LU503463B1 - PCR amplification primer pair and application thereof - Google Patents

Abstract

The present invention belongs to the technical field of bacteria detection, specifically relates to a PCR amplification primer pair and an application thereof, and in particular, is applicable to detection of Bacillus sporothermodurans (BSTD). An forward primer of the PCR amplification primer pair includes a sequence shown as SEQIDNO:1, and a reverse primer includes a sequence shown as SEQIDNO:2. The PCR amplification primer pair is highly specific in detecting the BSTD, and may effectively perform specific amplification with the BSTD without showing a false positive result. In addition, a real-time fluorescent PCR amplification detection method based on the PCR amplification primer pair is simple in detection step and short in detection time; and the limit of detection for the BSTD may reach 2.8 CFU/mL, such that the detection method is high in sensitivity.

Description

PCR AMPLIFICATION PRIMER PAIR AND APPLICATION THEREOF

LU503463

Technical Field

The present invention belongs to the technical field of bacteria detection, specifically relates to a PCR amplification primer pair and an application thereof, and in particular, is applicable to detection of Bacillus sporothermodurans (BSTD).

Background

Bacillus is kind of bacilli or cocci that can form spores. The heat resistance of the bacillus varies with different types of bacteria. Some of the bacillus can even withstand high temperatures of 100°C and above. Generally, the bacillus that can withstand pasteurization temperature is called BSTD. The BSTD is a typical type of bacillus which is relatively heat-resistant, which is a kind of bacteria that have relatively-high heat resistance and produce endospore. The strain belongs to bacteria, Firmicutes, bacilli, Bacillales, Bacillaceae, Genus

Bacillus, BSTD species. The model strain number of the strain is M215 (DSMZ10599).

In 1985 and 1990, the BSTD is discovered in Ultraheattreated (UHT) milk in Germany.

Subsequent discoveries have been made in other European countries (such as, Belgium, France and Spain). The BSTD may survive or reproduce in some foods or environments. Some of the

BSTD do not obviously change the quality of the milk and do not have pathogenicity, which are easily neglected. Although the BSTD is not pathogenic and does not significantly reduce the quality of a product, the BSTD widely exists in the environments or foods, especially in dairy products, which can reflect the defects in a production process of the product and bring potential risks to food safety. Moreover, after the BSTD is ignored, it is likely to cause the whole line pollution of an enterprise, causing great economic losses to the enterprise, and the strain is difficult to remove after being polluted. In addition, some of the BSTD may also produce toxins and be pathogenic, bringing a greater risk to food safety. Therefore, enterprises, especially food enterprises, need to have comprehensive and in-depth understanding of the BSTD, so as to facilitate the enterprises to establish a more perfect microbiological control system.

Currently, there is no systematic method for testing the BSTD in China. Common detection methods include a plate cultivation method and a PCR identification method. The strain needs to be cultivated on a traditional solid plate for about 48 to 72h, and then is observed by naked eyes. However, the colony morphology of the strain on the plate is extremely inconspicuous and is very likely to be neglected through visual observation, causing the whole production line of the enterprise to be polluted. Current PCR identification usually uses bacterial universal

LU503463 primers 27F and 1492R, which are not strong in specificity, not high in accuracy and not high in sensitivity, such that a sequencing result may be a false positive result.

Therefore, a high-accuracy and strong-sensitivity method for detecting BSTD is necessary.

Summary

In order to solve the above problem, one of the objectives of the present invention provides a PCR amplification primer pair. The PCR amplification primer pair has strong specificity to BSTD. The PCR amplification primer pair may be used to perform qualitative and quantitative analysis on the BSTD by means of a PCR amplification detection method.

In order to achieve the above purpose, the following technical solution may be used.

An aspect of the present invention provides a PCR amplification primer pair. An forward primer includes a sequence shown as SEQIDNO:1, and a reverse primer includes a sequence shown as SEQIDNO:2.

Another aspect of the present invention provides a detection reagent. The detection reagent may include the PCR amplification primer pair.

Still another aspect of the present invention provides a detection kit. The detection kit may include the PCR amplification primer pair or the detection reagent.

Still another aspect of the present invention provides an application of the PCR amplification primer pair or the detection reagent or the detection kit in detection of BSTD.

Still another aspect of the present invention provides a PCR amplification detection method for Bacillus sporothermodurans. The method includes: mixing a sample to be detected and the PCR amplification primer pair for PCR amplification, so as to obtain a PCR amplification product, and analyzing the PCR amplification product, so as to determine whether the sample to be detected contains BSTD.

