonucleotide in the kidney and in the liver was determined. Methods for determining the concentration of the oligonucleotide in tissues are known in the art (Geary et al., Anal. Biochem., 1999, 274, 241-248). Table 6 shows the concentration of the total oligonucleotide and the concentration of the full-length oligonucleotide (in μg / g) in the kidney or liver of animals treated with 25 mg / kg of the indicated oligonucleotide. The total oligonucleotide is the sum of all the metabolites of the oligonucleotides detected in the tissue.

TABLE 6 Concentration of the oligonucleotide in the liver and kidney As shown in Table 6, the concentrations of the "opening-dilated" oligonucleotides in the kidney were generally reduced with respect to those found for ISIS 356171 in these tissues. Taking them with the target reduction data shown in Table 5 where the power was maintained with ISIS 356371, ISIS 356372, and ISIS 356373 with respect to ISIS 356171, these data suggest that the oligos "open-dilated", particularly ISIS 356371 , ISIS 356372, and ISIS 356373 are, in essence, more effective than ISIS 356171 in reducing target levels in the liver.

EXAMPLE 6 Physiological effects of antisense oligonucleotides directed to GCGR - rat study in vivo To evaluate the physiological effects of the reduction of GCGR with the antisense compounds of the invention, plasma glucose levels were monitored throughout the study for each treatment group described in the previous example. Glucose levels were measured using routine chemical methods (eg, the YSI glucose analyzer, YSI Scientific, Yellow Springs, OH) before the start of treatment ("Pre-Sacred"), and during each week of the treatment period . The results are presented in table 7 in mg / dL for each treatment group.

TABLE 7 As shown in Table 7, animals treated with the antisense compounds directed to GCGR showed a tendency toward reduced glucose during the course of the study. Therefore, another embodiment of the present invention is a method for decreasing glucose levels in an animal that comprises administering to said animal an oligonucleotide. antisense that reduces the expression of GCGR levels. In preferred embodiments, the antisense oligonucleotide is an "apertured-dilated" oligonucleotide. In one embodiment, the antisense oligonucleotide comprises an opening of 16 deoxynucleotides flanked at both 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. In some embodiments, the antisense oligonucleotide comprises an opening of fourteen deoxynucleotides flanked at both 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides or an opening of 12 deoxynucleotides flanked at both 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. To examine the effects of reducing GCGR on other elements in the glucagon pathway, animals treated with the antisense compounds were also evaluated for glucagon levels and glucagon-1 (GLP-I) -like peptide levels at the end of the period of treatment. Plasma levels of glucagon and active GLP-1 were determined using commercially available equipment, instruments, or services (e.g., by radioimmunoassay, ELISA, and / or immunoassay by Luminex, and / or Lineo Research Inc. Bioanalytical Services, St. Louis, MO). The average glucagon levels (in ng / mL) and the GLP-1 (pM) levels for each treatment group are shown in Table 8.

TABLE 8 As shown in Table 8, the antisense reduction of GCGR causes increases in circulating glucagon levels as well as circulating GLP-1 levels, although trends towards reductions in plasma glucose levels were observed Table 7, no hypoglycemia was observed. Therefore, another embodiment of the present invention is a method for increasing the levels of GLP-I in a animal by administering an antisense oligonucleotide directed to GCGR. In one embodiment, the antisense oligonucleotide comprises an opening of 16 deoxynucleotides flanked at both 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. In some embodiments, the antisense oligonucleotide comprises an opening of fourteen deoxynucleotides flanked at both 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides or an opening of twelve deoxynucleotides flanked at both 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. In preferred embodiments, the antisense oligonucleotide is an "apertured-dilated" oligonucleotide. In preferred embodiments, the antisense oligonucleotide comprises ISIS 357371, ISIS 357372, or ISIS 357373.

