LU500610B1 - Method and aptamer pq-6 for recognizing tumor target protein jup and application thereof - Google Patents

Abstract

The disclosure provides a method and an aptamer PQ-6 for recognizing tumor target protein JUP and application thereof. The target protein JUP recognized by the aptamer PQ-6 is expressed on the surfaces of multiple tumors and associated with invasiveness of tumors, thus the ability of the aptamer PQ-6 to specifically recognize the JUP protein can be used for researches on multiple tumors. In addition, because of strong cell internalization, the aptamer PQ-6 can serve as a target vector to be coupled with an anti-tumor drug to construct a target drug delivery system, thereby achieving the target therapy of tumors while reducing the side effects brought by the non-target effect of a chemotherapeutic drug.

Description

METHOD AND APTAMER PQ-6 FOR RECOGNIZING TUMOR TARGET PROTEIN JUP AND APPLICATION THEREOF 100000

TECHNICAL FIELD

[0001] The disclosure specifically relates to the technical field of molecular biology, and particularly relates to a method and aptamer PQ-6 for recognizing tumor target protein JUP and application thereof.

BACKGROUND

[0002] Cell membrane proteins play an important role in all organisms, including cell signaling, intercellular interaction, etc. In the process of tumor occurrence and progression, abnormal changes in membrane protein can directly reflect differences between cancer cells and their corresponding normal cells, so as to provide a basis for cancer diagnosis. In addition, abnormal tumor membrane proteins can be used for studying the tumorigenesis mechanism, and can also be used as effective targets for tumor therapy. Therefore, tumor marker membrane proteins play an extremely important role in tumor diagnosis, progress prediction, detection and treatment.

[0003] JUP protein, also known as y catenin, belongs to a catenin family. The members of the family include a, B and y catenins and pl120ctn protein. The JUP protein and ß catenin tightly bind to the catenin binding region of cadherin in a mutually exclusive manner, and the other end binds to à catenin. The œ catenin binds to an actin cytoskeleton to form a cadherin-catenin complex which plays an important role in maintaining normal signaling and adhesion functions of cells, and can participate in the signaling transduction of tumorigenesis and regulate the progression of tumors. It has been reported that the JUP protein is associated with proliferation and invasion of multiple tumors, such as melanoma, oral squamous cell carcinoma, B-cell acute lymphoblastic leukemia, pancreatic ductal adenocarcinoma and etc. Researches show that in patients with breast cancer, the high expression of the JUP protein can allow tumor cells to be adhered together and swarmed into the blood, so as to promote distant metastasis of tumors and results in poor prognosis of patients. In the progression of ovarian cancer, the up-regulation of the JUP protein promotes ovarian cancer cells to be aggregated with each other to form spheres, so as to promote the release of cancer cells to the abdominal cavity. Therefore, the JUP protein is a meaningful marker and therapeutic target in the process of tumorigenesis.

[0004] An aptamer, ssDNA or ssRNA in nature, is a kind of short single stranded oligonucleotide molecules capable of binding specifically to targets. The aptamers targeting specific targets can be selected from a large oligonucleotide library through in-vitro selection 1 technology-Systematic Evolution of Ligands by Exponential Enrichment (SELEX). The aptamer has the advantages of high affinity and strong specificity, and can effectively identify LU500610 cancer cells and normal cells. In addition, compared with traditional antibodies, it also has the advantages of small molecular weight, easy modification, easy preparation, no immunogenicity, low toxicity and high biosecurity. Therefore, the aptamer has shown broad application prospects in the aspects of basic research, clinical diagnosis, drug development, etc. A series of experiments prove that the aptamer PQ-6 specifically recognize tumor cells by binding to the JUP protein on the surface of the cell.

[0005] The research of target ligands is of great significance in target therapy of tumors. At present, the target ligands studied in most cases mainly include antibodies, peptides and small molecular compounds, but these ligands have many limitations in practical application. For example, although the polypeptides have small molecular weights and are easy to synthesize, they are easy to degrade, which limits their application in vivo; although the antibodies have high affinity to the target, they have high immunogenicity and high cost; although the small molecule compounds have many advantages, they require tumor cells to express many corresponding receptors in order to achieve their targeting effect. Compared with them, the aptamers have many merits. The aptamer has high specificity and high affinity to target molecules, so it can realize the targeting delivery of anticancer drugs. In addition, the aptamer is easy to synthesize in vitro, low in cost, easy to modify, good in stability in vivo and strong in tissue penetration ability. The JUP protein is highly expressed on the surfaces of many tumor cells and can be internalized.

SUMMARY

[0006] In order to solve the technical defects existing in the prior art, the disclosure provides a method and aptamer PQ-6 for recognizing tumor target protein JUP and application. The aptamer PQ-6 can be used for recognition and diagnosis of multiple tumor cells, construction of a target drug delivery system and mechanism research of tumor cells.

[0007] The technical solution adopted by the disclosure is a method for recognizing tumor target protein JUP, the method containing: recognizing JUP protein through an aptamer having the following sequence: 5”-ACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCACTAGGGGATA-3’, or a sequence with primer sequences at both ends of the sequence 5S’-ACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCACTAGGGGATA-3”.

