KR101548616B1 - Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell - Google Patents

Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell Download PDF

Info

Publication number
KR101548616B1
KR101548616B1 KR1020100014681A KR20100014681A KR101548616B1 KR 101548616 B1 KR101548616 B1 KR 101548616B1 KR 1020100014681 A KR1020100014681 A KR 1020100014681A KR 20100014681 A KR20100014681 A KR 20100014681A KR 101548616 B1 KR101548616 B1 KR 101548616B1
Authority
KR
South Korea
Prior art keywords
mesenchymal stem
stem cells
bdnf
differentiation
neurons
Prior art date
Application number
KR1020100014681A
Other languages
Korean (ko)
Other versions
KR20110094940A (en
Inventor
조성래
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to KR1020100014681A priority Critical patent/KR101548616B1/en
Publication of KR20110094940A publication Critical patent/KR20110094940A/en
Application granted granted Critical
Publication of KR101548616B1 publication Critical patent/KR101548616B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0619Neurons

Abstract

본 발명은 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법 및 BDNF를 포함하는 중간엽 줄기세포의 GABA성 신경세포 분화유도용 조성물에 관한 것이다.
본 발명의 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법은 BDNF를 사용하여 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키므로, 이렇게 생산된 GABA성 신경세포는 뇌신경계 질환의 세포치료 요법에 대한 우수한 공급원으로서 역할을 할 수 있다.
또한, 본 발명의 BDNF를 포함하는 중간엽 줄기세포의 GABA성 신경세포 분화유도용 조성물은 체외 및 체내에서 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키므로 난치성 신경계 질환에 중간엽 줄기세포 이식 치료에의 사용을 기대할 수 있다.
The present invention relates to a method of differentiating mesenchymal stem cells into GABAergic neurons and a composition for inducing GABAergic neural differentiation of mesenchymal stem cells comprising BDNF.
The method of differentiating the mesenchymal stem cells of the present invention into GABA neurons differentiates the mesenchymal stem cells into GABA neurons in a large amount by using BDNF, It can serve as an excellent source of therapy.
In addition, the composition for inducing differentiation of GABA neurons in mesenchymal stem cells comprising BDNF of the present invention massively differentiates mesenchymal stem cells into GABA neurons in vitro and in vivo, so that mesenchymal stem cell transplantation It can be expected to be used for treatment.

Description

중간엽 줄기세포를 GAΒA성 신경세포로 분화시키는 방법 및 BDNF를 포함하는 GAΒA성 신경세포 분화유도용 조성물{Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell}BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for differentiating mesenchymal stem cells into GA B A nerve cells and a method for inducing the differentiation of GA B A neurons including BDNF into a GABAergic Neuronal Cell and Differentiating Compounds BDNF for Inducing Differentiation into GABAergic Neuronal Cells }

본 발명은 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법 및 BDNF를 포함하는 GABA성 신경세포 분화유도용 조성물에 관한 것이다.
The present invention relates to a method for differentiating mesenchymal stem cells into GABAergic neurons and a composition for inducing GABAergic neuron differentiation including BDNF.

감마아미노부틸산(GABA)은 중추신경계의 주요한 억제성 신경전달물질이며, 뇌신경계에 널리 분포되어 모든 시냅스의 약 70%를 구성한다(Schwartz RD, Biochem Pharmacol , 37:3369-75(1988)). 그러나 뇌졸중과 같은 뇌신경계 질환에서 해마와 같은 부위의 GABA성 세포는 퇴화될 수 있다(Nishino and Borlongan, Prog Brain Res , 127:461-76(2000)). 이에 대한 신경보호 요법으로 GABA성 효현제, 칼슘 길항제, 글루탐산 길항제 및 항산화제와 같은 약물이 개발되었거나 연구가 진행 중이며(Stutzmann et al, CNS Drug Rev , 8:1-30(2002); Rocelle et al., J Neurochem , 77:353-71(2001); Blezer et al, Eur J Pharmacol , 444:75-81(2002)), GABA성 약물도 뇌신경계 질환을 치료하는데 특히 효과적일 것으로 생각된다. 또한 세포치료 요법은 각종 뇌손상에 의해 야기되는 일차적 및 이차적 손상을 포괄적으로 치료하기에 유용한 수단일 수도 있다. 예를 들어, 파킨슨 병 환자에 도파민성 뉴런의 이식 치료를 시도하듯이(Grisolia, Brain Res Bull , 57:823-6(2002)). 뇌졸중과 같은 뇌신경계 환자에서 GABA성 뉴론이 손상 받은 경우, GABA성 뉴론의 이식 치료는 이상적인 요법일 수 있다. 미성숙 신경세포로부터 GABA성 세포를 생성하는 한가지 방법이 보고되었다(미국 특허 제6,602,680호). 루벤스타인 등은 미성숙 뉴런 세포에서, DLX 유전자(예: DLX1, DLX2, DLX5)의 활성을 증가시킴으로써 GABA성 세포의 생산을 보고하였다. 또한 쥐 배아 줄기세포로부터 GABA성 세포를 분화 유도하는 방법이 보고되었으나(Hancock et al., Biochem Biophys Res Commun, 271(2):418-21(2000); Westmoreland et al., Biochem Biophys Res Commun , 284(3):674-80(2001)) 이 방법은 세포치료를 시행할 수 있을 만큼 고효율로 GABA성 뉴런을 생성하지 않았다. 따라서 뇌신경계 질환에서 기능회복을 위한 세포치료를 위해, 보다 대량으로 기능성 GABA성 뉴론을 분화 유도할 수 있는 방법의 개발이 요구된다.
Gamma aminobutyric acid (GABA) is a major inhibitory neurotransmitter in the central nervous system and is widely distributed in the cranial nervous system, making up about 70% of all synapses (Schwartz RD, Biochem Pharmacol. , 37: 3369-75 (1988)). However, GABAergic cells in areas such as the hippocampus can be degenerated in cerebral nerve diseases such as stroke (Nishino and Borlongan, Prog Brain Res. , 127: 461-76 (2000)). Drugs such as GABA agonists, calcium antagonists, glutamate antagonists, and antioxidants have been or have been developed as neuroprotective therapies (Stutzmann et al, CNS Drug Rev. , 8: 1-30 (2002); Rocelle et al., J Neurochem , 77: 353-71 (2001); Blezer et al., Eur J Pharmacol , 444: 75-81 (2002)), GABA-mediated drugs are also considered to be particularly effective in treating cranial nerve system disorders. Cell therapy may also be a useful tool for comprehensive treatment of primary and secondary damage caused by various brain injuries. For example, as an attempt to transplant a dopaminergic neuron into a patient with Parkinson's disease (Grisolia, Brain Res Bull , 57: 823-6 (2002)). Transplantation of GABAergic neurons may be an ideal therapy if GABAergic neurons are damaged in patients with cerebral nervous system such as stroke. One method of generating GABAergic cells from immature neurons has been reported (US Patent No. 6,602,680). Rubenstein et al. Reported the production of GABAergic cells by increasing the activity of DLX genes (eg, DLX1, DLX2, DLX5) in immature neuron cells. In addition, a method of inducing the differentiation of GABAergic cells from mouse embryonic stem cells has been reported (Hancock et al., Biochem Biophys Res Commun., 271 (2): 418-21 (2000); Westmoreland et al., Biochem Biophys Res Commun. , 284 (3): 674-80 (2001)). This method did not produce GABA neurons with high efficiency enough to perform cell therapy. Therefore, it is required to develop a method for inducing the differentiation of functional GABA neurons in a larger amount for cell therapy for functional recovery in cerebral neurological diseases.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자는 뇌신경계 질환의 세포 치료 요법에 사용할 수 있는 GABA성 신경세포를 생체 외 또는 생체 내에서 효과적으로 유도하고 대량으로 생산할 수 있는 방법의 개발을 위하여 예의 연구 노력하였고 그 결과 BDNF를 사용하여 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키는데 성공함으로써, 본 발명을 완성하게 되었다.The present inventors have made intensive researches for the development of a method capable of effectively inducing and mass-producing GABAergic neurons in vitro or in vivo, which can be used for cell therapy of brain neurological diseases. As a result, The present inventors have succeeded in mass-differentiating stem cells into GABAergic neurons, thereby completing the present invention.

