LU509290B1 - A human inducible pluripotent stem cell line with Cas9 gene, construction method, characterization method and application - Google Patents

Abstract

he present invention belongs to the field of pluripotent stem cells, and specifically relates to a human-origin inducible pluripotent stem cell line with Cas9 gene, a method for constructing it, a method for characterizing it, and an application. The present patent utilizes a gene editing method to integrate the Cas9 gene into the genome of a human source iPS cell, thereby constructing a human source iPS cell line (iPS-Cas9) that can be subjected to gene editing. Based on this iPS-Cas9 cell line, any type of mutated iPS cells can be constructed, which can then be induced to differentiate into specific target cells, establish disease cell models, and carry out research on disease pathogenesis and drug screening, which has great clinical application value.

Description

Là nnn

A human inducible pluripotent stem cell line with Cas9 gene, LU509290 construction method, characterization method and application

Technical field

The present invention belongs to the field of pluripotent stem cells, and specifically relates to a human inducible pluripotent stem cell line with Cas9 gene, a method of constructing it, a method of characterizing it, and an application.

Technical background

In 2006, Yamanaka et al. introduced four reprogramming factors (Oct4, KIf4, Sox2, and c-Myc) into mouse skin fibroblasts for the first time via retrovirus, resulting in totipotent stem cells similar to embryonic stem cells (ES), which were named "inducible pluripotent stem cells" (iPS). and named them "inducible pluripotent stem cells" (iPS). Subsequently, Takahashi et al. and Yu et al. reprogrammed human fibroblasts into iPS cells, making the possibility of using iPS cells in the clinic a step forward. iPS cells have the same pluripotency as ES cells, and theoretically can be induced to differentiate into a variety of cell types, while at the same time completely circumventing the immune rejection and ethical problems faced by ES cells, and have great clinical application value. iPS cells can be used in the clinic for a wide range of applications. iPS cells are mainly used for cell differentiation and transplantation, and can provide in vitro disease models to study the mechanism of disease formation, screen new drugs and open up new therapeutic methods, so how to make iPS cells have a greater application value is the direction of the current research.

Content of the invention

In a first aspect of the present invention, a human inducible pluripotent stem cell line with a Cas9 gene is provided. The CRISPR/Cas9 technology is currently the most valuable gene editing technology, which can utilize a specific sgRNA to guide the Cas9 enzyme to cleave the target gene, resulting in a double-stranded break in DNA. Thereby, gene editing is performed in a specific target gene sequence region using gene homologous recombination or non-homologous recombination to introduce a mutation, correct a mutation or insert a specific exogenous gene sequence. The 1PS-Cas9 cell line provided by the present invention can subsequently construct any type of gene mutated iPS cells, which can then be induced to differentiate into specific target cells, establish a disease cell model, and carry out research on disease pathogenesis and drug screening, etc., which has great clinical application value.

A second aspect of the present invention provides a method of constructing a human inducible pluripotent stem cell line with a Cas9 gene as described above, comprising the steps of: (1) The gRNA sequence that can target the AAV S1 safe site region of human iPS cells was cloned into a vector with the gRNA cloning site and Cas9 enzyme gene sequence to obtain the cloning vector; (2) Co-transfect the cloning vector obtained in step (1) and the vector with the drug screening marker and the gene sequence of Cas9 enzyme into human iPS cells; (3) Human inducible pluripotent stem cells with the Cas9 gene were obtained by screening with an additional drug;

The drug screening marker in step (2) corresponds to the drug added in step (3).

Preferably, in step (1), the gRNA sequences capable of targeting the AAVSI1 safe site

Là noon region of human iPS cells are: 5-CACCGGTCCCCTCCACCCCACAGTG-3' and LU509290 3'-CCAGGGGAGGTGGGTGTCACCAAA-S".

Preferably, in step (1), the vector with gRNA cloning site and Cas9 enzyme gene sequence is digested with Bbsl, and then ligated with gRNA sequence line T4 DNA ligase with BbsI digestion site and can target the AAVS1 safety site region of the human iPS cells, and the ligated product is purified to be the cloning vector.

