LU500595B1

LU500595B1 - miR-16 and miR-30c joint Expression Vector, Construction Method and their Use

Info

Publication number: LU500595B1
Application number: LU500595A
Authority: LU
Inventors: Tianpeng Li; Tingting Sun
Original assignee: Univ Zaozhuang
Priority date: 2020-07-28
Filing date: 2020-11-06
Publication date: 2022-01-28
Also published as: CN111850047B; CN111850047A; WO2022021660A1

Abstract

The present invention belongs to the field of biomedicine, and specifically relates to the use of two small RNAs, i.e., miR-16 and miR-30c in combination for regulating the proliferation of neural stem cells. The present application conducted the following works: (1) the number of adult neural stem cells in the hippocampi of Alzheimer's disease mice increased by 1.96 times, n=6, p <0.001, under the combined action of miR?16 and miR- 30c; (2) after the miR- 16 and miR- 30c overexpression, adult neurogenesis in the subventricular zone of the lateral ventricle and adult neurogenesis in the hippocampal dentate gyrus of Alzheimer's disease mice increased by 13.90 times, n=6, p<0.001, and 6.71 times, n=6, p<0.001, respectively. miR-16 and miR-30c show a significant effect on regulating the proliferation of neural stem cells in adult Alzheimer's disease mice, which is conducive to designing targeted drugs for the treatment of Alzheimer's disease, which can be in turn used in clinic treatment of Alzheimer's disease.

Description

BL-5291 LU500595 miR-16 and miR-30c joint Expression Vector, Construction Method and their Use Technical field

[0001] The present invention provides a miR-16 and miR-30c joint expression vector, which finds application in treating Alzheimer's disease by promoting proliferation of stem cells or neurogenesis, belonging to the field of biological medicine. Background

[0002] Most of the neurons in the adult rodent and primate brains do not have the ability to regenerate. Adult neurogenesis is only confined to part of stem cells located in the hippocampal dentate gyrus and the subventricular zone surrounding the lateral ventricle. Moreover, the proliferation ability of adult neural stem cells continuously decreases with the increase of age. Particularly, recent researches have shown that the occurrence of neurological diseases, especially neurodegenerative diseases, is closely associated with the adult neurogenesis. Enhancing neurogenesis exhibits a vital application value in the diagnosis and treatment of neurological diseases.

[0003] miR-16 has an inhibiting effect on the proliferation of a variety of tumor cells, and also functions as an inducer of early apoptosis capable of causing cell apoptosis. While miR-30c has a positive effect on cell proliferation and thus can promote neurogenesis in the subventricular zone and the hippocampal dentate gyrus of the nervous system. Summary of the invention

[0004] The present invention provides a miR-16 and miR-30c joint expression vector, in which miR-16 and miR-30c are used for regulating the proliferation of neural stem cells, specifically:

[0005] The present invention provides a miR-16 and miR-30c joint expression vector, including an miR-16 down-regulation sequence, an miR-30c over-expression sequence, and a plasmid vector. The miR-16 down-regulation sequence is miR-16-KD, and the miR- 30c over-expression sequence is miR-30c-OE, with their coding sequences being SEQ ID NO: 1 and SEQ ID NO: 2, respectively. 1

BL-5291

[0006] The plasmid vector is a pLV-shRNA2 vector; and the expression vector is a dual- ~~ LU500595 promoter expression vector, specifically a dual-promoter lentiviral vector.

[0007] The joint expression vector is used to promote the proliferation of neural stem cells.

[0008] The joint expression vector is used to promote neurogenesis.

[0009] The nerve cells that the joint expression vector acts on are the nerve cells in the subventricular zone and hippocampal nerve cells.

[0010] The joint expression vector is used for the preparation of a drug for neural stem cell migration.

[0011] The joint expression vector is applied in a reagent for early detection of Alzheimer's disease.

[0012] The miR-16 down-regulation sequence is a sponge vector sequence that is complementary to a mature miR-16 sequence and concatenated for 8 times, which can capture the mature miR-16 sequence in a cell. The miR-30c over-expression sequence is a precursor sequence of miR-30c capable of realizing constitutive expression.