[0008] The primer sequence at the 5’ end has 19 nucleotides, and the primer sequence at the 2

3’ end has 19 nucleotides. LU500610

[0009] The primer sequence at the 5’ end is ACCGACCGTGCTGGACTCA, and the primer sequence at the 3° end is ACTATGAGCGAGCCTGGCG.

[0010] In the method, an aptamer having a similar function is obtained through addition, deletion and substitution of bases.

[0011] Both ends or one end of the aptamer is linked with fluorescent groups, biotin, enzyme labeled substances, radioactive substances, therapeutic substances, etc. to obtain a functionalized aptamer derivative which also has the ability of binding to JUP protein.

[0012] The method containing the following steps:

[0013] (1) proving that a target to which the aptamer PQ-6 binds is a cell membrane protein through trypsin and protease K digestion experiments;

[0014] (2) extracting the cell membrane protein by a membrane and cytosol protein extraction kit;

[0015] (3) incubating the extracted membrane protein with biotin-labeled PQ-6 or a random ssDNA library, and then incubated with agarose beads coated with streptavidin, so as to obtain a protein binding to the aptamer PQ-6 and the random library through a aptamer pull-down experiment;

[0016] (4) isolating the protein using SDS-PAGE gel and analyzing differential proteins between PQ-6 and the random ssDNA library; 10017] (5) cutting the differential proteins on the SDS-PAGE gel, carrying out enzymolysis, and performing mass spectrometry; and

[0018] (6) verifying mass spectrometry results utilizing RNAi knockdown technology and flow cytometry so that the target protein is determined as JUP.

[0019] Provided is an aptamer PQ-6 for recognizing tumor target protein JUP, the nucleic acid having the following sequence:

[0020] 5°-ACCGACCGTGCTGGACTCAACTCGCCGAGGGAGGGCTTTCCAGGGTTTC CACTAGGGGATAACTATGAGCGAGCCTGGCG-3".

[0021] The both ends or one end of the sequence comprises modifications or transformations comprising radioactive labeling, therapeutic drug connection, fluorescent labeling or biotin 3 labeling. LU500610

[0022] Provided is use of an aptamer in preparation of a drug for recognizing tumor target protein JUP.

[0023] Both ends or one end of the aptamer is linked with fluorescent groups, biotin, enzyme labeled substances, radioactive substances, therapeutic substances, etc. to obtain a functionalized aptamer derivative which also has an ability of binding to JUP protein.

[0024] The disclosure has the beneficial effects: the disclosure provides a method and aptamer PQ-6 for recognizing tumor target protein JUP and application, the aptamer PQ-6 can be used for recognition and diagnosis of multiple tumor cells, construction of a target drug delivery system and mechanism research of tumor cells. The aptamer has the advantages of good targeting, strong binding ability, convenient synthesis in vitro, easy modification, low fabrication cost, strong internalization, etc., the JUP protein is highly expressed on the surfaces of multiple many tumors, and its related aptamer PQ-6 can be internalized by cells. Therefore, the aptamer PQ-6 specifically binding to JUP can be used as a targeting ligand, and coupled with an anticancer drug to construct a target drug delivery system.

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Fig.1 shows identification of target types and differential bands; wherein, the left of the figure shows identification of target types; the right of the figure shows differential bands.

[0026] Fig. 2 shows the fluorescence signal of PQ-6 and JUP antibody in co-localization experiment.

[0027] Fig.3 shows the binding of a pull-down sample to a JUP antibody.

[0028] Fig. 4 shows the binding ability of the human esophageal cancer cell line TE-1 to PQ-6 after RNAi knockdown of JUP protein.

[0029] Fig.5 shows an affinity curve and a Kd value of PQ-6 and JUP protein.

[0030] Fig.6 shows a competition experiment between JUP antibody and aptamer PQ-6, in which the left of the figure shows that the JUP antibody competes with the aptamer PQ-6; the right of the figure shows that the aptamer PQ-6 competes with the JUP antibody.

[0031] Fig.7 is a cell scatter diagram of JUP antibody and aptamer PQ-6.

[0032] Fig.8 shows light field and confocal imaging of normal cells and normal cells whose phenotype is affected by tumor supernatant.

4

[0033] Fig. 9 shows cellular internalization of PQ-6. LU500610

[0034] Fig. 10 is a fluorescence diagram showing the coupling of aptamer PQ-6 and doxorubicin, in which the left of the figure shows a fixed concentration of aptamer and different aptamer-doxorubicin molar ratios are prepared; the right of the figure is a fixed concentration of doxorubicin, and different doxorubicin-aptamer molar ratios are prepared.

[0035] Fig. 11 shows investigation of targeting of a PQ-6-Dox chimera with flow cytometry, in which the left of the figure shows PQ-6-Dox chimera and TE-1 tumor cells; the right of the figure shows PQ-6-Dox chimera and HEK-293T control cells.

[0036] Fig.12 shows investigation of competition between PQ-6-Dox chimera and aptamer PQ-6 with flow cytometry.

