LU500095B1 - LAMP Detection Method for Identifying Dog Meat in Beef and Mutton - Google Patents

Abstract

The present invention relates to an LAMP detection method for identifying dog meat in beef and mutton by using mitochondrial DNA, and belongs to the technical field of molecular biological detection. According to the detection method, an LAMP detection system is built by using DNA of a meat product to be detected as a template and using DF3, DB3, DFIP and DBIP as primers; the LAMP detection system reacts in a 64 °C thermostatic water bath for 40 min, and 1 uL of fluorescent dye SYBR GREEN I is added to the reaction liquid after the reaction; if the reaction liquid becomes green, the condition indicates that dog meat is present in the meat product to be detected; and if the reaction liquid becomes saffron yellow, the condition indicates that dog meat is not present in the meat product to be detected.

Description

DESCRIPTION LAMP Detection Method for Identifying Dog Meat in Beef and Mutton

TECHNICAL FIELD The present invention relates to a LAMP detection method for identifying dog meat in beef and mutton by using mitochondrial DNA, and belongs to the technical field of molecular biological detection.

BACKGROUND In recent years, with the increasing demand for beef and mutton in the market and the rapid rise in price, some unscrupulous traders, driven by profits, adulterate other cheap meat to pretend to be beef and mutton. Since 2012, a number of incidents of adulterating pork, chicken and duck in beef and mutton have been reported in China; what's more, meat of dogs dead of diseases is adulterated in beef and mutton, which not only disrupts the economic order, but also seriously endangers the health of people.

The currently available methods for detecting components of animal origin mainly include conventional PCR and fluorescence quantitative PCR, but the diagnostic methods take a long time, and the determination of results requires precise instruments and equipment, therefore, it is difficult to popularize and apply such methods in practical production.

SUMMARY In order to solve the above technical problems in detection of dog meat adulterated in beef and mutton by conventional PCR and fluorescence quantitative PCR, dog meat is identified by LAMP technology and cytochrome C oxidase subunit I(COX I) gene on animal mitochondrial DNA through reaction in a thermostatic water bath for 40 min, and the results can be directly observed by naked eyes by adding a dye to the final product.

The technical solution of the present invention is as follows: An LAMP detection method for identifying dog meat in beef and mutton by using mitochondrial DNA, characterized in that an LAMP detection system is built by using DNA of a meat product to be detected as a template and using DF3, DB3, DFIP and DBIP as primers; wherein the LAMP detection system reacts in a 64 °C thermostatic water bath for 40 min, and 1 uL of fluorescent dye SYBR GREEN I is added to the reaction liquid after the reaction; if the reaction liquid becomes green, the condition indicates that dog meat is present in the meat product to be detected; and if the reaction liquid becomes saffron yellow, the condition indicates that dog meat is not present in the meat product to be detected: wherein the primers used are as follows: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC,as shown in SEQ ID NO.3, DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA,as shown in SEQ ID NO.4.

wherein the LAMP detection system, with a total volume of 25 pL, is composed of

0.5 pL of 10 ymol/L DF3, 0.5 pL of 10 umol/L DB3, 4 uL of 10 pmol/L DFIP, 4 pL of 10 pmol/L DBIP, 4 pL of 2.5 mmol/L dNTP, 2 uL of 50 mmol/L MgSO4,

2.5 uL of 5 mol/L Betaine, 1 uL of Bst DNA polymerase, 2.5 uL of 10xThermo buffer, 2 uL of template and the balance ultrapure water.

Compared with the conventional PCR, the detection method of the present invention can be completed through reaction in an ordinary thermostatic water bath for 40 min, and the results can be directly observed by naked eyes by adding a dye to the final product, so that components of animal origin can be quickly and accurately identified. The LAMP detection method has the advantages of simple operation, low requirements for experimental instruments and easy determination of results. The LAMP detection method of the present invention does not require large expensive instruments and equipment, and thus is more suitable for in-situ detection at the base level, with broad market prospects and great social and economic benefits.

With cytochrome C oxidase subunit I(COX I) gene on mitochondrial DNA as a target gene; and DF3, DB3, DFIP and DBIP as primers, the COX I gene of dog meat can be amplified specifically, so that dog meat can be detected from mutton and beef, and can also be distinguished from meat of similar species such as cats and foxes. Therefore, the present invention has the advantage of high specificity. In addition, with DF3, DB3, DFIP and DBIP as primers, the sensitivity is high, and the minimum detectable concentration is 2x10* ng/uL. Therefore, even a small amount of adulterated dog meat can be detected.