따라서 본 발명의 목적은 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법을 제공하는 데 있다.Accordingly, it is an object of the present invention to provide a method of differentiating mesenchymal stem cells into GABAergic neurons.

본 발명의 다른 목적은 BDNF를 유효성분으로 포함하는 중간엽 줄기세포를 GABA성 신경세포로의 분화유도용 조성물을 제공하는 데 있다.
Another object of the present invention is to provide a composition for inducing the differentiation of mesenchymal stem cells containing BDNF as an active ingredient into GABAergic neurons.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 (a) 중간엽 줄기세포를 수득하는 단계; 및 (b) BDNF(brain-derived neurotrophic factor)를 포함하는 배지에서 상기 중간엽 줄기세포를 배양하여 GABA성 신경세포로 분화시키는 단계를 포함하는 중간엽 줄기세포를 GABA(gamma-aminobutyric acid)성 신경세포로 분화시키는 방법을 제공한다.
According to one aspect of the present invention, there is provided a method for producing a mesenchymal stem cell comprising: (a) obtaining mesenchymal stem cells; And (b) culturing the mesenchymal stem cells in a medium containing BDNF (brain-derived neurotrophic factor) to differentiate into GABAergic neurons, the mesenchymal stem cells are transfected with GABA (gamma-aminobutyric acid) Lt; RTI ID = 0.0 > cells. ≪ / RTI >

본 발명자는 뇌신경계 질환의 세포 치료 요법에 사용할 수 있는 GABA성 신경세포를 생체 외 또는 생체 내에서 효과적으로 유도하고 대량으로 생산할 수 있는 방법의 개발을 위하여 예의 연구 노력하였고 그 결과 BDNF를 사용하여 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키는데 성공함으로써, 본 발명을 완성하게 되었다.The present inventors have made intensive researches for the development of a method capable of effectively inducing and mass-producing GABAergic neurons in vitro or in vivo, which can be used for cell therapy of brain neurological diseases. As a result, The present inventors have succeeded in mass-differentiating stem cells into GABAergic neurons, thereby completing the present invention.

줄기세포는 크게 두 종류로 구별된다: 배아줄기세포 (ES) 및 배아생식세포 (EG)를 포함하는 전능성 줄기세포(pluripotent stem cell)와 다능성 줄기세포 (multipotent stem cell). 본 발명의 중간엽 줄기세포(mesenchymal stem cell)는 다능성 줄기세포의 일종이다. 본 발명의 중간엽 줄기세포는 이에 제한되는 것은 아니나 바람직하게는 골수, 제대혈 또는 지방조직으로부터 유래될 수 있다. 본 발명의 중간엽줄기세포는 성체줄기세포의 일종으로서 뼈를 만드는 조골 모세포, 연골세포, 지방세포, 근육세포, 섬유아세포와 골수의 기질등 다양한 세포 유형으로 분화될 수 있는 능력을 갖으며, 자가재생산(self-renewal) 능력을 갖는다. Stem cells are divided into two types: pluripotent stem cells and multipotent stem cells, including embryonic stem cells (ES) and embryonic germ cells (EG). The mesenchymal stem cells of the present invention are a kind of pluripotent stem cells. The mesenchymal stem cells of the present invention may be derived from bone marrow, umbilical cord blood, or adipose tissue, but are not limited thereto. The mesenchymal stem cells of the present invention are capable of differentiating into various cell types such as osteoblasts, cartilage cells, adipocytes, muscle cells, fibroblasts and bone marrow matrices which form bone as adult stem cells. Self-renewal capability.

본 발명의 중간엽줄기세포는 세포표면항원 CD14+, CD31+, CD45+, CD34-, CD133- 및 CD166- 으로 구성된 군으로부터 선택되는 최소 1종의 면역학적 특성을 나타낸다. The mesenchymal stem cells of the present invention exhibit at least one immunological characteristic selected from the group consisting of cell surface antigens CD14 +, CD31 +, CD45 +, CD34-, CD133- and CD166-.

바람직하게는, 본 발명에서 이용하는 중간엽줄기세포는 포유동물의 골수, 제대혈 또는 지방조직으로부터 수득할 수 있다. 보다 바람직하게는 인간, 돼지, 소, 양, 토끼, 마우스(mouse) 또는 랫트(rat), 보다 더 바람직하게는 인간, 돼지 또는 마우스, 가장 바람직하게는 인간의 골수, 제대혈 또는 지방조직에서 수득할 수 있다.Preferably, the mesenchymal stem cells used in the present invention can be obtained from the bone marrow, umbilical cord blood, or adipose tissue of a mammal. More preferably in human, pig, cow, sheep, rabbit, mouse or rat, more preferably human, pig or mouse, most preferably human bone marrow, cord blood or fat tissue .

본 발명에서 이용되는 중간엽줄기세포는 하기에 기재된 방식으로 수득할 수 있다. 예컨대, 지방조직을 절단하고 절단된 지방조직을 직접 배양하여 세포를 성장(outgrowth)시킨다. 이어, 상기 성장된 세포를 계대 배양함으로써, 중간엽줄기세포를 수득한다. 상기 배양 과정에서 이용되는 배지는 동물세포의 배양에 통상적으로 이용되는 어떠한 배지도 가능하며, 예를 들어, Eagles's MEM (Eagle's minimum essential medium, Eagle, H. Science 130:432(1959)), α-MEM (Stanner, C.P. et al., Nat . New Biol . 230:52(1971)), Iscove's MEM (Iscove, N. et al., J. Exp. Med. 147:923(1978)), 199 배지 (Morgan et al., Proc . Soc . Exp . Bio . Med ., 73:1(1950)), CMRL 1066, RPMI 1640 (Moore et al., J. Amer . Med . Assoc . 199:519(1967)), F12 (Ham, Proc . Natl . Acad . Sci. USA 53:288(1965)), F10 (Ham, R.G. Exp . Cell Res . 29:515(1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8:396(1959)), DMEM과 F12의 혼합물 (Barnes, D. et al., Anal . Biochem . 102:255(1980)), Way-mouth's MB752/1 (Waymouth, C. J. Natl. Cancer Inst . 22:1003(1959)), McCoy's 5A (McCoy, T.A., et al., Proc . Soc . Exp . Biol . Med. 100:115(1959)) 및 MCDB 시리즈 (Ham, R.G. et al., In Vitro 14:11(1978)) 등이 이용될 수 있다. The mesenchymal stem cells used in the present invention can be obtained in the manner described below. For example, the fat tissue is cut and the cut fat tissue is directly cultured to outgrow the cells. Then, the grown cells are subcultured to obtain mesenchymal stem cells. The medium used in the culturing may be any medium conventionally used for culturing animal cells. For example, Eagles's MEM (Eagle's minimum essential medium, Eagle, H. Science 130: 432 (1959)), MEM (Stanner, CP et al., Nat . New Biol . 230: 52 (1971)), Iscove's MEM (Iscove, N. et al, J. Exp Med 147:... 923 (1978).....), 199 medium (Morgan et al, Proc Soc Exp Bio Med ., 73: 1 (1950) ), CMRL 1066, RPMI 1640 (Moore et al, J. Amer Med Assoc 199:.... 519 (1967)....), F12 (Ham, Proc Natl Acad Sci USA 53: 288 (1965)), F10 (Ham, RG Exp . Cell Res . 29: 515 (1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8: 396 (1959)), a mixture of DMEM and F12 (Barnes, D. et al., Anal . Biochem . 102:. 255 (1980) ), Waymouth's MB752 / 1 (Waymouth, C. J. Natl Cancer Inst . 100: 115 (1959)) and the MCDB series (Ham, RG et al., In (1987)), McCoy's 5A (McCoy, TA, et al., Proc . Soc . Exp . Biol . Vitro 14: 11 (1978)) and the like can be used.