Preferably, in step (2), the cloning vector obtained in step (1) and the vector with the drug screening marker and the gene sequence of the Cas9 enzyme are co-transfected into human iPS cells by means of a cell electrotransfer apparatus.

Preferably, said drug screening marker in step (2) is a puromycin drug screening marker and the drug added in step (3) is puromycin.

Preferably, in step (3), the iPS cells obtained in step (2) are cultured with medium with

Puromycin, and the iPS cells screened to be with Puromycin resistance are the human-derived inducible pluripotent stem cells with Cas9 gene.

Based on the gene editing approach, a gRNA sequence targeting the AAVS1 security site in the first intronic region of chromosome 19 of human cells with Bbsl cleavage site was cloned into a vector with the gRNA cloning site and the gene sequence of Cas9 enzyme, and then the cloned vector and the vector with the drug screening markers and the gene sequence of Cas9 enzyme were cotransfected into the human iPS cells by a cellular electrotransfer apparatus The cloned vector and the vector with the drug screening marker and Cas9 enzyme gene sequence were then co-transfected into human iPS cells by cell electrotransfer. The gene with the

Puromycin drug screening marker and Cas9 enzyme was integrated into the safe site region of iPS cells by homologous recombination. The iPS cell lines with Cas9 gene were then screened by adding Puromycin.

In a third aspect of the present invention, there is provided a method of characterizing a human inducible pluripotent stem cell line with a Cas9 gene as described above, comprising one or more of the following steps: (a) Cells were subjected to Sanger sequencing to detect the presence of the Cas9 gene in them; (b) Cells were expanded and conserved, followed by mRNA extraction and PCR to identify whether GADPH and Cas9 genes are normally expressed; (c) Cells were expanded and conserved, followed by total protein extraction, and then protein blotting assays were performed to characterize whether GADPH and Cas9 proteins were normally expressed.

In a fourth aspect of the present invention, human-derived inducible pluripotent stem cell lines with Cas9 genes as described above are provided for use in the construction of applications for establishing cellular models of disease.

The beneficial effects of the present invention are as follows: the present patent utilizes gene editing to integrate the Cas9 gene into the genome of human iPS cells, thereby constructing a human iPS cell line (iPS-Cas9) that can be subjected to gene editing. Based on this iPS-Cas9 cell line, any type of gene-mutated iPS cells can be constructed subsequently, and then induced to differentiate into specific target cells, establish a disease cell model, and carry out research on disease pathogenesis and drug screening, etc., which is of great clinical application value.

Illustrated description

In order to more clearly illustrate the technical solutions in the embodiments or prior art of LU509290 the present invention, the following will be a brief introduction to the embodiments or prior art description of the need to use the accompanying drawings, it is obvious that the following description of the accompanying drawings is only some of the embodiments of the present invention, for the people of ordinary skill in the field, in the premise of no creative labor, according to the drawings of these drawings to obtain other drawings still belong to the scope of the present invention, the drawings are not the same as the other drawings. the scope of the present invention.

Figure 1 shows the px458 2A GFP_sgRNA TIAI plasmid map;

Figure 2 shows the pAAVS1-PDi-CRISPRn plasmid mapping;

Figure 3 shows a schematic diagram of the integration of the Cas9 gene into the AAVS1 safe site region using CRISPR/Cas9 gene editing;

Figure 4 shows the flow chart of Puromycin drug screen iPS-Cas9 cells;

Figure 5 shows the Sanger sequencing results of iPS-Cas9 cells;

Figure 6 shows reverse transcription PCR to identify Cas9 gene expression in iPS-Cas9 cells;

Figure 7 shows protein blotting to identify Cas9 protein expression in iPS-Cas9 cells;

Figure 8 shows the clonal mass of iPS-Cas9 cells observed by light microscopy:

Figure 9 shows immunofluorescence identification of pluripotency marker protein expression in iPS-Cas9 cells;

Figure 10 shows the immunofluorescence identification of the expression of different germ layer marker proteins after embryoid body formation in iPS-Cas9 cells

Figure 11 shows the chromosomal karyotype analysis of iPS-Cas9 cells.

