LU100920B1 - Animal luring device - Google Patents

Abstract

The invention provides an animal luring device (1), comprising a) a first compartment (2) containing genetically engineered first microorganisms, the genetically engineered first microorganisms being genetically engineered in that they produce and release i) an attractant attracting an animal and ii) an active agent, b) an area or second compartment (3), which is freely accessible to the animal, and connected to the first compartment (2) in a manner that the attractant and the active agent are able to pass to the area or second compartment (3), whereas the genetically engineered first microorganisms are not, and c) a nutrient source for the genetically engineered first microorganisms. The animal luring device of the invention has an improved longevity.

Description

PAT 1681 LU 3 -1- LU100920

ANIMAL LURING DEVICE

DESCRIPTION The invention relates to an animal luring device. Animal luring devices are widely used to attract, study, trap or kill animals. In particular, such devices are frequently applied to trap vermin or pests like rodents or mosquitoes. A variety of animal luring devices, for example mosquito traps, is commercially available using different lure molecules, e.g. carbon dioxide, and killing mechanisms like insecticides, electricity, or sticky surfaces. An example for an insect/arthropod trap is described in US 6920716 B2. Currently available traps have limited longevity or other drawbacks. Many lure molecules, for example, deplete quickly due to their volatile nature, and traps relying on electricity depend on electrical infrastructure. If chemical insecticides or glue is used, longevity is limited due to expiration and exhaustion of the mechanism. Currently, these problems are accounted for by active maintenance of the trap. Traps must be cleaned, replaced, maintained, or refilled frequently. It is an object of the invention to provide an animal luring device with improved longevity. In order to solve the object, the invention provides an animal luring device, comprising a) a first compartment containing genetically engineered first microorganisms, the genetically engineered first microorganisms being genetically engineered in that they produce and release 1) an attractant attracting an animal and ii) an active agent, b) an area or second compartment, which is freely accessible to the animal, and connected to the first compartment in a manner that the attractant and the active agent are able to pass to the area or second compartment, whereas the genetically engineered first microorganisms are not, and c) a nutrient source for the genetically engineered first microorganisms.

0° PAT 1681 LU 3 -2- LU100920 The invention makes use of genetically engineered microorganisms producing and releasing an attractant and an active agent, thus providing the attractant and the active agent in a sustained manner.

In order to keep the microorganisms alive over a long period of time, the device also contains a nutrient source for the microorganisms, preferably a sustained-release nutrient source providing nutrients for the microorganisms in a sustained manner.

The term “animal luring device” refers to a device being designed to attract and trap, capture, kill or otherwise treat animals, in particular vermin and pests like mosquitoes.

The term “animal trap” may also be used here synonymously, without intending to delimit the function of the device to only capturing or killing animals.

The term “genetically engineered microorganisms” refers to microorganisms, the genome of which has been biotechnologically modified compared to the wild-type microorganism and/or into which genetic material, preferably foreign DNA, has been biotechnologically introduced, e.g. by means of a suitable gentic vector like a plasmid.

The modification may i.a. comprise the introduction of a foreign gene or trait, or of an additional copy of an own gene, or the introduction or elimination of gene regulatory elements.

The term “genetically engineered first microorganisms being genetically engineered in that they produce and release i) an attractant attracting an animal and ii) an active agent” does not mean that each cell of the first microorganisms is so genetically engineered that it produces and releases both an attractant and an active agent.

Rather, the term encompasses the case where there are at least two different fractions within the first microorganisms, one fraction being genetically engineered to produce an attractant, a second fraction being genetically engineered to produce an active agent.

The term “attractant” refers to any inorganic or organic chemical compound or composition, or any other physico-chemical means, which attracts a targeted animal.

Exemplary chemicals attracting mosquitoes, for example, are carbon dioxide, ammonia or lactate.

The term also encompasses physico-chemical means attracting an animal, e.g. heat (warmth) or light.

An “active agent” as used herein is meant to be any compound or composition having an effect on a targeted animal.

The effect may be, in one exemplary setting, weakening or killing the Ww

) PAT 1681 LU 3 -3- LU100920 targeted animal.

In another setting, however, the intended effect may also be to feed, strengthen, cure or vaccinate a targeted animal.

The term “sustained-release nutrient source” as used herein refers to a nutrient source steadily releasing a suitable nutrient, preferably at least a carbon and/or energy source, keeping a microorganism alive over a comparatively long period of time.