상기 계대 배양에서 70-80% 컨플루언시(confluency)를 나타낼 때 까지 배양하며, 이어 부착성(adherent) 세포를 수확하고, 이 수확된 세포의 일부를 다음 계대 배양에 이용한다. 상술한 과정을 통하여 골모세포, 지방세포, 연골세포 등의 중배엽성 조직으로의 분화능 및 줄기세포 특성을 갖는 중간엽줄기세포가 생성된다.
The cells are cultured in the subculture until they exhibit 70-80% confluency, then adherent cells are harvested and a portion of the harvested cells are used for the next subculture. Through the above process, mesenchymal stem cells having the ability to differentiate into mesodermal tissues such as osteoblasts, adipocytes and chondrocytes and stem cell characteristics are produced.

본 발명자는 생체 외에서 중간엽 줄기세포(골수, 제대/제대혈, 지방세포 유래)의 GABA성 신경세포로의 분화유도 가능성과 분화 효율을 확인하였다. 즉, GABA성 신경세포로의 분화 가능성 및 분화에 필요한 최적의 배양 조건(세포 성장인자, 분화 관련인자)을 연구, 탐색하여 세포치료제로 이용할수 있도록 분화유도 및 배양 기술을 확립하고, 분화 유도된 세포의 표현형과 함께 기능성 측면에서 생화학적, 분자생물학적 특성을 분석하여 신경질환에 대한 세포치료제로서 유효하게 적용될 수 있는지에 대한 평가 기준을 확립하였다.The present inventors confirmed the possibility of inducing differentiation of mesenchymal stem cells (bone marrow, umbilical cord / umbilical cord blood, adipocyte-derived) into GABA neurons in vitro and their differentiation efficiency in vitro. That is, differentiation induction and culturing techniques were established to exploit the potential for differentiation into GABAergic neurons and optimal culture conditions (cell growth factors, differentiation-related factors) necessary for differentiation and to use them as cell therapy agents. In addition to the phenotype of the cells, biochemical and molecular biologic characteristics were analyzed in terms of functionality, and evaluation criteria were established to determine whether they could be effectively applied as a cell therapy for neurological diseases.

본 발명의 바람직한 구현예에서, 중간엽줄기세포는 DMEM/F12(Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12) 배지에서 분화를 유도한다. HG-DMEM(High glucose - Dulbecco's modified eagle media) 배지를 사용하는 것도 가능하나, DMEM/F12를 분화 배지로 사용하는 경우에, 보다 효과적인 분화로 인해 GABA성 신경세포를 대량으로 생산할 수 있다. In a preferred embodiment of the invention, mesenchymal stem cells induce differentiation in DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12) medium. It is possible to use HG-DMEM (High glucose-Dulbecco's modified eagle media) medium. However, when DMEM / F12 is used as a differentiation medium, it can produce GABA neurons in a large amount due to more efficient differentiation.

본 발명의 중간엽 줄기세포를 배양하여 분화시키는 단계에 있어서, 신경영양인자로서 BDNF를 사용한다. 이를 상기 배지에 넣어 배양하는 경우 GABA성 신경세포로까지 분화시킬 수 있으며, 효과적인 분화로 인해 GABA성 신경세포를 대량으로 생산할 수 있다. In the step of culturing and differentiating the mesenchymal stem cells of the present invention, BDNF is used as a neurophysiologist. When cultured in the above-mentioned culture medium, it is possible to differentiate into GABA neurons, and it is possible to produce GABA neurons in a large amount due to effective differentiation.

BDNF(brain-derived neurotrophic factor)는 단백질의 신경 성장 인자 패밀리인 당단백질로서, 거대 전구체로부터 처리되어 신경 세포 집단의 생존을 촉진하는 신경영양 인자를 산출한다(Jones K.R. et al., Proc . Natl . Acad . Sci U.S.A., 87:8060-8064(1990)). 이러한 신경 세포는 모두 중추 신경계 내에 또는 이와 직접 연결되어 위치한다. BDNF (brain-derived neurotrophic factor) is a glycoprotein of the nerve growth factor family of proteins, and calculates a neurotrophic factor that is processed from a large precursor promotes the survival of neuronal cell populations (Jones KR et al., Proc . Natl. Acad . Sci USA, 87: 8060-8064 (1990)). All of these neurons are located in or directly in the central nervous system.

본 발명에서는 천연의 BDNF를 사용하는 것이 바람직하지만, 천연의 BDNF 분자와 동일한 기능을 수행하는 개질 BDNF 분자, 유사체 및 재조합 BDNF 분자도 사용할 수 있다.Although it is preferred to use native BDNF in the present invention, modified BDNF molecules, analogs and recombinant BDNF molecules that perform the same function as natural BDNF molecules can also be used.

본 발명의 바람직한 구현예에서, 인간 뇌유래 신경영양 인자(BDNF)의 양은 배양 배지를 기준으로 하여 20-100 ng/ml으로 첨가하여 배양한다.In a preferred embodiment of the invention, the amount of human brain-derived neurotrophic factor (BDNF) is added at 20-100 ng / ml based on the culture medium and cultured.

본 발명의 바람직한 구현예에서, 신경영양인자로서 BDNF는 세포증식인자로서 EGF(epidermal growth factor), FGF-2(fibroblast growth factor-2) 또는 이의 혼합물과 함께 사용될 수 있다. 상기 세포증식인자를 추가적으로 배지에 첨가하는 경우 중간엽줄기세포의 GABA성 신경세포로의 분화를 더욱 효율적으로 유도할 수 있다.In a preferred embodiment of the invention, BDNF as a neurotrophin can be used with EGF (epidermal growth factor), FGF-2 (fibroblast growth factor-2) or mixtures thereof as cell proliferation factors. When the cell growth factor is additionally added to the medium, differentiation of mesenchymal stem cells into GABAergic neurons can be induced more efficiently.

상기 방법에 의해 대량으로 생성된 GABA성 신경세포는 이렇게 대량으로 생성된 GABA성 신경세포는 뇌졸중, 외상성 뇌손상, 뇌성마비, 간질 및 헌팅턴 병과 같은 뇌신경계 질환의 세포치료 요법에 대한 우수한 공급원으로서 역할을 할 수 있다. GABAergic neurons produced in large quantities by the above method can be used as an excellent source of cell therapy for brain neurological diseases such as stroke, traumatic brain injury, cerebral palsy, epilepsy and Huntington's disease can do.

바람직한 구현예에서, 상기 GABA성 신경세포는 10 세포/㎕ 내지 1×107 세포/㎕ 농도로 병변이 있는 부위에 이식하며, 보다 바람직하게는 1×103 세포/㎕ 내지 1×106 세포/㎕1 농도로 병변이 있는 부위에 이식한다.In a preferred embodiment, the GABAergic neuron is implanted at a site of lesion at a concentration of 10 cells / μl to 1 × 10 7 cells / μl, more preferably 1 × 10 3 The cell / ㎕ to 1 × 10 6 implanted in the site of the lesion to the cell / 1 concentration.