[0037] Fig.13 shows internalization of a PQ-6-Dox chimera by flow cytometry.

[0038] Fig.14 shows analysis on targeting and internalization of a PQ-6-Dox chimera with microscopy confocal imaging.

[0039] Fig.15 shows toxic effects of PQ-6-Dox chimera on tumor cells and normal cells.

DESCRIPTION OF THE EMBODIMENTS

[0040] The technical solution in the embodiments of the disclosure will be clearly and completely described below in combination with the accompanying drawings in the embodiments of the disclosure. Obviously, the described embodiments are only parts of the embodiments of the disclosure rather all the embodiments. Based on the embodiments of the disclosure, all other embodiments obtained by those skilled in the art without creative efforts belong to the protection scope of the disclosure.

[0041] The cell lines used in the experiments include: a human esophageal cancer cell line (TE-1), a human pancreatic cancer cell line (PANC-1), a human cervical lymph node metastasis of oral squamous cell carcinoma cancer cell line (GNM), a human embryonic kidney cell line (HEK-293T) and a human retinal pigment epithelial cell line (ARPE-19), which are all purchased from Procell Life Science &Technology Co., Ltd.

[0042] The washing buffer contains: DPBS, 5 mM MgCl, 4. 5mg/ml glucose.

[0043] The binding buffer contains: DPBS, 5 mM MgCl, 4.5 mg/ml glucose, 0.1 mg/ml tRNA and 1 mg / ml BSA.

[0044] 5% BSA blocking buffer : 1g BSA, 20ml DPBS. 5

[0045] DNA blocking buffer: 4 ml binding buffer, 1 ml fetal bovine serum, 5 mg salmon LU500610 sperm DNA.

[0046] The aptamers required in those experiments were all synthesized by Sangon Biotech (Shanghai) Co, Ltd.

[0047] The purchased reagents:

[0048] Membrane and Cytosol Protein Extraction Kit, RIPA Lysis buffer, PMSF (100 mM) and Hoechst 33342 living cell staining solution were all purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0049] DPBS, BSA, trypsin, protease K, DMEM medium and RPMI1640 medium were all purchased from Thermo Fisher Scientific.

[0050] Enzyme-free cell dissociation solution was purchased from Applygen Technologies Inc., Beijing, China.

[0051] SiRNA and RNAI transfection reagents were purchased from Shanghai GenePharma Co. Ltd.

[0052] Doxorubicin hydrochloride was purchased from Shanghai Macklin Biochemical Co., Ltd.

[0053] Omni-PAGE prefabricated glue, two-color pre-staining protein Marker, TBS/Tween buffer, Omni-Flash™ transfer buffer, Omni-ECL™ ultra-sensitive chemiluminescence detection kit, WB primary antibody diluent, Goat anti-rabbit IgG-HRP, ECL chemiluminescence solution, skimmed milk powder, loading buffer, Coomassie brilliant blue staining solution, etc. were purchased from Shanghai Epizyme Technology Co., Ltd.

[0054] The anti-gamma catenin antibody was purchased from Beijing BIOSYNTHESIS Biotechnology Co., Ltd;

[0055] gamma Catenin antibody (CTNG/1664) [FITC] was purchased from Novus Biologicals.

[0056] I. Identification of target types

[0057] 1. Preparation of ssDNA: ssDNA was centrifuged at 13000 rpm, at 4 °C for 3 mins, the powder was aggregated to the bottom and a sterile DPBS solution was added, so as to prepare a 100 uM system. 0.5 pL aptamer PQ-6 and a random ssDNA library were taken and 199.5 uL 6 binding buffer were added, so that the final concentration of DNA was 250 nM. The DNA denatured at 95 °C for 10 mins and then incubated on ice for 10 mins, for later use. LU500610

[0058] PQ-6 sequence:

[0059] ACCGACCGTGCTGGACTCAACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCA

CTAGGGGATAACTATGAGCGAGCCTGGCG

[0060] Library sequence:

[0061] ACCGACCGTGCTGGACTCA(N)s&2ACTATGAGCGAGCCTGGCG

[0062] (2) Preparation of cell samples: TE-1 cells were cultured to a logarithmic growth stage, the above TE-1 cells were washed twice with DPBS, then two dishes of cells were added with trypsin and protease K respectively and then digested for 10 mins at room temperature, the rest dishes of cells were added with the enzyme-free digestive solution and then digested under the same conditions, and subsequently complete media were added to terminate digestion, and then centrifugation and counting were performed, so that the number of cells in each group was 2 x 10°.

[0063] (3) Incubation of samples: random library were added into cells digested with the enzyme-free digestion solution, then PQ-6 was added into cells that were not specially treated and digested with trypsin, protease K and the enzyme-free digestion solution, respectively, and incubated for 1 h in a shaker at 4 °C in the dark. After incubation, the cells were centrifuged and washed three times with washing buffer, then re-suspended with binding buffer, and the fluorescence intensity of the cells was detected by a flow cytometeter.