[0013] Beneficial effects of the present invention

[0014] It is the first time to discover that differential expressions of miR-16 and miR-30c appear as growth proceeds, and the expressions of miR-16 and miR-30c are negatively correlated with age. The miR-16 down-regulation vector and the miR-30c over-expression vector are constructed, and transduced neural stem cells in vitro, thereby miR-16 down- regulation, miR-30c over-expression, and increased proliferation of the neural stem cells are observed.

[0015] Labeled with neural stem cell markers and neural precursor cell markers, it is found that inhibiting the expression of miR-16 and promoting the expression of miR-30c can maintain the stemness of stem cells and inhibit their differentiation into neural precursor cells.

[0016] The dual-promoter lentiviral vector capable of simultaneous expressing miR-16 down-regulation sequence and miR-30c over-expression sequence is constructed, and 2

BL-5291 microinjected into the hippocampal dentate gyrus using a brain stereotaxic apparatus. It is LU500595 found that the neurogenesis in the subventricular zone and the neurogenesis in the hippocampal dentate gyrus increase by 13.90 times and 6.71 times, respectively.

[0017] Therefore, regulating the expression levels of miR-16 and miR-30c can effectively improve the proliferation of neural stem cells of mice with Alzheimer's disease, prevent subsequent differentiation, and meanwhile enhance neurogenesis, which is of great significance for early detection and treatment of Alzheimer's disease. Brief Description of the Drawings

[0018] FIG. 1 shows detections of diameters of neurospheres subjected to in vitro proliferation under the combined action of miR-16 and miR-30c; where, (a) shows overall neuron morphologies with 4',6-diamidino-2-phenylindole (DAPI) staining, scale bar: 50 um; (b) shows a statistical analysis of the diameters of neurospheres after proliferation; in which, AD represents Alzheimer's disease (AD) mice group; shRNA represents miR-16 and miR-30c combined action group; Test, p<0.0001, n=10.

[0019] FIG. 2 shows detections of neural stem cells in vitro under the combined action of miR-16 and miR-30c; where, (a) shows immunofluorescence detections of neural stem cells labeled with glial fibrillary acidic protein (GFAP) and phosphorylated histone H3 (PH3), scale bar: 50 um; (b) shows a statistical analysis of the number of neural stem cells in vitro; in which, AD represents Alzheimer's disease (AD) mice group; shRNA represents miR-16 and miR-30c combined action group; t-Test, p=0.023, n=10.

[0020] FIG. 3 shows significantly increased proliferations of nerve cells in the subventricular zone of the lower brain and the hippocampus under the combined action of miR-16 and miR-30c; where, (a) shows detections of proliferations of nerve cells in the hippocampal dentate gyrus, in which, shRNA represents group of mice microinjected with lentivirus having miR-16 down- regulation and miR-30c over-expression; AD represents group of Alzheimer's disease (AD) mice (4 months old); ki67 is used to label cells in the proliferation phase; GFAP, glial fibrillary acidic protein, can be used to label neuronal stem cells and glial cells; scale bar: 50 um; (b) shows statistical results of the proliferations of nerve cells in the hippocampal dentate gyrus, t-test; (c) shows detections of proliferations of nerve cells in the subventricular zone of the lateral ventricle, in which, DAPI is used to label cell nuclei, scale 3

BL-5291 bar: 50 um; (d) shows statistical results of the proliferations of nerve cells in the LU500595 subventricular zone of the lateral ventricle, test, p<0.001, n=5.

[0021] FIG. 4 shows significantly increased number of neural stem cells under the combined action of miR-16 and miR-30c; where, (a) shows immunofluorescence performed on sections of brain to detect changes in the number of neural stem cells, in which, shRNA represents group of mice microinjected with lentivirus having miR-16 down-regulation and miR-30c over-expression; AD represents group of Alzheimer's disease (AD) mice (4 months old); the white arrows indicate the neural stem cells; (b) shows statistical results of the changes in the number of neural stem cells, t-test, p<0.001, n=6.

Detailed Description

[0022] The present invention will be further described in detail below in conjunction with specific examples. The following examples will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those ordinary skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention.

These all belong to the protection scope of the present invention.