Still another aspect of the present invention provides a PCR amplification detection method for Bacillus sporothermodurans. The method includes: mixing a sample to be detected and the detection reagent for PCR amplification, and during PCR amplification, determining, according to a fluorescence signal, whether the sample to be detected contains BSTD.

The beneficial effects of the present invention at least include the following. (1) The PCR amplification primer pair provided in the present invention is highly specific in detecting the BSTD, and may effectively perform specific amplification with the BSTD without showing a false positive result.

(2) The real-time fluorescent PCR amplification detection method based on the PCR

LU503463 amplification primer pair is simple in detection step and short in detection time; and the limit of detection for the BSTD can reach 2.8 CFU/mL, such that the detection method is high in sensitivity.

Brief Description of the Drawings

Fig. 1 is a microscopic examination chart of BSTD B1 after activation.

Fig. 2 is a phylogenetic tree of BSTD B1.

Fig. 3 is an amplification curve of a PCR amplification reaction in Embodiment 3.

Fig. 4 is a melting curve of the PCR amplification reaction in Embodiment 3.

Fig. 5 is an amplification curve of a PCR amplification reaction in Embodiment 4.

Fig. 6 is a melting curve of the PCR amplification reaction in Embodiment 4.

Fig. 7 is an amplification curve of a PCR amplification reaction in Embodiment 5.

Fig. 8 is a melting curve of the PCR amplification reaction in Embodiment 5.

Fig. 9 is an amplification curve of a PCR amplification reaction in Embodiment 6.

Fig. 10 is a melting curve of the PCR amplification reaction in Embodiment 6.

Fig. 11 is an amplification curve of a PCR amplification reaction in Embodiment 7.

Fig. 12 is a melting curve of the PCR amplification reaction in Embodiment 7.

Detailed Description of the Embodiments

The embodiments are given to better describe the present invention, but the content of the present invention is not limited only to the given embodiments. Therefore, non-essential improvements and adjustments to the embodiments made by a person skilled in the art in accordance with the content of the above present invention still fall within the scope of protection of the present invention.

The terms used herein are only intended to describe specific embodiments and are not intended to limit the present invention. Expressions in the singular form include those in the plural form unless the expressions have a distinctly different meaning in the context. As used herein, it is to be understood that terms such as "include", "have", "contain", and the like are intended to indicate the presence of features, figures, operations, components, parts, elements, materials, or combinations. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, figures, operations, components, parts, elements, materials, or combinations thereof may exist or may be added. As used here, "/" may be interpreted as "and" or "or", as appropriate.

LU503463

An aspect of the present invention provides a PCR amplification primer pair. In some embodiments, an forward primer includes a sequence shown as SEQIDNO:1, and a reverse primer includes a sequence shown as SEQIDNO:2.

Specifically by means of performing 16srDNA sequencing on BSTD, a sequence is compared with 16srDNA of a standard mode strain M215, and 100% homology is reached; according to the 16srDNA sequence of the BSTD and a sequence of related Bacillus, comparison is performed by using DNAMAN, so as to find a highly conserved region of the strain and determine V1-V9 variable regions, and specific primers are designed in the variable regions by means of PrimerPremier6 and Oligo6; and thus, the PCR amplification primer pair shown as SEQIDNO:1 and SEQIDNO:2 in the present invention is obtained, which is highly specific to the BSTD.

Another aspect of the present invention provides a detection reagent. In some embodiments, the detection reagent at least includes the PCR amplification primer pair.

Specifically, the PCR amplification primer pair may be combined with a conventional auxiliary reagent to form a detection reagent used for detecting the BSTD. The conventional auxiliary reagent is known in the art, for example, a PCR reaction buffer solution in a PCR amplification reaction system, DNA polymerase, or dNTP. Through the above, the detection reagent including the PCR amplification primer pair may enable the BSTD to perform specific amplification with the PCR amplification primer pair in the detection reagent.

Further, the detection reagent further includes a labeling reagent. The labeling reagent includes, but is not limited to, a fluorescent dye or a fluorescent probe. Specifically, by adding the labeling reagent to the detection reagent, the efficiency and sensitivity of detection may be further improved. For example, by adding the fluorescent dye or the fluorescent probe to the

PCR amplification reaction system, the fluorescent dye or the fluorescent probe may label a synthesized double strand during PCR amplification to form the double strand. By means of some external devices such as a PCR fluorescence detector, changes in a fluorescence signal may be monitored, such that PCR amplification may be detected in real time.