In particular, the term refers to a nutrient source providing nutrients keeping the genetically engineered microorganisms present in the animal luring device of the invention alive for a period of at least 5 days, preferably at least one week, or at least two, three, four, five, six seven or eight weeks.

Such a sustained- release nutrient source may, for example, be or comprise a polymer that can be biologically degraded by the microorganisms, e.g. via enzymes excreted by the microorganisms.

The term also encompasses a separate culture of microorganisms providing a nutrient for the genetically engineered microorganisms.

A nutrient source preferably provides the genetically engineered microorganisms with at least a suitable carbon and/or energy source, and preferably additionally with any macro- and micronutrients, for example nitrogen, required by the genetically engineered microorganism.

The term “nutrient source” encompasses a composition or combination of separate nutrient sources separately providing different nutrients, e.g. a carbon source, a nitrogen source, a phosphorus source etc.

The animal luring device of the invention is designed such that the genetically engineered first microorganisms are confined to a first compartment of the device in order not to allow them to escape into the environment.

The device is, however, also designed to allow the attractant and the active agent to leave the first compartment and to pass to an area or second compartment, where it is accessible to the animals to be attracted.

The first compartment with the genetically engineered first microorganisms confined therein and the area or second compartment are therefore interconnected, preferably via fluidic communication, however, in a manner that does not allow the genetically engineered microorganisms to leave the first compartment and to get to the area or second compartment and into the environment.

This may, for example, be achieved by separating the first compartment from the area or second compartment via a filter, which is permeable for the attractant and the active agent, but not for the genetically engineered first microorganisms.

Such filters are available and could, for example consist of or comprise a nitrocellulose nano filter.

Further, the animal luring device of the invention is designed in a y

- PAT 1681 LU —4- LU100920 manner that the attracted animals are not able to get in direct contact with or ingest the genetically engineered first microorganisms.

In a preferred embodiment the animal luring device according to the invention further comprises d) a third compartment containing second microorganisms providing a nutrient source for the genetically engineered first microorganisms, wherein the third compartment is connected to the first compartment in a manner that the nutrient source is able to pass to the first compartment, whereas the second microorganisms are not, and wherein the first microorganisms are not able to pass to the third compartment.

In this preferred embodiment a nutrient source for the genetically engineered first microorganisms, for example genetically engineered chemoheterotrophic bacteria like E. coli, is produced and provided by second microorganisms, which may also be genetically engineered or not.

The second microorganisms are preferably microorganisms, which do not need an organic carbon and energy source, and are thus preferably photoautotrophic.

The third compartment of the animal luring device is therefore preferably permeable to light as energy source and carbon dioxide as carbon source for the photoautotrophic microorganisms.

Most preferred, the second microorganisms are Cyanobacteria.

The compartments with the first and second microorganisms are connected with each other, however, in a manner that neither the first nor the second microorganisms are able to leave their own compartment and to move to the other compartment.

The nutrient source provided by the second microorganisms preferably includes all macro- and micronutrients required by the genetically engineered first microorganisms.

In this manner, the second microorganisms may provide all nutrients necessary for a long-term survival of the first microorganisms, such that this embodiment of the animal luring device of the invention is at least essentially self-sustaining.

The second microorganisms, e.g.

Cyanobacteria, may, for example, provide the first microorganisms, e.g.

E. coli, with a nutrient source by simply growing and dying.

In this case, the second microorganisms need not to be genetically engineered.

Cell lysate, e.g.

Cyanobacterium lysate, is a suitable nutrient source for E. coli, for example.

The second microorganisms, for example Cyanobacteria, may, however, also be genetically engineered in Ww

0° PAT 1681 LU : -5- LU100920 that they produce and release a nutrient source, e.g. Glucose, for the genetically engineered first microorganisms. It is especially preferred to use nitrogen-fixing Cyanobacteria in order to also provide a nitrogen source for the first microorganisms.