마우스 동물 모델을 이용해 실험하는 경우 상기 방법으로 GABA성 신경세포로 유도된 분화 세포를 총 1×104 세포 - 1×106 세포를 병변측 선조체 내로 이식할 수 있다.
In the case of an experiment using a mouse animal model, a total of 1 x 10 4 cells to 1 x 10 6 cells derived from GABA neurons can be transplanted into the lesion-side striatum.

본 발명의 다른 양태에 따르면, 본 발명은 BDNF(brain-derived neurotrophic factor)를 유효성분으로 포함하는 중간엽 줄기세포를 GABA(gamma-aminobutyric acid)성 신경세포로의 분화유도용 조성물을 제공한다. According to another aspect of the present invention, there is provided a composition for inducing the differentiation of mesenchymal stem cells, which comprise BDNF (brain-derived neurotrophic factor) as an active ingredient, into GABA (gamma-aminobutyric acid) neurons.

일 구현예에서, 상기 조성물은 상기 기술한 바와 같이 생체 외에서 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 용도로 사용된다. 본 발명의 본 발명은 BDNF를 유효성분으로 포함하는 조성물을 이용하여 생체 외에서 증식시킨 GABA성 신경세포는 추후 병변이 있는 부위에 이식함으로써 세포 치료에 사용될 수 있다.In one embodiment, the composition is used to differentiate mesenchymal stem cells into GABAergic neurons in vitro as described above. The present invention of the present invention can be used for cell therapy by implanting GABA neurons which are grown in vitro using a composition containing BDNF as an active ingredient, in a site where a lesion is present.

다른 구현예에서, 상기 조성물은 생체 내에서 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 용도로 사용된다. 보다 구체적으로 중간엽 줄기세포를 병변부위로 이식 후, 본 발명의 조성물을 이식 부위로 지속적으로 주입하여 생체 내에서 GABA성 신경세포를 효과적으로 생성되도록 할 수 있다. 이는 분화에 앞서 GABA성 신경세포가 필요한 병변 부위에 중간엽 줄기세포를 이식하고 이를 GABA성 신경세포로 분화시키는 방법이므로 난치성 신경계 질환에 중간엽 줄기세포 이식 치료를 통한 신경 재생 및 기능 회복을 기대할 수 있다. In another embodiment, the composition is used to differentiate mesenchymal stem cells into GABAergic neurons in vivo. More specifically, after the mesenchymal stem cells are transplanted into the lesion site, the composition of the present invention may be continuously injected into the transplantation site to effectively generate GABAergic neurons in vivo. This is because the method of transplanting mesenchymal stem cells into GABA neurons in a lesion site requiring GABA neurons prior to differentiation is possible, and thus neural regeneration and function recovery can be expected through mesenchymal stem cell transplantation therapy for refractory neurological diseases have.

바람직한 일 구현예에서, 상기 분화전 중간엽 줄기세포는 10 세포/㎕ 내지 1×106 세포/㎕ 농도로 병변이 있는 부위에 이식되며, 보다 바람직하게는 1×103 세포/㎕ 내지 1×105 세포/㎕1 농도로 이식된다. In a preferred embodiment, the mesenchymal stem cells before the differentiation are implanted at a site of lesion at a concentration of 10 cells / μl to 1 × 10 6 cells / μl, more preferably 1 × 10 3 Cells / ㎕ to 1 × 10 5 cells are implanted in / 1 concentration.

이식된 중간엽 줄기세포를 GABA성 신경세포로 분화시키기 위해서는 본 발명의 GABA성 신경세포로의 분화유도용 조성물을 이식 부위 내로 지속적으로 투여하여 세포 증식 및 분화에 부유한 환경을 조성하여야 한다. In order to differentiate the transplanted mesenchymal stem cells into GABAergic neurons, the composition for inducing differentiation into GABAergic neurons of the present invention should be continuously administered into the transplantation site to create a floating environment for cell proliferation and differentiation.

바람직한 다른 구현예에서, 본 발명의 조성물은 상기 중간엽 줄기세포 이식부위에 2일 내지 30일 동안 지속적으로 주입된다. In another preferred embodiment, the composition of the present invention is continuously injected into the mesenchymal stem cell transplantation site for 2 to 30 days.

상기 주입 방법에는 제한이 없으나, 기술적 측면에서 투여용량, 투여속도, 투여기간에 따른 다양한 종류의 삼투압 펌프를 이용하여 뇌실 내로 본 발명의 조성물을 지속적으로 투여하는 것이 바람직하다. 현재 상업적으로 이용가능한 삼투압 펌프를 예시하면, Alzet삼투압 펌프 및 Medtronic회사의 펌프 시스템 등이 있다.상기 삼투압 펌프를 이용한 본 발명의 조성물의 투여는 배출속도 0.01 내지 10 ㎕/hr, 배출기간 2일 내지 30일, 배출용량 1㎕ 내지 1ml으로 하는 것이 바람직하다. 상기 삼투압 펌프는 중간엽 줄기세포 이식 후 바로 본 발명의 GABA성 신경세포로의 분화유도용 조성물을 바로 배출될 수 있도록 수술 시행 전날부터 37도로 전처지하는 것이 바람직하다.  The injection method is not limited. However, from the technical point of view, it is preferable to continuously administer the composition of the present invention into the ventricle using various osmotic pumps depending on the administration dose, administration rate, and administration period. Currently commercially available osmotic pumps include Alzet osmotic pumps and Medtronic's pump systems. The administration of the composition of the present invention using the osmotic pump may be performed at a rate of 0.01 to 10 μl / hr, 30 days, and the discharge volume is 1 쨉 l to 1 ml. It is preferable that the osmotic pump is pre-positioned at 37 degrees from the day before the operation so that the composition for inducing differentiation of GABA neurons into the GABA neurons of the present invention immediately after mesenchymal stem cell transplantation.

바람직한 구현예에서, 본 발명의 조성물은 세포증식인자로서 EGF(epidermal growth factor), FGF-2(fibroblast growth factor-2) 또는 이의 혼합물을 추가적으로 포함하며, BDNF의 양은 조성물 전체를 기준으로 하여 1-1000 ㎍/ml인 것이 바람직하다.
In a preferred embodiment, the composition of the present invention additionally comprises EGF (epidermal growth factor), FGF-2 (fibroblast growth factor-2) or a mixture thereof as a cell growth factor and the amount of BDNF is 1- 1000 mu g / ml.

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법 및 BDNF를 포함하는 중간엽 줄기세포의 GABA성 신경세포 분화유도용 조성물을 제공한다.(I) The present invention provides a method for differentiating mesenchymal stem cells into GABAergic neurons and a composition for inducing GABAergic neuronal differentiation of mesenchymal stem cells comprising BDNF.

(ⅱ) 본 발명의 중간엽 줄기세포를 GABA성 신경세포로 분화시키는 방법은 BDNF를 사용하여 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키므로, 이렇게 생산된 GABA성 신경세포는 뇌신경계 질환의 세포치료 요법에 대한 우수한 공급원으로서 역할을 할 수 있다. (Ii) The method of differentiating the mesenchymal stem cells of the present invention into GABAergic neurons involves massively differentiating mesenchymal stem cells into GABA neurons using BDNF, Can serve as an excellent source of cell therapy therapy.

