LU102712B1 - Primer, kit, and detection method for simultaneous detection of eight animal-derived ingredient and use thereof - Google Patents

Abstract

The present disclosure provides a primer composition, a kit and a detection method for one-step simultaneous detection of eight animal-derived ingredients in food or feedstuff, and use thereof. The primers, kit and detection method provided by the present disclosure can be used to rapidly authenticate whether there are 1-8 animal-derived ingredients from pigs, cattle, goat, chickens, ducks, rabbits, foxes, and minks in food or feedstuff through a one-step multiplex PCR. The method provided by the present disclosure has the advantages of rapidness, high efficiency, specificity, sensitivity, and economy, and one-step reaction can realize simultaneous authentication of the eight animal-derived ingredients.

Description

DESCRIPTION PRIMER, KIT, AND DETECTION METHOD FOR SIMULTANEOUS DETECTION OF EIGHT ANIMAL-DERIVED INGREDIENT AND USE THEREOF

TECHNICAL FIELD The present disclosure belongs to the field of gene detection, and in particular relates to a primer composition, a kit and a detection method for one-step simultaneous detection of eight animal-derived ingredients from pigs, cattle, goats, chickens, ducks, rabbits, foxes, and minks in food or feedstuff, and use thereof.

BACKGROUND Food safety 1s a hot topic of great concern in today's society. With the improvement of people's living standards, meat and meat products are becoming more and more important in diet structure. Unscrupulous merchants often use shoddy, adulterated and other means to reduce the costs of the meat and meat products, and make illegal profits, leading to prominent counterfeit and inferior meat and meat products in the current market. The common method of meat adulteration in the market is to use large-scale raised and cheap animal meat (such as chicken or duck) to counterfeit high-quality and high-priced beef and lamb/mutton, and even use inedible meat (such as fox meat or mink meat) to counterfeit beef, lamb/mutton, pork, rabbit meat, and the like.

The meat adulteration severely disrupts the normal market order, infringes on the legitimate rights and interests of consumers, and even endangers the safety of people’s life and property safety, causing serious food safety and other problems. After people eat counterfeit and inferior meat products, they may be sick or poisoned because the products contain certain pathogenic microorganisms or ingredients toxic and harmful to human body; alternatively, some people who are allergic to individual types of meat may blindly ingest allergens that cause allergic diseases. This requires the establishment of accurate and efficient meat authentication methods. Only on this basis, the food supervision department can reinforce supervision to ensure food safety and protect consumers from the rights and health violations caused by meat fraud.

Similarly, meat protein materials are adulterated in the feedstuff. It has been reported inside and outside of China that low-value meat protein materials are used to counterfeit high-value ones, or animal offal, feather meal, bone meal, and the like are used instead of fish meal. These phenomena disrupt the normal order of the feed industry and increase the risk of morbidity in breeding. This further requires the establishment of accurate and efficient meat authentication methods. Only on this basis, the agricultural supervision department can reinforce supervision to ensure feed safety, thereby ensuring the safety of breeding and animal products.

A fast, accurate, convenient, efficient and economical meat authentication method is a challenge facing in the field of food and feed detection. Conventional meat authentication methods established based on morphological characteristics (flavor, color, shape, taste, and appearance), such as sensory analysis and histological authentication, cannot distinguish different animal-derived ingredients. Meat authentication methods established based on protein analysis, such as electrophoresis and ELISA, have low resolution and are prone to false positive and false negative results. Moreover, in the process of food and feed processing and cooking, proteins denature due to high temperature and high pressure. Denaturation affects the accuracy of the detection results, making the detection methods based on protein analysis particularly difficult in detecting ingredients of cooked meat products.

In the process of food and feed processing, some biomarkers for distinguishing meat will be destroyed. However, DNAs are extremely stable and ubiquitous in all tissues and cells, so DNA-based meat authentication methods have excellent applicability. The DNA-based meat authentication methods mainly include polymerase chain reaction (PCR), multiplex PCR, fluorescent quantitative PCR, loop-mediated isothermal amplification (LAMP), and the like.

(1) PCR can exponentially amplify a specific DNA fragment with high specificity and sensitivity, and can be used to authenticate counterfeit meat raw materials and meat products. Classic PCR uses a pair of specific primers to amplify a target fragment. In conventional PCR methods for meat authentication, one pair of primers can only be used to authenticate one species at a time. More than two kinds of meat and products thereof need a plurality of PCR assays to authenticate, which is time-consuming and costly.

(2) Multiplex PCR is to add more than two pairs of primers into the same PCR system to simultaneously amplify a plurality of nucleic acid fragments, which is used to authenticate meat products containing more than two types of meat. The detection efficiency of the multiplex PCR 1s higher than that of conventional PCR. Two challenges that need to be overcome for the multiplex PCR assay are the design of multiplex PCR primers and the optimization of multiplex PCR conditions. The former ensures the specificity of the primers and the latter ensures the stability of the assay.