Alternatively or additionally to the second microorganisms, the animal luring device may comprise a polymer that is enzymatically degradable by the genetically engineered first microorganisms as a nutrient source for the first microorganisms. The polymer may, for example, be a slowly degrading carbohydrate polymer, e.g. a glucose-xylose hybrid polymer. Cellulase enzymes, secreted by E. coli, for example, would degrade the polymer, releasing glucose and xylose. Xylose inhibits cellulase activity and thus ensures long-term functionality. The polymer may, for example, be arranged in the first compartment together with the first microorganisms. It would, however, also be possible to arrange the polmyer in a separate compartment connected to the first compartment, such that enzymes excreted by the first microorganisms are able to enter the compartment and the nutrients released are able to pass to the first compartment with the first microorganisms, while the first microorganisms are not able to pass to the compartment with the polymer. The polymer preferably provides at least a source of carbon and energy to the first microorganisms. The term “polymer” also encompasses a composition or combination of different polymers serving the purpose of delivering a nutrient or nutrients to the first microorganisms. In an especially preferred embodiment of the invention, the genetically engineered first microorganisms are growth inhibited. In a preferred embodiment of the invention, the genetically engineered first microorganisms are further genetically engineered in that they are growth-inhibited. As an example, the microorganisms, e.g. E. coli, may be engineered such that they overexpress genes which regulate reproduction. For E. coli, this could include, for example, overexpression of cspD for DNA synthesis inhibition, mraZ for cell wall synthesis inhibition, cbtA for cell elongation inhibition and/or sulA for cell division inhibition. The growth inhibition preferably only limits cell division and does not kill surplus bacteria to prevent a possible negative impact of lysed bacteria on the culture. This is especially usefull when E. coli is used as a first microorganism, since E. coli, once grown to density, may accumulate toxic substances which endanger the media microenvironment. It is within the y

‘ PAT 1681 LU -6- LU100920 ordinary skill to choose and implement a usefull strategy to achive growth-inhibition, e. g. to choose and implement a suitable biotechnological engineering approach.

It is to be noted here again that it is not necessary, and not preferred, to engineer all first microorganisms in the same way, such that any of the cells have the same mutation(s) and/or are transformed with the same construct(s). Rather, it is preferred that a first fraction of the cells is engineered such that the cells produce an attractant and a second fraction of the cells is engineered such that the cells produce the active agent.

In case that more than one attractant and/or active agent is used, there may be different cells being engineered accordingly.

It is, however, preferred that all cells are engineered such that they are growth inhibited.

The attractant is chosen dependent on the animals to be attracted.

In case the animal luring device is intended for attracting moths, for example, the attractant may be a pheromone.

In case of mosquitos, for example, the attractant can be heat, lactate, 3-methyl-1-butanol or myristic acid, or a combination thereof.

For producing heat, the first microorganisms, e.g.

E. coli, may be engineered to express alternative oxidase la from Nelumbo nucifera (see Graves, C. & Holmes, S.

Part:BBa K410000, 2010. Available at: http://parts.igem.org/Part:BBa_K410000; Accessed: 13th August 2018; Grant, N. et al., 2009, Two Cys or Not Two Cys? That Is the Question; Alternative Oxidase in the Thermogenic Plant Sacred Lotus, Plant Physiology 150, 987-995, DOI: https://doi.org/10.1104/pp.109.139394). The biotechnological production of the known mosquito attractants lactate (L-Lactic acid), 3-methyl-1-butanol, and myristic acid, is within the ordinary skill of the skilled person (see, for example, Verhulst, N.

O. et al.

Improvement of a synthetic lure for Anopheles gambiae using compounds produced by human skin microbiota.

Malar.

J. 10, 28 (2011); Connor, M.

R., Cann, A.

F. & Liao, J.

C. 3-Methyl-1- butanol production in Escherichia coli: random mutagenesis and two-phase fermentation.

Appl.

Microbiol.

Biotechnol. 86, 1155-1164 (2010); Xiao, S. et al. 3-Methyl-1-butanol Biosynthesis in an Engineered Corynebacterium glutamicum.

Mol.

Biotechnol. 58, 311-318 (2016); Afzal, M. 1. et al.

Biosynthesis and role of 3-methylbutanal in cheese by lactic acid bacteria: Major metabolic pathways, enzymes involved, and strategies for control.

Crit.

Rev.

Food Sci.

Nutr. 57, 399-406 (2017); Mathew, N., Ayyanar, E., Shanmugavelu, S. & Muthuswamy, K.

Mosquito attractant blends to trap host seeking Aedes aegypti.

Parasitol.

Res. 112, 1305-1312 (2013); Xu, P. et al.

Modular optimization of multi-gene pathways for fatty acids production in a

* PAT 1681 LU -7- LU100920 E. coli.

Nat.

Commun. 4, 1409 (2013)). Lactate, for example, may be produced in E. coli by overexpression of lactate dehydrogenase (IdhA). The active agent may be a compound or composition that is toxic to the targeted animal.

