LU501477B1 - Primer composition, kit and method for forensic identification of Cannabis sativa L. - Google Patents

Abstract

The invention provides a primer composition, a kit and a method which can detect 17 autosomal STR loci and 2 sex determination sites of Cannabis sativa L. samples in parallel, wherein the 17 autosomal STR loci include D02-CANN1, C11-CANN1, 4910, B01-CANN1, E07-CANN1, 9269, B05-CANN1, H06-CANN2, 5159, nH09, ANUCS 501, CS1, ANUCS 305, 3735, ANUCS 302, 1528 and 9043, and the two sex determination sites are DM029 and DM016. The primer sequences shown in SEQ ID NO. 1-38. The primer composition, kit and method have the characteristics of high sensitivity, good specificity, strong stability and high accuracy, and provide a brand-new detection means for sex identification, individual identification, origin inference in forensic study of Cannabis sativa L..

Description

Description LUS01477 Primer composition, kit and method for forensic identification of Cannabis sativa L.

TECHNICAL FIELD The invention relates to the technical field of molecular identification, in particular to a primer composition of polymorphic genetic markers, a kit and a method for forensic identification of Cannabis sativa L..

BACKGROUND Cannabis sativa L. is an annual dioecious herb belonging to Cannabis of Cannabinaceae, which is mainly natively cultivated in Europe, Africa, Asia, Nepal, India, China and other regions, and is one of the oldest cultivated crops on the earth. Cannabis sativa L. fiber is good raw material for textile and papermaking. Cannabinoids contained in plants are widely used in medical and health fields. Its seeds are rich in protein, amino acids, unsaturated fatty acids, trace elements and other nutrients that are easily absorbed by the human body and have become an important economic crop in many countries. However, because tetrahydrocannabinol (THC) contained in flowers and leaves is addictive and legally considered as narcotic in many countries, Cannabis sativa L. has been listed as one of three major drugs alongside heroin and cocaine by the United Nations Anti-Drug Convention.

Cytological studies show that Cannabis sativa L. is a diploid plant with 20 chromosomes (including 18 autosomes and 2 sex chromosomes). The karyotype of female plant is XX and that of male plant is XY. The utilization value of male and female Cannabis sativa L. plants is different. The fiber quality of male plants is obviously higher than that of female plants. The male plants do not contain or have a low content of THC and cannabidiol (CBD), while the female plants have a relatively high content of them. As a result, the female plants have higher medicinal value and abuse potential.

In recent years, influenced by the legalization of Cannabis sativa L. in some countries and regions in the world, the number of people who smoke or abuse Cannabis sativa L. in China continues to rise, and the cases of cross-border trafficking of Cannabis sativa L. are increasing day by day. Therefore, it has become an urgent social demand to carry out rapid and accurate forensic identification for and trace the source of Cannabis sativa L.. At present, the mainstream conventional identification methods of Cannabis sativa L. are morphological and chemical composition analysis. These methods are not without their limitation, especially when, in sone 201477 cases, Cannabis sativa L. is processed or mixed with tobacco leaves. The mixing makes it challenging, if not impossible, to identify this kind of samples from the shape. Gas chromatography-mass spectrometry (GC-MS) is often used in the qualitative and quantitative analysis of THC in biological samples. However, GC-MS analysis of chemical components of Cannabis sativa L. requires a large quantities of fresh samples, because THC is easily oxidized in older samples, and the content of THC will be influenced by the development stage, the location and the planting environment of Cannabis sativa L. plants. In addition, gender differences have a great influence on THC content of Cannabis sativa L.. Further, the sex of Cannabis sativa L. plants for older or processed Cannabis sativa L. samples or Cannabis sativa L. before flowering period cannot be accurately determined by way of morphology or chemical composition analysis. Finally, the individual identification and origin determination of Cannabis sativa L. are also of great significance in practical cases, which is what morphological and chemical composition analysis cannot adequately do. To better meet the needs of species identification, individual identification and origin inference of Cannabis sativa L. in forensic community, scientists around the world have been trying to find new methods to solve these problems.

With the rapid development of molecular biology technology, identification of Cannabis sativa L. at DNA level has gradually become a research hotspot and provided a new technical means for the identification. At present, the research on Cannabis sativa L. DNA genetic markers mainly focuses on areas such as RAPD, AFLP, SCAR, DNA barcode and STR. The research to date shows that RAPD, AFLP and SCAR genetic markers can identify the species and sex of Cannabis sativa L.; DNA barcode can accurately identify Cannabis sativa L. and its adulterants, but none of the above genetic markers can be used to identify Cannabis sativa L. on an individual basis nor can they be used to determine its geographical origin.