(iii) 또한 본 발명의 BDNF를 포함하는 중간엽 줄기세포의 GABA성 신경세포 분화유도용 조성물은 체외 및 체내에서 중간엽 줄기세포를 GABA성 신경세포로 대량으로 분화시키므로 난치성 신경계 질환에 중간엽 줄기세포 이식 치료에의 사용을 기대할 수 있다.
(iii) The composition for inducing GABAergic neuronal differentiation of the mesenchymal stem cells comprising BDNF of the present invention massively differentiates mesenchymal stem cells into GABA neurons in vitro and in vivo, It can be expected to be used for cell transplantation therapy.

도 1은 각각 골수(BM), 제대혈(UCB), 제대(UC), 지방조직(AT)으로부터 유래한 각각의 중간엽 줄기세포 모습을 나타낸다.
도 2는 골수, 제대혈, 제대, 지방조직으로부터 유래한 각각의 중간엽 줄기세포의 세포 표현형을 나타낸다.
도 3은 인간 중간엽 줄기세포의 골, 지방, 연골로의 분화능을 확인할 수 있는 실험 결과이다.
도 4는 인간 지방줄기세포에 여러 배지를 처리한 후 GABA성 신경세포 유전자(GAD67, GAT-1)와 신경전구세포 유전자(Nestin)의 발현을 나타낸 것이다.
도 5는 인간 지방줄기세포에 여러 배지를 처리한 후 GABA성 신경세포 표지 단백질(GABA)와 성숙신경세포 표지 단백질(βⅢ tubulin)의 발현을 면역형광화학법으로 확인한 그림이다(빨간색: GABA, 초록색: βⅢ tubulin, 파란색: 세포의 핵).
Fig. 1 shows the appearance of each mesenchymal stem cell derived from bone marrow (BM), umbilical cord blood (UCB), umbilical cord (UC) and adipose tissue (AT).
Fig. 2 shows the cell phenotype of each mesenchymal stem cell derived from bone marrow, umbilical cord blood, umbilical cord, and adipose tissue.
FIG. 3 shows the results of experiments to confirm the ability of human mesenchymal stem cells to differentiate into bone, fat, and cartilage.
FIG. 4 shows the expression of GABAgic neuron gene (GAD67, GAT-1) and neural progenitor cell gene (Nestin) after treatment of human adipose stem cells with various media.
FIG. 5 is a photograph showing the expression of GABA neuron labeled protein (GABA) and mature neuron labeled protein (βⅢ tubulin) by immunofluorescence after treating various adipocytes in human adipose stem cells (red: GABA, green : βⅢ tubulin, blue: nucleus of the cell).

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as limiting the scope of the present invention. It will be self-evident.

실시예Example

실시예 1: 인간 중간엽 줄기세포의 분리 및 배양Example 1: Isolation and culture of human mesenchymal stem cells

본 발명자는 이미 골수, 제대혈/제대, 지방조직에서 유래한 중간엽 줄기세포의 분리 배양에 성공한 바 있으며, 논문(Adel Alhadlaq et al., Stem Cells and Development, 13(4): 436-448(2004); D.T. Covas et al., Braz J Med Biol Res, 36(9):1179-1183(2003); Yu. A. Romanov et al., Bulletin of Experimental Biology and Medicine, 140(1):138-143(2005))에 기재된 방법에 따라 실시하여 골수, 제대혈/제대, 지방조직으로부터 각각 인간 중간엽 줄기세포를 분리 배양하고 그 모습을 도 1에 나타내었다.The present inventors have already succeeded in isolating and culturing mesenchymal stem cells derived from bone marrow, umbilical cord / umbilical cord, and adipose tissue. Adel Alhadlaq et al., Stem Cells and Development, 13 (4): 436-448 (2003); J. A. Romanov et al., Bulletin of Experimental Biology and Medicine, 140 (1): 138-143 (1994); DT Covas et al., Braz J Med Biol Res, 36 (9): 1179-1183 (2005)) to separate and culture human mesenchymal stem cells from bone marrow, umbilical cord / umbilical cord, and adipose tissue, respectively, and its appearance is shown in Fig.

얻어진 다분화능 줄기세포는 세포표면항원 CD14+, CD31+, CD45+, CD34-, CD133-, CD166- 등의 특징을 보였으며, 골모세포, 지방세포, 연골세포 등의 중배엽성 조직으로 분화가 가능하였다. 골수, 제대혈, 제대, 지방조직으로 부터 유래한 각각의 중간엽 줄기세포의 세포 표현형은 도 2에 나타내었고, 인간 중간엽 줄기세포의 골, 지방, 연골로의 분화능을 확인한 실험 결과는 도 3에 나타내었다.
The obtained multipotential stem cells showed cell surface antigens CD14 +, CD31 +, CD45 +, CD34-, CD133-, CD166-, and were able to differentiate into mesodermal tissues such as osteoblasts, adipocytes and chondrocytes. The cell phenotype of each mesenchymal stem cell derived from bone marrow, umbilical cord blood, umbilical cord, adipose tissue is shown in Fig. 2, and the experimental results of verifying the ability of human mesenchymal stem cells to differentiate into bone, Respectively.

실시예 2: 생체 외 GABA성 신경세포 분화 유도 Example 2 Induction of In Vitro GABA Neuronal Differentiation

2-1. HG-DMEM 배지 및 BDNF를 사용하여 GABA성 신경세포 분화 유도 2-1. Induction of GABAergic neuron differentiation using HG-DMEM medium and BDNF

상기 실시예 1에서 배양한 인간 지방유래 줄기세포를 5000 개/cm2 의 농도로 세포배양용기에 접종하였다. 세포를 부착시킨 후 20% FBS(Fetal Bovine Serum)가 들어있는 HG-DMEM(High glucose - Dulbecco's modified eagle media) 배지(Gibco)에 넣어서 37℃ 5% CO2 대기에서 24시간 배양하였다. 배양 후 PBS(phosphate buffered saline)로 2번 세척하고 분화배지를 첨가하였다. 분화 배지는 HG-DMEM 배지에 200 μM BHA(Butylated Hydroxyanisole)(Finetech), 5 mM 염화칼륨(potassium chloride, KCl), 2 mM 발프로산(valproic acid)(Alfa Chem), 10 μM 포스콜린(forskolin)(Spectrum), 1 μM 하이드로코르티손(hydrocortisone)(Spectrum), 5 ㎍/ml 인슐린(Alfa Chem)에 BDNF(brain-derived neurotrophic factor)(Sigma-aldrich) 50 ng/ml 를 첨가하였다. 세포는 37℃ 5% CO2 대기에서 24시간 배양하였다.The human adipose-derived stem cells cultured in Example 1 were inoculated into a cell culture container at a concentration of 5000 cells / cm 2 . After attaching the cells, they were cultured in HG-DMEM medium (Gibco) containing 20% FBS (Fetal Bovine Serum) for 24 hours at 37 ° C in a 5% CO 2 atmosphere. After incubation, the cells were washed twice with PBS (phosphate buffered saline) and the differentiation medium was added. The differentiation medium was prepared by adding 200 μM BHA (Butylated Hydroxyanisole) (Finetech), 5 mM potassium chloride (KCl), 2 mM valproic acid (Alfa Chem), 10 μM forskolin to HG- 50 ng / ml of brain-derived neurotrophic factor (BDNF) (Sigma-aldrich) was added to 1 μM hydrocortisone (Spectrum) and 5 μg / ml insulin (Alfa Chem). The cells were incubated for 24 hours at 37 ° C in a 5% CO2 atmosphere.