EXAMPLE 7 Effect of antisense oligonucleotides directed to GCGR - in vivo study in cynomolgus monkeys To assess alterations in tissue distribution, potency, or therapeutic index caused by modification of the antisense oligonucleotide motif in a primate, cynomolgus monkeys were injected with ISIS 310457 (motif 5-10-5) or ISIS 325568 (motif 2-16). -2) at a dose of 3, 10, or 20 mg / kg per week. These antisense compounds show 100% complementarity with the GCGR monkey blank sequence. Animals injected with saline alone served as controls. The duration of the The study was 7 weeks, and the animals were dosed three times during the first week, followed by dosing once a week for 6 weeks. Each treatment group was comprised of 5 animals. A group treated with 20 mg / kg of ISIS 310457 and a group treated with 20 mg / kg of ISIS 325568 were recovered for three weeks after cessation of dosing before sacrifice ("recovery with 20 mg / kg"). Other treatment groups were sacrificed at the end of the study. Liver tissues were collected to evaluate target reduction. RNA isolation and quantification of the level of expression of the target mRNA was carried out as described by other examples in the present invention using RIBOGREEN ™. The results are presented in Table 9 as a percentage of the control levels treated with saline.

TABLE 9 Reduction of liver white levels of monkeys treated with antisense oligonucleotides directed to GCGR As shown in Table 9, treatment with ISIS 310457 and 325568 causes decreases in GCGR levels at all doses evaluated, and the reduction in target levels was even observed in the recovery groups with 20 mg / kg. ISIS 325568 caused a greater reduction than ISIS 310457 at doses of 3 mg / kg. Therefore, one embodiment of the present invention is a method for reducing the expression of GCGR levels in an animal comprising the administration of an antisense oligonucleotide directed to GCGR. In preferred embodiments, the antisense oligonucleotide is an "apertured-dilated" oligonucleotide. In one embodiment, the antisense oligonucleotide comprises an opening of sixteen deoxynucleotides flanked at both 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. In some embodiments, the antisense oligonucleotide comprises an opening of fourteen deoxynucleotides flanked at both 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides or an opening of twelve deoxynucleotides flanked at both 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. In one embodiment, the antisense oligonucleotide comprises ISIS 325568. In addition, the oligonucleotide concentrations in kidney and liver were determined. Methods for determining the concentration of the oligonucleotide in tissues are known in the art (Geary et al., Anal Biochem, 1999, 274, 241-248). Table 10 shows the total concentration of the oligonucleotide and the concentration of the full-length oligonucleotide (in μg / g) in the kidney or liver of animals treated with the indicated oligonucleotide.

TABLE 10 Oligonucleotide concentration in liver and kidney ro As shown in Table 10, the renal concentration of oligonucleotide motif 5-10-5 ISIS 310457 is higher than that measured for oligonucleotide motif 2-16-2 ISIS 325568 at all concentrations tested. Taking them with the blank reduction data in Table 9 for the oligonucleotide motif 2-16-2, these data suggest that the "gap-widened" oligonucleotide is more potent than the corresponding oligonucleotide motif 5-10-5, providing a decrease stronger levels of white mRNA in the liver without improved oligonucleotide accumulation.

EXAMPLE 8 Physiological effects of antisense oligonucleotides directed to GCGR - in vivo study in cynomolgus monkeys To examine the effects of reducing GCGR on other elements in the glucagon pathway, animals treated with the antisense compounds as described in Example 7 were also evaluated for glucagon levels and glucagon-1-like peptide levels (GLP -1) during each week of treatment. The recovery groups were evaluated for three additional weeks after cessation of dosing. The monkeys were anesthetized before collecting the blood to avoid artifacts due to stress. The active plasma glucagon and GLP-1 levels were determined using commercially available equipment, instruments, or services (eg by radioimmunoassay, ELISA, and / or immunoassay by Luminex, and / or Lineo Research Inc. Bioanalytical Services, St. Louis, MO). The average glucagon levels (in ng / mL) and the GLP-1 (pM) levels for each treatment group are shown in Table 11.

TABLE 11 Effects of GCGR antisense inhibition on glucagon and GLP-1 levels in cvnomolgus monkeys ^ 1 Another embodiment of the present invention is a method for increasing the levels of GLP-1 in an animal by administering an antisense oligonucleotide directed to GCGR. In preferred embodiments, the antisense oligonucleotide is an apertured-dilated oligonucleotide. In one embodiment, the antisense oligonucleotide comprises an aperture deoxynucleotide flanked at both 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. In some embodiments, the antisense oligonucleotide comprises a 14 opening deoxynucleotides flanked at both 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides or a 12 opening deoxynucleotides flanked at both 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. In preferred embodiments, the antisense oligonucleotide is ISIS 325568. In another embodiment, the antisense oligonucleotide comprises ISIS 325568.