This is preferred in embodiments, where it is desired to kill the animal, e.g. an insect pest being at least potentially harmful to human beings, pets or crops, for example Malaria transmitting Anopheles mosquitoes.

In a preferred embodiment of the invention the active agent is a scorpion toxin.

An example of a suitable scorpion toxin killing Anopheles mosquitoes is the Black Scorpion alpha Insect Toxin BjalT (see CN 106754944 A; Amon, T. et al., BjalT: a novel scorpion a-toxin selective for insects — unique pharmacological tool.

Insect Biochem.

Mol.

Biol. 35, 187-195 (2005). The genetically engineered first microorganisms, e.g.

E. coli, or a fraction thereof, are genetically engineered in that they express and secrete BjalT.

To this end, a construct may, for example, be introduced into the first microorganisms, or a fraction thereof, comprising the BjalT coding sequence, preferably a codon-optimized BjalT coding sequence, and sequences coding for a linker containing an outer membrane protease (OmpT) site, a FLAG tag and an hlyA signal peptide for secretion.

Alternatively, the active agent can be a compound or composition being toxic for a pathogen infesting the animal, or a compound or composition immunizing or vaccinating the animal against a pathogen infesting the animal.

In this embodiment of the invention, the animal can, for example, be freed from an endopathogen being harmful to a human being when transmitted from the animal to the human being.

For example, the active agent can be a compound being toxic for a Plasmodium species infesting Anopheles mosquitoes.

The animal to be lured by the animal luring device of the invention can be any animal, which can be attracted by an attractant.

Preferably, the targeted animal is a pest or vermin, e.g. a rodent, an arthropod, e.g. arachnid or insect, e.g. stinging insect, or other harmful, annoying or detrimental animal.

Especially preferred, the targeted animal is an insect, for example an insect of the suborder Nematocera, e.g. a mosquito, or an arachnid, e.g. a mite.

The animal luring device of the invention is particularly useful for, but not limited to, luring mosquitoes, for +

: PAT 1681 LU -8- LU100920 example mosquitoes of the genus Anopheles transmitting Malaria, e.g.

Anopheles gambiae, or mosquitoes of the genera Aedes, Culex, Culiseta, Haemagogus, or Ochlerotatus.

In a preferred embodiment of the invention, the genetically engineered first microorganisms are genetically engineered E. coli cells.

Further preferred, the genetically engineered first microorganisms are genetically engineered E. coli cells and the second microorganisms are genetically engineered Cyanobacteria genetically engineered in that they produce and release the nutrient source for the genetically engineered E. coli cells.

In the following, the invention is further described for illustration purposes only by way of the attached figures and examples.

Figure 1. Simplified schematic longitudinal section (A) of an embodiment of the animal luring device of the invention and top view (B) of a part of the animal luring device of Fig. 1A.

Figure 2. Perspective view of the embodiment of the animal luring device of the invention of Fig. 1. Part of the device is shown in section.

Figure 3, 4. DNA constructs.

Figure 1 shows a simplified schematic longitudinal section (A) of an embodiment of the animal luring device 1 of the invention and a top view (B) of a part of the animal luring device of Fig. 1A.

Figure 2 shows a perspective view of the embodiment of the animal luring device of the invention schematically depicted in Figure 1. The animal luring device 1, which is especially adapted and suitable for luring mosquitoes, comprises a cylindrical first compartment 2 containing the genetically engineered first microorganisms, here genetically engineered E. coli cells.

The E. coli cells are genetically engineered in that they produce and release an attractant attracting mosquitoes and an active agent, here an insecticide killing the mosquitoes.

A filter 5, permeable for the attractant and the active agent, but not permeable to the first microorganisms, is arranged above the first compartment 2, separating the first compartment 2 from an area or compartment 3, which is

© PAT 1681 LU -9—- LU100920freely accessible for mosquitoes.

The filter 5, for example a nitrocellulose nano filter, is arranged on a filter support 6 formed by annular projections inwardly projecting into the first compartment 2 from the cylindrical wall 10 of the first compartment 2. The filter 5 is secured from above by a clamping ring 7, a top view of which is shown in Fig. 1B.

The genetically engineered first microorganisms are thus confined to the first compartment 2. The microorganisms are not able to pass the filter 5 and cannot escape from the first compartment 2. In this embodiment, the animal luring device 1 of the invention comprises a third compartment 4 containing second microorganisms, in this case genetically engineered Cyanobacteria.

The Cyanobacteria are genetically engineered in that they produce glucose in order to feed the E. coli cells in the first compartment.