Concrete implementation mode

In order to make the objects, technical solutions and advantages of the present invention clearer, the invention will be described in further detail in the following in connection with the accompanying drawings.

I. Inducible Pluripotent Stem Cell (iPS) Culture of Human Origin

The clonal mass of human iPS was inoculated on 1% Matrigel incubation-treated 6-well plates and cultured in a carbon dioxide incubator at 37 °C. The growth status was observed daily under an inverted microscope, and the fresh E8 medium was replaced in full every day, and differentiated cells were found to be picked up in time, and the cells were passaged at intervals of 6 days, with a passaging dilution of 6:1. In order to minimize damage to the iPS cells, the cells were passaged with To minimize damage to the iPS cells, the cells were treated with 0.25% EDTA for 3-5 min, and when the edge of the clone started to roll up and detached from the bottom of the Petri dish, the cells were washed with deionized PBS for 1 time, and then the cells were gently blown with 1 mL of E8 medium (not more than 6 times), and then the cells were collected and inoculated into new 6-well plates pretreated with 1% Matrigel for further cultivation. On day 1 after each passaging, 10 uM Y-27632 needs to be added to the medium.

II. Construction of cloning vectors

Addgene purchased the px458 2A GFP sgRNA TIA1 (Item No. 106097) vector, which carries a gRNA cloning site and Cas9 enzyme gene sequence as shown in Figure 1.

The pAAVS1-PD1-CRISPRn (Item No. 73500) vector was purchased, which carries a

Puromycin drug screening marker and a Cas9 enzyme gene sequence that contains sequence

LU A homology arms at both ends of the AAVS1 security site region of the first intron on LU509290 chromosome 19 of human cells, as shown in Figure 2.

Two complementary oligonucleotide sequences of gRNA with Bbsl cleavage site were synthesized: 5'-CACCGGTCCCCTCCACCCCACAGTG-3' and 3'-CCAGGGGGAGGTGGGGTGTCACCAAA-S". After synthesized single-stranded oligonucleotide sequences were dissolved by adding a certain volume of deionization, and the final concentration was 100 u M. Then 2 LL of each was added to 46 u L of annealing buffer (10 mM Tris PH=8.0, 50 mM NaCl, 1 mM EDTA), and the sequences were mixed thoroughly and then incubated at 95 °C for 5 min, and then taken out and allowed to drop to room temperature automatically to obtain the double-stranded oligonucleotide sequences with

Bbsl 5 pL of double-stranded gRNA with Bbsl cleavage site was taken and diluted 1:100 with deionized water. The px458 ZA GFP sgRNA TIA1 vector was digested with Bbsl, and the

DNA concentration was purified and measured after digestion. 50 ng of the BbsI digested px458 2A GFP sgeRNA TIAI vector was ligated with 1 pL of the double-stranded gRNA at 1:100 dilution by T4 DNA ligase for 10 min, and the ligated product was purified, then the cloned vector was obtained. The cloning vector was purified.

III. Cellular transduction

Purchase the Lonza Electrotransferometer (Model: Nucleofector2B) with the Stem Cell

Electrotransfer Kit (Item: VPH-5012), and prepare the electrotransfer solution according to the instructions. That is, take 18 1 L of Supplement 1 and 82 u L of Solution 1 and mix well, add 4 ug of vectors (2 ug of cloning vector px458 2A GFP_sgRNA TIA1 and 2 pg of vector pAAVS1-PDi-CRISPRn), mix well and leave it at room temperature for 20 minutes. At this time, iPS single-cell suspensions were prepared, and after cell counting, 1.2-2 X 106 cells were obtained by centrifugation at 1500 rpm for 5 min. The iPS cells were resuspended with the above mix, mixed well and transferred to an electrotransfer cup. Place the electrotransfer cup into the electrotransfer tank of the Lonza Electrotransferometer, select the B-016 program after powering on the machine, and click Start to start the electrotransfer. After completion of the electrorotation, the cells were resuspended with E8 medium with 10 uM Y-27632 and transferred to a new dish for further cultivation. As shown in Figure 3, the gene editing will generate a double-strand break structure (DSB) in the AAVS1 safe site region, and then combined with gene homologous recombination, the integration of Puromycin drug screen marker and Cas9 gene into the genome of human iPS cells can be realized.