Claims (63)

1. NOVELTY OF THE INVENTION CLAIMS 1. An antisense oligonucleotide of 20 nucleobases in length directed towards a nucleic acid molecule encoding GCGR and comprising at least a portion of 8 nucleobases of SEQ ID NO: 2 or 4 wherein the oligonucleotide comprises a deoxynucleotide region of 12, 13, 15, 16, 17, or 18 nucleobases in length which is flanked at their ends towards 5 'and 3' with 1 to 42'-0- (2-methoxyethyl) nucleotides and wherein the oligonucleotide specifically hybridizes with and reduces the expression of GCGR.
2. 2. The antisense oligonucleotide according to claim 1, further characterized in that at least one intemucleoside bond is a phosphorothioate bond.
3. 3. The antisense oligonucleotide according to claim 1, further characterized in that at least one cytosine is a 5-methylcytosine.
4. 4. The antisense oligonucleotide according to claim 1, further characterized in that it has the nucleobase sequence of SEQ ID NO: 4.
5. 5. The antisense oligonucleotide according to claim 4, further characterized by a flanked 16 deoxynucleotide region. at its 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides.
6. 6. The antisense oligonucleotide according to claim 5, further characterized in that at least one intemucleoside bond is a phosphorothioate linkage.
7. 7. The antisense oligonucleotide according to claim 5, further characterized in that at least one cytosine is a 5-methylcytosine.
8. 8. The antisense oligonucleotide according to claim 4, further characterized by a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide.
9. 9. The antisense oligonucleotide according to claim 8, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage.
10. 10. The antisense oligonucleotide according to claim 8, further characterized in that at least one cytosine is a 5-methylcytosine.
11. 11. The antisense oligonucleotide according to claim 4, further characterized by a region of 17 deoxynucleotides flanked at their 5 'and 3"ends with one or two 2'-0- (2-methoxyethyl) nucleotides. antisense oligonucleotide according to claim 11, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 13. - The antisense oligonucleotide according to claim 11, further characterized in that at least one cytosine is a 5-methylcytosine. 14. The antisense oligonucleotide according to claim 4, further characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. 15. The antisense oligonucleotide according to claim 14, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 16. The antisense oligonucleotide according to claim 14, further characterized in that at least one cytosine is a 5-methylcytosine. 17. The antisense oligonucleotide according to claim 4, further characterized by a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides. 18. The antisense oligonucleotide according to claim 17, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 19. The antisense oligonucleotide according to claim 17, further characterized in that at least one cytosine is a 5-methylcytosine. 20. - The antisense oligonucleotide according to claim 1, further characterized in that it has the nucleobase sequence of SEQ ID NO: 2. 21. The antisense oligonucleotide according to claim 20, further characterized by a region of 16 deoxynucleotides flanked in their 5 'and 3' ends with two 2'-0- (2-methoxyethyl) nucleotides. 22. The antisense oligonucleotide according to claim 21, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 23. The antisense oligonucleotide according to claim 21, further characterized in that at least one cytosine is a 5-methylcytosine. 24. The antisense oligonucleotide according to claim 20, further characterized by a region of 18 deoxynucleotides flanked at their 5 'and 3' ends with a 2'-0- (2-methoxyethyl) nucleotide. 25. The antisense oligonucleotide according to claim 24, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 26. The antisense oligonucleotide according to claim 24, further characterized in that at least one cytosine is a 5-methylcytosine. 27. The antisense oligonucleotide according to claim 20, further characterized by a region of 17 deoxynucleotides flanked at their 5 'and 3' ends with one or two 2'-0- (2-methoxyethyl) nucleotides. 28. The antisense oligonucleotide according to claim 27, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 29. The antisense oligonucleotide according to claim 27, further characterized in that at least one cytosine is a 5-methylcytosine. 30. The antisense oligonucleotide according to claim 20, further characterized by a region of 12 deoxynucleotides flanked at their 5 'and 3' ends with four 2'-0- (2-methoxyethyl) nucleotides. 31. The antisense oligonucleotide according to claim 30, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 32. The antisense oligonucleotide according to claim 30, further characterized in that at least one cytosine is a 5-methylcytosine. 