The third compartment 4 is essentially funnel-shaped and has a lower cylindrical section 11 and an upper conically widening section 12. A cover 9 covers the third compartment 4. At least part of the compartment 4, e.g. the cover 9, is permeable to light and carbon dioxide.

To this end, the compartment 4 or at least part of it may consist of a transparent plastic material.

The compartment 4 can, for example, be reversibly attached to the clamping ring 7 via a screw connection 8. A hydrogel (not depicted here) may be arranged upon the filter 5. The hydrogel may act as a reservoir for the insecticide and as a surface for mosquitos to land on.

The mosquitos may sting into the hydrogel and ingest the insecticide produced by the microorganism and diffused through the filter 5 to the hydrogel.

Preferably, the hydrogel is self-healing or self-repairing, i.e. returns into its former shape when the mosquitoes withdraw their sting from the hydrogel.

The hydrogel may, for example, be produced from 1,8-octylene diacrylamide (ODA), N,N- dimethylacetamide (DMAc), poly(N,N-dimethylacrylamide) (PDMA), poly(acrylic acid) (PAA) or triethylamine (TEA). Examples DNA constructs Recurring basic parts

: PAT 1681 LU -10- LU100920

Glucose-inhibited promoter MIcRE MICRE as annotated by Plumbridge (Plumbridge, J.

Expression of ptsG , the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose.

Mol.

Microbiol. 29, 1053-1063 (1998)) was amplified from E. coli genome using Pre_MIcRE_f and MIcRE_Suf r primers and inserted into pSB1C3 (SEQ ID NO: 58) by restriction cloning using EcoRI and PstI, creating pSB1C3-MIcRE.

To measure promoter strength, MIcRE PCR product was additionally inserted into GFP-coding pSB1C3-BBa_E0840 (SEQ ID NO: 59) by restriction cloning using EcoRI and Xbal, creating pSB1C3-MIcRE- BBa E0840. Competent DH5a E. coli cells were transformed with pSB1C3-MIcRE-BBa E0840 and grown at 37°C to match an OD600 of 0.2. Present GFP was inactivated under high light, and cells were incubated with glucose at varying concentrations for 2 h.

GFP expression was measured on a fluorescence plate reader as well as by flow cytometry, revealing an inverse correlation of promoter strength and glucose concentration.

RnaG120-based inverter of MIcRE (see Fig. 3A) BBa B0015-BBa_J23106-RnaG120-MIcRE, called NOT-MIcRE hereafter, was designed in silico based on parts BBa_B0015 and BBa_J23106 taken from the iGEM Parts Registry, RnaG120 as annotated by Tran et al. (Tran, C.

N. et al.

A multifactor regulatory circuit involving H-NS, VirF and an antisense RNA modulates transcription of the virulence gene icsA of Shigella flexneri.

Nucleic Acids Res. 39, 8122-34 (2011)), and MIcRE as described above.

BBPre-BBa B0015-BBa J23106-RnaG120-MIcRE-BBSuf (SEQ ID NO: 66) was synthesized by Integrated DNA Technologies, Inc. (IDT). Synthetic DNA was amplified by PCR employing primers BBPre_Syn_f and BBSuf Syn r and inserted into pSB1C3 by restriction cloning using EcoRI and Pstl, creating pSB1C3-NOT _MIcRE.

To test functionality a characterization construct like described for MIcRE was created, named pSB1C3-NOT_MIcRE-BBa_ E0840. Competent DHSa E. coli cells are transformed with pSB1C3-NOT_MIcRE-BBa E0840 and grown at 37°C to match an OD600 of 0.2. Present GFP is inactivated under high light, and cells

© PAT 1681 LU = 11— LU100920 are incubated with glucose at varying concentrations for 2 h. GFP expression is measured on a fluorescence plate reader as well as by flow cytometry, revealing an inverse correlation of promoter strength and glucose concentration. Composite constructs Lactic acid production (see Fig. 3B) IdhA was amplified from E. coli genome employing primers Xbal_34_ldhA_fand ldhA _Suf r, creating BBa_B0034-1dhA flanked by Xbal restriction site and BioBrick Suffix. NOT MIcRE PCR product like described above was digested with EcoRI and Spel, BBa_B0034-IdhA was digested with Xbal and Pstl, and pSB1C3 was digested with EcoRI and PstI, and ligated with both inserts in a three-point ligation, giving rise to pSB1C3_NOT-MIcRE-BBa_B0034-1dhA. Glucose-induced lactic acid production are characterized by transforming competent E. coli DHS5a with pSB1C3-NOT_MIcRE-BBa_B0034-1dhA. Cells are grown at 37°C until OD600 of