IV. Puromycin Screening

As shown in Figure 4, 24 hours after cell electrotransformation was counted as day 0, at which time the cell supermatant was aspirated. On days 0-2, the cells were cultured in E8 medium with 0.4 pg/mL Puromycin, and the medium was changed daily. On days 2-3,

Puromycin was withdrawn and E8 medium was replaced to resume culture for 1 day. On days 3-5, incubate with E8 medium with 0.6 1 g/mL Puromycin, and change the solution daily. On days 5-6, Puromycin was withdrawn and E8 medium was replaced to continue the recovery culture for 1 day. On days 6-8, the culture was incubated with E8 medium with 0.9 pg/mL

Puromycin, and the solution was changed daily. On days 8-9, Puromycin was withdrawn and

E8 medium was replaced to continue the recovery culture for 1 day. On day 9, the surviving iPS cells were digested, blown apart into single cells, and then passaged into a 10 cm diameter petri dish. After 2-3 days of culture, 20 clonal clusters were picked under an ordinary light microscope, transferred to 24-well plates to continue culture, and numbered for each clonal

ZA cluster. After 6-8 days of further incubation, the cells corresponding to each number were |U509290 digested and transferred in duplicate to a new 24-well plate for further incubation. After the cells reached 60% healing, one copy of the cells was used to extract the genomic DNA of the cells using Thermo's Genome Extraction Kit, and then the samples were sent to the company for Sanger sequencing analysis, and the other copy of the cells continued to be cultured. As shown in Figure 5, the results showed that the iPS cells after Puromycin drug screening had

Cas9 gene, and after the sequencing results came out, the positive clone cells were selected for expansion culture and preservation.

V. Identification of iPS-Cas9 cells 1. Reverse transcription PCR assay

Total RNA from each group of cells was extracted using Trizol (Invertek, USA) and OD was measured to ensure that the OD 260 /OD280 values of the extracted RNA from each group were between 1.8 and 2.1 to ensure its purity. Then the total RNA was reverse transcribed into cDNA using a reverse transcription kit (Toyo Spun, Japan), and the reaction system and reaction program were referred to the product manual. cDNA was used for reverse transcription

PCR, and the primer sequence was used:

GADPH-F: CATGGCACCGTCAAGGCT

GADPH-R: GACGAACATGGGGGGCATCAG

Cas9-F: AGGAAATCGGCAAGGCTACC

Cas9-R: ACCACCAGCACAGAATAGGC

The reaction system is described in the SYBR kit (Baoji-Japan). After transient separation, the reaction was pre-denatured at 94 °C for 2 min, and the reaction was carried out for 35 cycles (94 °C, 30 s; 60 °C, 30 s; 72 °C, 30 5). 6 UL of the reaction product was mixed with 2 uL of 6

X Loading Buffer, and then electrophoresed on a 2% agarose gel and photographed.

As shown in Figure 6, the identification results showed that iPS-Cas9 cells could express

GADPH and Cas9 genes normally, and the negative control iPS cells could only express

GADPH genes and could not express Cas9 genes. 2. Protein blotting

After the cultured groups of cells reached healing, the supernatant was aspirated off and washed once with PBS. Place on ice, add cell lysis solution (RIPA) lysis 30 minutes, collect the lysate, 4 °C freezing centrifugation (16000 rpm, 15 minutes) to collect the supernatant, BCA quantitative kit to determine the protein concentration, -20 °C refrigerator storage. The samples were thawed and mixed with bromophenolan (4:1) before running the gel, and

