CN109022542A - A method of visualization identification soybean A saponins type - Google Patents

A method of visualization identification soybean A saponins type Download PDF

Info

Publication number
CN109022542A
CN109022542A CN201810829360.0A CN201810829360A CN109022542A CN 109022542 A CN109022542 A CN 109022542A CN 201810829360 A CN201810829360 A CN 201810829360A CN 109022542 A CN109022542 A CN 109022542A
Authority
CN
China
Prior art keywords
type
saponins
soybean
added
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810829360.0A
Other languages
Chinese (zh)
Inventor
岳爱琴
杜维俊
赵晋忠
赵巧玲
王敏
高春燕
张永坡
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi Agricultural University
Original Assignee
Shanxi Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi Agricultural University filed Critical Shanxi Agricultural University
Priority to CN201810829360.0A priority Critical patent/CN109022542A/en
Publication of CN109022542A publication Critical patent/CN109022542A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to plant genetics and breeding technical fields, and in particular to a method of visualization identification soybean A saponins type；The specific probe of the detection soyasaponin synthase gene of DNAzyme label is added by design, it is expanded with positive and negative primer pair soyasaponin synthase gene, simultaneously digestion soyasaponin synthase gene is specifically identified using exonuclease, form single-stranded target segment, hybridize chain reaction with probe again, DNAzyme in probe is marked into release, finally by the saponin(e type in chromogenic reaction judgement sample；The method of the present invention is quick, accurate, efficient and cheap, can be applied to the genetic test system of various metabolite types, especially has very high practical value to the screening of Crop quality breeding and specific materials.

