LU102409B1 - Indel marker for simultaneously identifying restorer genes rf1 and rf2 of cotton cytoplasmic male sterility - Google Patents

Abstract

The invention discloses an InDel marker for simultaneously identifying restorer genes Rf1 and Rf2 of cotton cytoplasmic male sterility. The InDel marker is linked not only to the restorer gene Rf1 of Gossypium harknessii cytoplasmic male sterility hut also to the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility. The insertion/deletion length polymorphism of nucleotide sequences, presented in an agarose gel electrophoretogram, can identify whether a single cotton plant contains restorer genes and can determine types of the restorer genes. The InDel marker is obtained by amplification of primers shown in SEQ ID NO. 1 to 2. The InDel marker plays an important role in selecting new restorer line materials of cotton with different restorer genes (Rf1/Rf2) and ensuring the purity of three-line hybrid seeds. The InDel marker can identify different types of restorer genes of two sets of cytoplasmic male sterility of cotton.

Description

] LU102409

INDEL MARKER FOR SIMULTANEOUSLY IDENTIFYING RESTORER GENES RFI AND RF2 OF COTTON

CYTOPLASMIC MALE STERILITY

TECHNICAL FIELD The present invention relates to a molecular marker and the use thereof, and in particular, to an InDel molecular marker linked to restorer genes of restorer lines of two sets of cotton cytoplasmic male sterility three-line materials and the use thereof, to establish a simple and feasible system for identifying types of two sets of cotton restorer genes and the purity system of hybrid seeds.

BACKGROUND Cotton is an important economic crop as well as an important fiber energy crop in the world. and has an important position and significance in agricultural production. Breeders have used cotton's heterosis to significantly increase cotton yield, improve quality, and increase resistance. Hybrid seed production is an effective way to utilize the heterosis, and the yield of hybrid cotton varieties is increased by about 15% compared with that of conventional cotton varicties. In production practice, the common methods for cotton hybrid seed production include an artificial emascuiation and pollination method, a chemical emasculation method and a "three-line matching” method. The artificial emasculation and pollination method needs higher cost due to the increasing labor cost year by vear. and obtains hybrid seeds with low purity, failing to guarantee the quality of seeds. The chemical emasculation method has unstable emasculation effect and is prone to causing environmental pollution, though it reduces the labor and material input in artificial emasculation. The cytoplasmic male sterility three-line matching method has the advantages of simple procedure of hybrid seed production, low labor input, decreased material consumption. high purity of seeds. low cost. and the like. and is applicable to hybrid seed production in large scale. Therefore, the three-line matching method will become one of the best ways to commercial production of hybrid cotton. The promotion of three-line hybrid cotton is of a great significance for increasing the benefit of cotton planting. increasing the income of cotton farmers, stabilizing the planting area of hybrid cotton, and developing the cotton processing industry.

Two sets of cytoplasmic male sterility materials that have been studied more frequently at present are Gossypium frilobum cytoplasmic male sterility (CMS-Ds) and Gossypium harknessii cytoplasmic male sterility (CMS-Da). The reasons for the slow process of selection of a strong-advantage three-line hybrid combination. the difficulty in obtaining restorer lines with superior comprehensive agronomic traits and strong restoring capacity of cotton, and the lack of germplasm resources of the parents of superior restorer lines are as follows: cotton cytoplasmic male sterility restorer genes have a narrow source. and their restoring capacitics are limited: the mechanism of nucleocytoplasmic interaction is still not clear; the associated physiological mechanism of fertility restoration has not been studied clearly: and the restorer genes of cotton come from Gossypium harknessii and Gossypium trilobum and are difficult to locate and clone. Therefore, the long-term objective and important tasks of three-line hybrid cotton variety selection is to select and improve superior restorer lines with strong restoring capacity, and expand the germplasm resources of threc-line hybrid breeding parents. to enrich the parent combination of cotton threc-line hybrid seed production: and develop the InDel marker that is stable in inheritance and closely linked to cotton restorer genes for selection of superior restorer lines and production of hybrid seeds, to provide a marker that is co- segregate with target genes for molecular marker—assisted breeding. and to accelerate the accumulation of restorer genes by means of molecular marker—assisted breeding.