[0023] Example 1 Construction of miR-16 and miR-30c joint expression vector

[0024] Example 1-1 Construction of pLV-shRNA2 dual-promoter vector

[0025] (a) The 1st-forward primer and the 1st-reverse primer shown in Table 1 were used to amplify the H1 promoter sequence from the pSUPER.retro-GFP/Neo vector, and the Xhol and Xba | restriction enzyme recognition site sequences were introduced through the primers. The amplified sequence was named Xhol-H1-Xbal (see Table 1).

The reaction mixture system: 2 ul of LA Tag (5 U/l), 2 ul of 10xLA Tag buffer, 8 ul of ANTP (2.5 mM), 500 ng of pSUPER.retro-GFP/Neo plasmids, 1 ul of primer mix primer mixture (10 uM), and the balance of ddHzO to make up 20 ul. Thermal reaction system: 30 cycles of pre-denaturation at 95°C for 5 min, 94°C for 30 s, 57.5°C for 40 s, and 72°C for 1 min; followed by extension at 72°C for 10 min, and maintaining at 4°C for 60 min.

[0026] (b) The 2nd-forward primer and the 2nd-reverse primer shown in Table 1 were used to add recognition sequences and protective bases of BamH | and EcoR | to both ends of the above Xhol-H1-Xba | sequence, and the amplified sequence was named BamH |-Xhol- 4

BL-5291 H1-Xba I-EcoR |. The reaction mixture system: 2 ul of LA Tag(5 U/ul), 2 ul of 10xLA Tag ~~ LU500595 buffer, 8 ul of ANTP (2.5 mM), 800 ng of the amplified product obtained in (a), 1 ul of primer mix primer mixture (10 uM), and the balance of ddHzO to make up 20 pl. Thermal reaction system: 30 cycles of pre-denaturation at 95°C for 5 min, 95°C for 30 s, 63.6°C for 40 s, and 72°C for 1 min; followed by extension at 72°C for 10 min, and maintaining at 4°C for 60 min.

[0028] (d) The pLV-shRNA2 was transformed into DH5 a competent cells, and the clone was subsequently sequenced for identification.

[0029] Example 1-2 Insertion of miR-30c over-expression sequence

[0030] (a) Trizol was used to extract total RNA from the brain and leg muscles of a mouse with Alzheimer’s disease.

[0031] (b) The miR-30c over-expression primer sequences (see Table 2 and Table 3 for the primers) were used to perform reverse transcription and amplification;

[0032] The mixture system for reverse transcription: 0.25 ul of dNTPs, 1 pl of 5xReverse Transcription Buffer, 0.5 pl of reverse transcription primer (2 nM), 1.25 ul of total RNA (250 ng), 0.5 ul of M-MLV (40 U/ul), 0.25 pl of RNase inhibitor, and 1.25 ul of RNase-free ddH2O.

[0033] Reverse transcription thermal reaction system: the total RNA was pre-degenerated at 70°C for 10 min to eliminate RNA secondary struciure, followed by ice cooling for 2 min. Subsequently, the mixture system for reverse transcription reacted at 42°C for 1 h, followed by heating at 70°C for 15 min to inactivate the reverse transcriptase.

[0034] The mixture system for amplification: 5 ul of LA Tag(5 U/ul), 2.5 ul of 10xLA Tag buffer, 8 ul of ANTP (2.5 mM), 500 ng of the product obtained by reverse transcription, 1 pl of primer mixture (10 uM), and the balance of ddH2O to make up 25 pl.

BL-5291

[0035] The thermal reaction was as follows: 30 cycles of pre-denaturation at 94°C for 3 LU500595 min, 94°C for 30 s, 55°C for 40 s, and 72°C for 1 min; followed by extension at 72°C for 10 min, and maintaining at 4°C for 60 min.

[0036] (c) BamH | and Xho | endonucleases were used to digest the miR-30c over- expression sequence and the pLV-shRNA2 vector and tap the gel to recover the digested products.

[0037] (d) The digested products were ligated into the pLV-shRNA2 vector with T4 DNA ligase, and the resulting vector was named pLV-U6-miR-30c-OE-ZsGreen1.

[0038] (e) The pLV-U6-miR-30c-OE-ZsGreen1 was transformed into DH5a competent cells, and the clone was subsequently sequenced for identification.

[0039] Example 1-3 Insertion of miR-16 down-regulation sequence

[0040] (a) A down-regulation vector sequence (see SEQ ID NO:2) complementary to a mature miR-16 sequence and repeated for 8 times was designed.