[0064] As shown in Fig. 1 (left), the aptamer PQ-6 is capable of specifically recognizing TE-1 cells, however, PQ-6 loses the recognition ability after membrane proteins on the surfaces of the TE-1 cells were treated with protease K and trypsin, which indicates that the type of the target that can be recognized by the aptamer PQ-6 is membrane protein.

[0065] II. Exploration and mass spectrometry identification of differential bands of aptamer target proteins

[0066] 1. Preparation of membrane proteins

[0067] (1) TE-1 cells in 30 T75 culture dishes (the number of cells was about 1.2 x 10°) were prepared, the medium was discarded when the cell fusion degree was about 90-95%, and then the cells were washed three times with pre-cooled DPBS.

7

[0068] (2) The enzyme-free digestion solution was added to digest in a 37 °C incubator, then ; ; ; ; LU500610 DPBS was added, and the resulting mixture was centrifuged for 5 mins at 4 °C and 600g to remove supernatant.

[0069] (3) Membrane protein extraction reagents were prepared: extraction reagents A and B were dissolved and uniformly mixed at room temperature, the mixed extraction reagent was placed on ice immediately after melting, appropriate amounts of extraction reagents À and B were taken for later use, and PMSF was added within a few minutes before use so that the final concentration of PMSF was 1 mM.

[0070] (4) Pretreatment of cells: the extraction reagent A with PMSF was added into the cells, the cells were sufficiently re-suspended, and then placed on the ice for 10-15 mins.

[0071] (5) Cell disruption with freeze-thaw method: the cell mixture was placed in liquid nitrogen to be quick frozen for 1 min and then melted at room temperature, the above steps were repeated for 3-4 times until more than 70% of cells were broken.

[0072] (6) Removing the nucleus, unbroken cells and precipitated cell membrane fragments: the supernatant was taken after centrifugation for 10 mins at 4 °C and 700g, then the supernatant was centrifuged for 30 mins at 4 °C and 14000g, and then the supernatant was removed.

[0073] (7) Extraction of membrane protein: the extraction reagent B was added, the mixture was violent vortexed for 5 s at the highest speed, precipitated, and incubated on ice for 5-10 mins, this step was repeated twice, then the resulting mixture was centrifuged at 4 °C and 14000g for 5 mins, and the supernatant was collected namely cell membrane protein solution.

[0074] 2. Pull-down assay

[0075] (1) Three 1.5ml EP tubes were taken and labeled as blank, library and aptamer groups, respectively. Streptavidin-coated agarose beads were added, and the samples were washed with washing buffer for 3 times.

[0076] (2) Blocking of beads: 5% BSA was added into each EP tube, the cells were incubated for 1 h in a rotary shaker at 4 °C. After blocking, the cells were washed with WB buffer for 5 times, centrifuged for 3 mins at 5500rpm and 4 °C, and incubated on ice for later use.

[0077] (3) Blocking of protein: the DNA blocking buffer was added into the collected protein samples, the resulting mixture was incubated at 4 °C for 1h. After blocking, 100ul of protein samples were taken as a total protein sample group.

8

[0078] (4) Incubation of blank sample beads with collected proteins: the blocked membrane ; ; ; . LU500610 proteins were added into the blank beads, and incubated at 4 °C for 1h, the incubated product was centrifuged (5500rpm, 4 °C, 5 mins) after incubation, and the supernatant after centrifugation was used for the next experiment. The beads were placed on ice.

[0079] (5) The supernatant obtained in the previous step was incubated with the random library solution for 1h at 4 °C. After incubation, the incubated product and library group beads were incubated for 1h at 4 0. After incubation, the resulting mixture was centrifuged (5500rpm, 4 0, 5 mins). The supernatant after centrifugation was used for the next experiment, and the beads were placed on ice.

[0080] (6) The supernatant obtained in the previous step was incubated with PQ-6 aptamer solution for 1h at 4 0. After incubation, it was incubated with beads of the aptamer group for 1h at 4 0. After incubation, it was centrifuged (5500rpm, 4 [J, 5 mins). The supernatant was used for the next experiment, and the beads were placed on ice.

[0081] (7) Three groups beads were centrifugated and washed 5 times with washing buffer.

Loading buffer was added into the reserved total protein samples and the beads of the three groups after centrifugation, and the resulting mixtures were denatured at 100 [J for 10 mins, cooled on ice for 10 mins and stored at -80 O.

[0082] 3. SDS-PAGE electrophoresis

[0083] (1) The prepared samples were added into prefabricated holes in SDS-PAGE in a sequence of marker, total protein, blank beads, library group beads, aptamer beads and marker. A power supply was turned on until bromophenol blue bands migrated to the glue bottom layer, and electrophoresis was ended.

[0084] (2) Coomassie blue staining: a suitable amount of Coomassie Blue Fast Staining Solution was added to cover the gel and stain for 2h on a horizontal shaker at room temperature.

After staining, the samples were washed with pure water for 4 ~ 5 times to obtain clear protein bands. The positions of differential protein bands are shown in Fig. 1 (right).