It is to be noted that, the fluorescent dye and the fluorescent probe have their own advantages and disadvantages. The fluorescent dye has the advantages of being convenient for usage and relatively cheap in price, and does not need to design complex probes; but the fluorescent dye also has the disadvantages of no template specificity, high requirements for primer specificity and relatively low sensitivity, and cannot perform multiplex quantitation. The fluorescent probe has the advantages of high specificity, good repeatability and high sensitivity, and can perform multiplex quantitation; but the fluorescent probe is only suitable for one 99469 specific target, relatively high in price and not easy to find probes with low backgrounds. During detection, whether to use the fluorescent dye or the fluorescent probe may be selected 5 according to specific situations.

Further, the fluorescent dye may be a fluorescent dye known in the art, for example,

SYBRGreen. The fluorescent probe may be automatically designed according to methods known in the art, or may be designed by entrusting a design company.

Still another aspect of the present invention provides a detection kit. In some embodiments, the detection kit may include the PCR amplification primer pair or the detection reagent. Specifically, the composition of the detection kit is in a conventional form known in the art. For example, the detection kit is provided with a kit specification. For example, there are reagent bottles for holding various detection reagents. For example, several small lattices are arranged to place detection reagent bottles. For example, a pipette is used to pipette the detection reagent. Likewise, on the basis of the strong specificity of the PCR amplification primer pair in the detection kit to the BSTD, the detection kit can effectively perform qualitative and quantitative analysis on the BSTD.

Still another aspect of the present invention provides an application of the PCR amplification primer pair or the detection reagent or the detection kit in detection of BSTD.

Specifically, when the PCR amplification primer pair or the detection reagent is used to amplify the BSTD, specific amplification can be performed on the BSTD. When the detection reagent containing a fluorescent reagent or the fluorescent probe is used for amplification, strong fluorescent light may be produced during amplification, facilitating detection and analysis.

It is to be noted that, the PCR amplification primer pair or the detection reagent may also be combined with a microfluidic chip to apply to the detection of the BSTD. In combination with the high efficiency and convenience of the microfluidic chip, great convenience may be brought for the detection of the BSTD.

Still another aspect of the present invention provides a PCR amplification detection method for Bacillus sporothermodurans. In some embodiments, the method may include: mixing a sample to be detected and the detection reagent (not containing the labeling reagent) for PCR amplification, so as to obtain a PCR amplification product, and analyzing the PCR amplification product, so as to determine whether the sample to be detected contains BSTD. It is to be noted that, the sample to be detected here may refer to a sample carrying or not carrying the BSTD, such as raw milk, water or other foods, or may refer to microbial DNA

LU503463 separated and extracted from the raw milk, water or other foods. That is to say, the PCR amplification detection method for Bacillus sporothermodurans may directly perform an amplification reaction on the raw milk, water or other foods in the PCR amplification reaction system, or may first separate microorganisms from the raw milk, water or other foods and extract DNA, and then perform the amplification reaction in the PCR amplification reaction system. On the basis of the PCR amplification primer pair, whether PCR amplification detection is performed by using the raw milk, water or other foods, or is performed after the DNA is separated and extracted, the method has good accuracy and sensitivity.

Specifically, in the PCR amplification detection method for Bacillus sporothermodurans, qualitative analysis may be performed on the BSTD in the sample to be detected by detecting the PCR amplification product. A gel electrophoresis method is selected and used to perform gel electrophoresis on the PCR amplification product. It is to be understood that, the amount of the PCR amplification product is the amount enough for gel electrophoresis. For example, if the amplification amount of 10 cycles is enough for gel electrophoresis, gel electrophoresis is performed on the amplification product after 10 cycles. For example, if it requires the amplification amount of 20 cycles for gel electrophoresis, gel electrophoresis is performed on the amplification product after 20 cycles. It is to be noted that, the method for performing gel electrophoresis on the product which has been subjected to PCR amplification can be chosen from methods known to those skilled in the art. For example, the size and position of a target strip of electrophoresis are compared with marker, so as to perform qualitative analysis on the

BSTD in the sample to be detected. The relative content of the target strip may also be analyzed by means of image], so as to achieve qualitative analysis of the product which has been subjected to PCR amplification. On the basis of high specificity of the PCR amplification primer pair to the BSTD, the PCR amplification detection method for Bacillus sporothermodurans may accurately determine whether the sample to be detected contains the

BSTD.