[0041] (b) The miR-16 down-regulation vector sequence was synthesized by Shanghai Generay Biotech Co., Ltd.

[0042] (c) Xba | and EcoR | endonucleases were used to digest the miR-16 down- regulation sequence and the pLV-U6-miR-30c-OE-EGFP vector and tap the gel to recover the digested products.

[0043] (d) The miR-16 down-regulation sequence was ligated into the pLV-U6-miR-30c- OE-ZsGreen1 vector with T4 DNA ligase, and the resulting vector was named pLV-U6- miR-30c-OE-H1-miR-16-KD-ZsGreen1.

[0044] (e) The pLV-U6-miR-30c-OE-H1-miR-16-KD-ZsGreen1 was transformed into DH5a competent cells, and the clone was subsequently sequenced for identification.

[0045] Example 1-3 Package and titer determination of lentivirus containing dual-promoter pLV-U6-miR-30c-OE-H1-miR-16-KD-ZsGreen1 expression vector

[0046] After obtaining the dual-promoter pLV-U6-miR-30c-OE-H1-miR-16-KD-ZsGreen1 expression vector, it was necessary to test the function of the combined action of the two 6

BL-5291 small RNAs, and for this purpose, the expression vector-containing lentivirus liquid was LU500595 obtained. Then, the extracted pLV-U6-miR-30c-OE-H1-miR-16-KD-ZsGreen1 expression vector, the auxiliary vector psPAX2, and the auxiliary vector PMD2.G were mixed at a ratio of 1:1:1 (molecular weight) and dissolved in 10 ml of Opti-MEM for incubation at room temperature for 5 min, followed by mixing with Opti-MEM medium containing Lipofactamine 3000, incubating at room temperature for 25 min, and transfecting HEK293T cells in the exponential growth phase (10 cm culture dish, 2.5x10° cells). After being transfected for 6 h, the medium was replaced with a complete culture medium. The virus-containing supernatant was harvested 48-72 h after transfection, filtered with a 45 um filter membrane, and then centrifuged at 24,000 rpm for 120 min for concentration.

[0047] In order to determine the high-efficiency expression of adult miR-16 and miR-30c, it is necessary to determine the virus titer before a brain stereotaxic localization. The virus titer was accurately determined by flow cytometry, that is, the viruses were first diluted into four concentrations of 1/10, 1/100, 1/1000 and 1/10000, and added to HEK293T cells that had been inoculated for 6 h. After 48 h, lysis was conducted with 0.25% trypsin-EDTA (500 pl, 6-well plate) to prepare a single cell suspension, followed by centrifuging to discard the supernatant (12,000 rpm, 5 min). Ethanol was added to fix at -20°C for 2 h, and the mixture was re-suspended after washing with phosphate-buffered saline (PBS). The percentage of ZsGreen1 positive cells was measured by flow cytometry.

[0048] Virus titer (IU/ml) = number of inoculated cells x percentage of fluorescent protein- positive cells x 1000/volume of viruses added (ul).

[0049] Example 2 Application of miR-16 and miR-30c joint expression vector

[0050] Example 2-1 In vitro experiment to detect the effect of the vector on the proliferation of neural stem cells

[0051] Pregnant mice with Alzheimer's disease (AD) at embryonic day 14.5 (E14.5) were intraperitoneally injected with a pentobarbital sodium solution (45 mg/kg) for anesthesia, followed by opening the abdomens and taking the embryos from the uterine horns. The hippocampi were obtained by dissection under a stereomicroscope, and tissues thereof were digested with papain (50 U) at 37°C for 1 h to obtain a single cell suspension. The single cell suspension was cultured in Neurobasal-A medium, in which the Neurobasal-A medium was supplemented with B27 (having a final concentration of 20 ng/ml), L- glutamine (having a final concentration of 2 mM), basic fibroblast growth factor (bFGF) (having a final concentration of 20 ng/ml), and epidermal growth factor (EGF) (having a 7