Description

A method of visualization identification soybean A saponins type
Technical field
The present invention relates to plant genetics and breeding technical fields, and in particular to one kind is related to hybridizing chain reaction The method of the visualization identification soybean A saponins type of (Hybridization Chain Reaction, HCR).
Background technique
Soyasaponin is a kind of important one of secondary metabolite in soybean growth course, is had many beneficial to human body Physiological function.Soyasaponin is many kinds of, structure is complicated, according to the different big 54 kinds of discovery at present of soyasaponin aglycon Beans saponin(e is divided into seven classes: A class, B class, DDMP class, E class, H class, I class and J saponins.A saponins account for always respectively in embryo and cotyledon 68.78%, the 43.17% of saponin content.A class soyasaponin is divided into tri- series of Aa, Ab and Ao.It is existing that analyze and identify A class big The method of beans saponin(e mainly has: thin-layered chromatography, high performance liquid chromatography, high performance liquid chromatography-mass spectrometry technology and preparation Type high performance liquid chromatography.These methods respectively have shortcoming, and thin-layered chromatography identifies that the type accuracy of A saponins is not high, high Effect liquid phase chromatogram method and the accuracy of high performance liquid chromatography-mass spectrometry technology are high, but its instrument price is expensive, operating cost Height, long operational time, it is difficult to meet the detection of lot of materials in crop breeding.Therefore establish a kind of high sensitivity, accuracy it is good, Quick and easy and low testing cost method is particularly important to saponin(e Research on kinds in soybean.Aa, Ab Type Soybean saponin(e difference By being controlled by the codominant allele UGT73F4 and UGT73F2 in the site GmSg-1, it is based on UGT73F4 and UGT73F2 base Announcement and HCR method Visual retrieval polymorphism because of sequence combine, and develop one kind by nucleotide sequence variation and develop one kind It is capable of the method for efficiently and accurately visualization identification A class soyasaponin type, has for the identification of soyasaponin type germ plasm resource Important meaning.
Summary of the invention
The present invention is that the existing identification soybean A saponins type accuracy of solution is not high or instrument is expensive, operation It is at high cost, long operational time, it is difficult to which the technical issues of meeting the detection of lot of materials in crop breeding provides a kind of for visual Change the PCR amplification primer sequence of the method for identification soybean A saponins type；One kind is for visualizing identification soybean A saponins class The probe of the method for type；A kind of and method of visualization identification soybean A saponins type.
In order to solve the above technical problems, the technical scheme adopted by the invention is as follows:
It is a kind of for visualize identification soybean A saponins type method PCR amplification primer sequence, the primer sequence are as follows:
F2:5'- pATCCCACGACTTGCCTTCA-3'；
R2:5'- CCCGTGTCGGAATGGAGT-3'.
It is a kind of for visualize identification soybean A saponins type method probe,
For detecting the probe of Aa type soyasaponin are as follows:
GAa1:5'-CCTCTTCGCCGTCAGCGCCATGAAGTCCGTGGGTAGGGCGGGTTGGGAAATTACCCACCGACTTC ATGGCGCTGACGGCG-3'；
GAa2:5'-CGGACTTCATGGCGCTGACGGCGAAGAGGCGCCGTCAGCGCCATGAAGTCGGTGGGTA-3'；
For detecting the probe of Ab type soyasaponin are as follows:
GAb1:5'-CTCTTCTCCGGCGCCGCCATGAAGTGCGTGGGTAGGGCGGGTTGGGAAATTACCCACCCACTTC ATGGCGGCGCCGGAG-3'；
GAb2:5'-GCACTTCATGGCGGCGCCGGAGAAGAGGCTCCGGCGCCGCCATGAAGTGGGTGGGTA-3'。
A method of visualization identification soybean A saponins type, comprising the following steps:
A, Soybean genomic DNA is extracted from soybean material to be identified；
B, it is carried out using extracted Soybean genomic DNA in step a as template using amplimer as described in claim 1 Pcr amplification reaction, the PCR reaction condition are as follows: 95 DEG C of 5 min；95 DEG C of 1 min, 6 DEG C of 45 s, 72 DEG C of 8s, 35 are followed Ring；72 DEG C of 10 min, 15 DEG C of preservations, amplifies the target sequence of 92bp；
C, Lambda Exonuclease and the resulting PCR product of step b are added in digestion system for endonuclease reaction；Reaction condition Are as follows: 37 DEG C of 90 min；85℃ 15min；Endonuclease reaction cuts away the complementary strand of target fragment, and obtained digestion products are single-stranded mesh Standard film section；
D, HCR react, the HCR reaction system are as follows: be added in system probe GAa1/GAa2 as claimed in claim 2 or GAb1/GAb2, HCl-NaCl, the digestion products of step c, reaction condition are 37 DEG C of 60 min；
E, hemin, Triton X-100, ABTS and H is added into the system after step d reaction in chromogenic reaction2O2It is shown Colour response, 14-16min observe color change；
If the aobvious green of probe GAa1/GAa2 is added, GAb1/GAb2 is added and does not develop the color, then soybean material A saponins class to be identified Type is Aa type；
If the aobvious green of probe GAb1/GAb2 is added, GAa1/GAa2 is added and does not develop the color, then soybean material A saponins class to be identified Type is Ab type；
If the aobvious green of probe GAb1/GAb2 is added, GAa1/GAa2 is added and also shows green, then soybean material A saponins to be identified Type is Aa/Ab type.
The above method is that the specific of detection soyasaponin synthase gene that DNAzyme is marked is added by design to visit Needle is expanded with positive and negative primer pair soyasaponin synthase gene, is specifically identified using exonuclease and digestion is big Beans saponin formation enzyme gene forms single-stranded target segment, then HCR occurs with probe and reacts, and the DNAzyme in probe is marked Release, finally by the A saponins type in chromogenic reaction judgement sample.The DNAzyme label released in HCR reaction Object, the marker can form the specific structure with peroxidase activity, and hemin, chromogenic substrate and peroxidating is added It after hydrogen, develops the color at room temperature, the color change that directly detects by an unaided eye is to judge the saponin(e type of the sample.
Compared with prior art the invention has the following advantages:
1) rapidity, very quick using the method for the present invention identification, 3-4 hours it can be learnt that qualification result, can identify daily 150-200 material.2) practicability, existing real-time fluorescence PCR technology usually to detection device requirement with higher, from And make detection that there is certain limitation, and identification method of the present invention only needs regular-PCR instrument, therefore, so that A class in soybean The identification of saponin(e type becomes simpler, practical, conveniently.3) economy, existing real-time fluorescence PCR technology, agents useful for same It is all higher with the expense of synthesising probing needle, and probe sequence and marker involved in the present invention are all by common nucleotide group At synthesis facilitates cheap, therefore, greatly reduces testing cost.4) accuracy can be accurate using identification method of the present invention The errorless type for identifying soybean A saponins.5) to identify A saponins type in soybean visual by obtaining one kind by the present invention Change label, the molecular labeling of practicability can be provided for the molecular breeding of saponin(e type in identification soybean germplasm.
Detailed description of the invention