2-2. 2-2. HGHG -- DMEMDMEM 배지에서  On the badge BDNFBDNF 없이  without GABAGABA 성 신경세포 분화를 유도Induce sexual neuron differentiation

분화 배지에 BDNF를 사용하지 않은 것을 제외하고는 상기 2-1과 동일한 방법으로 GABA성 신경세포 분화를 유도하였다.GABAergic neuron differentiation was induced in the same manner as in 2-1 except that BDNF was not used in the differentiation medium.

2-3. 2-3. DMEMDMEM /F12 배지 및 / F12 medium and BDNFBDNF 를 사용하여 use with GABAGABA 성 신경세포 분화 유도 Induction of sexual neuron differentiation

분화 배지로 HG-DMEM 대신에 DMEM/F12(Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12) 배지(Gibco)를 사용한 것을 제외하고는 상기 2-1과 동일한 방법으로 GABA성 신경세포 분화를 유도하였다.GABAergic neuron differentiation was induced in the same manner as in 2-1 except that DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12) medium (Gibco) was used as the differentiation medium instead of HG-DMEM.

2-4. 2-4. DMEMDMEM /F12 배지에서 / F12 medium BDNFBDNF 없이  without GABAGABA 성 신경세포 분화를 유도Induce sexual neuron differentiation

분화 배지에 BDNF를 사용하지 않은 것을 제외하고는 상기 2-3과 동일한 방법으로 GABA성 신경세포 분화를 유도하였다.
GABAergic neuron differentiation was induced by the same method as above 2-3 except that BDNF was not used in the differentiation medium.

실시예Example 3.  3. RTRT -- PCRPCR 을 통한 through GABAGABA 성 신경분화 표지의 확인 Identification of sexual neural differentiation markers

RT-PCR(reverse transcription-polymerase chain reaction) 분석을 위하여 상기 2-1 내지 2-4에 따라 신경세포로의 분화유도가 끝난 세포 각각에 트리졸(Invitrogen) 1 ㎖을 5분간 처리하여 용해시키고 트리졸 1 ㎖당 클로로포름 200 ㎕를 처리하여 12,000 rpm의 속도로 15분간 원심분리 하였다. 이로부터 RNA가 포함된 상층액을 분리하여 새 튜브에 옮긴 후 트리졸 1 ㎖당 이소프로판올 500 ㎕를 첨가하여 RNA 침전을 유도하였다. 75% 냉각 에탄올로 RNA 침전물을 세척하고 상온에서 건조시킨 후 DEPC(diethyl pyrocarbonate)가 포함된 3차 증류수에 적정 농도로 RNA를 용해시켜 역전사 반응의 주형으로 사용하였다. 상기와 같이 준비된 RNA를 65℃에 5분간 두어 2차 구조를 제거하였다. 역전사 반응용액은 6× 역전사 효소 완충용액(LAROVA) 5 ㎕, 2.5 mM dNTP(LAROVA) 2 ㎕, 올리고 d(T) 프라이머(500 ng/㎕, LAROVA) 1 ㎕, RNase 억제제(LAROVA) 0.5 ㎕, 주형 RNA 2 ㎍ 및 역전사 효소(350 U/㎕, TaKaRa) 0.1 ㎕를 포함하며, DEPC 처리된 멸균 3차 증류수로 전체 반응부피를 30 ㎕로 적정하였다. For the RT-PCR (Reverse Transcription-Polymerase Chain Reaction) analysis, 1 ml of Invitrogen was treated and dissolved in each of the cells induced to differentiate into neurons according to 2-1 to 2-4 for 5 minutes, 200 [mu] l of chloroform per 1 ml of the sol was treated and centrifuged at a speed of 12,000 rpm for 15 minutes. From this, the supernatant containing RNA was separated and transferred to a new tube, and 500 μl of isopropanol per 1 ml of trizol was added to induce RNA precipitation. The RNA precipitates were washed with 75% cold ethanol and dried at room temperature. RNA was dissolved in tertiary distilled water containing DEPC (diethyl pyrocarbonate) and used as a template for the reverse transcription reaction. The RNA thus prepared was placed at 65 DEG C for 5 minutes to remove the secondary structure. The reverse transcription reaction solution contained 5 μl of 6 × reverse transcriptase buffer (LAROVA), 2 μl of 2.5 mM dNTP (LAROVA), 1 μl of oligodeptide (500 ng / μl, LAROVA), 0.5 μl of RNase inhibitor (LAROVA) 2 μg of template RNA and 0.1 μl of reverse transcriptase (350 U / μl, TaKaRa) and titrated with DEP-treated sterilized tertiary distilled water to a total reaction volume of 30 μl.

역전사 반응은 44℃에서 50분간 반응시킨 후, 94℃에서 5분간 역전사 효소를 불활성화시켜 cDNA를 합성함으로써 이후 PCR에 사용될 주형 cDNA를 제조하였다. PCR에 사용한 프라이머는 가바성 신경세포에 특이적인 GAD67 유전자를 위한 primer쌍(정방향; 5'-CGAGGACTCTGGACAGTAGAGG-3', 역방향; 5'-GATCTTGAGCCCCAGTTTTCTG-3'), GAT-1 유전자를 위한 프라이머쌍 (정방향; 5'-TGGCTGATGGCTCTGTCTTC-3', 역방향; 5'-ACAGTGTCTTCGCTGGGCTG-3')과 신경분화초기에 발현하는 인자인 네스틴(nestin) 유전자를 위한 프라이머쌍 (정방향; 5'- gccctgaccactccagttta -3', 역방향; 5'- ggagtcctggatttccttcc -3') 그리고 GAPDH를 통해 농도를 보정하기 위한 프라이머쌍 (정방향; 5'-ATCTCCATCTTCCAGGAGCG-3', 역방향; 5'-CCTGCTTCACCACCTTCTTG-3')을 사용하였다. The reverse transcription reaction was carried out at 44 ° C for 50 minutes, and the cDNA was synthesized by inactivating the reverse transcriptase at 94 ° C for 5 minutes to prepare a template cDNA to be used for the subsequent PCR. The primers used for PCR were primer pair (forward direction: 5'-CGAGGACTCTGGACAGTAGAGG-3 ', reverse direction: 5'-GATCTTGAGCCCCAGAGTTTTCTG-3') for the GAD67 gene specific for the Caucasian neuron, ; 5'-gccctgaccactccagttta -3 'for the nestin gene, which is a factor expressing early in neural differentiation (reverse direction, 5'-ACGTGTCTTCGCTGGGCTG-3', reverse direction 5'-TGGCTGATGGCTCTGTCTTC-3 ' ; 5'-ggagtcctggatttccttcc -3 ') and a primer pair (5'-ATCTCCATCTTCCAGGAGCG-3', reverse direction; 5'-CCTGCTTCACCACCTTCTTG-3 ') for correcting the concentration through GAPDH was used.