BL-5291 final concentration of 20 ng/ml). After 5 days, the neurospheres were gently blown with a LU500595 Pasteur pipette to form a single cell suspension, followed by passage, and inoculating into a poly-L-ornithine and fibronectin-coated cell plate. After 24 h, a Cell Nucleofector kit was used to transfect miR-16 down-regulation vector and miR-30c over-expression vector into neural stem cells derived from the pregnant mice with AD according to the kit instruction. After 5 days, phosphorylated histone H3 (PH3) immunostaining, glial fibrillary acidic protein (GFAP) immunostaining, and 4',6-diamidino-2-phenylindole (DAPI) counterstaining of the nucleus were conducted, followed by imaging under a fluorescence microscope to detect the effect of the miR-16 and miR-30c joint expression vector on the proliferation of neural stem cells. The ruler tool of Image J software was used to calculate the diameters of neurospheres and calculate the number of PH3 (10 neurospheres were selected from each group for measurement and calculation). The results showed that the diameters of the neurospheres from the miR-16 and miR-30c combined action group after being subjected to in vitro proliferation were 1.48 times of those of the control group (FIG. 1). Moreover, the number of proliferative cells of neurospheres from the miR-16 and miR-30c combined action group after being subjected to in vitro proliferation was increased by 1.72 times as compared to the control group (FIG. 2).

[0052] Example 2-2 Using brain stereotaxic localization to specifically microinject lentivirus carrying miR-16 down-regulation and miR-30c over-expression into the neural stem cell proliferation zone of brain: the subventricular zone of the lateral ventricle and the hippocampal dentate gyrus

[0053] Mice were divided into two groups: the Alzheimer's disease mice group and the lentivirus-infected mice group (that is, the shRNA group), with 15 mice in each group. The mice were anesthetized by intraperitoneal injection with a pentobarbital sodium solution (45 mg/kg). The mice were then fixed by fixing two ears and upper jaw until the head of mice did not move when pushing their heads in all directions. Skin was prepared, followed by removing the fascia, muscle and periosteum, and exposing the anterior fontanelle. The zero calibration of the stereotaxic apparatus was performed by setting the position of the anterior fontanelle as zero point. Skull drilling was conducted according to the coordinates based on the mouse brain atlas. The needle of micro-injector was lowered at the drilling site to puncture the dura mater, gently puncture to the corresponding depth and slowly inject at a uniform velocity of 0.2 ul/min (with a virus titer of 1.21x10° IU/ml). After the injection was completed, the needle was maintained for 20 min, and then slowly withdrawn. The injection positions of the hippocampal dentate gyrus were as follows: subventricular zone: AP+0.86 mm, ML-0.8 mm, DV-3.8 mm; hippocampal dentate gyrus: AP-1.75 mm, MLO.75mm, DV-3.8 mm.

8

BL-5291 LU500595

[0054] Example 2-3 Application of miR-16 and miR-30c joint expression vector —— proliferation and stemness

[0055] Serial sections of brain were used for the detection of the number of neural stem cells and the proliferation of neural stem cells.

[0056] The preparation of the serial sections of brain and the operations of immunofluorescence staining were as follows. The mice were anesthetized by intraperitoneal injection of a pentobarbital sodium solution 4 weeks after lentivirus injection, followed by perfusion, dehydration with sucrose gradiently, and preparation of sagittal freezing serial section (20 um). Two serial sections were selected for immunofluorescence staining, one of which was used for the detection of the number of neural stem cells (incubating mouse anti-Nestin, goat anti-GFAP and rabbit anti-Ki67 together on the blocked sections), and the other was used for the detection of the proliferation of neural stem cells (mouse anti-GFAP and rabbit anti-Ki67 or mouse anti-GFAP and rabbit anti-PH3) after incubation overnight at 4°C. The above sections were washed with PBS (5 minx3 times). The sections where neural stem cells were labeled were simultaneously added with Alexa Fluor647 donkey anti-mouse, Alexa Fluor488 donkey anti-rabbit, Alexa Fluor549 donkey anti-goat and Alexa Fluor546 donkey anti-mouse secondary antibodies. The sections where proliferative neural stem cells were labeled were added with Alexa Fluor488 donkey anti-mouse and Alexa Fluor549 donkey anti-rabbit secondary antibodies, and incubated for 2 h at room temperature. The above sections were washed with PBS (5 minx3 times), followed by blocking with an anti-quenching agent, and photographing with a laser confocal microscope for detection.