Fig. 1 is in embodiment 1GmSg-1Gene PCR result detects electrophoretogram, and (respectively label is respectively M:Trans2K in figure Plus DNA marker；0: negative control；1: military black；2: iron rich 31；3: middle yellow 13；4: Fen beans 56；5:L-6；6: Shanxi beans 52,； 7: losing 30 in Shanxi；8: very heavy beans；9: Shanxi is big by 70；10: Jin Ke No. 4).
Fig. 2 is the target fragment and probe of HCR reaction, and wherein GA1 is GAa1/GAb1 probe, GA2 GAa2/GAb2.
Fig. 3 is (two rows of from left to right to distinguish 1: military black by the colour developing figure for identifying soybean sample in embodiment 1；2: Shanxi It is big by 73；3: losing 30 in Shanxi；4: Jin Ke No. 4；5:WS285；6: Shanxi is big 47).
Specific embodiment
Below in conjunction with specific embodiment, the invention will be further described.
Embodiment 1
One, extracting genome DNA
Choose Aa type (military black, mountain is peaceful), Ab type (Jin Ke 4, very heavy beans), Aa/Ab type (Shanxi big 47, WS285) soybean material mention Take DNA.Specific following steps:
(1) 65 DEG C of water-bath preheats SDS- buffer (100 mM Tris-HCl pH 8.5,100 mM NaCl, 50 mM EDTA PH 8.0,2% SDS) 20 min；Appropriate blade is ground in liquid nitrogen, takes and is put into 2 mL centrifuge tubes in right amount, 800 μ L are added The SDS- buffer of preheating, concussion mixes immediately；
(2) the warm bath 1-2 h in 65 DEG C of water-baths is mild during water-bath to overturn for several times；
(3) centrifuge tube is taken out, the phenol-chloroform (V/V=1:1) that isometric (800 μ L) is added in every pipe in ventilating kitchen is mixed, shaking table Mix 1 h；
(4) 12000 rpm are centrifuged 15 min；Supernatant is moved to another centrifuge tube by the pipette tips cut with scissors；In ventilating kitchen It is added and the isometric chloroform of supernatant；Soft to mix 20 min, 12000 rpm are centrifuged 15 min；
(5) supernatant is taken, the isopropanol of the pre-cooling of 0.6 times of volume is added, mixes and stands 20 min, 12000 rpm centrifugation 10 Min, by DNA centrifugation to tube bottom；
(6) liquid phase is outwelled, it is dry after being washed 2-3 times with 70% ethyl alcohol；
(7) DNA is dissolved in 500 1 × TE(pH of μ L 8.0), add 6 μ L RNA enzyme (10 mg/mL), 37 DEG C of 1 h of constant temperature；
(8) the chloroform-isoamyl alcohol solution of isometric (600 μ L) is added, shaking table mixes 20 min, 12000 rpm centrifugation 15 min；
(9) supernatant is taken, the sodium acetate (pH 8.0) of 1/10 volume, 3 M and the cold dehydrated alcohol of 2 times of volumes is added, gently mixes Even, -20 DEG C of standings 30 min, 10000 rpm are centrifuged 15 min；
(10) outwell liquid phase, washed with 70% ethyl alcohol dry after 1-2 times, be dissolved in suitable 1 × TE(pH 8.0), -20 DEG C save to With；
(11) with nucleic acid-protein detector measurement DNA concentration and relative purity.
Two,GmSg-1The amplification of gene and the acquisition of gene target fragment
According in the website NCBIGmSg-1Gene order AB628091, using 5.0 software of Primer Premier, design should The special F1/R1 of genome.F1:5'-ATGGGGTCTCTTGTCATCTTCA-3', R1:5'- TAGAGAACAAAAGAAGGCGTAGTG -3'；Choose 5 Aa types, 5 Ab type soybean materials carry outGmSg-1Genome sequence Amplification, electrophoresis result show 10 materials amplify 1844 bp or so single band it is as shown in Figure 1.To sequencing gained DNA sequence dna is compared, the results showed thatGmSg-1aWithGmSg-1bGene shares 19 SNP site differences, wherein 10 SNP Point causes amino acid variation, remaining 9 SNP is same sense mutation.It choosesGmSg-1The more segment of gene order SNP site is mesh Standard film section (391-482 bp), design primer F2/R2, wherein the end 5' of primers F 2 carries out phosphorylation, carries out next step experiment.
Three, design HCR reacts probe