Still another aspect of the present invention provides a PCR amplification detection method for Bacillus sporothermodurans. In some embodiments, the method includes: mixing a sample to be detected and the detection reagent (containing a labeling reagent) for PCR amplification, and during PCR amplification, determining, according to a fluorescence signal, whether the sample to be detected contains BSTD. It is to be noted that, as above, the sample to be detected here may be a sample carrying or not carrying the BSTD, such as raw milk, water or other foods, or may be microbial DNA separated and extracted from the raw milk, water or

LU503463 other foods.

Specifically, in addition to the method of using the PCR amplification primer pair for conventional PCR amplification detection and then using gel electrophoresis to perform quantitative and qualitative analysis on a final product which is subjected to PCR amplification, the detection reagent may also be used to perform fluorescent PCR amplification detection.

That is to say, a labeling reagent is introduced into PCR amplification, and a DNA double strand formed during annealing and extension is labeled. Therefore, by means of a fluorescence signal from the labeling reagent, a PCR amplification process may be monitored in real time, and qualitative and quantitative analysis may be performed on a DNA template to be detected. It is to be noted that, the method for performing qualitative and quantitative analysis on the sample to be detected may be used from the methods known in the art. For example, according to whether an amplification curve of fluorescence labeling starts a curve, qualitative analysis is performed on the sample to be detected, and if the curve starts, it indicates that the sample to be detected contains the BSTD. For example, a threshold value may also be set, then a CT value is obtained, and the content of the BSTD in the sample to be detected is obtained according to a relationship between the CT value and a standard curve. It is to be understood that, the standard curve is a curve that is obtained by detecting standards with known copy numbers, which is known in the art. Likewise, on the basis of high specificity of the PCR amplification primer pair to the BSTD, the PCR amplification detection method for Bacillus sporothermodurans may also accurately perform qualitative and quantitative analysis on the sample to be detected.

It is to be noted that, there is a difference between PCR amplification detection performed by using the PCR amplification primer pair and PCR amplification detection performed by using the detection reagent (including a fluorescence reagent). When the PCR amplification primer pair is used to perform PCR amplification detection, gel electrophoresis is required, and pre-enrichment may also be required, resulting in relatively long overall detection time, which is about 48-72h, such that the process is relatively complicated. Moreover, only the final PCR product can be analyzed, and analyzed results can only be analyzed qualitatively but not quantitatively for the sample to be detected. When the detection reagent (including the PCR amplification primer pair and the labeling reagent) is used for PCR amplification detection, gel electrophoresis is not required, such that detection time is relatively short. Generally, the detection time is 90 min, which is much less than 48-72h. Furthermore, by means of the fluorescence signal, annealing and extension processes during PCR may be monitored in real

LU503463 time, such that the entire PCR amplification process may be completely grasped, which is more conductive to research. Further, the content of the BSTD in the DNA template to be detected may be determined according to the CT value and the standard curve, and qualitative and quantitative analysis may also be accurately performed on the DNA template to be detected.

Further, in the PCR amplification detection method for Bacillus sporothermodurans, a PCR amplification reaction procedure includes performing preheating and denaturation at 90°C-95°C. It is to be noted that, 90°C-95°C is the temperature for DNA extraction by means of a high-temperature pyrolysis method, and is also a denaturation temperature of the DNA double strand during PCR amplification. Therefore, during PCR amplification, preheating and denaturation may be performed at 90°C-95°C, for example, 92°C, 93°C or 94°C. The PCR amplification detection method for Bacillus sporothermodurans in the present invention is also required to be described.

It is to further be noted that, the BSTD is generally present in different media, such as raw milk, water and other foods. A current detection method generally needs to separate microbiota in the media, and then DNA is extracted from microorganisms as the DNA template for detection. On the basis of the PCR amplification primer pair (SEQIDNO:1 and SEQIDNO:2) of the present invention, the BSTD in the raw milk, water and other foods may be detected without separating and extracting the DNA, such that the requirements for rapidly detecting the BSTD in the raw milk, water and other foods may be achieved. In addition, the method is simple in operation, not tedious, and high in accuracy and sensitivity.

Further, in the PCR amplification detection method for Bacillus sporothermodurans, an annealing temperature of a PCR amplification reaction may range from 60°C to 65°C.