STR is an oligonucleotide sequence composed of 2-6 base core sequences in tandem. STR has many advantages, including but not limited to high sensitivity, high discrimination ability, high species specificity, high accuracy of results, easy analysis and standardization. It is widely used in individual identification, kinship identification and group investigation in the field of forensic community and has become the most widely used genetic marker. Based on this, some scientists in forensic science try to apply STR genetic markers to the identification of Cannabis 201477 sativa L., and prove the potential of STR genetic markers in identifying Cannabis sativa L., distinguishing Cannabis sativa L. varieties and inferring the origin of Cannabis sativa L.. At present, there are 28 STR loci in Cannabis sativa L. found and reported across the world. In 2003, Hsieh and others reported the first Cannabis sativa L. STR locus CS1, and observed that the number of repeats of this locus ranged from 3 to 40 in 108 Cannabis sativa L. samples, and the heterozygosity was about 87.04%, which proved that CS1 locus was highly polymorphic. Later, more polymorphic Cannabis sativa L. STR loci were developed, such as the 11 polymorphic Cannabis sativa L. STR loci developed by Alghanim et al. which includes C11-CANNI, BO1-CANNI1 and D02-CANN |, and the 6 four-base repetitive Cannabis sativa L. STR loci such as 5159, 4910 and 1528 developed by Valverde et al., which is also the first reported four-base repetitive Cannabis sativa L. STR locus. Based on the continuous development of Cannabis sativa L. STR loci, research on the multiplex amplification system of Cannabis sativa L. STR loci also started. In 2008, Howard and others successfully constructed a compound amplification system with 10 polymorphic STR loci. For the first time, in strict accordance with the validation guidelines of the Scientific Working Group for DNA Analysis Methods (SWGDAM), the system was verified in terms of its sensitivity, stability and species specificity. The results showed that such system can be used to establish a Cannabis sativa L. STR genetic database. By screening Cannabis sativa L. STR reported in previous studies and combining it with the 6 four-base repetitive STRs found by Valverde et al, Houston et al. successfully constructed a STR multiplex amplification system with 13 loci, which is also the most studied and applied system at present. The research on STR locus of Cannabis sativa L. in China started relatively late. In 2008, Ma Yuan and others selected three loci with similar amplification conditions and high heterozygosity (ANUCS 301, ANUCS 305 and CS1) to construct a compound amplification system, which provided a theoretical basis for determining the variety and origin of the drug plant Cannabis sativa L. by STR genetic markers; however, such system is not yet capable enough for individual identification of Cannabis sativa L..

SUMMARY In order to realize accurate sex identification, individual identification and origin inference of Cannabis sativa L., and to provide detection methods for establishing a Cannabis sativa L.

STR database, the invention developed and established a primer composition, kit and method/>01477 which can detect 17 autosomal STR loci and 2 sex determination sites of Cannabis sativa L. samples in parallel.

To achieve the above purposes, the present invention adopts the following technical scheme: In the first aspect, the present invention provides a primer composition for the identification of polymorphic genetic markers of Cannabis sativa L., which includes amplification primers of 17 autosomal STR loci and amplification primers of 2 sex determination sites of Cannabis sativa L.; specifically, the 17 autosomal STR loci include D02-CANNI, C11-CANNI, 4910, BO1-CANNI, E07-CANNI, 9269, BO5S-CANNI1, H06-CANN2, 5159, nH09, ANUCS 501, CS1, ANUCS 305, 3735, ANUCS 302, 1528 and 9043; the two sex determination sites are DM029 and DM016.

In addition, the sequences of the amplification primers of the 17 autosomal STR loci and the amplification primers of the 2 sex determination sites of Cannabis sativa L. are as follows: D02-CANN1: SEQ ID NO. 1-2; C11-CANNI1: SEQ ID NO. 3-4; DM029: SEQ ID NO. 5-6; DM016: SEQ ID NO. 7-8; 4910: SEQ ID NO. 9-10; BO1-CANNI1: SEQ ID NO. 11-12; EO07-CANNI1: SEQ ID NO. 13-14; 9269: SEQ ID NO. 15-16; BOS-CANNI1: SEQ ID NO. 17-18; H06-CANN2: SEQ ID NO. 19-20; 5159: SEQ ID NO. 21-22; nH09: SEQ ID NO. 23-24; ANUCS 501: SEQ ID NO. 25-26; CS1: SEQ ID NO. 27-28; ANUCS 305: SEQ ID NO. 29-30; 3735: SEQ ID NO. 31-32; ANUCS 302: SEQ ID NO. 33-34; 1528: SEQ ID NO. 35-36; 9043: SEQ ID NO. 37-38.

Furthermore, one primer in each pair of amplification primers 1s labeled with a fluorescent dye, which is selected from one of the following, FAM, HEX, TRMRA or ROX. The amplification primers of D02-CANNI1, C11-CANNI1, DM029, DM016, 4910 and BO1-CANNI1 were labeled with FAM. E07-CANN1, 9269, BO5-CANNI1, H06-CANN2, 5159 and nH09 were labeled with HEX. The amplification primers of ANUCS 501, CS1 and ANUCS 305 were labeled with TRMRA. The amplification primers of 3735, ANUCS 302, 1528 and 9043 were labeled with ROX.

In the second aspect, the present invention also provides a kit for forensic identification of Cannabis sativa L. comprising the above-mentioned primer composition. It also includes a

4<PCR reaction premix VII [50 mM Tris-HCI (pH 8.3), 50 mM KCI, 1.5 mM MgCl, 0.2 mM°01477 dNTPs, 0.08 mg/ml bovine serum albumin (BSA), 0.5 U amplification enzyme] and deionized water.