(3) Real-time fluorescent quantitative PCR enables qualitative or quantitative analysis of meat products with high sensitivity. Compared with PCR, fluorescent PCR omits the steps of electrophoresis or sequencing. However, fluorescent PCR requires the purchase of expensive fluorescent quantitative PCR machine and fluorescent PCR kits, and contamination and false positive results are prone to occur during detection. Moreover, in most cases, meat detection only requires qualitative detection, and quantitative detection has no practical significance. In contrast, multiplex PCR is more suitable for meat detection in daily production activities, and fluorescent PCR assays are difficult to popularize in practice.

The difference between the present disclosure and the existing disclosures 1s as follows: The existing China Patent Application No. CN108330168A discloses a method for authenticating whether meat or meat products contain 14 animal-derived ingredients from pigs, cattle, sheep, goats, chickens, ducks, dogs, foxes, raccoon dogs, cats, rats, donkeys, deer and horses based on two 5-plex PCRs and microchip electrophoresis technology. However, each multiplex PCR system can only authenticate five animal-derived ingredients, and the patent does not cover rabbits that are raised on a large scale and commonly found in meat products.

The existing China Patent Application No. CN108411001A discloses multiplex PCR primers, a kit and an authentication method for dogs, chickens, cattle, pigs, horses, donkeys, foxes, and rabbits. The primer system can detect up to eight animal species at a time, but the patent does not cover meat species such as goat, ducks, and minks that are raised on a large scale in breeding and are commonly found in meat products.

The existing China Patent Application No. CN104498597A designs specific primer pairs based on the mitochondrial cytochrome gene sequences of pigs, sheep, chickens, mice, and cattle, and establishes a multiplex PCR method for authenticating the above five animal-derived ingredients. This method cannot authenticate meat from ducks, foxes, minks, and rabbits that are raised on a large scale and commonly found in meat products.

The existing China Patent Application No. CN103361422A discloses a 5-plex PCR assay for fox meat, mouse meat, pork, chicken, and duck, which cannot authenticate cattle, sheep, rabbits, minks and other meat species that are raised on a large scale and are commonly found in meat products.

The existing China Patent Application No. CN105506167A discloses a method: using a single universal primer to amplify a target fragment in the mitochondria, and using specific restriction endonuclease to perform digestion to determine the species composition based on digested bands. The established method can authenticate porcine-, bovine-, goat-, chicken-, duck-, murine-, and fish-derived ingredients, but the patent has cumbersome detection procedures and does not cover foxes, minks, rabbits, and other meat species that are raised on a large scale in daily life and are commonly found in meat products.

The existing China Patent Application No. CN106811534A discloses a method of using a pair of universal PCR primers for PCR amplification and gene fragment sequencing to analyze the species. The method can authenticate fish, shrimp, pork, beef, lamb/mutton, chicken, and other meat, but cannot authenticate ducks, foxes, minks, rabbits, and other meat species that are raised on a large scale and are commonly found in meat products.

The existing China Patent Application No. CN105274099A uses a fluorescent quantitative PCR assay to detect nine animal-derived ingredients from pigs, cattle, sheep, horses, minks, mice, chickens, ducks, and foxes, but the method is carried out through three reaction systems, and each reaction system can only detect three animal-derived ingredients.

The existing China Patent Application No. CN102899394A discloses an LAMP detection kit and a detection method for five animal-derived ingredients, including yak meat, chicken, pork, rabbit meat, and mutton, but this disclosure simply combines five independent detection reagents with the detection method.

To add an assay for an animal-derived ingredient to a multiplex PCR system, it is necessary to add a pair of specific primers. This is not only necessary to ensure that the pair of primers can only specifically amplify the species and the size of the fragment is significantly different from that of other amplified fragments, but is also necessary to ensure that the pair of primers cannot form a hairpin structure or dimer with other primers, and the difficulty of primer design multiplies. At the same time, the multiplex PCR system and program should be optimized to ensure that all target bands can be amplified efficiently.

SUMMARY In view of the shortcomings of the prior art, the present disclosure provides a primer composition, a kit and a detection method for one-step rapid detection of eight animal-derived ingredients from pigs, cattle, goat, chickens, ducks, rabbits, foxes, and minks in food or feedstuff. The primer composition, the kit and the detection method provided by the present disclosure can be used to rapidly authenticate the above 1-8 animal-derived ingredients simultaneously.

The present disclosure 1s realized through the following technical solutions: Primers, a kit, and a detection method for simultaneous detection of eight animal-derived ingredients, and use thereof are disclosed, where nucleotide sequences thereof are as follows: (1) goat-specific primers: upstream sequence: Goat-F: CCACCAACTACCCACTTT, as shown in SEQ ID NO: 1; downstream sequence: Goat-R: TTGCGTCTGTTCGTCCAT, as shown in SEQ ID NO: 2; (2) bovine-specific primers: upstream sequence: Bovine-F: GCATCATTCTACCCACTTT, as shown in SEQ ID NO: 3; downstream sequence: Bovine-R: CGACTATTGTTGGTAGAAAAG, as shown in SEQ ID NO: 4; (3) porcine-specific primers: upstream sequence: Pig-F: TTGCCCTTCCATCATTAC, as shown in SEQ ID NO: 5; downstream sequence: Pig-R: CTGGGATAGCATCTGTTT, as shown in SEQ ID NO: 6; (4) chicken-specific primers: upstream sequence: Chicken-F: GGATGATGACAAGGACGAG, as shown in SEQ ID NO: 7; downstream sequence: Chicken-R: TAGTAAGGTTATGCGGAGG, as shown in SEQ ID NO: 8; (S) duck-specific primers: upstream sequence: Duck-F: TAGTCATAGCAAGCCTCCA, as shown in SEQ ID NO: 9;