Specifically, the annealing temperature mainly depends on the base composition, length and concentration of a primer; and an appropriate annealing temperature is particularly critical for the specificity of the PCR amplification reaction. Generally, the annealing temperature affects both the specificity and sensitivity (amplification efficiency) of the PCR reaction, and the specificity and the sensitivity are negatively correlated. That is to say, the low annealing temperature may improve the sensitivity of the PCR reaction, but the specificity is relatively poor; and the high annealing temperature may improve the specificity of the reaction but reduce the amplification efficiency. The annealing temperature in the present invention is set to 60°C-65°C, for example, 62°C, 63°C or 64°C, such that the PCR amplification primer pair may maintain high specificity in the PCR amplification reaction, and the rate of the PCR amplification reaction may also be maintained at a high level.

LU503463

In order to better understand the present invention, the content of the present invention is further described below with reference to specific embodiments, but is not only limited to the following examples.

In the following embodiments, both a Brain Heart Infusion (BHI) medium and an LB broth medium are from Beijing Land Bridge Techonolgy Co., LTD.

In the following embodiments, listeria monocytogenes ATCC19115, escherichia coli

ATCC8739, bacillus cereus CMCC(B)63303, bacillus subtilis ATCC6633 and citrobacter freundii

ATCC43864 used are all purchased from the China Center of Industrial Culture Collection (CICC);

BacillussporothermoduransM215 (DSMZ10599) is purchased from Deutsche Sammlung von

Mikroorganismen und Zellkulturen (DSMZ); and the BSTD B1 is from milk.

In the following embodiments, in the embodiments involving the PCR amplification reaction, a PCR amplification reaction system is shown in Table 1 below, and the PCR amplification reaction procedure is shown in Table 2 below.

Table 1 PCR amplification reaction system in the embodiments of the present invention

Table 2 PCR amplification reaction procedure in the embodiments of the present invention

CJ

Embodiment 1 Separation, screening and identification of BSTD B1 (1) Preliminary screening of the BSTD: a sample is first heated for 30 min at 100°C and then poured into a BHI medium, the medium is cultured for 48-72h at 55°C, single colonies are then selected, and purified and cultured strains are stored in a -80°C freezer. (2) Activation and identification of the strains: a glycerin tube is taken and inoculated in the sterilized liquid BHI medium, cultured for 24-48h at 37°C, continuously activated for 3 times

LU503463 until no bacteria are found by microscopic examination (a microscopic examination chart is shown in Fig. 1), and then inoculated into the BHI medium with 2% inoculation amount; and bacterial fluid is taken and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. (3) Separation and identification of the BSTD: Blast is performed in NCBI after the BSTD separated and identified from the sample is sequenced, the strain is found to be highly homologous to a type strain BSTD M215, and the homology a 16srDNA sequence reaches 100%; a phylogenetic tree is shown in Fig. 2, indicating that the strain belongs to Bacillus sporothermodurans; and the strain is named as the BSTD B1, which is shown in Fig. 1.

Embodiment 2 Design of a fluorescent quantitative PCR primer (1) Activation of strains

Bacillus cereus, bacillus subtilis, listeria monocytogenes, escherichia coli and citrobacter freundii are inoculated into an LB broth medium, and are cultured at 37°C a logarithmic phase for later use; and the BSTD B1 and the BSTD M215 are inoculated into a BHI medium, and are cultured at 37°C a logarithmic phase for later use. (2) Design of a primer

According to the 16srDNA sequence of the BSTD B1 and a sequency of related Bacillus, comparison is performed by using DNAMAN, so as to find a highly conserved region of the strain and determine V1-V9 variable regions; 3 primer pairs are designed in the variable regions by means of PrimerPremier6 and Oligo6: B1-F: CGCATGAAGGAGAATTGAAAGACG (SEQIDNO:1);

B1-R: ATCGTCGCCTTGGTGAGCCG (SEQIDNO:2); B2-F: ACAAGAGTGACAGGTGGTGC (SEQIDNO:3);

B2-R: GCCTACAATCCGAACTGAGAA (SEQIDNO:4); B3-F: TCTGTAACTGACGCTGAGGC (SEQIDNO:5);

B3-R: AGCACTAAAGGGCGGAAA (SEQIDNO:6); the specificity of the primer is verified in NCBI by means of calculating a Tm value, and the specificity of the primer pair B1-F and B1-R is the optimal; and finally the sequences of the primers with better specificity are sent to Sangon

Biotech (Shanghai) Co., Ltd. for synthesis.