Third, the invention provides a method for forensic identification of Cannabis sativa L. by using the kit, which is specifically used for sex determination, individual identification and origin inference of Cannabis sativa L.; the method comprises the following steps: step 1, performing PCR amplification of a genomic DNA sample to be tested by using amplification primers with sequences shown in SEQ IDNO. 1-38; step 2, taking the PCR amplification product, mixing it with a proper amount of molecular internal standard and formamide; denature and then cool that mixture; step 3, using genetic analyzer to carry out typing detection.

Furthermore, the total volume of the PCR amplification system is 20uL, including a 5uL 4x PCR reaction premix VII, a 2uL primer mixture (10uL) 2uL, a 13-XuL deionized water and a XuL genomic DNA.

Furthermore, the concentrations of the above amplification primers in the amplification system are as follows: DO2-CANNI: 0.03uM; C11-CANNI1: 0.03 uM; DMO029: 0.05 uM ; DMO16: 0.03 uM; 4910: 0.04 uM; BO1-CANNI: 0.06 uM; E07-CANNI: 0.05 uM; 9269: 0.04 uM; BOS-CANNTI: 0.03 uM; H06-CANN2: 0.04 uM; 5159: 0.04 uM; nH09: 0.04 uM; ANUCS 501: 0.05 uM; CS1: 0.05 uM; ANUCS 305: 0.05 uM; 3735: 0.05 uM; ANUCS 302: 0.04 uM; 1528: 0.05 pM; 9043: 0.05 uM.

Further, the procedure of PCR multiplex amplification is: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at 56°C for 1 minute and extension at 60°C for 30 seconds, totally 28 cycles; final extension at 60°C for 5 minutes; 15°C heat preservation.

Further, the PCR amplification is achieved through a reaction thermal cycler; the reaction thermal cycler is selected from one of the following models, ABI9700, ABI9600, ABI2720, Bio-Rad iCycler or Bio-Rad C1000.

Further, the molecular internal standard adopts T500 Size Standard and LIZ fluorescence labeling; the 5-Dye Matrix Standards were used for fluorescence calibration.

Furthermore, in the second step, the volume ratio of PCR amplification products, molecular internal standard and formamide is 1:8.5:0.5.

Furthermore, the genetic analyzer is selected from one of the following models, 3100 series) 0 1477 3130 series or 3500 series genetic analyzers.

Further, step one also includes DNA extraction of flowers, stems, leaves and/or seeds of the sample to be tested to prepare genomic DNA samples.

Further, the denaturation condition in step 2 is 95°C for 3 minutes; the cooling condition is ice cooling for 3 minutes.

Compared with the prior art, the invention has the following technical effects by adopting the technical schemes:

1. The present invention can simultaneously amplify 17 autosomal STR loci and 2 sex determination loci of Cannabis sativa L., which is superior to the amplification system which contains at most 15 loci in previous studies; in addition, the present invention adds the sex determination site to the Cannabis sativa L. STR amplification system for the first time.

2. The present invention provides an effective method for the further research of Cannabis sativa L. STR locus, the establishment of a Cannabis sativa L. STR database and the identification of Cannabis sativa L. in related cases in the field of forensic science.

3. With high sensitivity, good specificity and strong stability, the invention establishes a forensic kit and method and provide effective detection tools for sex identification, individual identification, and origin inference of Cannabis sativa L..

BRIEF DESCRIPTION OF THE FIGURES Fig. 11s a Ladder typing profile of the kit used for forensic identification of Cannabis sativa L. as one example of the application of the present invention; Fig. 2 is a profile of a female Cannabis sativa L. DNA sample genotyped by the kit as one example of the application of the present invention; Fig. 3 is a profile of a male Cannabis sativa L. DNA sample genotyped by the kit as one example of the application of the present invention; Fig. 4 is the genotyping profiles of concordance study of the kit as one example of the application of the present invention; Fig. 5 is a graph showing the results of sensitivity study of the kit as one example of application of the present invention;

Fig. 6 is the genotyping profiles of species-specific study of the kit as one example of thé 201477 application of the present invention.

DESCRIPTION OF THE INVENTION The invention provides a primer composition, kit and method containing polymorphic genetic markers for forensic identification of Cannabis sativa L., especially for sex determination, individual identification and origin inference of Cannabis sativa L. samples in forensic community. The primer mixture includes primers of 17 autosomal STR loci of Cannabis sativa L. and primers of 2 sex determination sites. Among them, the 17 autosomal STR loci include DO2-CANNI1, C11-CANNI1, 4910, BO1-CANNI1, E07-CANNI1, 9269, BO5-CANNI, H06-CANN2, 5159, nH09, ANUCS 501, CS1, ANUCS 305, 3735, ANUCS 302, 1528 and 9043; The two sex determinationsites are DM029 and DM016.