downstream sequence: Duck-R: CGTGGTATTAGTTATGTGGG, as shown in SEQ ID NO: 10; (6) fox-specific primers: upstream sequence: Fox-F: CCTAACTATCCAAACTCTCACC, as shown in SEQ ID NO: 11; downstream sequence: Fox-R: GGCCATGGTGATTATGAA, as shown in SEQ ID NO: 12: (7) mink-specific primers: upstream sequence: Mink-F: CCTATCACCCTTTCACTTCTG, as shown in SEQ ID NO: 13; downstream sequence: Mink-R: AGTTAGTGCTGTTGCGTATG, as shown in SEQ ID NO: 14; and (8) rabbit-specific primers: upstream sequence: Rabbit-F: GGATGCTCAGGAGGTAGA, as shown in SEQ ID NO: 15; downstream sequence: Rabbit-R: CAGGTCTGATGTTGGGAT, as shown in SEQ ID NO:

16.

The present disclosure provides a kit including a primer composition, Taq DNA Polymerase and PCR Buffer, and the kit is convenient to use, fast, efficient and accurate in results.

The primers, kit, and detection method for simultaneous detection of eight animal-derived ingredients, and the use thereof include the primer composition and raw materials and reagents necessary for multiplex PCR.

The raw materials and reagents necessary for multiplex PCR include: PCR Buffer, MgCl», dNTPs, Tag DNA Polymerase, deionized water, and meat DNA-positive template.

All ingredients in the kit constitute a 25 uL PCR system: 2.5 uL of 10x PCR Buffer, 1.6 uL of 25 mmol/L MgCl,, 3 U TagDNA Polymerase, 2.8 uL of 2.5 mmol/L. dNTPs, 0.08-0.56 umol/L (final concentration) primer pairs, finally making up to 25 pL with deionized water.

Preferably, the final concentrations of primer pairs for fox, goat, and duck may be 0.16 umol/L, respectively; the final concentrations of primer pairs for rabbit and cattle may be 0.2 umol/L, respectively; the final concentration of primer pair for mink may be 0.08 pmol/L; the final concentration of primer pair for pig may be 0.48 umol/L, and the final concentration of primer pair for chicken may be 0.56 umol/L.

The present disclosure further provides a one-step multiplex PCR method for simultaneous detection of eight animal-derived ingredients in food or feedstuff. The method has the advantages of simplicity, rapidity, accuracy and high throughput.

The multiplex PCR method for simultaneous detection of eight animal-derived ingredients in food or feedstuff includes the following steps: (1) DNA extraction method: before animal-derived DNA extraction from a meat product or a feed, pre-treating a sample, and extracting total cellular DNA from a sample by an optimized cetyltrimethylammonium bromide (CTAB) method, that is, weighing 0.2 g of the sample, adding 1 mL of deionized water, shaking for 1 min, centrifuging at high speed, discarding a supernatant, adding 200 uL of chloroform to pellets, shaking vigorously to resuspend the pellets, centrifuging at high speed, and decanting a liquid carefully; weighing and mixing 0.05 g of treated sample pellets with 500 pL of 2x CTAB Cell Lysis Buffer (1 mol/L Tris HCI, 4 mol/L NaCl, 0.5 mol/L EDTA, 2% CTAB, pH 8.0) in a 1.5 mL Eppendorf (EP) tube for mixing well, incubating the EP tube in a 65°C water bath for 3 h, taking out the EP tube every 15 min, and shaking for 30 s to 1 min; after the water bath, adding an equal volume of pre-mixed phenol: chloroform: isopentanol (25:24:1) to the EP tube, shaking vigorously at room temperature for 10 min, centrifuging at 10,000 rpm for 5 min, absorbing the upper aqueous phase, adding twice the volume of pre-cooled absolute ethanol, precipitating at -20°C for 10-20 min, centrifuging at 10,000 rpm and 4°C for 10 min, and discarding a supernatant; adding 200 pL of pre-cooled 70% ethanol, and gently shaking for 15 min at room temperature, centrifuging at 10,000 rpm and 4°C for 10 min, and discarding a supernatant; air-drying DNA pellets, and finally dissolving the DNA with 50 uL of deionized water; (2) reaction system: preferably, adding 1 uL of the sample DNA prepared according to the DNA extraction method into the 25 uL PCR system, mixing well, and centrifuging instantaneously at high speed, (3) reaction program: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at