At present, breeders usually use the method of combining conventional hybridization technologies and molecular marker—assisted breeding to select and improve superior restorer lines, which makes up for the deficiency such as the long selection cycle in traditional breeding, the large-arca covering, the high field workload, and the low efficiency. Moreover, the key to the process of three-line hybrid seed production is to ensure the purity of the restorer lines. Hybrid seeds are the F1 generation obtained by hybridization of the restorer lines and sterile lines. Once the restorer lines and sterile lines are mixed. hybrid seeds sterility may be caused, the purity of hybrid seeds may be lowered. and the hybrid seeds may be unqualified in inspections, thereby causing economic losses for seed production farmers and seed production companies. Molecular markers are not affected by plant development stages. growth environment factors, and whether genes are expressed, feature abundant quantity and stable inheritance. and can reflect differences in nucleotide sequences according to the DNA level. Therefore. developing a stable, accurate and easy-to-test co-dominant InDel molecular marker and applying the same to the molecular marker—assisted selection technology can overcome the shortcomings such as time- and labor-consuming, less accurate field trait identification in the traditional conventional breeding process, and allow the types and genotypes of restorer genes of single plants to be identified during any growth stage of seeds and plants, thereby improving efficiency, ensuring the purity of restorer line seeds, and reducing breeding time, to meet the needs of production practices.

SUMMARY The present invention provides an InDel molecular marker that is co-segregated with restorer genes of cotton cytoplasmic male sterility, and primers of the InDel molecular maker, to solve problems in the selection and improvement of a restorer line in a traditional conventional breeding method. In the present invention, the same marker is used to simultancously identify restorer genes of two sets of cotton cytoplasmic male sterility restorer lines, can identify hybrid seeds of different three-line combinations. and can also test purity of the hybrid seeds. In the present invention. a system that is used to identify whether cotton contains restorer genes and can identify the types of the restorer genes (Rf1/Rf2) and guarantee the purity of the hybrid seeds is established.

The InDel marker provided in the present invention is linked not only to the restorer gene RT of Gossypium harknessii cytoplasmic male sterility but also to the restorer gene R12 of Gossypium trilobum cytoplasmic male sterility. The insertion/deletion length polymorphism of the nucleotide sequences, presented in an agarose gel electrophoretogram, can identify whether a single cotton plant contains restorer genes and can determine the types of the restorer genes contained therein.

The present invention further provides a pair of InDel molecular marker primers, including a forward primer of S'-ACTCAACTOTCTTCCTCTTCTCA-3(SEQ ID NO.) and a reverse primer of 5-TGGGAGCCTAATATATGTAATGGTG-3'(SEQ ID NO.2).

The present invention further provides the useof the InDel molecular marker primers in identifying the restorer gene R/7 of Gossypium harknessii cytoplasmic male sterility and the restorer gene R/2 of Gossypium trilobum cytoplasmic male sterility.

The present invention further provides the use of the InDel molecular marker primers in the selection of new restorer line materials of cotton with different restorer genes (RfI/Rf2).

The present invention further explains a feasible method for identifying the restorer gene R/7 ol Gossypium harknessii cytoplasmic male sterility and the restorer gene R/2 of Gossypium trilobum cytoplasmic male sterility by using the InDel molecular marker primers. The method includes: 1) using genomic DNA of two sets of three-line cotton materials to be tested as the template. and performing Polymerase China Reaaction (PCR) amplification with the InDel molecular marker primers; 2) performing agarose gel electrophoresis analysis on the above PCR amplification product; where when two bands simultancously appear in an agarose gel electrophoresis result of the PCR amplification product. under a condition of appearance of specifically amplified bands at 376 bp and 408 bp respectively. a material including a heterozygous locus of the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility is determined: under a condition of appearance of specifically amplified bands at 376 bp and 562 bp respectively, a material including a heterozygous locus of the restorer gene Rf! of Gossypium harknessii cytoplasmic male sterility is determined; and when one band appears in an agarose gel electrophoresis result of the PCR amplification product, under a condition of appearance of a specifically amplified band at 376 bp only, a material without restorer gene loci is determined; under a condition of appearance of a specifically amplified band at 408 bp only, a restorer line material including a homozygous locus of the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility is determined; under a condition of appearance of a specifically amplified band at 562 bp only, a restorer linc material including a homozygous locus of the restorer gene R/7 of Gossypium harknessii cytoplasmic male sterility is determined.

The method according to the present invention is used to identify the restorer genes of germplasm resources of restorer lines matching the two sets of cotton cytoplasmic male sterility, and can significantly reduce workload in identification of field materials, improve accuracy. and ensure the purity of restorer line materials and restorer line seeds of cotton. This method, when used for the selection and improvement of the restorer lines, can accelerate the selection process. reduce breeding cost and increase identification efficiency. This method, when used for three-line hybrid seed production, can guarantee the purity of three-line hybrid seeds, and clarify the types of genotypes of the restorer genes contained in the materials.