Embodiment 3 Establishment of a fluorescent quantitative PCR detection method of

BSTD

(1) DNA preparation of positive control BSTD M215

DNA extraction is performed on the positive control BSTD M215 in Embodiment 2 cultured to the logarithmic phase by using an Ezup column bacterial genome DNA extraction kit (Sangon

Biotech (Shanghai) Co., Ltd.); the extracted DNA is preserved at -80°C for later use as a PCR reaction positive control template, a NanoDropone ultramicro ultraviolet spectrophotometer is used to measure a DNA concentration, and the DNA concentration is 135.4 ng/ul; and by

LU503463 means of plate spreading and counting, it is learned that the viable count of the BSTD M215 cultured to the logarithmic phase is 1.5*10° CFU/ml. (2) DNA preparation of BSTD B1 to be detected

A high-temperature pyrolysis method is used to extract DNA of the BSTD B1; 1 mL of bacterial fluid of the BSTD B1 cultured to the logarithmic phase is taken and placed into a 1.5 mL sterile Eppendorf centrifuge tube, and centrifugation is performed for 5 min at 8000 rpm at 4°C; supernatant is sucked and added to another 1.5 mL sterile Eppendorf centrifuge tube, centrifugation is performed for 10 min at 8000 rpm, and then the supernatant is discarded; 200 uLof deionized water is added to resuspend the bacteria, heated for 10 min in a boiling water bath, then immediately placed in liquid nitrogen and taken out after cooling; then centrifugation is performed for 10 min at 8000 rpm, and the supernatant is taken as the DNA template of the PCR reaction; and by means of plate spreading and counting, it is learned that the viable count of the BSTD B1 cultured to the logarithmic phase is 2.1*10° CFU/ml. (3) Counting of BSTD M215 and BSTD B1

After the BSTD M215 and the BSTD B1 which are cultured to the logarithmic phase are diluted to different concentration gradients, plate spreading and counting is performed; and there are 3 repeats in each gradient, and a spread plate is inverted in a 37°C constant temperature incubator and cultured for about 48h. (4) Establishment of a fluorescent quantitative PCR method

The extracted DNA of the BSTD M215 is used as a positive control template; the DNA of the BSTD B1 extracted by means of the high-temperature pyrolysis method is used as a template of the sample to be detected; ddH2O is used as a negative control; and fluorescent

PCR amplification is performed according to the PCR amplification reaction system and the PCR — amplification reaction procedure shown in Table 1 and Table 2.

The fluorescent PCR amplification reactions are shown in Fig. 3 and Fig. 4. The B1-F and

B1-R primer pair positive controls M215 and strain B1 to be detected start curves at about 18

Ct values and show a typical S-shaped amplification curve. In addition to B1-F and B1-R, the remaining primer pairs and the negative control do not start curves, indicating a good amplification effect. It may be learned from a melting curve that, melting temperatures of the

M215 and the B1 are both 78.5°C, and the negative control has no melting temperature. By means of the amplification curve and the melting curve of the embodiments of the present invention, it may be learned that the method in the embodiments of the present invention may rapidly detect the BSTD in the detected sample.

LU503463

Embodiment 4 Specificity evaluation of a fluorescent quantitative PCR detection method of BSTD

Bacillus cereus, bacillus subtilis, listeria monocytogenes, escherichia coli and citrobacter freundii are inoculated into an LB broth medium, and are cultured at 37°C a logarithmic phase for later use; and the BSTD B1 is inoculated into a BHI medium, and is cultured at 37°C a logarithmic phase for later use.

The genomic DNA of each strain is extracted by means of the high-temperature pyrolysis method; the concentration and purity of the genome of each strain are measured, so as to determine the purity to be good; and the concentration of each genome is diluted, such that the genome concentrations of all strains are the same. These genomes are used as templates for the SYBR real-time fluorescent quantitative PCR reaction; the M215 is a positive control; and the ddH,0 is a negative control. Fluorescent PCR amplification is performed according to the PCR amplification reaction system and the PCR amplification reaction procedure shown in

Table 1 and Table 2.

The fluorescent PCR amplification reactions are shown in Fig. 5 and Fig. 6. The determination of related bacillus cereus, bacillus subtilis and multiple foodborne bacteria shows that, the primers (B1-F and B1-R) only have good curve starting effect on the positive controls M215 and B1, and have the typical S-shaped amplification curve at about 18 Ct values.