B-mercaptoethanol was added and boiled to make the samples. In each group, 50 pg of protein samples were taken with a micro syringe for 12% sodium dodecyl sulfate gel electrophoresis, and after electrophoresis, the samples were electrotransferred (stacked in the order of "filter paper-PVDF membrane-gel-filter paper", with a constant current of 180 mA and a voltage of 120 V, and wet rotated for 2 hours), and then the protein samples were transferred to the PDVF membrane. Then the PDVF membrane was closed with 5% skimmed milk powder at 4 °C for 1 hour, followed by the addition of primary antibodies: rabbit monoclonal Cas9 antibody (1:5000) and murine monoclonal GADPH antibody (1:1000), and incubated overnight at 4 °C. The membrane was then washed five times with TBST. Then TBST was washed 5 times for 10 minutes each time, followed by the addition of secondary antibodies: HRP-labeled goat anti-rabbit IgG antibody (1:5000) and HRP-labeled goat anti-mouse IgG antibody (1:5000) and incubation at room temperature for 2 hours. After that, TBST was washed 5 times for 10 nnn nnn minutes each time, ECL luminescent solution was added and then exposed and photographed [U509290 under protein fluorescence imaging system.

As shown in Figure 7, iPS-Cas9 cells could express GADPH and Cas9 proteins normally, and negative control iPS cells could only express GADPH proteins and not Cas9 proteins.

The results of the above experiments showed that human iPS cell lines with Cas9 gene were successfully constructed.

VI. characterization of pluripotency of iPS-Cas9 cells 1. Ordinary light microscope observation of the growth state of iPS-Cas9 cells, as shown in Figure 8, showed that iPS-Cas9 cells still maintained clonal mass-like growth. 2. Cellular immunofluorescence was used to identify the expression of pluripotency proteins OCT4 and SOX2, as shown in Fig. 9, which showed that both pluripotency proteins were positively expressed, and the sites of expression overlapped with the nucleus location. 3. Analyze the differentiation potential of iPS-Cas9 cells by using embryoid body formation experiments, and induce iPS-Cas9 cells to differentiate into triploblasts by using embryoid body formation experiments combined with differentiation induction.

The specific procedure of embryoid body formation experiments was as follows: each embryoid body was formed by 50 uL E8 medium containing 5000 iPS-Cas9 cells cultured by suspension droplet method for 3 days. The embryoid bodies were then resuspended in 50% E8 medium and 50% differentiation medium containing DMEM-F12, 20% fetal bovine serum, 1% penicillin/streptomycin, 1 X non-essential amino acids (NEAA), 2 mM levoglutarimide, and 0.1 mM B -sulfoethanol. After resuspension, embryoid bodies were transferred to non-adherent culture plates and cultured for 2 days. Then, the embryoid bodies were transferred to

Matrigel-incubated 24-well culture plates for 14 days. The cells were then fixed with 4% paraformaldehyde for subsequent cellular immunofluorescence staining analysis.

Immunofluorescence staining was performed as follows: after the cultured cells reached 40% healing, the supematant was aspirated and washed once with PBS. Add 4% paraformaldehyde and incubate for 15 minutes at room temperature, then wash with PBS three times, each time for 5 minutes, and then add PBS containing 0.1% Triton-X 100 and 3% bovine serum albumin to permeabilize the membrane for 1 hour at room temperature. Primary antibodies were then added directly without washing: rabbit anti-OCT4 antibody (1:500), murine anti-SOX2 antibody (1:200), murine anti-NESTIN antibody (1:200), murine anti-SMA antibody (1:200), and murine anti-AFP antibody (1:500), and incubated at 4 ° C overnight. Then PBS was washed 3 times, each time for 5 minutes, followed by the addition of secondary antibodies:

Cy3-labeled goat anti-rabbit IgG antibody (1:1000), Cy3-labeled goat anti-mouse IgG antibody (1:1000), and FITC goat anti-mouse IgG antibody (1:1000) incubated at room temperature for 2 hours. After that, PBS was washed 3 times, each time for 5 minutes, followed by the addition of

DAPI staining solution incubated at room temperature for 15 minutes away from light. Finally, the sample was washed 3 times with PBS for 5 minutes each time and photographed directly under an inverted fluorescence microscope.

As shown in Figure 10, cellular immunofluorescence results showed that differentiated 1PS-Cas9 cells positively expressed the ectodermal marker protein NESTIN, the mesodermal marker protein SMA, and the endodermal marker protein AFP. 4. To characterize the stability of the chromosome structure of iPS-Cas9 cells, they were subjected to chromosomal karyotyping.