The present invention further provides a detection reagent for the LAMP detection method, comprising the following primers: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC,as shown in SEQ ID NO.3, DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA,as shown in SEQ ID NO.4.

The present invention further provides a detection kit for the LAMP detection method, comprising 0.5 uL of 10 pmol/L DF3, 0.5 uL of 10 umol/L DB3, 4 UL of 10 umol/L DFIP, 4 pL of 10 umol/L DBIP, 4 uL of 2.5 mmol/L dNTP, 2 uL of 50 mmol/L MgSO4, 2.5 uL of 5 mol/L Betaine, 1 uL of Bst DNA polymerase and 2.5 pL of 10xThermo buffer; wherein: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC,as shown in SEQ ID NO.3, DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA,as shown in SEQ ID NO.4.

BRIEF DESCRIPTION OF THE FIGURES Fig. 1 shows detection results in Example 1; from left to right: positive control, negative control, beef, mutton, dog meat, cat meat, mink meat and fox meat; results: tubes 1 and 5 are green and the rest tubes are saffron yellow.

Fig. 2 is a schematic diagram showing the sensitivity of the PCR detection method; from right to left: Marker, 10-1, 10-2, 105, 104 and 10° dilutions.

Fig.3 is a schematic diagram showing the sensitivity of the LAMP detection method; from right to left: Marker, 107, 102, 10%, 10% and 10° dilutions.

DESCRIPTION OF THE INVENTION In the following examples, all reagents used are analytically pure except those supplied directly by manufacturers; and water is ultrapure water, unless otherwise specified.

Example 1 Design primers A COX I sequence of dog was retrieved from the GenBank and analyzed by software to determine the accuracy of the sequence. Based on the sequence, primers are designed by using PrimerExplore software as follows: DF3: TTATTTACAGTAGGCGGGTT (as shown in SEQ ID NO.1), DB3: GTAAAGTGAATCTTTGCTCAAG(as shown in SEQ ID NO.2), DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC(as shown in SEQ ID NO.3),

DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA (as shown in SEQ ID NO.4).

Example 2 (1) Extraction of DNA from samples as templates Fresh muscle tissues of cattle, sheep, dogs, cats, foxes and minks were collected aseptically as samples, and then DNA was extracted from the samples by phenol-chloroform extraction respectively. LAMP systems were established with positive plasmids containing dog COX I gene (positive control), ultrapure water (negative control), beef DNA, mutton DNA, dog meat DNA, cat meat DNA, fox meat DNA and mink meat DNA preserved in the laboratory as templates respectively, with the concentrations of the DNA templates of 20 ng/uL.

(2) Establishment of LAMP system The LAMP system established by exploring the concentration ratio of inner primers to outer primers, dNTP concentration, reaction temperature and reaction time, with a volume of 25 uL, was composed of 0.5 uL of 10 umol/L DF3, 0.5 pL of 10 umol/L DB3, 4 pL of 10 umol/L DFIP, 4 pL of 10 jmol/L DBIP, 4 UL of 2.5 mmol/L dNTP, 2 pL of 50 mmol/L MgSO4, 2.5 uL of 5 mol/L Betaine, 1 uL of Bst DNA polymerase, 2.5 uL of 10xThermo buffer, 2 uL of template with the minimum concentration of 20 ng/uL, and the balance ultrapure water.

Among them, the dNTP and the MgSO4 were purchased from Takara Biotechnology (Dalian) Co., Ltd., the Betaine was purchased from Sigma, the Bst DNA polymerase (8 U/uL) and the 10xThermo buffer were purchased from

NEB, and the SYBR GREEN I was purchased from Beijing Solarbio Science & Technology Co., Ltd.

(3) LAMP amplification reaction The LAMP systems (arranged in the order of the templates obtained in Example 1) were placed in a 64 °C thermostatic water bath for LAMP for 40 min; and 1 pL of fluorescent dye SYBR GREEN I was added after the reaction. The colors of the reaction liquid are green, saffron yellow, saffron yellow, saffron yellow, green, saffron yellow, saffron yellow and saffron yellow in sequence (as shown in Fig. 1). Among them, saffron yellow represents a negative result and green represents a positive result.