반응튜브에 각 프라이머(10 pmole) 0.5 ㎕, 2.5 mM dNTP 혼합액 2 ㎕, 10× Taq DNA 중합효소 완충용액(염화마그네슘 포함) 2.5 ㎕, 주형 cDNA 2 ㎕ 및 Taq DNA 중합효소(KOMA biotech) 0.1 ㎕를 첨가하고 멸균된 3차 증류수로 전체 반응부피를 25 ㎕로 적정한 후 각 프라이머 쌍에 대한 반응조건에서 PCR을 실시하였다. DNA의 증폭을 위한 PCR은 94℃에서 먼저 5분간 변성시킨 후, 35 사이클로 94℃에서 30초 동안 변성시키고, 48℃ 내지 62℃에서 30초간 결합 및 72℃에서 1분간 증폭한다. 마지막 사이클이 끝난 후 72℃에서 7분 동안 증폭시켰다. 이때, 각각의 유전자에 대한 프라이머의 어닐링 온도는 GAD67 58℃, GAT-1 67℃ 및 네스틴 57℃이다. PCR 결과 증폭된 DNA 산물은 2% 아가로스 젤에 전기영동한 후 에티디움 브로마이드 염색하여 Gel Doc XR (BIO-RAD)을 이용하여 밴드를 확인하고 그 결과를 도 4에 나타내었다(라인 1: 상기 2-2의 세포를 시료로 사용한 것임, 라인 2: 상기 2-1 세포를 시료로 사용한 것임, 라인 3: 상기 2-4 세포를 시료로 사용한 것임, 라인 4: 상기 2-3 세포를 시료로 사용한 것임, 대조군(control): 미분화한 줄기세포를 시료로 사용함).To the reaction tube, 0.5 μl of each primer (10 pmole), 2 μl of 2.5 mM dNTP mixture, 2.5 μl of 10 × Taq DNA polymerase buffer solution (containing magnesium chloride), 2 μl of template cDNA and 0.1 μl of Taq DNA polymerase (KOMA biotech) Was added to each well, and 25 μl of the total reaction volume was titrated with sterilized distilled water. PCR was carried out under the reaction conditions for each pair of primers. The PCR for the amplification of DNA is first denatured at 94 ° C for 5 minutes, denatured at 35 ° C for 30 seconds at 94 ° C, and then annealed at 48 ° C to 62 ° C for 30 seconds and at 72 ° C for 1 minute. After the last cycle, the cells were amplified at 72 ° C for 7 minutes. At this time, the annealing temperatures of the primers for the respective genes are GAD67 58 deg. C, GAT-1 67 deg. C and Nestin 57 deg. The amplified DNA product was electrophoresed on 2% agarose gel, stained with ethidium bromide, and band was confirmed using Gel Doc XR (BIO-RAD). The results are shown in FIG. 4 (line 1: Line 2: The above 2-1 cells were used as a sample. Line 3: The above-mentioned 2-4 cells were used as a sample. Line 4: The above 2-3 cells were used as a sample , Control (control): undifferentiated stem cells are used as a sample).

그 결과 GABA성 신경세포 표지자인 GAD67과 GAT-1의 발현이 DMEM/F12배지에 BDNF를 처리한 군(상기 2-3)이 가장 발현이 높게 나왔고, 신경전구세포 표지자인 네스틴의 발현이 감소하였다. 즉 DMEM/F12배지에 BDNF를 처리하여 분화를 유도하는 경우 GABA성 신경세포를 대량으로 생성시킬 수 있음을 확인하였다. 미분화한 지방조직 줄기세포인 대조군에서는 표지자의 발현이 나타나지 않았다.
As a result, the expression of GAD67 and GAT-1, which are GABAgic neuron markers, was highest in the group treated with BDNF in the DMEM / F12 medium (2-3 above), and the expression of the neural progenitor cell nestin was decreased Respectively. In other words, when BDNF was treated in the DMEM / F12 medium to induce differentiation, it was confirmed that a large amount of GABAergic neurons could be produced. In the undifferentiated adipose tissue stem cells, the control group did not express the marker.

실시예Example 4.  4. 세포면역형광화학법에In cell-mediated immunocytochemistry 의한  by GABAGABA 성 신경분화 표지의 확인 Identification of sexual neural differentiation markers

면역형광염색법을 실시하기 위하여 우선, 분리된 지방 유래 줄기세포를 챔버 슬라이드에 부착 시킨 후 실시예 1에 따라 GABA성 신경세포분화 방법으로 분화 배양하였다. 분화유도 후 먼저 챔버 슬라이드를 PBS로 헹구고, 상기 2-1 내지 2-4의 세포 시료를 각각 실온에서 10% 포르말린 솔루션으로 15분간 고정하였다. 그런 다음 0.2% 트리톤 X-100이 들어있는 PBS용액으로 실온에서 5분간 침투시키고, 비특이적 결합을 막기 위해 실온에서 2% FBS이 들어있는 PBS로 30분간 차단시켰다. GABA성 신경세포에 특이적인 GABA/βⅢ 튜블린 1차 항체를 PBS에 1:100으로 희석하여 4℃에서 18시간 반응시켰다: 폴리클로날 GABA 항체(Sigma), 모노클로날 βⅢ 튜블린 항체(chemicon). In order to perform immunofluorescence staining, first, isolated adipose-derived stem cells were attached to a chamber slide, and then differentiated into GABA neuronal differentiation according to Example 1. After induction of differentiation, the chamber slides were first rinsed with PBS, and the cell samples of 2-1 to 2-4 were fixed at room temperature with 10% formalin solution for 15 minutes, respectively. Then, it was permeabilized with PBS solution containing 0.2% Triton X-100 for 5 minutes at room temperature and blocked with PBS containing 2% FBS at room temperature for 30 minutes to prevent nonspecific binding. The GABA / β III tubulin primary antibody specific for GABA neurons was diluted 1: 100 in PBS and reacted at 4 ° C. for 18 hours: polyclonal GABA antibody (Sigma), monoclonal βIII tubulin antibody (chemicon ).

1차 항체 반응이 끝난 세포를 PBS로 3번 세척한 후 FITC(Fluorescein isothiocyanate)와 로다민(Rhodamine)이 표지된 2차 항체(Vector)로 30분간 실온에서 암반응 시켰다. 그런 다음 PBS로 2번 세척한 후 핵을 염색하기 위하여 DAPI(4',6-diamidino-2-phenylindole)를 PBS에 1:1000으로 희석하여 실온에서 10분간 반응시킨 후 다시 PBS로 2번 세척한 후 형광 현미경에서 관찰하여 면역 양성 세포를 평가하고 그 결과를 도 5에 나타내었다.After the primary antibody reaction, the cells were washed three times with PBS, and then reacted with FITC (Fluorescein isothiocyanate) and rhodamine-labeled secondary antibody for 30 minutes at room temperature. After washing twice with PBS, DAPI (4 ', 6-diamidino-2-phenylindole) was diluted 1: 1000 in PBS for 10 min at room temperature and washed twice with PBS The immunofluorescent cells were evaluated by observation with a fluorescence microscope and the results are shown in Fig.

그 결과, DMEM/F12에 BDNF를 처리한 군(상기 2-3)에서 성숙신경세포 표지 단백질인 βⅢ 튜블린과 GABA성 신경세포 표지 단백질인 GABA의 발현이 가장 높은 분포를 나타내었다. 즉 DMEM/F12배지에 BDNF를 처리하여 분화를 유도하는 경우 GABA성 신경세포를 대량으로 생산할 수 있음을 확인하였다. 미분화한 지방조직 줄기세포인 대조군에서는 전혀 발현하지 않았다.
As a result, in the group treated with BDNF in DMEM / F12 (above 2-3), the expression of mature neuron-labeled protein βIII-tubulin and GABA-labeled neural cell protein GABA was the highest. In other words, when BDNF was treated in DMEM / F12 medium to induce differentiation, it was confirmed that GABAergic neurons could be mass produced. But not in the control group, which was an undifferentiated adipose tissue stem cell.