In a preferred example of the present invention, the sequences of amplification primers of 17 autosomal STR loci and 2 sex determinationsites of Cannabis sativa L. are as follows: D02-CANNI1: SEQ ID NO. 1-2; C11-CANNI1: SEQ ID NO. 3-4; DM029: SEQ ID NO. 5-6; DM016: SEQ ID NO. 7-8; 4910: SEQ ID NO. 9-10; BOI-CANN1: SEQ ID NO. 11-12; E07-CANN1: SEQ ID NO. 13-14; 9269: SEQ ID NO. 15-16; BO5S-CANN1: SEQ ID NO. 17-18; H06-CANN2: SEQ ID NO. 19-20; 5159: SEQ ID NO. 21-22; nH09: SEQ ID NO. 23-24; ANUCS 501: SEQ ID NO. 25-26; CS1: SEQ ID NO. 27-28; ANUCS 305: SEQ ID NO. 29-30; 3735: SEQ ID NO. 31-32; ANUCS 302: SEQ ID NO. 33-34; 1528: SEQ ID NO. 35-36; 9043: SEQ ID NO. 37-38.

In a preferred example of the present invention, one primer in each pair of amplification primers is labeled with a fluorescent dye, which is selected from one of the following, FAM, HEX, TRMRA or ROX.

In a preferred example of the present invention, the amplification primers of D02-CANN |], C11-CANNI1, DM029, DM016, 4910 and BO1-CANNI are labeled with FAM; E07-CANN], 9269, BO5-CANNI1, H06-CANN2, 5159 and nH09 are labeled with HEX; ANUCS 501, CS1 and ANUCS 305 are labeled with TRMRA; 3735, ANUCS 302, 1528 and 9043 are labeled with ROX.

In addition, the kit comprises the primer composition of the polymorphic genetic marker, 4xPCR reaction premix VII and deionized water.

The present invention will be described in detail and specifically below by specific 501477 examples and profiles to better understand the present invention, but the following examples do not limit the scope of the present invention.

In the examples, if there are no special instructions, conventional methods are used, and if there are no special instructions, conventional commercially available reagents or reagents prepared according to conventional methods are used for the reagents used.

Example 1 This example provides a method detecting polymorphic genetic markers for forensic identification of Cannabis sativa L., which comprises the following steps:

1. Screening of Cannabis sativa L. STR loci suitable for forensic science; The literature report and the gene database provide the basis for the searching of STR loci of Cannabis sativa L., however, only a portion of these STR loci are suitable for the research of Cannabis sativa L. compound amplification system. After screening polymorphic STR loci and eliminating the loci with duplicate dinucleotides, 17 optimal autosomal STR loci and 2 sex determination loci were selected for the kit development. The loci are as follows: DO2-CANNI, C11-CANNI, DM029, DM016, 4910, BOI-CANNI, E07-CANNI, 9269, B05-CANNI, H06-CANN2, 5159, nH09, ANUCS 501, CS1, ANUCS 305, 3735, ANUCS 302, 1528 and 9043. Among them, the sex determination locus DMO029 is related to X chromosome and all samples show a single peak; the sex determination locus DMO016 is related to Y chromosome and all male samples show a single peak, while female samples show no peak.

2. Designing amplification primers.

A multiplex amplification kit containing five-color fluorescent labels (FAM, HEX, TAMRA, ROX and LIZ) was developed, and LIZ fluorescent label (T500) was used as the molecular internal standard.

The genetic markers described in this example and their corresponding amplification primer sequences, labeled fluorescence and final reaction concentration are shown in Table 1.

Table 1 Primer sequence, final reaction concentration and labeled fluorescence of the genetic markers used in the multiplex amplification system

Final LU501477 Genetic reaction Labeled Primer sequence (5”-3") markers concentration | fluorescence (uM) D02-CANN GGTTGGGATGTTGTTGTTGTG (SEQ ID NO. 1) 1 AGAAATCCAAGGTCCTGATGG (SEQ ID NO. 2) Los | C11-CANN GTGGTGGTGATGATGATAATGG (SEQ ID NO. 3) 1 TGAATTGGTTACGATGGCG (SEQ ID NO. 4) os | GATGACAGACTTCCTGATTG (SEQ ID NO. 5) DM029 GTCTAAGAGTGGGAATGCTA (SEQ ID NO. 6) os | GCCCAAGTTGCTGCTGAG (SEQ ID NO. 7) DM016 CCCACCGTTTAGGGAGCA (SEQ ID NO. 8) os | AGATTCCCAAGATGAGCAA (SEQ ID NO. 9) 4910 ACAAACTGGTATCAAGAGCC (SEQ ID NO. 10) ow | B01-CANN ATGACATACCAGACAGAAACTC (SEQ ID NO. 11) 06 | Fam | 1 CATCCATAGCATTATCCCACT (SEQ ID NO. 12) ow | CAAATGCCACACCACCTTC (SEQ ID NO. 15) E07-CANNI1 CCCAAACTACTGTTTGTGCC (SEQ ID NO. 15) 9269 ACTTGCACGTGATGTTAGATCC (SEQ ID NO. 16) oe | B05-CANN TTGATGGTGGTGAAACGGC (SEQ ID NO. 17) 1 CCCCAATCTCAATCTCAACCC (SEQ ID NO. 18) os | H06-CANN TGGTTTCAGTGGTCCTCTC (SEQ ID NO. 19) 2 ACGTGAGTGATGACACGAG (SEQ ID NO. 20) oe | 5159 AGTACGAAAGGGCACTGAGG (SEQ ID NO. 22) Lou |

TCTTGACTGTAGTAATCCAGC (SEQ ID NO. 24) 0.04 AGCAATAATGGAGTGAGTGAAC (SEQ ID NO. 25) ANUCS 501 AGAGATCAAGAAATTGAGATTCC (SEQ ID NO.