94°C for 30 s, annealing at 50-55.6°C for 55 s, and extension at 72°C for 90 s; and finally extension at 72°C for 10 min; preferably, initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 30 s, annealing at 55.6°C for 55 s, and extension at 72°C for 90 s; and finally extension at 72°C for 10 min; (4) nucleic acid electrophoresis and result observation: electrophoresing 5 uL of PCR product on a 1.5% agarose gel; taking out and placing the gel in a gel imager, observing band sizes under a UV lamp, and determining a result; and (5) determination of electrophoretic results: under the UV lamp, defining the length of each specifically amplified product in the agarose gel as a specific animal-derived ingredient, wherein a 168 bp fragment is detected as a bovine-derived ingredient, a 217 bp fragment is detected as a rabbit-derived ingredient, a 303 bp fragment is detected as porcine-derived ingredient, a 408 bp fragment is detected as a goat-derived ingredient, a 588 bp fragment is detected as a mink-derived ingredient, a 707 bp fragment is detected as a duck-derived ingredient, a 819 bp fragment is detected as a chicken-derived ingredient, and a 979 bp fragment is detected as fox-derived ingredient.

In the above method, the sample to be tested may be chilled meat, frozen meat, processed meat products, animal fats, feed materials, meat and bone meal, complete feed, and the like.

The primer composition, kit and detection method thereof may be used in the simultaneous detection of 1-8 animal-derived ingredients from goats, cattle, pigs, chickens, ducks, rabbits, foxes and minks in the sample to be tested.

Compared with the existing detection technology, the present disclosure has the following advantages: (1) The present disclosure uses multiplex PCR technology to authenticate eight animal-derived ingredients from cattle, goats, pigs, chickens, ducks, foxes, minks and rabbits in meat, meat products, food and feed materials. The simultaneous detection of up to eight animal-derived ingredients may be achieved by a one-step reaction, and these eight animal species have been bred on a large scale, and the animal-derived ingredients therefrom are most frequently added in meat and meat products in China. The method of the present disclosure has the advantages of low cost, time saving, high efficiency, and simultaneous authentication of a plurality of species. At present, there is no patent disclosing a multiplex PCR assay for simultaneously detecting the eight animal-derived ingredients in one-step reaction.

(2) The present disclosure selects different mitochondrial genes as target genes for designing primers for the above eight animal-derived ingredients, such as cytochrome C oxidase subunit II, 12S rRNA, and NADH dehydrogenase subunits II and V. The objective 1s to improve the specificity of primers as much as possible, thereby improving the specificity and sensitivity of multiplex PCR assay, and avoiding the influence of non-specific amplification caused by a small difference in homology between the same target genes. The present disclosure may complete the qualitative detection of eight animal-derived ingredients through a reaction system and one-step reaction, which is especially suitable for the detection of mixed samples.

(3) The present disclosure does not require the purchase of expensive instruments and expensive detection reagents, detection and operation processes have low technical requirements; the operation is easy; the present disclosure is not prone to contamination and false positive results. In the multiplex PCR result determination, the types of animal-derived ingredients may be determined by observing the band size through electrophoretic analysis; the present disclosure is more suitable for meat detection in daily production activities and is easy to popularize and promote in practice.

BRIEF DESCRIPTION OF DRAWINGS FIG. 1 illustrates the results of electrophoretic analysis of temperature gradient PCR products. M is DNA Marker DL2000; the PCR annealing temperature is 50°C for lanes 1, 4, 7, 10, 13, 16, 19, and 22; the PCR annealing temperature is 55.6°C for lanes 2, 5, 8, 11, 14, 17, 20, and 23; the PCR annealing temperature is 60°C for lanes 3, 6, 9, 12, 15, 18, 21, and 24. Lanes 1, 2, and 3 represent fox meat DNAs; lanes 4, 5, and 6 represent chicken DNAs; lanes 7, 8, and 9 represent duck meat DNAs; lanes 10, 11, and 12 represent mink meat DNAs; lanes 13, 14, and 15 represent goat meat DNAs; lanes 16, 17, and 18 represent pork DNAs; lanes 19, 20, and 21 represent rabbit meat DNAs; lanes 22, 23, and 24 represent beef DNA.

FIG. 2 illustrates the amplification result of 8-plex PCR before optimization. M is 100 bp DNA ladder; 5 is a blank group; 1, 2, 3, and 4 are experimental groups.

FIG. 3 illustrates the optimized result of multiplex PCR. M is 100 bp DNA ladder; 5 is a blank group; 1, 2, 3, and 4 are experimental groups, Tm’s are 54.4°C, 55.6°C, 56.9°C, and

58.2°C successively.

FIG. 4 illustrates a sensitivity analysis of multiplex PCR for the detection of 8 animal-derived ingredients. M is 100 bp DNA ladder; 5 is a blank group; 1 and 2 are 10" experimental groups; 3 and 4 are 10 experimental groups.

DETAILED DESCRIPTION The specific implementation of the present disclosure will be further described below in conjunction with specific examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present disclosure.