Compared with the prior art, the present invention has the following beneficial effects: 1} Multiple-effect: This InDel marker can identify the types of different restorer genes of two sets of cotton cytoplasmic male sterility, and can also identify whether restorer gene loci are contained and whether the restorer gene loci arc homozygous. Therefore, the InDel marker has a wider range of application (especially applicable to hybridization of two sets of cytoplasmic male sterility) and better practicability (sparing the need of identifying the set of cytoplasmic male sterility materials before use, and supporting identification of cytoplasmic male sterility restorer lines according to identification results) as compared with a marker that tests a single set of cytoplasmic male sterility.

2) High accuracy: The InDel marker has the advantages such as simplicity, reliability, reproducibility, and casy identification, and detection can be implemented simply by PCR amplification and agarose gel electrophoresis. In the present invention, a pair of InDel marker primers is used, and can distinguish the types of restorer genes (Rf1/Rf2) contained in restorer line materials, three-line hybrid seeds, and materials without restorer genes at the molecular level, without being affected by plant growth stages or environmental factors, thereby improving the socuracs and efficieney of restorer gene identification X) Simple operation and fast identifivation: The InDel marker plays an Important role in selecting never restorer Hee material of colton wich différent restorer genes RSR and ensuring the parity of theee-Tine hybrid sesds, Compared with conventional breeding, the breeding using the Inbal marker saves à lot of iabor and material resources, in processes of imprisrement of the restorer Hines, construction of new restores lines md three-Une hybrid seed production, the workfond of edd trait investigation and mufti-Hand backiross experiment can he reduced appropriaiels, Alter cotton DNA is exiracted and spesiiic amphifiretion iv performed with InDei primers, identification can be impiementen by sparose vel chectropheerels, The whole identification and testing prososy only fakes about 3 hours, which is short and efficient, and the identiication results are more accurate than those of Held trait investigation, 4) Simpfleity and practicability: Compared with an SSR marker and a LAPS marker, the Ine] marker hus the advantages such es high dbdnbution density, high accuract, goad reproducibility, am)? easy identification. Nussspectfic band amplification Is avoided in PUR anylification with the InDel marker primers according to the present invention. The info! molecular marker of the present invention has à good prospoct in the research of molecalar marker-evsisted breading of the restorer Hines conttinme different restorer genes af coton. Thus, the present invention Ras à great practical vahe in the seed purity identification work of semmaercial hybrid seed production of cotton,

BRIEF DESCRIPTION OF THE BRAWIRGS FIG | shows à sequence alignment result among à three-Hne materi of Gossypium féifobuse cytoplasmis wale sterilits, à thrve-line material of Cocuppten Seren eytopisente male sterility and a rofbrence gnome, whare TMA ts an upland cotton reference guneme sequence; AR, RE, RE, AI BLL and R2 are respustively sequences of differential fragments on à corresponding chromasome DUR in materials of a sterile hoe, & maintaîner Mone and a restorer Hoe matching Gossppden felon oylopissmic male sterility, and materials of a sterile line, a maintainer line and a restorer line matching Gossypium harknessii cytoplasmic male sterility.

FIG. 2 shows an agarose gel electrophoresis result after the InDel marker is used for PCR amplification on parents and heterozygotes matching three lines of two sets of cotton cytoplasmic male sterility. Lanes | to 8 are respectively the sterile line, the maintainer line, the restorer line, and a heterozygote containing the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility, and the sterile line, the maintainer line, the restorer line, and a heterozygote containing the restorer gene Rf! of Gossypium harknessii cytoplasmic male sterility.

FIG. 3 shows an InDel marker—based identification result for 24 randomly sampled backcross first-generation population materials (BCF1) of the Gossypium trilobum cytoplasmic male sterility restorer line, where lane 2 represents a heterozygous single plant with the restorer gene Rf2, and lane | represents a single plant without the restorer gene R/2.

FIG. 4 shows an InDel marker—based identification result for 24 randomly sampled F2 population materials of the Gossypium harknessii cytoplasmic male sterility restorer tine, where lane a represents a homozygous single plant with the restorer gene Rf/, lane b represents a heterozygous single plant with the restorer gene R/7, and lane ¢ represents a single plant without the restorer gene R//.