0.05 26) AAGCAACTCCAATTCCAGCC (SEQ ID NO. 27) CSI TAATGATGAGACGAGTGAGAACG (SEQ ID NO.

0.05 28) ANUCS 305 TGAAGCCGATGCCCTAT (SEQ ID NO. 30) los | TGATTCTGTGTTTGTGTGCAAT (SEQ ID NO. 31) 3735 CATCGCACCCACAGGITAGT SEOIDNO 3) | 005 | AACATAAACACCAACAACTGC (SEQ ID NO. 33) ANUCS 302 ATGGTTGATGTTTTGATGGT (SEQ ID NO. 34) Lou | GGACTTTGTCTAGTGCCTTTG (SEQ ID NO. 35) 1528 GAGTACTTGGCTGATGATGG (SEQ ID NO. 36) os | AGGTCTGCGTTGTGCATTATT (SEQ ID NO. 37) 9043 AGGGCTGGTTICAGTTICG(SEQIDNO 3) | 005 | |

3. The construction and the optimization of multiplex PCR amplification system.

The compound amplification of 19 genetic markers was realized by adjusting and optimizing the PCR reaction conditions, including primer concentration, annealing temperature, cycle number, DNA template amount, etc. As a result, balanced and stable typing results of PCR products were obtained.

The composition of the multiplex PCR amplification system described in this example is shown in Table 2.

Table 2 The composition of the multiplex PCR amplification system of Cannabis sativa 14501477 System composition Volume (uL) 4x PCR reaction premix VII 5 de-ionized water 13-X Primer mixture (10uM) 2 DNA (1ng) X Ideal results can be obtained by using the following procedures on various reaction thermal cyclers (such as ABI 9700, ABI 9600, ABI 2720, Bio-Rad iCycler, etc.): pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at 56°C for 1 minute and extension at 60°C for 30 seconds, totally 28 cycles; final extension at 60°C for 5 minutes; 15°C heat preservation.

4. Establishment of analytical methods and the detection of PCR products; First, establishing 3100 series, 3130 series or 3500 series genetic analyzer spectral calibration (Matrix) file when using the corresponding model of genetic analyzer. In capillary electrophoresis, 1uL PCR amplification product was mixed with 8.5uL formamide and 0.5uL molecular internal standard (T500 Size Standard). The mixture was denatured at 95°C for 3 minutes, then placed on ice and cooled for 3 minutes. The mixture was detected by genetic analyzer of the above model. Electrophoretic migration parameters of different alleles of each marker were obtained by capillary electrophoresis. Based on this, corresponding Bin files and Panel files were compiled to create electrophoresis analysis methods by following the format requirements of GeneMapper/D v3.2.1 or GeneMapper®ID-X v1.5 software.

The Ladder genotyping profile of the kit is shown in Figure 1; the genotyping profile of a female DNA sample is shown in Figure 2; and the genotyping profile of a male DNA sample is shown in Figure 3.

Example 2 In this example, the method provided in Example 1 was used to detect the DNA of Cannabis sativa L. samples.

Different tissues (flowers, stems, leaves and seeds) of a Cannabis sativa L. sample were collected for DNA extraction. Compound amplification of 19 genetic markers was carried out on the above DNA samples by using the kit developed in Example 1. All samples obtained effective and consistent genotyping results on tested genetic markers. LUS01477 Example 3 In this example, according to the requirements of SWGDAM, forensic validation (concordance, sensitivity, species specificity and forensic parameters) is carried out on the method provided in Example 1, and then the superiority of this method is assessed and determined.

The specific operations are as follows: (1) Concordance study: the genomic DNA of flowers, leaves and stems of the same plant was quantified to 1 ng/uL, and detected by the method provided in Example 1.

The results show (Figure 4) that the kit developed in Example 1 has ideal tissue concordance: the flowers, leaves and stems of the same plant have the same genotyping results.

(2) Sensitivity study: diluting Cannabis sativa L. genomic DNA to 2 ng/uL, 1 ng/uL, 0.5 ng/uL, 0.25 ng/uL, 0.125 ng/uL, 0.0625 ng/uL, 0.03125 ng/uL and 0.015625 ng/L. Using the method provided in Example 1, the genomic DNA of Cannabis sativa L. with the above concentration was detected separately, and the detection was repeated three times for each template sample.

The results show (Figure 5) that the kit developed in Example 1 has high sensitivity: complete genotyping profile can be obtained when the amount of DNA template is as low as

0.125 ng.