Example 1: Design and quality evaluation of multiplex PCR primers for meat authentication According to the status quo of large-scale farming and common meat species in market meat products in China, eight animals including goats, cattle, pigs, chickens, ducks, rabbits, foxes, and minks were selected as subjects. The mitochondrial genes (cytochrome C oxidase subunit II, 12S rRNA, and NADH dehydrogenase subunits II and V) of the above eight animals were retrieved from the Genbank database. Using BLAST software, homology alignment analysis was conducted on the same gene sequence of different species to find out the conserved domain of each gene. Through alignment analysis, the cytochrome C oxidase subunit II gene was selected as a target gene for the authentication of porcine- and rabbit-derived ingredients, the NADH dehydrogenase subunit V gene as a target gene for the authentication of goat-, chicken-, and fox-derived ingredients, the NADH dehydrogenase subunit II gene as a target gene for the authentication of bovine- and mink-derived ingredients, and the 12s rRNA gene as a target gene for authentication of duck-derived ingredient. The above target genes all showed more than 90% homology in the homologous sequence alignment, indicating that these genes were highly conserved in the same species.

Using DNAMAN software, non-homologous sequences of each gene were aligned to analyze the similarity between sequences, and a specific domain was determined as a template for PCR amplification, which is used to design multiplex PCR primers, according to the alignment results. The matching degree between the above gene sequences was 42.33%, and there were relatively specific domains between sequenced, which could be used to design primers.

These intraspecifically conserved and interspecific DNA sequences were selected to design primers by using Primer premier and DNAMAN software.

The nucleotide sequences of the designed PCR amplification primers for eight animal-derived ingredients are shown in Table 1. The designed PCR amplified DNA fragments of foxes, chickens, ducks, minks, goats, pigs, rabbits, and cattle are 979, 819, 707, 588, 408, 303, 217 and 168 bp in size in sequence, and the primer annealing temperature ranges from 51.1°C to 56.9 °C.

Table 1 The specific primer sequences of animal-derived ingredients and the size of target amplified products ~ Nameof Nucleotide sequence of the primer Name of the target gene Size of the amplified _ primer product/bp * ChickenF ~~ GGATGATGACAAGGACGAG | NADHdchydrogenase 819 Chicken-R TAGTAAGGTTATGCGGAGG subunit V _ DmkF TAGICATAGCAAGCCTCCA @ 7 © MinkF CCTATCACCCTTTCACTICTG NADH dehydrogenase 588 Mink-R AGTTAGTGCTGTTGCGTATG subunit II eur CCACCAACTACCCACTTT NADHdehvdopense 408 © PigF TIGCCCTTCCATCATTAC Cytochrome Coxidase 303 Pig-R CTGGGATAGCATCTGTTT subunit II Bovine-R CGACTATTGTTGGTAGAAAAG subunit II The success of the multiplex PCR assay depends on the quality of the primers.

Multiplex PCR primers are not only required to ensure that each pair of primers can only specifically amplify specific fragments of the species, and that the fragment size is significantly different from that of other amplified fragments, but also to ensure that no hairpin structure or dimer can be formed between the primers.

Each additional primer pair multiplies the design difficulty.

At the same time, the multiplex PCR system and program should be optimized to ensure that all target bands can be amplified efficiently.

Quality assessment was conducted on the designed primers. NCBI website was logged on and the BLAST module was used to perform primer specificity tests online. After alignment on BLAST, the selected primers with better specificity were subjected to primer dimer screening using the online primer analysis tool on the Thermo Scientific website. The analysis results showed that the primers had excellent sequence specificity, and most of the primers did not form dimers. The difference in annealing temperature and the influence of dimers on the experimental results were reduced by the subsequent optimization of the reaction system and reaction conditions.

Example 2: DNA extraction When extracting animal-derived DNAs from meat products or feedstuff, samples require pretreatment, and total cellular DNA is extracted from the sample by the optimized CTAB method. 0.2 g of sample was weighed, mixed with 1 mL of deionized water, shaken for 1 min, and centrifuged at high speed; a supernatant was discarded; pellets were mixed with 200 pL of chloroform, shaken vigorously to resuspend, and centrifuged at high speed; the liquid was decanted carefully; 0.05 g of treated sample pellets were weighed and mixed well with 500 uL of 2x CTAB Cell Lysis Buffer (1 mol/L Tris HCI, 4 mol/L NaCl, 0.5 mol/L EDTA, 2% CTAB, pH 8.0) in a 1.5 mL Eppendorf (EP) tube; the EP tube was incubated in a 65°C water bath for 3 h and taken out every 15 min to shake for 30 s to 1 min; after the water bath, an equal volume of pre-mixed phenol: chloroform: isopentanol (25:24:1) was added to the EP tube, shaken vigorously at room temperature for 10 min, centrifuged at 10,000 rpm for 5 min, the upper aqueous phase was absorbed, mixed with twice the volume of pre-cooled absolute ethanol, precipitated at -20°C for 10-20 min, centrifuged at 10,000 rpm and 4°C for 10 min; a supernatant was discarded; 200 pL of pre-cooled 70% ethanol was added, and the mixture was gently shaken for 15 min at room temperature, and centrifuged at 10,000 rpm and 4°C for 10 min; after a supernatant was discarded, DNA pellets were air-dried, and finally the DNA was dissolved with 50 pL of deionized water. The integrity, purity and concentration of the DNA were analyzed.