The bacillus cereus, the bacillus subtilis, the listeria monocytogenes, the escherichia coli and the citrobacter freundii do not start curves. Curve starting indicates the accumulation of products during the entire PCR process. If more specific products are present in a sample, amplification is observed in an earlier cycle, and the Ct value is small; if there is less product, amplification is observed in a later cycle, and the Ct value is large; and smaller Ct values indicate a better detection effect.

By means of observing the melting curve, it may be learned that the melting curves of the positive controls M215 and B1 show a single melting peak, the melting temperatures are all 78.5°C, and other strains have no obvious melting peaks, such that the melting curves are close to the negative control. That is to say, by means of a specificity experiment of this embodiment, in combination with the melting curves and the melting temperatures, it may be learned that, the fluorescent quantitative PCR method has good specificity when detecting the BSTD.

Embodiment 5 Sensitivity evaluation of a fluorescent quantitative PCR detection method of BSTD

The BSTD B1 is inoculated in the BHI medium, cultured at 37°C to the logarithmic phase

LU503463 and counted. Genomic DNA is extracted by means of the high-temperature pyrolysis method; the concentration and purity of the genomes of the strains are measured, so as to determine the purity to be good; and then the genomes are diluted to 10° with 10-fold gradient, which are used as a template for SYBR real-time fluorescent quantitative PCR reaction, and the ddH20 is the negative control. By means of counting the BSTD B1 cultured to the logarithmic phase, it may be learned that the viable count is 2.8*10° CFU/mL. Fluorescent PCR amplification is performed according to the PCR amplification reaction system and the PCR amplification reaction procedure shown in Table 1 and Table 2.

The fluorescent PCR amplification reactions are shown in Fig. 7 and Fig. 8, showing results of the amplification curve of fluorescent quantitative PCR of the genomic DNA template with different concentrations and the melting curves. The amplification curves with 7 different concentrations from a stock solution to dilution 10° all start curves within 35 cycles (Ct value<35), and the S shape is obvious; and the temperatures of the melting curves are all at 78.5°C. However, the amplification curves with lower concentrations and the negative control all do not start curves within 40 cycles, and none of the melting curves has melting temperatures, indicating that the sensitivity of the method may be detected up to 2.8 CFU/mL.

That is to say, if the sample to be detected contains 2-3 BSTD B1 strains per milliliter, the BSTD

B1 may be detected by means of fluorescent PCR amplification detection of the present invention.

Embodiment 6 Detection of an artificially-contaminated sample

The case of reagents in the embodiments of the present invention: bacillus cereus, bacillus subtilis, listeria monocytogenes, escherichia coli and citrobacter freundii are inoculated into an

LB broth medium, and are cultured at 37°C a logarithmic phase for later use; and the BSTD B1 is inoculated into a BHI medium, and is cultured at 37°C a logarithmic phase for later use. (1) Preparation of an artificially-contaminated sample

In one group, the bacillus cereus, the bacillus subtilis, the listeria monocytogenes, the escherichia coli, the citrobacter freundii and the BSTD B1 are taken 20pL each into 1 mL of sterile ultrapure water; and in the other group, 100 pL of the BSTD B1 is taken into 1 mL of sterile ultrapure water. Then the two groups are vortexed for 1 min by using a vortex mixer, so as to cause the bacterial fluid to be uniformly dispersed, and in each group, 1 ul is taken as the

DNA template of fluorescent quantitative PCR. (2) Fluorescent quantitative PCR

The fluorescent quantitative PCR template prepared in (1) is used as the DNA template,

LU503463 and fluorescent PCR amplification is performed according to the PCR amplification reaction system and the PCR amplification reaction procedure shown in Table 1 and Table 2.

The fluorescent PCR amplification reactions are shown in Fig. 9 and Fig. 10. It may be learned from the figures that, the BSTD B1 contaminated by single bacteria starts a curve at about 13 cycles and shows a typical S-shaped curve. The amplification curve contaminated by mixed bacteria starts a curve at 16 cycles and shows a typical S-shaped curve. In combination with the results of the melting curve, it may be learned that there is no melting temperature on the melting curve of the negative control, and the melting temperatures of samples contaminated by the single bacteria and the mixed bacteria are all at 78.5°C. The concentration of the bacterial fluid contaminated by the single bacteria is higher than the concentration of the bacterial fluid contaminated by the mixed bacteria, such that the amplification curve contaminated by the single bacteria starts the curve several cycles earlier than the amplification curve contaminated by the mixed bacteria.