[0085] 4. Mass spectrometry

[0086] After the differential bands were found, the differential bands were cut carefully, subjected to enzymolysis in gel, and then underwent mass spectrometry. The relevant protein information in the differential protein bands were obtained by analysis on original mass spectrometry data via Proteome Discovery 1.3, alignment with human protein data in Uniprot 9 and retrieval via Sequset software. After these data were analyzed and selected, the results are shown in Table 1. According to conditions such as abundances of membrane proteins and LU500610 proteins, the JUP protein is preliminarily determined as a target protein of PQ-6. Table 1 Mass spectrum data of differential proteins P14923 142.39 24 2.72E+07 81745 5 Junction plakoglobin P68104 120.72 12 7.92E+06 50141 5 Elongation factor 1 Q13835 89.72 10 5.72E+06 82861 5 Plakophilin-1 P14618 60.18 7 2.81E+06 57937 4 Pyruvate kinase P0O7355 52.36 8 3.88E+06 38604 5 Annexin A2 Q96P63 41.76 4 1.81E+06 46276 4 Serpin B12 Q96QA5 31.54 2 3.51F+05 49365 4 Gasdermin-A P06733 27.97 2 2.06E+06 47169 5 Alpha-enolase P05154 22.07 2 2.59E+05 45675 5 Plasma serine protease inhibitor POCG48 63.89 4 9.87E+05 77039 4 Polyubiquitin-C

[0087] III. Co-localization of PQ-6 and JUP antibody

[0088] The confocal laser scanning microscopy imaging technology can intuitively display the fluorescence signal on the surface of the cell. The co-localization of aptamer PQ-6 and JUP protein was observed by a confocal laser scanning microscope, which further proves that the target of PQ-6 was the JUP protein.

[0089] The specific experimental steps are as follows;

[0090] 1. Preparation of cells: TE-1 cells were pre-inoculated in a confocal dish, and the cells were washed three times with washing buffer for later use when the level of cell confluence reached about 90%.

[0091] 2. Preparation of samples: 50 pmol Cy5-labeled PQ-6 labeled and FITC-labeled JUP antibody were added into an EP tube with 200 pL binding buffer. 10

[0092] 3. Incubation: the complex of prepared ssDNA and antibody was added into the cells ; ; LU500610 and the cells were incubated at 4 [J for 1h in the dark.

[0093] 4. Confocal microscopy imaging: the results are shown in Fig. 2, suggesting that the fluorescence signal of Cy5-labeled PQ-6 overlaps with that of FITC-labeled JUP antibody.

[0094] IV. Verification of target protein with Western blot

[0095] 1. Protein samples were prepared according to step (2) of the pull-down assay: total protein, blank beads, sample of library group beads and sample of aptamer PQ-6 beads, and the protein samples were added into the prefabricated holes in gel in turn for electrophoresis.

[0096] 2. Electrotransfer: after electrophoresis, pieces of filter paper and PVDF membrane with the same size were cut according to the size of glue, clamped on a plate in a sequence of filter paper, PVDF membrane, glue and filter paper, soaked in the transfer buffer, and electrotransferred at a constant current of 300mA for 90 mins on ice.

[0097] 3. Blocking: after electrotransfer, the PVDF membrane was blocked with skimmed milk at room temperature for 2h.

[0098] 4. Incubation with primary antibody: the JUP antibody was diluted in a ratio of 1:1000 and incubated overnight at 4 [J, and then the antibody was washed 3 times with TBST buffer.

[0099] 5. Incubation with secondary antibody: incubate with secondary antibody at 4 [1 for 2h, and then wash with TBST buffer 3 times.

[00100] 5. Chemiluminescence detection 100101] As shown in Fig. 3, the amount of the JUP protein bound by beads of aptamer PQ-6 group is much greater than the amount of the JUP protein bound by beads of random ssDNA library group, which further proves that the target recognized by PQ-6 is the JUP protein.

[00102] V. Small interfering RNA knockdown and verification of target protein

[00103] 1. TE-1 cells in good condition were selected 24 h in advance and digested, cell suspension was collected, cell density was measured, and the cells were inoculated in a 6-well plate and cultured in a constant temperature cell incubator, wherein 1.5 x 10° cells were inoculated in each hole. The next day, the cells were observed and subjected to siRNA transfection. The sequence of interfering RNA is as follows: sense anti-sense 11

NC 5’-UUC UCC GAA CGU GUC ACG 5’-ACG UGA CAC GUU CGG AGA UTTS* ATT" LU500610 siRNA1 | 5-GUGCGUACCAUGCAGAAUATT-3" 5-UAUUCUGCAUGGUACGCACTT-3’ siRNA2 =—5-GAGCAUGAUUCCCAUCAAUTT-3° 5-AUUGAUGGGAAUCAUGCUCTT-3"

[00104] 2. Transfection: a serum-free medium was added into a sterile EP tube, an appropriate amount of transfection reagent was added, the mixture was gently uniformly mixed, and incubated at room temperature for 5 mins. Then the serum-free medium and an appropriate amount of siRNA oligo were added into a new sterile EP tube, gently uniformly mixed, and then incubated at room temperature for 5 mins. The GP-transfect-Mate medium mixture was added dropwise into siRNA medium mixture, gently uniformly mixed, incubated at room temperature for 15-20 mins, and then transfected immediately.