Two couples of complementary special hairpin structure probe GAa1/GAa2 and GAb1/GAb2 are designed according to selected target fragment, such as Shown in attached drawing 2, in GAa1/GAb1 probe 1 ', 2 ' and target fragment in 29bp sequence it is complementary, 3,4 be G- tetrad segment, 3 ' With 3 complementations, 2^ and 2 ' is complementary other than having the difference of a base, in GAa2/GAb2 probe in 1,2 sequences and target fragment 29bp is identical, and 2^ ' and 2 is complementary other than having the difference of a base, and 3 is identical with 3 in GAa1/GAb1.
Four, sample identification
1) PCR reaction amplification: with Aa type (military black, mountain is peaceful), Ab type (Jin Ke 4, very heavy beans), Aa/Ab type (Shanxi big 47, WS285) Soybean material extract genomic DNA be template carry out PCR amplification.30 μ L of system total volume, wherein DNA profiling (20 ng/ μ L) 4.2 μ L, 10 × buffer, 3.0 μ L, each 0.6 μ L of positive anti-primer (F2/R2) (10 μm of ol/L), dNTP (2.5 μ Mol/L) 2.4 μ L, 0.6 μ L TransStart Taq and 18.6 μ L ddH2O.PCR program: 95 DEG C of 5 min；95℃ 1 Min, 6 DEG C of 45 s, 72 DEG C of 8s, 35 circulations；72 DEG C of 10 min, 15 DEG C of preservations, amplifies the target sequence of 92bp.
2) endonuclease reaction: 1 μ L Lambda Exonuclease, 19 μ L PCR products.37℃ 90 min；85℃ 15min, endonuclease reaction cut away the complementary strand of target fragment, obtain single-stranded target segment.
3) HCR reacts: system total volume 10 μ L, 0.5 μ L GAa1 add 0.5 μ L HCl-NaCl, 0.5 μ LGAa2 to add 0.5 μ L HCl-NaCl, the two is mixed, and then adds 8 μ L digestion products again；Or 0.5 μ L GAb1 add 0.5 μ L HCl-NaCl, 0.5 μ LGAb2 adds 0.5 μ L HCl-NaCl, and the two is mixed, and then adds 8 μ L digestion products again；The GAa1/GAa2 or GAb1/GAb2 Concentration be 10 μm of ol/L, the concentration of HCl is 0.04M in the HCl-NaCl, and the concentration of NaCl is 4M.37 DEG C, 60 min.
4) chromogenic reaction: hemin 1.2 μm of ol/L, Triton X-100 0.002 %, ABTS 3.8 mmol/L, H2O2 1.5mM, 15min or so observe color change.As a result as shown in figure 3, Aa type soybean material force is black, GAa1/GAa2 is rather added in mountain The aobvious green of probe, is added GAb1/GAb2 and does not develop the color；GAa1/GAa2 probe is added not in Ab type soybean material Shanxi section 4, very heavy beans The aobvious green of GAb1/GAb2 is added in colour developing；Aa/Ab type soybean material Shanxi is big 47, the aobvious green of GAa1/GAa2 probe is added in WS285, The aobvious green of GAb1/GAb2 is added.
<110>Agricultural University Of Shanxi
<120>a kind of method of visualization identification soybean A saponins type
<160>8
<210>1
<211>22
<212>DNA
<213>artificial sequence
<220>
<223>soybean material carries out the primers F 1 of GmSg-1 genome sequence amplification
<400>1
ATGGGGTCTCTTGTCATCTTCA
<210>2
<211>24
<212>DNA
<213>artificial sequence
<220>
<223>soybean material carries out the primer R1 of GmSg-1 genome sequence amplification
<400>2
TAGAGAACAAAAGAAGGCGTAGTG
<210>3
<211>19
<212>DNA
<213>artificial sequence
<220>
<223>it is used to visualize the PCR amplification primer F2 of the method for identification soybean A saponins type, wherein the end 5' of primers F 2 Carry out phosphorylation
<400>3
pATCCCACGACTTGCCTTCA
<210>4
<211>18
<212>DNA
<213>artificial sequence
<220>
<223>for visualizing the PCR amplification primer R2 of the method for identification soybean A saponins type
<400>4
CCCGTGTCGGAATGGAGT
<210>5
<211>80
<212>DNA
<213>artificial sequence
<220>
<223>for detecting the probe GAa1 of Aa type soyasaponin
<400>5
CCTCTTCGCC GTCAGCGCCA TGAAGTCCGT GGGTAGGGCG GGTTGGGAAA TTACCCACCG 60
ACTTCATGGC GCTGACGGCG 80
<210>6
<211>58
<212>DNA
<213>artificial sequence
<220>
<223>for detecting the probe GAa2 of Aa type soyasaponin
<400>6
CGGACTTCAT GGCGCTGACG GCGAAGAGGC GCCGTCAGCG CCATGAAGTC GGTGGGTA
<210>7
<211>79
<212>DNA
<213>artificial sequence
<220>
<223>for detecting the probe GAb1 of Ab type soyasaponin
<400>7
CTCTTCTCCG GCGCCGCCAT GAAGTGCGTG GGTAGGGCGG GTTGGGAAAT TACCCACCCA 60
CTTCATGGCG GCGCCGGAG 79
<210>8
<211>57
<212>DNA
<213>artificial sequence
<220>
<223>for detecting the probe GAb2 of Ab type soyasaponin
<400>8
GCACTTCATG GCGGCGCCGG AGAAGAGGCT CCGGCGCCGC CATGAAGTGG GTGGGTA