Example 3 A total of 30 fresh beef samples and 30 fresh mutton samples were collected from slaughterhouses in Shandong Province; and 10 fresh dog meat samples were collected from Shandong Animal Hospital; and DNA was extracted from the samples by the method in Example 1 as templates to establish LAMP systems for LAMP. The detection results are shown in Table 1: Table 1

DEZE samples 70 0 | 0 || 0 | 10 | wm | Positive rate/% | 0 | 0 |100| 0 | 100 | 100 | It can be concluded from Examples 2 and 3 that the primers in Example 1 can specifically amplify dog meat DNA. The reaction liquid with fluorescent dye

SYBR GREEN I added to LAMP products becomes green only when the templates contain dog meat DNA; and the reaction liquid with fluorescent dye SYBR GREEN I added to the LAMP products becomes saffron yellow when the templates contain any non-dog meat (beef, mutton, cat meat, fox meat, mink meat) DNA. Therefore, dog meat can be distinguished from meat of other animals (beef, mutton, cat meat, fox meat and mink meat) with the fluorescent dye SYBR GREEN I as a developer by using the primers in Example 1 and the LAMP systems, thereby identifying whether dog meat is present in the meat product.

Example 4 Sensitivity test The DNA used for the positive control in Example 1 was diluted at 1077, 102, 10-3, 104 and 10° dilutions respectively, and the diluted DNA was used as templates for LAMP and PCR respectively to compare the sensitivity of the two detection methods. The results indicated that the amplification sensitivity of LAMP was higher than that of ordinary PCR. The third dilution gradient (as shown in Fig. 2) can be detected by ordinary PCR, while the fourth dilution gradient (as shown in Fig. 3) can be detected by LAMP.

<110> Animal Products Quality and Safety Center of Shandong Province <120> LAMP Detection Method for Identifying Dog Meat in Beef and Mutton <160>4 <210>1 <211>20

<212>DNA <213> Artificial synthesis <400>1 TTATTTACAG TAGGCGGGTT 20 <210>2 <211>22 <212>DNA <213> artificial sequence <400>2 GTAAAGTGAA TCTTTGCTCA AG 22 <210>3 <211>46 <212>DNA <213>artificial sequence <400>3

ACATAGTGAA AATGAGCCAC AACATATTGT CCTAGCTA AT TCGTCC 46 <210>4 <211>48 <212>DNA <213>artificial sequence

<400>4

CTTTCAATAG GAGCAGTTTT TGCCTATCGT TAAGAGTATA ACCTGAGA 48

Claims (3)

1. An LAMP detection method for identifying dog meat in beef and mutton, characterized in that an LAMP detection system is built by using DNA of a meat product to be detected as a template and using DF3, DB3, DFIP and DBIP as primers; wherein the LAMP detection system reacts in a 64 °C thermostatic water bath for 40 min, and 1 uL of fluorescent dye SYBR GREEN I is added to the reaction liquid after the reaction; if the reaction liquid becomes green, the condition indicates that dog meat is present in the meat product to be detected; if the reaction liquid becomes saffron yellow, the condition indicates that dog meat is not present in the meat product to be detected: wherein the primers used are as follows: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC, as shown in SEQ ID NO.3, DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA, as shown in SEQ ID NO.4, wherein the LAMP detection system, with a total volume of 25 pL, is composed of

0.5 pL of 10 pmol/L DF3, 0.5 pL of 10 pmol/L DB3, 4 uL of 10 umol/L DFIP, 4 pL of 10 pmol/L DBIP, 4 pL of 2.5 mmol/L dNTP, 2 uL of 50 mmol/L MgSO4,

2.5 uL of 5 mol/L Betaine, 1 uL of Bst DNA polymerase, 2.5 uL of 10xThermo buffer, 2 uL of template and the balance ultrapure water.

2. A detection reagent for the LAMP detection method for identifying dog meat in beef and mutton, characterized by comprising the following primers: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC, as shown in SEQ ID NO.3, DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA, as shown in SEQ ID NO.4.

3. A detection kit for the LAMP detection method for identifying dog meat in beef and mutton, characterized by comprising 0.5 pL of 10 umol/L DF3, 0.5 HL of 10 umol/L DB3, 4 UL of 10 pmol/L DFIP, 4 pL of 10 pmol/L DBIP, 4 pL of

2.5 mmol/L dNTP, 2 pL of 50 mmol/L MgSOQOs, 2.5 pL of 5 mol/L Betaine, 1 pL of Bst DNA and 2.5 uL of 10xThermo buffer; wherein: DF3: TTATTTACAGTAGGCGGGTT, as shown in SEQ ID NO 1, DB3: GTAAAGTGAATCTTTGCTCAAG, as shown in SEQ ID NO.2, DFIP: ACATAGTGAAAATGAGCCACAACATATTGTCCTAGCTAATTCGTCC,as shown in SEQ ID NO.3,

DBIP: CTTTCAATAGGAGCAGTTTTTGCCTATCGTTAAGAGTATAACCTGAGA,as shown in SEQ ID NO.4.