[00105] 3. After 72h, the protein expression was detected by Western Blot (the steps were the same as the IV), and the binding ability of PQ-6 to cells with knockdown of JUP was detected by flow cytometry.

[00106] As shown in Fig. 4: the expression amount of JUP in TE-1 cells after siRNA 1 and siRNA 2 interference was greatly decreased, and the binding ability of the TE-1 cells to aptamer PQ-6 was also decreased, while TE-1 cells in blank control group and TE-1 cells after NC sequence interference still bound to aptamer PQ-6, indicating that the ability of aptamer PQ-6 to recognize tumor cells was related to the JUP protein.

[00107] VI. Detection of affinity of PQ-6 to pure protein JUP

[00108] 1. Coating buffer and pure JUP protein were added into an Elisa well plate, and incubated overnight at 4 0. After incubation, the samples were washed with washing buffer three times, then blocking buffer was added, and the resulting mixture was incubated at room temperature for 1h. After incubation, the resulting product was washed with washing buffer three times.

[00109] 2. Aptamer PQ-6 was prepared into biotin-PQ-6 having different concentrations with binding buffer, and the biotin-PQ-6 was added into a well plate and incubated in a shaker at 4 [J for 1h.

[00110] 3. Streptavidin-HRP was added into the well plate and incubated at room temperature for 1h. After incubation, the solution was removed, the obtained product was washed 5 times with washing buffer. After washing, a substrate solution was added, the resulting mixture was 12 incubated at room temperature for 30 mins, and then stop solution was added. LU500610

[00111] 4. Detection was carried out with ELIASA, and Kd value curves were made according to absorption values.

[00112] As shown in Fig. 5, the dissociation constant of PQ-6 binding to JUP protein 1s calculated, Kd=63.27 + 19.66nM, indicating that PQ-6 has a strong affinity to JUP protein.

[00113] VII. Competitive analysis of JUP antibody and PQ-6

[00114] In order to further clarify the relationship between aptamer PQ-6 and JUP antibody, a high-concentration aptamer PQ-6 without a fluorescent label was used to compete with FITC -labeled JUP antibody, and a high-concentration JUP antibody without a fluorescent label was used to compete with FAM-labeled aptamer PQ-6. The fluorescence intensity was detected by flow cytometry.

[00115] As shown in Fig. 6, suggesting that there is no obvious competition between aptamer PQ-6 and the JUP antibody, which indicates that they may bind to different sites of the same protein.

[00116] VIII. The relationship between JUP antibody and aptamer PQ-6 was investigated by scatter diagram of cell

[00117] In order to further investigate the relationship between JUP antibody and aptamer PQ-6, the cell scatter diagram was observed by double labeled fluorescence combined with flow cytometry. The sample are set as follows:

[00118] Group I: blank cells 0

[00119] Group 2: cells were incubated with control library.

[00120] Group 3: cells were incubated with aptamer PQ-6.

[00121] Group 4: cells were incubated with the JUP antibody.

[00122] Group 5: cells were simultaneously incubated with the control library and the JUP antibody.

[00123] Group 6: cells were simultaneously incubated with aptamer PQ-6 and the JUP antibody.

[00124] After incubation, the cells were washed 3 times with washing buffer and then analyzed 13 by flow cytometry. As shown in Fig. 7, there is a linear relationship between the binding strength of aptamer PQ-6 and the binding strength of JUP antibody, indicating that the JUP LU500610 antibody and PQ-6 bind to different binding sites of the same protein, which further proves that the target to which PQ-6 binds is JUP protein.

[00125] IX. PQ-6 is capable of identifying normal cells whose phenotypes are changed after being regulated by tumor supernatant

[00126] In order to investigate whether PQ-6 can recognize normal cells whose phenotypes were changed by tumor factors, tumor supernatant was taken, normal ARPE-19 cells were cultured in an normal RPMI1640 medium and a RPMI1640 medium with tumor supernatant, respectively, and the phenotypic changes of cells were observed under fluorescence microscope. After that, they were incubated with CyS-labeled PQ-6, and observed the binding. Meanwhile, the expressions of JUP proteins in normal ARPE-19 cells and normal cells regulated by tumor factors were monitored by Western blot.

[00127] As shown in Fig. 8, suggesting that under the influence of tumor factors, the phenotype of ARPE-19 cells was changed, and the expression of JUP in the regulated normal cells was much higher than that in normal cells cultured in an ordinary medium. The normal ARPE-19 cells do not bind to PQ-6, but the normal cells with phenotypic changes after being regulated by tumor supernatant can bind to PQ-6 because of the increase of JUP expression. It shows that factors secreted by tumor can induce changes in the phenotype of normal cells, and increase the expression of JUP protein, thereby, it can be recognized by PQ-6. PQ-6 can recognize not only tumor cells, but also normal cells whose phenotypes are affected by tumor cells to be changed to a certain extent.