Claims (7)

1. a kind of for visualizing the PCR amplification primer sequence of the method for identification soybean A saponins type, which is characterized in that institute State primer sequence are as follows: F2:5'- pATCCCACGACTTGCCTTCA-3'；
R2:5'- CCCGTGTCGGAATGGAGT-3'.
2. a kind of for visualizing the probe of the method for identification soybean A saponins type, which is characterized in that
For detecting the probe of Aa type soyasaponin are as follows:
GAa1:5'-CCTCTTCGCCGTCAGCGCCATGAAGTCCGTGGGTAGGGCGGGTTGGGAAATTACCCACCGACTT CATGGCGCTGACGGCG-3'；
GAa2:5'-CGGACTTCATGGCGCTGACGGCGAAGAGGCGCCGTCAGCGCCATGAAGTCGGTGGGTA-3'；
For detecting the probe of Ab type soyasaponin are as follows:
GAb1:5'-CTCTTCTCCGGCGCCGCCATGAAGTGCGTGGGTAGGGCGGGTTGGGAAATTACCCACCCACTTC ATGGCGGCGCCGGAG-3'；
GAb2:5'-GCACTTCATGGCGGCGCCGGAGAAGAGGCTCCGGCGCCGCCATGAAGTGGGTGGGTA-3'。
3. a kind of method of visualization identification soybean A saponins type, which comprises the following steps:
A, Soybean genomic DNA is extracted from soybean material to be identified；
B, it is carried out using extracted Soybean genomic DNA in step a as template using amplimer as described in claim 1 Pcr amplification reaction, the PCR reaction condition are as follows: 95 DEG C of 5 min；95 DEG C of 1 min, 6 DEG C of 45 s, 72 DEG C of 8s, 35 are followed Ring；72 DEG C of 10 min, 15 DEG C of preservations, amplifies the target sequence of 92bp；
C, Lambda Exonuclease and the resulting PCR product of step b are added in digestion system for endonuclease reaction；Reaction condition Are as follows: 37 DEG C of 90 min；85℃ 15min；Endonuclease reaction cuts away the complementary strand of target fragment, and obtained digestion products are single-stranded mesh Standard film section；
D, HCR react, the HCR reaction system are as follows: be added in system probe GAa1/GAa2 as claimed in claim 2 or GAb1/GAb2, HCl-NaCl, the digestion products of step c, reaction condition are 37 DEG C of 60 min；
E, hemin, Triton X-100, ABTS and H is added into the system after step d reaction in chromogenic reaction2O2It develops the color Reaction, 14-16min observe color change；
If the aobvious green of probe GAa1/GAa2 is added, GAb1/GAb2 is added and does not develop the color, then soybean material A saponins class to be identified Type is Aa type；
If the aobvious green of probe GAb1/GAb2 is added, GAa1/GAa2 is added and does not develop the color, then soybean material A saponins class to be identified Type is Ab type；
If the aobvious green of probe GAb1/GAb2 is added, GAa1/GAa2 is added and also shows green, then soybean material A saponins to be identified Type is Aa/Ab type.
4. a kind of method of visualization identification soybean A saponins type according to claim 3, which is characterized in that step b In PCR reaction system: 30 μ L of system total volume, wherein 4.2 μ L DNA profilings, 3.0 10 × buffer of μ L, positive anti-primer Each 0.6 μ L of F2/R2,2.4 μ L dNTP, 0.6 μ L TransStart Taq and 18.6 μ L ddH2O；The DNA profiling The concentration that concentration is 20 ng/ μ L, primers F 2/R2 is 10 μm of ol/L, and the concentration of dNTP is 2.5 μm of ol/L.
5. a kind of method of visualization identification soybean A saponins type according to claim 3, which is characterized in that step c Digestion system be 1 μ L Lambda Exonuclease, the 19 resulting PCR products of μ L step b.
6. one kind according to claim 3, which is characterized in that the HCR reaction system of step d is 10 μ L, 0.5 μ L GAa1 0.5 μ L HCl-NaCl, 0.5 μ LGAa2 is added to add 0.5 μ L HCl-NaCl, the two is mixed, then again plus 8 μ L digestion products；Or 0.5 μ L GAb1 adds 0.5 μ L HCl-NaCl, 0.5 μ LGAb2 to add 0.5 μ L HCl-NaCl, the two is mixed, then again plus 8 μ L enzymes Cut product；The concentration of the GAa1/GAa2 or GAb1/GAb2 is 10 μm of ol/L, and the concentration of HCl is in the HCl-NaCl The concentration of 0.04M, NaCl are 4M.
7. a kind of method of visualization identification soybean A saponins type as claimed in claim 3 is in soyasaponin type germplasm Application in the identification of resource, and the application in the screening of Crop quality breeding and specific materials.
CN201810829360.0A 2018-07-25 2018-07-25 A method of visualization identification soybean A saponins type Pending CN109022542A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810829360.0A CN109022542A (en) 2018-07-25 2018-07-25 A method of visualization identification soybean A saponins type