The results show that, the detection method of the present invention may not only detect the samples contaminated by the BSTD B1, but also detect the specificity of the BSTD B1 in the mixed bacterial fluid of the bacillus cereus, the bacillus subtilis, the listeria monocytogenes, the escherichia coli, the citrobacter freundii and the BSTD B1. That is to say, the detection method of the present invention may not only detect the samples contaminated by the single bacteria, but also detect the specificity of the BSTD B1 in the samples contaminated by various miscellaneous bacteria, such that an application range of the detection method of the present invention is greatly enlarged.

Embodiment 7 Testing different dairy products on the market

In the embodiments of the present invention, 9 different brands of UHT (ultra-high temperature sterilized milk) milk are purchased from a supermarket and labeled as 1 to 9 samples to be detected.

In order to simplify the steps of the detection operation of the present invention, 1 pL of milk is directly taken as a DNA template for fluorescent quantitative PCR without pre-treating the milk; the ddHz0 is used as the negative control, and the BSTD M215 is used as the positive control; and fluorescent PCR amplification is performed according to the PCR amplification reaction system and the PCR amplification reaction procedure shown in Table 1 and Table 2.

The fluorescent PCR amplification reactions are shown in Fig. 11 and Fig. 12. The results of the determination performed on the samples of 9 different brands of UHT milk on the market are shown in Fig. 11 and Fig. 12. The positive control starts a curve at about 16 cycles, and one

LU503463 product starts a curve at about 22 cycles. Since the milk contains some substances inhibiting the PCR reaction, a typical S-shaped curve is not shown, but the accuracy of the detection results is not affected. The remaining products and the negative control do not start curves, indicating that the product 3 may contain the BSTD. By means of performing plate spreading on the product 3 subsequently, it may be learned that, the product contains the BSTD. Then by separating and identifying strains in the sample 3, and by means of the 16srDNA, it may be learned that, the BSTD in product 3 has 99.6% homology with the BSTD B1. This also shows that the detection method of the present invention can accurately identify the BSTD in dairy products without complicated operation steps.

It is finally to be noted that, the above embodiments are merely for describing and not intended to limit the technical solutions of the present invention. Although the present invention is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention may be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present invention, and shall all fall within the scope defined by the claims of the present invention.

Claims (10)

CLAIMS LU503463

1. A PCR amplification primer pair, wherein an forward primer comprises a sequence shown as SEQIDNO:1, and a reverse primer comprises a sequence shown as SEQIDNO:2.

2. À detection reagent, comprising the PCR amplification primer pair as claimed in claim 1.

3. The detection reagent as claimed in claim 2, further comprising a labeling reagent, wherein the labeling reagent comprises, but is not limited to, a fluorescent dye or a fluorescent probe.

4. A detection kit, comprising the PCR amplification primer pair as claimed in claim 1 or the detection reagent as claimed in any of claims 2 to 3.

5. An application of the PCR amplification primer pair as claimed in claim 1 or the detection reagent as claimed in any of claims 2 to 3 or the detection kit as claimed in claim 4 in detection of Bacillus sporothermodurans (BSTD).

6. A PCR amplification detection method for Bacillus sporothermodurans, comprising: mixing a sample to be detected and the detection reagent as claimed in claim 2 for PCR amplification, so as to obtain a PCR amplification product, and analyzing the PCR amplification product, so as to determine whether the sample to be detected contains Bacillus sporothermodurans (BSTD).

7. A PCR amplification detection method for Bacillus sporothermodurans, comprising: mixing a sample to be detected and the detection reagent as claimed in claim 3 for PCR amplification, and during PCR amplification, determining, according to a fluorescence signal, whether the sample to be detected contains Bacillus sporothermodurans (BSTD).

8. The PCR amplification detection method for Bacillus sporothermodurans as claimed in claim 7, wherein during PCR amplification, the content of the BSTD in the sample to be detected is determined according to a CT value and a standard curve.

9. The PCR amplification detection method for Bacillus sporothermodurans as claimed in LU503463 claim 6, 7 or 8, wherein a PCR amplification reaction procedure comprises performing preheating and denaturation at 90°C-95°C.

10. The PCR amplification detection method for Bacillus sporothermodurans as claimed in claim 6, 7 or 8, wherein an annealing temperature of a PCR amplification reaction ranges from 60°C to 65°C.