DESCRIPTION OF EMBODIMENTS The following further describes the technical solution with reference to specific embodiments. Example 1 A sequence alignment result among a three-line material of Gossypium trilobum cytoplasmic male sterility, a three-line material of Gossypium harknessii cytoplasmic male sterility and a reference genome is shown in FIG. I. It can be seen from FIG. | that in a Gossypium trilobum cytoplasmic male sterility restorer line (R8), there is a nucleotide

; LU102409 sequence of insertion/deletion variation, and its sequence length is 408 bp; in a Gossypium harknessii cytoplasmic male sterility restorer line (R2), there is a nucleotide sequence of insertion/deletion variation, and its sequence length is 562 bp: where sequence lengths of the sterile line and the maintainer line are both 376 bp.

According to the InDel loci, sequences and PCR primer design principles, forward and reverse primers are designed on the InDel marker. and then are successfully converted into InDel labeled primers. A primer pair amplifying the InDel molecular marker are shown in Table |.

Table 1: InDel molecular marker primers Primer name Primer Base sequence (5S'—3”) SEQ ID direction NO. InDel molecular Forward ACTCAACTGTCTTCCTCTTCTCA I marker primers (F} Reverse TGGGAGCCTAATATATGTAATGGTG 2 (R) In a locus genome of the homozygous restorer gene Rf2 of the Gossypium trilobum cytoplasmic male sterility restorer line, a band, having insertion/deletion variation and a nucleotide sequence with a length of 408 bp. was obtained by specific amplification; and in a genome of an R/2 gene heterozygous material. bands at 376 bp and 408 bp were obtained by amplification. In a genome of the homozygous gene Rf of the Gossypium harknessii cytoplasmic male sterility restorer line, a band. having insertion/deletion variation and a nucleotide sequence with a length of 562 bp. was obtained by specific amplification: and in a genome of an RfI gene heterozygous material, bands at 562 bp and 376 bp were obtained by amplification. In a material without restorer genes. a band at 376 bp without insertion/deletion sequences was obtained by amplification.

Example 2

1. Extract DNA of seeds of a crossback first-generation population (BC Fp)

constructed by three lines of Gossypium trilobum cytoplasmic male sterility (CMS-D8) and a hybridized F2 population of the restorer line and the maintainer line (sterile line) of three lines of Gossypium harknessii cytoplasmic male sterility (CMS-D2) (CTAB method).

2. Perform PCR amplification on the extracted DNA by using InDel molecular marker primers. À PCR system is shown in Table 2. Table 2 20 ul PCR system Reaction component ul ddH20 14.8 dNTPs 0.4 x buffer 2 Taq (5U/pl. TransGen Biotech) 0.2 Forward primer (10 uM) 0.8 Reverse primer (10 uM) 0.8 DNA (50-300 ng/pl) 1 The PCR process is as follows: Perform initial denaturation at 94°C for 2 min; perform denaturation at 94°C for 30s, anneal at 58°C for 30s. and extend at 72°C for 20s by 35 cycles; then perform final extension at 72°C for 2 min and store at 4°C.

Subject a PCR product to agarose gel (2.5%) electrophoresis. take pictures by a gel imaging system and save the pictures, and perform band analysis on the electrophoresis results.

3. Test result Judgment criteria: For a Gossypium trilobum cytoplasmic male sterility material: in the statistics, if only a band at 408 bp appears, then it is determined as a Gossypium tritobum cytoplasmic male sterility restorer line that contains the homozygous restorer gene R/2: if both bands at 376 bp and 408 bp appear, then it is determined as a heterozygous material or hybrid that contains the restorer gene Æ/2: if only a band at 376 bp appears, then it is determined as a material (maintainer line or sterile line) without the restorer gene R/2, For a Gossypium harknessii cytoplasmic male sterility material: in the statistics, if only a band at 562 bp appears. then it is determined as a Gossypium harknessii cytoplasmic male sterility restorer line that contains the homozygous restorer gene R/!; if both bands at 376 bp and 562 bp appear. then it is determined as a heterozygous material or hybrid that contains the restorer gene R//: if only a band at 376 bp appears, then it is determined as a material (maintainer line or sterile line) without the restorer gene R//.

The agarose gel electrophoresis result after the InDel marker is used for PCR amplification on parents and heterozygotes matching three lines of two sets of cotton cytoplasmic male sterility is shown in FIG. 2. FIG. 2 verifies the above criteria.