(3) Species specificity study: the genomic DNA of common animal species (dog, cat, mouse, sheep, pig, cow, rabbit, chicken, duck, monkey, etc.) and common plant species (Solanum nigrum L., Papaver rhoeas L., mulberry leaf, Papaver somniferum L., Salvia japonica Thunb. and Humulus scandens (Lour.) Merr. (Lour.) Merr.) in forensic science was quantified to 5 ng/uL. The above-mentioned non-Cannabis sativa L.-derived genomic DNA was detected separately by the method provided in Example 1.

The results show (Figure 6) that the kit developed in Example 1 has species specificity: no product peaks were detected in the DNA of other species except Salvia japonica Thunb. and Humulus scandens (Lour.) Merr.. Although some product peaks were observed in the samples of Salvia japonica Thunb. and Humulus scandens (Lour.) Merr., most of them were not in the position of allele peaks, and their peak types were different from those of Cannabis sativa L.,

which would not affect the interpretation of the results. LUS01477 (4) Forensic parameters: 126 Cannabis sativa L. genomic DNA were quantified to 1 ng/uL, and detected by the method provided in Example 1. The heterozygosity (HET), polymorphism information content (PIC), power of discrimination (DP), power of exclusion (PE) of the 17 autosomal STR loci were calculated.

The results showed (Table 3) that the kit developed in Example 1 had good system efficiency: the HET of 17 autosomal STR loci in 126 Cannabis sativa L. samples ranged from

0.2381 to 0.7937, the PIC ranged from 0.2754 to 0.9419, the DP ranged from 0.4624 to 0.9855, and the PE ranged from 0.0410 to 0.5873. The cumulative power of discrimination is 1-3.0x10"!°, and the cumulative power of exclusion is 1-7.4x10*. Cannabis sativa L. sex determination sites DM029 and DMO016 can meet the requirements of sex identification in the tested samples. DM029 and DM016 peaks were detected in all male samples, and only DM029 peak was found in female samples.

Table 3 Forensic parameters of 17 autosomal STR loci in Cannabis sativa L. Genetic HET PIC DP PE markers D02-CANNI 0.5079 0.4334 0.6888 0.1945 C11-CANNI 0.5873 0.7315 0.9093 0.2759 4910 0.5873 0.5745 0.8157 0.2759 B01-CANNI 0.7222 0.8191 0.9452 0.4635 E07-CANNI 0.5317 0.6870 0.8788 0.2168 9269 0.2540 0.2754 0.4642 0.0463 B05-CANNI 0.5397 0.5982 0.8274 0.2246 H06-CANN2 0.3810 0.3986 0.6529 0.1028 5159 0.4365 0.4795 0.7007 0.1377 nH09 0.5164 0.7400 0.8990 0.2023 ANUCS501 0.4048 0.4081 0.6427 0.1168 Csi 0.7937 0.9419 0.9855 0.5873 ANUCS305 0.5081 0.7849 0.9188 0.1947 3735 0.7063 0.8149 0.9466 0.4382

ANUCS302 0.5556 0.7750 0.9239 0.2409 LUSO1477 1528 0.2381 0.4846 0.7106 0.0410 9043 0.5556 0.5822 0.8172 0.2409 It can be seen from the above examples that the primer composition, kit and method of the present invention, which can detect 17 autosomal STR loci and 2 sex determination sites in Cannabis sativa L. samples in parallel, provides a brand-new detection means for sex identification, individual identification, origin inference and STR database in forensic research of Cannabis sativa L..

The specific examples of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific examples described above. For those skilled in the art, any equivalent modifications and substitutions of the present invention are also within the scope of the present invention. Therefore, equal changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Sequence Listing <110> Academy of Forensic Science <120> Primer composition, kit and method for forensic identification of Cannabis sativa L.

<130> PT1717 <160> 38 <170> SIPOSequenceListing 1.0 <210> 1 <211> 21 <212> DNA <213> Primers for amplifying D02-CANNI (Artificial Sequence) <400> 1 gattgggatg ttettattet g 21 <210> 2

<> 21 LU501477 <212> DNA <213> Primers for amplifying DO2-CANNT1 (Artificial Sequence) <400> 2 agaaatccaa ggtcctgatg g 21 <210> 3 <211> 22 <212> DNA <213> Primers for amplifying C11-CANNI (Artificial Sequence) <400> 3 gtogtootoa tgatgataat gg 22 <210> 4 <211> 19 <212> DNA <213> Primers for amplifying C11-CANNI (Artificial Sequence) <400> 4 tgaattggtt acgatggcg 19 <210> 5 <211> 20 <212> DNA <213> Primers for amplifying DM029 (Artificial Sequence) <400> 5 gatgacagac ttectgattg 20 <210> 6 <211> 20 <212> DNA <213> Primers for amplifying DM029 (Artificial Sequence) <400> 6 gtctaagagt gggaatgcta 20 <210> 7