The specific experimental procedure for chromosome karyotype analysis was as follows:

nnn. nnn chromosome karyotype analysis was utilized to verify the chromosome stability of iPS-Cas9 LU509290 cells. Cells were treated with 10 pg/mL of colchicine at 37 °C for 60 min. Trypsin treatment was then made to obtain individual cells and cells were treated with 0.075 M hypotonic KCl.

Then they were fixed with Carnoy's fixative (containing 3:1 methanol and acetic acid). Finally, chromosomes at mid mitosis and G-banding were imaged and analyzed.

As shown in Figure 11, the cell has a normal karyotype (46, XY).

The above experimental results can show that the integration of Cas9 gene into the genome of human iPS cells does not affect the pluripotency properties of iPS cells.

The above disclosure is only a better embodiment of the present invention, of course, can not be used to limit the scope of the rights of the present invention, so in accordance with the claims of the present invention made by the equivalent changes, is still covered by the scope of the present invention.

Claims (9)

BB Claims LU509290

1. A human inducible pluripotent stem cell line with Cas9 gene.

2. A method of constructing a human inducible pluripotent stem cell line with Cas9 gene as claimed in claim 1, characterized in that it comprises the steps of: (1) The gRNA sequence that can target the AAVS1 safe site region of human iPS cells was cloned into a vector with the gRNA cloning site and Cas9 enzyme gene sequence to obtain the cloning vector; (2) Co-transfect the cloning vector obtained in step (1) and the vector with the drug screening marker and gene sequence of Cas9 enzyme into human iPS cells; (3) Human inducible pluripotent stem cells with the Cas9 gene were obtained by screening with an additional drug; The drug screening marker in step (2) corresponds to the drug added in step (3).

3. The method of constructing a human inducible pluripotent stem cell line with Cas9 gene according to claim 2, characterized in that: in step (1), the gRNA sequences capable of targeting the AAVS1 safe site region of the human iPS cell are: S'-CACCGGTCCCCTCCACCCCACAGTG-3' and 3'- CCAGGGGGAGGTGGGGTGTCACCAAA-S'.

4. A method for constructing a human inducible pluripotent stem cell line with Cas9 gene according to claim 2, characterized in that: in step (1), the vector with gRNA cloning site and Cas9 enzyme gene sequence is digested with Bbsl, and then ligated with T4 DNA ligase of the line with gRNA sequence of the Bbsl digesting site, and the ligated product is purified to be the cloning vector.

5. The method of constructing a human inducible pluripotent stem cell line with Cas9 gene according to claim 2, characterized in that: in step (2), the cloning vector obtained in step (1) and the vector with the drug screening marker and the gene sequence of Cas9 enzyme are co-transfected into the human iPS cells by means of a cell electrotransfer apparatus.

6. A method of constructing a human inducible pluripotent stem cell line with Cas9 gene according to claim 2, characterized in that: said drug screening marker in step (2) is a puromycin drug screening marker, and the drug added in step (3) is puromycin.

7. The method of constructing a human inducible pluripotent stem cell line with Cas9 gene according to claim 6, characterized in that: in step (3), the iPS cells obtained in step (2) are cultured with medium with Puromycin, and the iPS cells screened to be with Puromycin resistance are the human inducible pluripotent stem cells with Cas9 gene.

8. A method for characterizing a human inducible pluripotent stem cell line with a Cas9 gene as claimed in claim 1, characterized in that it comprises one or more of the following steps: (a) Cells were subjected to Sanger sequencing to detect the presence of the Cas9 gene in them; (b) Cells were expanded and conserved, followed by mRNA extraction and PCR to identify whether GADPH and Cas9 genes are normally expressed; (c) Cells were expanded and conserved, followed by total protein extraction, and

BL then protein blotting assays were performed to characterize whether GADPH and LUS09290 Cas9 proteins were normally expressed.

9. Application of a human inducible pluripotent stem cell line with Cas9 gene as claimed in claim 1 for use in the construction of an established disease cell model.