[00128] X. Investigation of intensity of internalization of PQ-6

[00129] Cy5-labeled aptamer PQ-6 (red) was incubated with tumor cells at 37 [J for 3 hours. After incubation, the incubated product was washed three times with washing buffer. The nucleus was stained with Hoechst (blue) and the cell membrane was stained with DiO (green). The internalization of PQ-6 was observed under the confocal laser scanning microscope.

[00130] As shown in Fig. 9, suggesting that PQ-6 is completely internalized into the cytoplasm, which indicates that it has strong internalization, and lays a foundation for the construction of a target drug delivery system.

[00131] XI. Construction of tumor target drug delivery system PQ-6-Dox chimera 14

[00132] Doxorubicin is an anti-tumor antibiotic with a wide-spectrum anti-tumor activity. . Cp ; ; ; ; LU500610 Doxorubicin can inhibit the synthesis of RNA and DNA and kill tumor cells in various growth cycles. However, its clinical application 1s limited by 1ts high toxicity. Therefore, it is proposed to couple the aptamer with doxorubicin to explore whether the toxicity of doxorubicin to other normal cells is reduced while targeted killing of tumor cells.

[00133] The modified aptamer can bind to a drug through physical action in binding buffer, but it is necessary to explore the optimal coupling ratio of aptamer PQ-6 with doxorubicin hydrochloride (Dox).

[00134] 1. Preparation of PQ-6-Dox chimeras with different molar ratios in two groups: the concentration of Dox 5 uM was fixed, the aptamers PQ-6 and Dox with different molar ratios were prepared; the concentration of aptamer PQ-6 5 uM was fixed, aptamers PQ-6 and Dox with different molar ratios were prepared.

[00135] 2. Vibrate in a microplate oscillator for 10s, the microplate was wrapped with tin foil paper, and incubated in a constant temperature incubator at 37 0 for 1h.

[00136] 3. The fluorescence spectrum scanning was carried out within the range of 500-700 nm under the excitation light of 480nm wavelength using a full wavelength microplate reader. Diagram was made by graphpad software to select the optimal ratio.

[00137] As shown in Fig. 10. With the increase of the concentration of the aptamer, the fluorescence of Dox is weaker and weaker, which shows that Dox can be effectively inserted into PQ-6. Furthermore, when PQ-6: Dox = 1:2, the fluorescence no longer decreases, indicating that 2 molecules of Dox can be inserted into 1 molecule of PQ-6.

[00138] XII. Analysis of targeting ability of PQ-6-Dox chimera

[00139] This experiment mainly explores whether the loading of Dox affects the targeting ability of PQ-6. FAM-labeled PQ-6 and Dox were incubated at room temperature for 1 hour at a molar ratio of 1:2. After incubation, the incubated product was put on ice for later use. Other random ssDNA libraries with FAM labels and PQ-6 were denatured, cooled and then placed on ice for later use. The prepared ssDNA and chimera were incubated with corresponding cells, the incubated product was washed with washing buffer, and the fluorescence intensity of cells was detected by flow cytometry.

[00140] As shown in Fig. 11, suggesting that the PQ-6-Dox chimera loaded with Dox do not affect the tumor cell targeting ability of PQ-6, and the chimera does not bind to the control cell 15

HEK-293T. LU500610

[00141] XIII. Competition test between PQ-6-dox chimera and PQ-6

[00142] In order to explore whether the binding sites of chimera loaded with Dox and PQ-6 in cells are the same or not, the chimera without fluorescence label was used to be competed with FAM-labeled PQ-6 labeled. Firstly, the chimera without label was incubated for 1 h, then FAM-labeled PQ-6 was incubated for 1 h, and flow cytometry detection was performed after incubation. The control group library and aptamer PQ-6 were incubated with cells for 1 h respectively and then detected by flow cytometry.

[00143] As shown in Fig. 12, suggesting that the chimera can compete with PQ-6, which indicates that the chimeric strand and aptamer PQ-6 bind to the same site.

[00144] XIV. Analysis on internalization of PQ-6-Dox chimera with flow cytometry

[00145] In this experiment, whether the PQ-6-Dox chimera could selectively release Dox into different cells under physiological conditions was mainly observed. A chimerawith a molar ratio of PQ-6: DoX of 1:2 (PQ-6 without fluorescent label) was prepared and incubated at room temperature for 1 h. After incubation, Dox solution, PQ-6-Dox chimera and corresponding cells were incubated at 37 [J for 1 h, and then the fluorescence intensity of Dox was detected by a flow cytometer.

[00146] As shown in Fig. 13, suggesting that in tumor cells, the fluorescence intensity of the chimerais stronger than that of free Dox, while in normal cells, the fluorescence intensity of Dox in chimera is much lower than that of free Dox, which indicates that the chimera can be loaded with Dox and selectively released into different cells.

[00147] XV. Analysis on targeting of PQ-6-Dox chimera with confocal microscopy imaging

[00148] The fluorescence signal of cells can be intuitively observed by confocal microscopy imaging. The chimera with PQ-6:Dox molar ratio of 1:2 (PQ-6 without fluorescence label) was prepared and incubated at room temperature for 1 h. After incubation, the PQ-6-Doxchimera was incubated with human pancreatic cancer cells (PANC-1), human cervical lymph node metastasis of oral squamous cell carcinoma cancer cells cells (GNM) and human embryonic kidney cell line (HEK-293T) for 1 h at 370. Then the fluorescence intensity of Dox was detected by a flow cytometer.