<211> 18 LU501477 <212> DNA <213> Primers for amplifying DMO016 (Artificial Sequence) <400> 7 gcccaagttg ctectgag 18 <210> 8 <211> 18 <212> DNA <213> Primers for amplifying DMO016 (Artificial Sequence) <400> 8 cccaccgttt agggagca 18 <210> 9 <211> 19 <212> DNA <213> Primers for amplification of 4910 (Artificial Sequence) <400> 9 agattcccaa gatgagcaa 19 <210> 10 <211> 20 <212> DNA <213> Primers for amplification of 4910 (Artificial Sequence) <400> 10 acaaactggt atcaagagcc 20 <210> 11 <211> 22 <212> DNA <213> Primers for amplifying BO1-CANNI (Artificial Sequence) <400> 11 atgacatacc agacagaaac tc 22 <210> 12

<211> 21 LU501477 <212> DNA <213> Primers for amplifying BO1-CANNI (Artificial Sequence) <400> 12 catccatagc attatcccac t 21 <210> 13 <211> 19 <212> DNA <213> Primers for amplifying E07-CANNI (Artificial Sequence) <400> 13 caaatgccac accaccttc 19 <210> 14 <211> 21 <212> DNA <213> Primers for amplifying E07-CANNI (Artificial Sequence) <400> 14 gtggtagcca ggtataggta g 21 <210> 15 <211> 20 <212> DNA <213> Primers for amplifying 9269 (Artificial Sequence) <400> 15 cccaaactac tetttetgcc 20 <210> 16 <211> 22 <212> DNA <213> Primers for amplifying 9269(Artificial Sequence) <400> 16 acttgcacgt gatgttagat cc 22 <210> 17

211> 19 LU501477 <212> DNA <213> Primers for amplifying BOS-CANNI (Artificial Sequence) <400> 17 ttgatggtgg tgaaacggc 19 <210> 18 <211> 21 <212> DNA <213> Primers for amplifying BOS-CANNI (Artificial Sequence) <400> 18 ccccaatete aatctcaacc C 21 <210> 19 <211> 19 <212> DNA <213> Primers for amplifying H06-CANN2 (Artificial Sequence) <400> 19 tggtttcagt gatectetc 19 <210> 20 <211> 19 <212> DNA <213> Primers for amplifying H06-CANN2 (Artificial Sequence) <400> 20 acgtgagtga tgacacgag 19 <210> 21 <211> 20 <212> DNA <213> Primers for amplifying 5159 (Artificial Sequence) <400> 21 ccagagcttg tggatctect 20 <210> 22

<211> 20 LU501477 <212> DNA <213> Primers for amplifying 5159(Artificial Sequence) <400> 22 agtacgaaag ggcactgagg 20 <210> 23 <211> 21 <212> DNA <213> Primers for amplifying nHO9 (Artificial Sequence) <400> 23 ccaacatttt ctcagaaccc a 21 <210> 24 <211> 21 <212> DNA <213> Primers for amplifying nH09 (Artificial Sequence) <400> 24 tcttgactgt agtaatccag c 21 <210> 25 <211> 22 <212> DNA <213> Primers for amplifying ANUCS 501 (Artificial Sequence) <400> 25 agcaataatg gagtgagtga ac 22 <210> 26 <211> 23 <212> DNA <213> Primers for amplifying ANUCS 501 (Artificial Sequence) <400> 26 agagatcaag aaattgagat tcc 23 <210> 27

211> 20 LU501477 <212> DNA <213> Primer for amplifying CS1 (Artificial Sequence) <400> 27 aagcaactcc aattccagec 20 <210> 28 <211> 23 <212> DNA <213> Primer for amplifying CS1 (Artificial Sequence) <400> 28 taatgatgag acgagtgaga acg 23 <210> 29 <211> 16 <212> DNA <213> Primers for amplifying ANUCS 305 (Artificial Sequence) <400> 29 agcccgaccg tgaaga 16 <210> 30 <211> 17 <212> DNA <213> Primers for amplifying ANUCS 305 (Artificial Sequence) <400> 30 tgaagccgat gccctat 17 <210> 31 <211> 22 <212> DNA <213> Primer for amplifying 3735 (Artificial Sequence) <400> 31 tgattctgtg tttgteteca at 22 <210> 32

211> 20 LU501477 <212> DNA <213> Primer for amplifying 3735 (Artificial Sequence) <400> 32 catcgcaccc acaggttagt 20 <210> 33 <211> 21 <212> DNA <213> Primers for amplifying ANUCS 302 (Artificial Sequence) <400> 33 aacataaaca ccaacaactg c 21 <210> 34 <211> 20 <212> DNA <213> Primers for amplifying ANUCS 302 (Artificial Sequence) <400> 34 atggttgatg ttttgatggt 20 <210> 35 <211> 21 <212> DNA <213> Primers for amplifying 1528 (Artificial Sequence) <400> 35 ggactttgtc tagtgcecttt g 21 <210> 36 <211> 20 <212> DNA <213> Primers for amplifying 1528 (Artificial Sequence) <400> 36 gagtacttgg ctgatgatgg 20 <210> 37

<> 21 LU501477 <212> DNA <213> Primers for amplifying 9043 (Artificial Sequence) <400> 37 aggtctgcgt tgtgcattat t 21 <210> 38 <211> 19 <212> DNA <213> Primers for amplifying 9043 (Artificial Sequence) <400> 38 agggctggtt tcagtttcg 19

Claims (10)

CLAIMS LU501477

1. A primer composition for forensic identification of Cannabis sativa L. is characterized by comprising amplification primers of 17 polymorphic autosomal STR loci of Cannabis sativa L. and 2 sex determaination sites; wherein the 17 autosomal STR loci include D02-CANN], C11-CANNI, 4910, BO1-CANNI1, E07-CANNI, 9269, BO5-CANN1, H06-CANN2, 5159, nH09, ANUCS 501, CS1, ANUCS 305, 3735, ANUCS 302, 1528 and 9043; the two sex determination sites are DM029 and DM016.