실시예Example 5.  5. 생체내In vivo GABAGABA 성 신경세포 분화 유도법Induction of sexual neuron differentiation

중간엽 줄기세포 1×104 세포 내지 1×106 세포를 병변측 선조체 내로 이식 후, 신경영양인자 및 세포증식인자를 Alzet 오스모틱 펌프(model 2002; 배출속도 0.5 ㎕/hr, 배출기간 14일, 배출용량 200 ㎕; Durect, Cupertino, CA)를 사용하여 2주 동안 뇌실내로 지속적으로 주입하였다. 카뉼라(Cannula, Brain Infusion Kit)를 우측 뇌실내로 정위고정 좌표(stereotaxic coordinate)를 이용하여 삽입하고, 오스모틱 펌프는 등 뒤의 피하조직내로 삽입하였다. 오스모틱 펌프는 증식인자 또는 영양인자가 바로 배출될 수 있도록 수술 시행 전날부터 37도로 전처지하였다. 1 × 10 4 cells to 1 × 10 6 cells of mesenchymal stem cells were transplanted into the lesion-side striatum, and the neurophysiologist and cell proliferative factor were transferred to an Alzet osmotic pump (model 2002; discharge rate 0.5 μl / hr, discharge period 14 days, (Durect, Cupertino, Calif.) For 2 weeks. The Cannula (Brain Infusion Kit) was inserted into the right brain chamber using stereotaxic coordinates, and the osmotic pump was inserted into the subcutaneous tissue behind the back. The osmotic pump was pre-positioned at 37 degrees Celsius from the day before the operation, so that the proliferative or nutritional factors could be released immediately.

즉, 세포증식인자인 상피 성장 인자(epidermal growth factor: EGF) 또는 섬유모세포 성장 인자(fibroblast growth factor-2: FGF-2)를 투여하여 이식된 세포의 증식을 유지하고, 신경영양인자인 뇌유래영양인자(brain-derived neurotrophic factor BDNF) 1 ㎍/ml - 1,000 ㎍/ml 를 투여하여 GABA성 뉴런의 분화 유도를 증진 시켰다.
That is, by administering epidermal growth factor (EGF) or fibroblast growth factor-2 (FGF-2) as a cell proliferation factor, the proliferation of the transplanted cells is maintained and a neurotrophic brain- Induced neurotrophic factor BDNF (1 ㎍ / ml - 1,000 ㎍ / ml).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (10)

다음 단계를 포함하는 중간엽 줄기세포를 GABA(gamma-aminobutyric acid)성 신경세포로 분화시키는 방법:
분리된 중간엽 줄기세포를 BDNF(brain-derived neurotrophic factor)를 포함하는 DMEM/F12 배지에서 배양하여 GABA성 신경세포로 분화시키는 단계.
Methods for differentiating mesenchymal stem cells into GABA (gamma-aminobutyric acid) neurons comprising the following steps:
The isolated mesenchymal stem cells are cultured in DMEM / F12 medium containing BDNF (brain-derived neurotrophic factor) to differentiate into GABA neurons.
삭제delete 제 1 항에 있어서, 상기 중간엽 줄기세포는 골수, 제대혈 또는 지방조직으로부터 수득한 것을 특징으로 하는 방법.
The method according to claim 1, wherein the mesenchymal stem cells are obtained from bone marrow, umbilical cord blood, or adipose tissue.
제 1 항에 있어서, 상기 BDNF의 양은 상기 배지를 기준으로 하여 20-100 ng/ml인 것을 특징으로 하는 방법.
The method according to claim 1, wherein the amount of BDNF is 20-100 ng / ml based on the medium.
삭제delete 삭제delete 삭제delete 삭제delete 삭제delete BDNF(brain-derived neurotrophic factor)를 유효성분으로 포함하는 생체 외에서의 중간엽 줄기세포의 GABA(gamma-aminobutyric acid)성 신경세포로의 분화유도용 조성물.A composition for inducing the differentiation of mesenchymal stem cells into GABA (gamma-aminobutyric acid) neurons in vitro, comprising BDNF (brain-derived neurotrophic factor) as an active ingredient.
KR1020100014681A 2010-02-18 2010-02-18 Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell KR101548616B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100014681A KR101548616B1 (en) 2010-02-18 2010-02-18 Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100014681A KR101548616B1 (en) 2010-02-18 2010-02-18 Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell

Publications (2)

Publication Number Publication Date
KR20110094940A KR20110094940A (en) 2011-08-24
KR101548616B1 true KR101548616B1 (en) 2015-09-01

Family

ID=44930873

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100014681A KR101548616B1 (en) 2010-02-18 2010-02-18 Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell

Country Status (1)

Country Link
KR (1) KR101548616B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101346582B1 (en) * 2011-11-08 2013-12-30 서울대학교산학협력단 A pharmaceutical composition for treating neuropathic pain comprising GABAergic neurons, which is adipose tissue-derived stem cell(ATSCs) differentiated by CBM-1078 as active ingredients
KR101542847B1 (en) * 2013-11-01 2015-08-10 주식회사 비비에이치씨 Method for Differentiating Pluripotency Stem Cell Induced from Mesenchymal Stem Cell into Neuron
CN111304167B (en) * 2018-12-12 2024-03-26 上海泉眼生物科技有限公司 Neuron precursor cells derived from human adipose-derived stem cells, and preparation method and application thereof

Also Published As

Publication number Publication date
KR20110094940A (en) 2011-08-24

Similar Documents

Publication Publication Date Title
Zhang et al. Differentiation and neurological benefit of the mesenchymal stem cells transplanted into the rat brain following intracerebral hemorrhage
CN105492597B (en) Method for preparing neural stem cell-inducing cell reprogrammed by non-neuron cell by using HMGA2
US20060247195A1 (en) Method of altering cell properties by administering rna
KR101686315B1 (en) A method for differentiation of tonsil-derived mesenchymal stem cell into schwann cells
KR101885122B1 (en) Spheroidal culture method of tonsil-derived mesenchymal stem cells for accelerating differentiation efficacy and maintenance of stemness
US20200206272A1 (en) Treatment agent for epidermolysis bullosa
JP2023038336A (en) Induction of neural progenitor cells, oligodendrocyte progenitor cells and oligodendrocytes by stem cell differentiation using landmark transcription factors
KR101548616B1 (en) Method of Inducing Mesenchymal Stem Cell to Differentiate into GABAergic Neuronal Cell and Compostion Comprising BDNF for Inducing Differentiation into GABAergic Neuronal Cell
US20120114616A1 (en) Olfactory stem cells and uses thereof
US9499787B2 (en) Method for differentiating stem cells into neurons
Jahromi et al. Emergence of signs of neural cells after exposure of bone marrow-derived mesenchymal stem cells to fetal brain extract
EP2845898B1 (en) Method for culturing neural crest stem cells, and use thereof
KR102236642B1 (en) A method for differentiation of tonsil-derived mesenchymal stem cell into motor neuron
Zhang et al. Comparison of adult neurospheres derived from different origins for treatment of rat spinal cord injury
EP4321614A1 (en) Method for preparing oligodendrocytes and use
JP6410343B2 (en) Induction from adipose tissue-derived stem cells into epidermal keratinocytes
KR100890992B1 (en) Method of inducing differentiation of mesenchymal stem cells into neurons
US20190374681A1 (en) Method for isolating human brain tissue-derived neural stem cell at high efficiency
JP2011211956A (en) Undifferentiation-maintaining agent for stem cell and growth-promoting agent
KR20190000596A (en) Novel Mesenchymal stem cells derived from Tissue of Animal Tongue and Method for Preparing Thereof
Du et al. HiPSC-Neural Stem/Progenitor Cell Transplantation Therapy for Spinal Cord Injury
WO2005095587A1 (en) Process for producing somatic stem cell differentiated from embryonic stem cell and use of the same
KR20180092523A (en) Serum-free medium additive composition and method for inducing chondrogenesis of mesenchymal stem cells
KR102280199B1 (en) A Composition for Enhancing Immunomodulatory Activity of Mesenchymal Stem Cells
KR100973823B1 (en) The potential of embryonal carcinoma cells as a new model system for endothelial cell differentiation

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180702

Year of fee payment: 4