The absorbance of DNA at 260 and 280 nm was measured on an ultraviolet spectrophotometer, and A260/A280 was calculated to obtain the concentration and purity of the

DNA. The concentrations and purity of DNAs extracted from 8 animal meat products by the CTAB method are shown in Table 2. At the same time, the integrity of the extracted DNA samples was analyzed by agarose gel electrophoresis. Through nucleic acid electrophoresis analysis, it was found that the meat DNA extracted by the modified CTAB method had excellent integrity, no DNA breakage occurred in electrophoresis analysis, and the purity and concentration of the prepared DNA were high, laying the foundation for the subsequent multiplex PCR assay. The method also obtains an excellent effect when extracting animal-derived DNAs from meat products and feedstuff, the concentration of 24.7-420.9 ng/uL and the purity of 1.6-1.9 might meet the needs for PCR assay. The quality of the extracted DNA depends on the content of meat in a sample and the types of ingredients. Table 2 The concentrations and purity of DNA extracted from eight kinds of animal meat by the CTAB method © Meatsample Concentration (ng/ul) A260/A280 ~~ Fox 175 180 Chicken 80.98 1.72 Duck 201.53 1.92 Mink 92.57 2.01 Goat 108.95 2.15 Pig 93.99 1.64 Rabbit 65.02 2.04 Cattle 42.07 1.90 Example 3: Optimization of primer annealing temperature According to the theoretical annealing temperature of the synthesized primers, a temperature gradient PCR was performed at 50-60°C, and three temperature gradients were set in this temperature range.

The PCR system was 25 pL: 2.5 uL of 10x PCR Buffer (containing Mg"), 1.25 U Taq DNA Polymerase, 2 pL of 2.5 mmol/L dNTPs, 0.5 uL each of forward and reverse primers (both 20 pmol/L), 1 uL of DNA Template, finally making up to 25 uL with deionized water.

PCR program was as follows: initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 30 s, annealing at 50-60°C for 30 s, and extension at 72°C for 45 s; and finally extension at 72°C for 5 min.

After 5 uL of PCR product was subjected to 1% agarose gel electrophoresis and placed into a gel imager to observe bands.

The result of electrophoretic analysis showed that 8 pairs of primers could amplify the target fragment at both 50°C and 55.6°C, but 3 pairs of primers could not do that at 60°C. Considering the increase in annealing temperature, the specificity of PCR amplification was improved. Therefore, the optimal annealing temperature was finally determined to be 55.6°C. The results are shown in FIG. 1.

Example 4: Optimization of multiplex PCR conditions After the annealing temperature was fixed, the multiplex PCR was conducted according to the reaction system and reaction conditions of Example 3 as the basic conditions of multiplex PCR; subsequently, primer concentration, dNTPs concentration, addition amount of Mg?*, amplification time, and cycle number were adjusted according to the amplification results, in order to optimize multiplex PCR conditions. For each reaction, repeated experimental groups, a blank group, a positive control group, and a negative control group were set up.

The multiplex PCR amplification was conducted according to the reaction system and reaction conditions of Example 3, and it was found that no band was amplified in the pig DNA sample, and the other 7 bands were also weak, especially the bands of cattle and rabbits with very low brightness (the results are shown in FIG. 2). Unamplified or dark band might be because the primers were inhibited by other primer pairs. Thus, the amount of this primer pair should be increased during optimization. The problem that the other 7 bands generally showed low brightness was optimized by increasing the annealing time, the cycle number or the concentrations of Mg?" and dNTPs. On the basis of the initial solution, the concentrations of primers for pigs, cattle and chickens were increased, the concentrations of primers for ducks, minks, goats, foxes, and cattle were reduced, the dNTPs concentration was increased, and the annealing and extension time was prolonged. After parameter optimization, all of the eight animal-derived ingredients obtained clear bands (see FIG. 3).

The optimal multiplex PCR system obtained was a 25 uL PCR system: 2.5 uL of 10x PCR Buffer, 1.6 pL of 25 mmol/L MgCl2, 3 U Taq DNA polymerase, 2.8 uL of 2.5 mmol/L dNTPs, the final concentration of each primer pair being 0.08-0.56 pmol/L, 1 uL of DNA, and finally making up to 25 uL with deionized water.

The optimal multiplex PCR program was as follows: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 30 s, annealing at 55.6°C for 55 s, and extension at 72°C for 90 s; and finally extension at 72°C for 10 min.

Example 5: Multiplex PCR reaction specific authentication Each specific primer should only specifically amplify the DNA of the corresponding species, instead of that of other animal species. In the test, a positive group, a negative group, and a blank group were set up for specific detection.

Using a combination of eight specific primer pairs for fox, chicken, duck, mink, goat, pig, rabbit, and cattle, PCR amplification was performed on eight meat DNA templates one by one. According to the results, the positive group could be amplified, and the size of the bands was consistent with that of the target bands, but no bands were amplified in the negative group and the blank group, indicating that the designed eight primer pairs had excellent specificity.