2. The primer composition according to claim 1, characterized in that the sequences of amplification primers of 17 autosomal STR loci and 2 sex determination sites of Cannabis sativa L. are as follows: D02-CANNI1: SEQ ID NO. 1-2; C11-CANNI1: SEQ ID NO. 3-4; DM029: SEQ ID NO. 5-6; DM016: SEQ ID NO. 7-8; 4910: SEQ ID NO. 9-10; BO1-CANN1: SEQ ID NO. 11-12; E07-CANNI1: SEQ ID NO. 13-14; 9269: SEQ ID NO. 15-16; BOS-CANNT1: SEQ ID NO. 17-18; H06-CANN2: SEQ ID NO. 19-20; 5159: SEQ ID NO. 21-22; nH09: SEQ ID NO. 23-24; ANUCS 501: SEQ ID NO. 25-26; CS1: SEQ ID NO. 27-28; ANUCS 305: SEQ ID NO. 29-30; 3735: SEQ ID NO. 31-32; ANUCS 302: SEQ ID NO. 33-34; 1528: SEQ ID NO. 35-36; 9043: SEQ ID NO. 37-38.

3. The primer composition according to claim 1, characterized in that one primer in each pair of amplification primers is labeled with a fluorescent dye, and the fluorescent dye is selected from one of FAM, HEX, TRMRA or ROX; wherein the amplification primers of DO2-CANNI, C11-CANNI1, DM029, DM016, 4910 and BO1-CANNI are FAM labeled, E07-CANNI1, 9269, BO5-CANNI1, H06-CANN2, 5159 and nH09 are HEX labeled; ANUCS 501, CS1 and ANUCS 305 are TRMRA labeled; 3735, ANUCS 302, 1528 and 9043 are ROX labeled; the concentrations of the amplification primers in the primer composition of claim 1 are as follows: D02-CANNI1: 0.03uM; C11-CANNTI: 0.03 uM; DM029: 0.05 uM; DM016: 0.03 uM; 4910:

0.04 uM; BO1-CANNI1: 0.06 uM; E07-CANNI: 0.05 uM; 9269: 0.04 uM; BO5-CANNI1: 0.03 uM; H06-CANN2: 0.04 uM; 5159: 0.04 uM; nH09: 0.04 uM; ANUCS 501: 0.05 uM; CS1: 0.05 uM; ANUCS 305: 0.05 uM; 3735: 0.05 uM; ANUCS 302: 0.04 uM; 1528: 0.05 uM; 9043: 0.05 uM.

4. A kit for forensic identification of Cannabis sativa L. including the primer composition according to any one of claims 1-3 is characterized in that the total volume of the PCR amplification system is 20 uL, including a SpL 4x PCR reaction premix VII, a 2uL 10x primer mixture, 13-X uL deionized water and 1 ng/uL genomic DNA XuL.

5. The method for forensic identification of Cannabis sativa L. that primer composition according to any one of claims 1-3 or the kit according to claim 4 is characterized in that it is specifically used for sex identification, individual identification and origin inference of Cannahi3}501477 sativa L.; the method comprises the following steps: step 1, PCR amplification is carried out on the genomic DNA of the to-be-tested sample by using amplification primers with the sequence shown in SEQ IDNO. 1-38; step 2, taking PCR amplification products, mixing them with proper amount of molecular internal standard and formamide; denaturing then cooling that mixture; step 3, using genetic analyzer to carry out typing detection.

6. The method according to claim 5, characterized in that the step 1 further comprises DNA extraction of flowers, stems, leaves and/or seeds of the sample to be tested to prepare genomic DNA samples.

7. The method according to claim 5, characterized in that the procedure of PCR compound amplification in step 1 is: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at 56°C for 1 minute and extension at 60°C for 30 seconds, totally 28 cycles; final extension at 60°C for 5 minutes; 15°C heat preservation; the PCR amplification is achieved through a reaction thermal cycler; the reaction thermal cycler is selected from one of the following models, ABI9700, ABI9600, ABI2720, Bio-Rad iCycler or Bio-Rad C1000.

8. The method according to claim 5, characterized in that the molecular internal standard in step 2 adopts T500 Size Standard and LIZ fluorescence labeling; the 5-Dye Matrix Standards were used for fluorescence calibration.

9. The method according to claim 5, characterized in that the volume ratio of PCR amplification products, molecular internal standard and formamide in step 2 is 1:8.5:0.5.

10. The method according to claim 5, characterized in that the genetic analyzer in step 3 is selected from one of 3100 series, 3130 series and 3500 series genetic analyzers.