[00149] As shown in Fig. 14, suggesting that in tumor cells, the fluorescence intensity of the 16 chimera is equivalent to that of free Dox, while in normal cells, the fluorescence intensity of Dox in the chimera is much lower than that of free Dox, which indicates that the chimera has LU500610 targeting and can selectively release Dox into tumor cells.

[00150] XVI. Cytotoxicity of PQ-6-Dox chimera on cells

[00151] Each group of cancer cells and normal cells in logarithmic growth stage were laid in a 96-well plate, in which 2000 cells were incubated in each well. PQ-6-Dox chimera was prepared and incubated with cells for 48 h. After incubation, 10 ul of CCK-8 reagent was added, the mixture was incubated for 2 h at 37 0, the OD value was detected by ELIASA (450nm wavelength), each experiment was repeated independently 3 times, then the relative survival rate of cells was calculated. As shown in Fig. 15, it can be seen that the PQ-6-Dox chimera can kill tumor cells more than free doxorubicin, while in normal cells, the PQ-6-Dox chimera has reduced cytotoxicity than free doxorubicin. This indicates that the PQ-6-Dox chimera can achieve the targeted therapeutic effect and meanwhile toxic and side effects on normal cells are reduced.

[00152] Note to all technicians: although the disclosure has been described according to the above specific embodiments, the inventive idea of the disclosure is not limited to the disclosure, and any modifications made using the inventive idea will be included within the protection scope of this patent.

[00153] The above mentioned is only the preferred embodiment of the disclosure. The protection scope of the disclosure is not limited to the above embodiments. All technical solutions under the idea of the disclosure belong to the protection scope of the disclosure. It should be noted that for persons of ordinary skill in the art, several improvements and refinements made without departing from the principles of the disclosure should also be regarded as the protection scope of the disclosure.

17

Claims (10)

Claims WHAT IS CLAIMED IS: 7500670

1. A method for recognizing tumor target protein JUP, comprising: recognizing JUP protein through an aptamer having the following sequence: 5’-ACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCACTAGGGGATA-3’, or a sequence with primer sequences at both ends of the sequence 5’-ACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCACTAGGGGATA-3".

2. The method for recognizing tumor target protein JUP according to claim 1, wherein the primer sequence at the 5° end has 19 nucleotides, and the primer sequence at the 3° end has 19 nucleotides.

3. The method for recognizing tumor target protein JUP according to claim 2, wherein the primer sequence at the 5’ end is ACCGACCGTGCTGGACTCA, and the primer sequence at the 3’ end is ACTATGAGCGAGCCTGGCG.

4. The method for recognizing tumor target protein JUP according to claim 2, wherein in the method, an aptamer having a similar function is obtained through addition, deletion and substitution of bases.

5. The method for recognizing tumor target protein JUP according to claim 1, wherein both ends of the aptamer are linked with fluorescent groups, biotins, enzyme labeled substances, radioactive substances, therapeutic substances, etc. to obtain a functionalized aptamer derivative which also has the ability of binding to JUP protein.

6. The method for recognizing tumor target protein JUP according to claim 1, the method comprising the following steps: (1) proving that a target to which the aptamer PQ-6 binds is a cell membrane protein through trypsin and protease K digestion experiments; (2) extracting the cell membrane protein by membrane and cytosol protein extraction kit; (3) incubating the extracted membrane protein with biotin labeled PQ-6 or a random library, and then incubated with agarose beads coated with streptavidin, so as to obtain a protein binding to the aptamer PQ-6 and the random library through a pull-down experiment; 18

(4) isolating the protein using SDS-PAGE gel and analyzing differential proteins between PQ-6 and the random library; LU500610 (5) cutting the differential proteins on the SDS-PAGE gel, carrying out enzymolysis, and performing mass spectrometry; and (6) verifying mass spectrometry results utilizing RNAi knockdown technology and flow cytometry, and the target protein is determined as JUP.

7. An aptamer PQ-6 for recognizing tumor target protein JUP, the aptamer having the following sequence: 5’-ACCGACCGTGCTGGACTCAACTCGCCGAGGGAGGGCTTTCCAGGGTTTCCAC TAGGGGATAACTATGAGCGAGCCTGGCG-3".

8. The aptamer PQ-6 according to claim 7, wherein the both ends or one end of the sequence comprises modifications or transformations comprising radioactive labeling, therapeutic drug connection, fluorescent labeling or biotin labeling,

9. Use of an aptamer PQ-6 according to claim 7 in preparation of preparations for recognizing tumor target protein JUP.

10. The use according to claim 9, wherein both ends or one end of the aptamer is linked with fluorescent groups, biotin, enzyme labeled substances, radioactive substances, therapeutic substances, etc. to obtain a functionalized aptamer derivative which also has the ability of binding to JUP protein.

19