33. The antisense oligonucleotide according to claim 20, further characterized by a region of 14 deoxynucleotides flanked at their 5 'and 3' ends with three 2'-0- (2-methoxyethyl) nucleotides. 34. The antisense oligonucleotide according to claim 33, further characterized in that at least one internucleoside linkage is a phosphorothioate linkage. 35. The antisense oligonucleotide according to claim 33, further characterized in that at least one cytosine is a 5-methylcytosine. 36.- A pharmaceutical composition comprising the antisense oligonucleotide according to claim 1 and optionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient. 37.- A method for reducing the expression of GCGR in tissues or cells comprising contacting said cells or tissues with the pharmaceutical composition according to claim 36. 38.- The use of a pharmaceutical composition of claim 36, for the manufacture of a drug useful for lowering blood glucose levels in an animal. 39.- The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for increasing the levels of GLP-I in an animal. 40. - The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for improving insulin sensitivity in an animal. 41.- The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for lowering triglycerides in blood in an animal. 42. The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for lowering blood cholesterol levels in an animal. 43.- The use of a pharmaceutical composition of the claim 36, for the manufacture of a medicament useful for treating an animal having a disease or condition associated with the expression of the glucagon receptor. 44. The use as claimed in claim 43, wherein the disease or condition is a disease or metabolic condition. 45. The use as claimed in claim 43, wherein the disease or condition is diabetes, hyperglycemia, obesity, primary hypergiucagonemia, insulin deficiency, or insulin resistance. 46.- The use as claimed in claim 43, wherein the disease or condition is Type 2 diabetes. 47.- The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for preventing or delay the onset of elevated blood glucose levels in an animal. 48. - The use of a pharmaceutical composition of claim 36, for the manufacture of a medicament useful for preserving the function of the beta cell in an animal. 49.- An antisense oligonucleotide of 20 nucleobases in length, having the sequence of SEQ ID NO: 2, and characterized by a region of 16 deoxynucleotides flanked at their 5 'and 3' ends with two 2'- 0- (2-methoxyethyl) nucleotides wherein each internucleoside link is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. 50.- A pharmaceutical composition comprising the antisense oligonucleotide according to claim 49 and optionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient. 51.- A method for reducing the expression of GCGR in tissues or cells comprising contacting said cells or tissues with the pharmaceutical composition according to claim 50. 52.- The use of a pharmaceutical composition of claim 50, for the manufacture of a drug useful for lowering blood glucose levels in an animal. 53. The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for increasing the levels of GLP-I in an animal. 54. - The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for improving insulin sensitivity in an animal. 55.- The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for lowering triglycerides in blood in an animal. 56.- The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for lowering blood cholesterol levels in an animal. 57.- The use of a pharmaceutical composition of the claim 50, for the manufacture of a medicament useful for treating an animal having a disease or condition associated with the expression of the glucagon receptor. 58.- The use as claimed in claim 57, wherein the disease or condition is a disease or metabolic condition. 59. The use as claimed in claim 57, wherein the disease or condition is diabetes, hyperglycemia, obesity, primary hypergiucagonemia, insulin deficiency, or insulin resistance. 60.- The use as claimed in claim 57, wherein the disease or condition is Type 2 diabetes. 61.- The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for preventing or delay the onset of elevated blood glucose levels in an animal. 62. The use of a pharmaceutical composition of claim 50, for the manufacture of a medicament useful for preserving the function of the beta cell in an animal. 63.- The use of a compound of claim 1, in combination with an anti-diabetic agent selected from the group comprising PPAR agonists including PPAR-gamma agonists, dual-PPAR or pan-PPAR, dipeptidyl peptidase inhibitors (IV ), GLP-1 analogs, insulin and insulin analogues, insulin secretagogues, SGLT2 inhibitors, human amylin analogues including pramlintide, glucokinase activators, biguanides and alpha-glucosidase inhibitors to achieve an additive therapeutic effect, for the manufacture of a medicament useful for treating an animal that has a disease or metabolic condition.