Example 6: Sequencing analysis of PCR product The products of each primer pair (approximately 21 pL per tube) amplified by conventional PCR were sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing.

The sequencing results were aligned with the sequences in GenBank through BLAST. The sequencing results of the amplified bands of the eight animal-derived ingredients had more than 96% matching degree with the target genes of the respective species, and it was determined that all primers amplified target fragments, with excellent primer specificity.

Example 7: Sensitivity identification of multiplex PCR assay Eight positive DNA templates were diluted according to the concentration gradient (10! to 10), respectively, and the multiplex PCR assay of the present disclosure was used to determine the lowest template concentration that can be amplified. A positive group, a negative group, and a blank group were set up as controls.

The results of the sensitivity testing showed that the lower limit of detection was 0.97 ng/uL for primers for goats and chickens, 4.88 ng/uL for primers for ducks, 1.01 ng/uL for primers for cattle, 0.04 ng/uL for primers for minks, 0.004 ng/uL for primers for rabbits, 0.12 ng/uL for primers for foxes, and 2.32 ng/uL for primers for pigs. The results are shown in FIG.

4.

Example 8: Use of the multiplex PCR detection method in the authentication of meat products in the market À total of 36 samples of chilled meat and frozen meat products (including skewers, ham, grilled sausage, bacon, and dried meat floss) were purchased from a market in Jinan. Using the multiplex PCR assay and kit of the present disclosure, DNA extraction and multiplex PCR assay were conducted on the samples; after PCR products were subjected to 1.5% agarose gel eletrophoresis and placed in a gel imager to observe bands.

The assay results showed that 24 of the 36 samples were suspected of being fraudulent, with a fraud rate as high as 67%; among them, the fake and shoddy lamb/mutton and beef were the most serious phenomena, with fraud rates of 33% and 20%, respectively. Secondly, there was fraud in pork and chicken, with fraud rates of 11% and 3%, respectively.

SEQUENCE LISTING LU102712 <110> Qilu University of Technology <120> PRIMER, KIT, AND DETECTION METHOD FOR SIMULTANEOUS DETECTION OF EIGHT ANIMAL -DERIVED INGREDIENT AND USE THEREOF <130> PT1088 <160> 16 <170> BiSSAP 1.3.6 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Goat-F <400> 1 ccaccaacta cccacttt 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Goat-R <400> 2 ttgcgtctgt tcgtccat 18 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Bovine-F <400> 3 gcatcattct acccacttt 19 <210> 4 <211> 21

<212> DNA LU102712 <213> Artificial Sequence

<220>

<223> Bovine-R

<400> 4 cgactattgt tggtagaaaa g 21 <210> 5

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Pig-F

<400> 5 ttgcccttcc atcattac 18 <210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Pig-R

<400> 6 ctgggatagc atctgttt 18 <210> 7

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Chicken-F

<400> 7 ggatgatgac aaggacgag 19 <210> 8

<211> 19

<212> DNA

<213> Artificial Sequence

<220> <223> Chicken-R <400> 8 tagtaaggtt atgcggagg 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Duck-F <400> 9 tagtcatagc aagcctcca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Duck-R <400> 10 cgtggtatta gttatgtggg 20 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Fox-F <400> 11 cctaactatc caaactctca cc 22 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence

<220> LU102712 <223> Fox-R

<400> 12 ggccatggtg attatgaa 18 <210> 13

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Mink-F

<400> 13 cctatcaccc tttcacttct g 21 <210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Mink-R

<400> 14 agttagtgct gttgcgtatg 20 <210> 15

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Rabbit-F

<400> 15 ggatgctcag gaggtaga 18 <210> 16

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Rabbit-R

<400> 16 caggtctgat gttgggat 18

Claims (4)

CLAIMS :

1. À primer composition for simultaneous detection of eight animal-derived ingredients, wherein sequences of the primer composition are as follows: (1) goat-specific primers: upstream sequence: Goat-F: CCACCAACTACCCACTTT, as shown in SEQ ID NO: 1; downstream sequence: Goat-R: TTGCGTCTGTTCGTCCAT, as shown in SEQ ID NO: 2; (2) bovine-specific primers: upstream sequence: Bovine-F: GCATCATTCTACCCACTTT, as shown in SEQ ID NO: 3; downstream sequence: Bovine-R: CGACTATTGTTGGTAGAAAAG, as shown in SEQ ID NO: 4; (3) porcine-specific primers: upstream sequence: Pig-F: TTGCCCTTCCATCATTAC, as shown in SEQ ID NO: 5; downstream sequence: Pig-R: CTGGGATAGCATCTGTTT, as shown in SEQ ID NO: 6; (4) chicken-specific primers: upstream sequence: Chicken-F: GGATGATGACAAGGACGAG, as shown in SEQ ID NO: 7; downstream sequence: Chicken-R: TAGTAAGGTTATGCGGAGG, as shown in SEQ ID NO: 8; (S) duck-specific primers: upstream sequence: Duck-F: TAGTCATAGCAAGCCTCCA, as shown in SEQ ID NO: 9; downstream sequence: Duck-R: CGTGGTATTAGTTATGTGGG, as shown in SEQ ID NO: 10; (6) fox-specific primers: upstream sequence: Fox-F: CCTAACTATCCAAACTCTCACC, as shown in SEQ ID NO: 11; downstream sequence: Fox-R: GGCCATGGTGATTATGAA, as shown in SEQ ID NO: 12: (7) mink-specific primers:

upstream sequence: Mink-F: CCTATCACCCTTTCACTTCTG, as shown in SEQ ID NO: 13; downstream sequence: Mink-R: AGTTAGTGCTGTTGCGTATG, as shown in SEQ ID NO: 14; and (8) rabbit-specific primers: upstream sequence: Rabbit-F: GGATGCTCAGGAGGTAGA, as shown in SEQ ID NO: 15; downstream sequence: Rabbit-R: CAGGTCTGATGTTGGGAT, as shown in SEQ ID NO:

16.

2. A kit for simultaneous detection of eight animal-derived ingredients, wherein the kit comprises raw materials and reagents necessary for multiplex PCR: the primer composition according to claim 1, PCR Buffer, MgCl,, dNTPs, Taq DNA Polymerase, deionized water, and meat DNA-positive template; all ingredients in the kit constitute a 25 uL PCR system: 2.5 uL of 10x PCR Buffer, 1.6 pL of 25 mmol/L MgCl,, 3 U TagDNA Polymerase, 2.8 uL of 2.5 mmol/L. dNTPs, 0.16 umol/L (final concentration) primer pairs for fox, goat, and duck, 0.2 umol/L (final concentration) primer pairs for rabbit and cattle, 0.08 pmol/L (final concentration) primer pair for mink, 0.48 umol/L (final concentration) primer pair for pig, and

0.56 umol/L (final concentration) primer pair for chicken, finally making up to 25 pL with deionized water.

3. A method for simultaneous detection of eight animal-derived ingredients, wherein the detection method comprises the following steps: step 1, DNA extraction: before animal-derived DNA extraction from a meat product or a feed, pre-treating a sample, and extracting DNA from animal tissues by a modified cetyltrimethylammonium bromide (CTAB) method, that is, weighing 0.2 g of the sample, cutting the sample into small pieces, adding 1 mL of deionized water, shaking for 1 min, centrifuging at high speed, discarding a supernatant, adding 200 pL of chloroform to pellets, shaking vigorously to resuspend the pellets, centrifuging at high speed, and decanting a liquid carefully; weighing and mixing 0.05 g of treated sample pellets with 500 pL of 2x CTAB Cell Lysis Buffer (1 mol/L Tris HCI, 4 mol/L NaCl, 0.5 mol/L EDTA, 2% CTAB, pH 8.0) in a 1.5 mL Eppendorf (EP) tube for mixing well, incubating the EP tube in a 65°C water bath for 3 h,

taking out the EP tube every 15 min, and shaking for 30 s to 1 min; after the water bath, adding an equal volume of pre-mixed phenol: chloroform: isopentanol (25:24:1) to the EP tube, shaking vigorously at room temperature for 10 min, centrifuging at 10,000 rpm for 5 min, absorbing the upper aqueous phase, adding twice the volume of pre-cooled absolute ethanol, precipitating at -20°C for 10-20 min, centrifuging at 10,000 rpm and 4°C for 10 min, and discarding a supernatant; adding 200 pL of pre-cooled 70% ethanol, and gently shaking for 15 min at room temperature, centrifuging at 10,000 rpm and 4°C for 10 min, and discarding a supernatant; air-drying DNA pellets, and finally dissolving the DNA with 50 uL of deionized water; step 2, optimization of multiplex PCR system: adding 1 uL of the sample DNA prepared in step 1 of claim 3 into the 25 uL PCR system according to claim 2, mixing well, and centrifuging instantaneously at high speed; step 3, optimization of multiplex PCR program: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 30 s, annealing at 55.6°C for 55 s, and extension at 72°C for 90 s; and finally extension at 72°C for 10 min; step 4, nucleic acid electrophoresis and result determination: mixing 5 uL of PCR product with appropriate amount of Loading Buffer, and running on a 1.5% agarose gel; after electrophoresis, taking out and placing the gel in a gel imager, observing band sizes under a UV lamp, and determining a result; and step 5, determination of electrophoretic results: under the UV lamp, defining the length of each specifically amplified product in the agarose gel as a specific animal-derived ingredient, wherein a 168 bp fragment is detected as a bovine-derived ingredient, a 217 bp fragment is detected as a rabbit-derived ingredient, a 303 bp fragment is detected as porcine-derived ingredient, a 408 bp fragment is detected as a goat-derived ingredient, a 588 bp fragment is detected as a mink-derived ingredient, a 707 bp fragment is detected as a duck-derived ingredient, a 819 bp fragment is detected as a chicken-derived ingredient, and a 979 bp fragment is detected as fox-derived ingredient.

4. Use of the primer composition, kit and detection method according to claims 1, 2, and 3 in simultaneous detection of 1-8 animal-derived ingredients from goats, cattle, pigs, chickens, ducks, rabbits, foxes and minks in food or feedstuff.