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810829360.0A CN109022542A (en) 2018-07-25 2018-07-25 A method of visualization identification soybean A saponins type

Publications (1)

Publication Number Publication Date
CN109022542A true CN109022542A (en) 2018-12-18

Family

ID=64646297

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810829360.0A Pending CN109022542A (en) 2018-07-25 2018-07-25 A method of visualization identification soybean A saponins type

Country Status (1)

Country Link
CN (1) CN109022542A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110205394A (en) * 2019-05-10 2019-09-06 中国农业大学 It is a kind of for detecting the biosensor and method of salmonella
CN115927720A (en) * 2022-09-16 2023-04-07 江苏省农业科学院 Soyasaponin related KASP marker and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104651486A (en) * 2014-08-12 2015-05-27 岳巧云 Method and kit for visually identifying American cockroaches

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104651486A (en) * 2014-08-12 2015-05-27 岳巧云 Method and kit for visually identifying American cockroaches

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JUAN DONG等: "Amplified detection of nucleic acid by G-quadruplex based hybridization chain reaction", 《BIOSENSORS AND BIOELECTRONICS》 *
赵巧玲等: "山西大豆皂苷类型及其关键酶基因表达分析", 《生物技术通报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110205394A (en) * 2019-05-10 2019-09-06 中国农业大学 It is a kind of for detecting the biosensor and method of salmonella
CN115927720A (en) * 2022-09-16 2023-04-07 江苏省农业科学院 Soyasaponin related KASP marker and application thereof
CN115927720B (en) * 2022-09-16 2023-10-13 江苏省农业科学院 Soy saponin related KASP (KASP) mark and application thereof
WO2024055406A1 (en) * 2022-09-16 2024-03-21 江苏省农业科学院 Soybean saponin-related kasp marker and use thereof

Similar Documents

Publication Publication Date Title
US11926869B2 (en) Development of simple sequence repeat (SSR) core primer group based on whole genome sequence of pomegranate and application thereof
CN105803071B (en) SNP marker relevant to melon powdery mildew resistance and its application
CN111304356B (en) Molecular marker primer combination for rapidly identifying sex traits of Chinese torreya in high throughput manner and application thereof
CN110438252B (en) Molecular marker closely linked with male and female sex of spinach and application thereof
CN106755437A (en) A kind of SNP marker of identification of being bloomed for Chinese cabbage group bolting
CN107746896B (en) SNP (Single nucleotide polymorphism) marker related to peach fruit skin and villus character and application thereof
CN107630103B (en) CAPS molecular marker method for identifying rice varieties and application
CN109628628A (en) The development and application of the SNP marker of rice blast resistant gene Pi2
CN106521021B (en) It is a kind of for identifying that rice grain is wide and the genetic marker of the haplotype of grain weight GS5 gene and application
CN109022542A (en) A method of visualization identification soybean A saponins type
KR101358416B1 (en) Method for Detecting Target Genes or Their Mutations Using Ligase Reaction and Nicking Amplification Reaction
CN106167825B (en) A kind of relevant microsatellite marker of yellow catfish growing characteristic and its detection and application
EP2875155B1 (en) Endpoint zygosity assay to detect rf4 gene in maize
JP7391321B2 (en) Oligonucleotide set and kit for determining the DNA type of P. acnes and method for determining the DNA type of P. acnes
CN107365873A (en) Molecular labeling and its application with the millet leaf sheath color linkage of characters
CN111763668B (en) Sequencing primer group and PCR-based whole genome sequencing method
CN109735646A (en) A kind of CAPS molecular labeling and method and its application for identifying rice varieties
CN105779570A (en) Method for detecting SNP sites
CN105567842B (en) Identify Hericium erinaceus monkey outstanding No. 2 primer pairs and method
CN113817861B (en) KASP (KASP-related fragment thereof) mark related to isoorientin content of corn and application of KASP mark
CN109694865B (en) Characteristic sequence, labeled primer and identification method of apocarya variety Desirable
Ehsanpour et al. Application of RAPD (Random Amplified Polymorphic DNA) marker for sex determination of Pistacia vera L.
CN116814841B (en) Primer group for identifying rice black brown glume gene HK4, and method and application thereof
KR101429231B1 (en) Primer Sets for Selecting Discriminating Color of Anthocyanin in Rice Pericarp and the Selecting Method thereof
CN101086010B (en) Dedicated primer for trichogram matids molecular identification and method for identifying trichogram matids

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20181218

RJ01 Rejection of invention patent application after publication