The result of identifying 24 randomly sampled BCF1 materials of Gossypium trilobum cytoplasmic male sterility by using the InDel marker is shown in FIG. 3. It can be seen from FIG, 3 that lane 1 represents a single plant without the restorer gene, which has a specific band appearing at 376 bp: lane 2 represents a locus heterozygous single plant with the restorer gene, which has target bands appearing at 408 bp and 376 bp simultaneously.

The result of identitying 24 randomly sampled F2 population single plants obtained from the restorer line and the maintainer line of Gossypium harknessii cytoplasmic male sterility by using the InDel marker is shown in FIG. 4. It can be seen from FIG. 4 that lane a represents a homozygous single plant with the restorer gene R77. lane b represents a heterozygous single plant with the restorer gene R//, and lane ¢ represents a single plant without the restorer gene Rf.

Through the above steps, the restorer genes can be identified easily and quickly, the types of the restorer genes (Rf2/Rf1), as well as the genotypes of the materials can be distinguished. Therefore, the purity of the restorer line can be ensured in the process of threc-line hybrid sced production, the workload of field material identification can be reduced significantly, the work process of conventional hybrid breeding can be accelerated, the breeding efficiency can be improved greatly, the purity of the three-line hybrid seeds can be guaranteed, and the cotton yield can be increased.

The toregoing descriptions are merely best implementations of the present invention.

Any simple variation or equivalent replacement of the technical solutions that can be obviously obtained by a person skilled in the art within the technical scope disclosed in the present invention belongs to the protection scope of the present invention.

Claims (5)

1. An InDel marker for simultaneously identifying restorer genes R// and Rf2 of cotton cytoplasmic male sterility, wherein the InDel marker is linked not only to the restorer gene Rf! of Gossypium harknessii cytoplasmic male sterility but also to the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility: the insertion/deletion length polymorphism of the nucleotide sequences, presented in an agarose gel clectrophoretogram. can identify whether a single cotton plant contains restorer genes and can determine types of the restorer genes; an forward primer of the InDel marker is; 5'- ACTCAACTGFTCTTCCTCTTCTCA-3': and a reverse primer of the InDel marker is: 5'- TOGGAGCCTAATATATOTAATGGTG-3".

2. InDel molecular marker primers for simultaneously identifying restorer genes R/7 and Rf2 of cotton cytoplasmic male sterility, wherein a forward primer is: 5'- ACTCAACTGTCTTCCTCTTCTCA-3"; and a reverse primer is: 5'- TGGGAGCCTAATATATGTAATGGTG-3".

3. Use of the InDel molecular marker primers according to claim 2 in identifying the restorer gene R/7 of Gossypium harknessii cytoplasmic male sterility and the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility.

4. Use of the InDel molecular marker primers according to claim 2 in selection of new restorer line materials of cotton with different restorer genes RfI/Rf2.

5. A method for identifying a restorer gene R/7 of Gossypium harknessii cytoplasmic male sterility and a restorer gene R/2 of Gossypium trilobum cytoplasmic male sterility by using the InDel molecular marker primers according to claim 2, comprising: 1) using a to-be-tested three-line cotton material of Gossypium harknessii cytoplasmic male sterility and/or a to-be-tested three-line cotton material of Gossypium trilobum cytoplasmic male sterility as the template. and performing PCR amplification with the InDel molecular marker primers: 2) performing agarose gel clectrophoresis analysis on the above PCR amplification product; wherein when two bands simultaneously appear in an agarose gel electrophoresis result of the PCR amplification product, under a condition of appearance of specifically amplified bands at 376 bp and 408 bp respectively, a material comprising a heterozygous locus of the restorer gene R/2 of Gossypium trilobum cytoplasmic male sterility is determined; under a condition of appearance of specifically amplified bands at 376 bp and 562 bp respectively, a material comprising a heterozygous locus of the restorer gene RfI of Gossypium harknessii cytoplasmic male sterility is determined: and when one band appears in the agarose gel clectrophoresis result of the PCR amplification product. under a condition of appearance of a specifically amplified band at 376 bp only. a material without restorer gene loci is determined; under a condition of appearance of a specifically amplified band at 408 bp only, a restorer line material comprising a homozygous locus of the restorer gene Rf2 of Gossypium trilobum cytoplasmic male sterility is determined; under a condition of appearance of a specifically amplified band at 562 bp only, a restorer line material comprising a homozygous locus of the restorer gene R/7 of Gossypium harknessii cytoplasmic male sterility is determined.