[0057] The proliferation of neural stem cells in the hippocampal dentate gyrus and subventricular zone was detected by using Image J software to count the number of ki67 cells in 15 laser confocal microscope images of serial sections of each mouse’s brain (6 mice in each group). Finally, the ratio of the number of ki67 cells in the shRNA group to the number of ki67 cells in the AD mice group was calculated as the times by which the proliferation of neural stem cells in the shRNA group was increased compared to that of the AD mice group (FIG. 3).

[0058] The stemness of neural stem cells was reflected by the number of neural stem cells. The cells co-labeled with GFAP, ki67 and Nestin were neural stem cells. The Image J software was used to count the number of GFAP/ki67/Nestin co-labeled cells in 15 laser confocal microscope images of serial sections of each mouse’ brain (6 mice in each group). 9

BL-5291 Finally, the ratio of the number of neural stem cells in the shRNA group to the number of ~~ LU500595 neural stem cells in the AD mice group was obtained as the times of the number of neural stem cells in the shRNA group compared to that of the AD mice group (FIG. 4).

[0059] SEQ ID NO: 1 miR-30c-OE sequence (5'-3'):

GAGTGACAGATATTGTAAACATCCTACACTCTCAGCTGTGAAAAGTAAGA AAGCTGGGAGAAGGCTGTTTACTCTCTCTGCCTT

[0060] SEQ ID NO: 2 miR-16-KD sequence (5'-3"):

CGCCAATATTGCAATGCTGCTAGCATCGCGCCAATATTGCAATGCTGCTA GCATCGCGCCAATATTGCAATGCTGCTAGCATCGCGCCAATATTGCAATG CTGCTAGCATCGCGCCAATATTGCAATGCTGCTAGCATCGCGCCAATATTG CAATGCTGCTAGCATCGCGCCAATATTGCAATGCTGCTAGCATCGCGCCA ATATTGCAATGCTGCTAGCATCG

[0061] Table 1 Primers for constructing pLV-shRNA2 dual-promoter vector Product Name Sequence (S'-3") (bp) Ist-forward primer CCGCTCGAGCGGAACTTATAAGATT . CTAGTCTAGACTAGAAAACGAATTCGAAC 238 1st-reverse primer GC . CGCGGATCCGCGCCGCTCGAGCGGAACTT 2nd-forward primer ATAA 272 >nd-reverse primer CCCACCCACCCCGGAATTCCGGCTAGTCT -reverse prime AGAC

[0062] Table 2 Primers for miR-16 #1 miR-30c reverse transcription Name Primers for reverse transcription (5'-3") miR-30c GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTGAG miR-16 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAAT

[0063] Table 3 Primers for miR-16 Al miR-30c reverse transcription and amplification Name Forward primer (5'-3") Reverse primer (5'-3") miR-30c GCCCGTCCTGTAAACATCCTACAC CCAGTGCAGGGTCCGAGGTAT miR-16 GCAGCAGGCTAGCAGCACGTA CCAGTGCAGGGTCCGAGGTAT Snord2 GGCAAATCATCTTTCGGGACTG CCAGTGCAGGGTCCGAGGTAT 5sRNA CTACGGCCATACCACCCTGAAC CGGTCTCCCATCCAAGTACTAACC

Claims

BL-5291

1. A miR-16 and miR-30c joint expression vector, characterized in that, it comprises an miR-16 down-regulation sequence, an miR-30c over-expression sequence, and a plasmid vector; wherein the miR-16 down-regulation sequence is miR-16-KD with the coding sequence SEQ ID NO:1, and the miR-30 over-expression sequence is miR-30c-OE with the coding sequence SEQ ID NO:2.

2. The vector according to claim 1, characterized in that, the joint expression vector is a dual-promoter expression vector.

3. The vector according to claim 2, characterized in that, the joint expression vector is pLV- UB-miR-30c-OE-H1-miR-16-KD-ZsGreen1.

4. The use of the joint expression vector according to claim 1 for promoting the proliferation of neural stem cells.

5. The use of the joint expression vector according to claim 1 for promoting neurogenesis.

6. The use according to claim 5, characterized in that, the neurogenesis is neurogenesis in the subventricular zone and hippocampal neurogenesis.

7. The use of the joint expression vector according to claim 1 for preparing a drug for neural stem cell migration.

8. The use of the joint expression vector according to claim 1 in a reagent for early detection of Alzheimer's disease.

11