0.2 prior to induction with glucose and incubation at 37°C for 2 h. lactic acid concentration is measured in supernatant medium. 3-methyl-1-butanol production (see Fig. 3C) Bsal-BBPre-NOT_MIcRE-Bsal was amplified from pSB1C3-NOT_MIcRE by PCR employing primers Bsal BBPre fand Bsal RnaG_r. BBPre-ADH2-BBSuf (SEQ ID NO: 65) was synthesized by IDT, and BBa_B0030-ADH2 was amplified by PCR employing primers Bsal ADH2 f and Bsal ADH2_ r. BBPre-kivD-BBSuf (SEQ ID NO: 69) was synthesized by IDT, and BBa_B0034-kivD was amplified by PCR employing primers Bsal kivD f and Bsal_kviD_r. LeuA, -B, -C, and -D were amplified by PCR from E. coli genome using Primers Bsal LeuA f and Bsal LeuA r, Bsal LeuB fand Bsal LeuB r, Bsal LeuC fand Bsal LeuC r, and Bsal LeuD fand Bsal LeuD r, respectively. pGGA and all PCR products were assembled by GoldenGate Assembly, under digestion with Bsal and ligation with T4 DNA ligase from NEB Golden Gate Assembly Mix according to the

© PAT 1681 LU —12- LU100920protocol supplied with the kit, giving rise to pGGA-BBPre-NOT_MIcRE-BBa_B0030-ADH2- BBa_B0034-kivD-LeuABCD-BBSuf. pGGA-BBPre-NOT MIcRE-BBa B0030-ADH2- BBa_B0034-kivD-LeuABCD-BBSuf and pSB1C3 were digested with EcoRI and PstI, and ligated, creating pSB1C3-NOT_MIcRE-BBa B0030-ADH2-BBa B0034-kivD-LeuABCD.

Glucose-induced 3-methyl-1-butanol production is characterized by transforming competent E. coli DHSa with pSB1C3-NOT_MIcRE-BBa_B0030-ADH2-BBa_B0034-kivD-LeuABCD.

Cells are grown at 37°C until OD600 of 0.2 prior to induction with glucose and incubation at 37°C for 2 h. 3-methyl-1-butanol concentration is measured in supernatant medium by HPLC.

Myristic acid production (see Fig. 3D) Bsal-BBPre-NOT_MIcRE-Bsal was amplified by PCR as described above.

BBa_B0030-accA, BBa_B0032-accB, and BBa_B0031-tesA were amplified by PCR from E. coli genome, employing primers Bsal_accA_f and Bsal accA r, Bsal accB fand Bsal accB_r, and Bsal tesA f and Bsal _tesA_r, respectively.

BBPre-accC-BBSuf (SEQ ID NO: 63) and BBPre- accD-BBSuf (SEQ ID NO: 64) were synthesized by IDT, and synthetic DNA was amplified using Bsal_accC_f and Bsal_accC_r, and Bsal_accD_f and Bsal_accD r, respectively. pGGA and all PCR products were assembled by GoldenGate Assembly, under digestion with Bsal and ligation with T4 DNA ligase from NEB Golden Gate Assembly Mix according to the protocol supplied with the kit, giving rise to pGGA-BBPre-NOT_MIcRE-BBa B0030-accA- accD-BBa_B0032-accB-accC-BBa_B0031-tesA-BBSuf. pGGA-BBPre-NOT_MIcRE- BBa B0030-accA-accD-BBa B0032-accB-accC-BBa B0031-tesA-BBSuf and pSB1C3 were digested with EcoRI and Pstl, and ligated, creating pSB1C3- NOT _MIcRE-BBa B0030-accA- accD-BBa B0032-accB-accC-BBa B0031-tesA.

Glucose-induced myristic acid production are characterized by transforming competent E. coli DH5a with pSB1C3-NOT_MIcRE-BBa B0030-accA-accD-BBa B0032-accB-accC- BBa_B0031-tesA.

Cells are grown at 37°C until OD600 of 0.2 prior to induction with glucose and incubation at 37°C for 2 h. 3-methyl-1-butanol concentration is measured in supernatant medium by HPLC.

- PAT 1681 LU -13- LU100920

Insecticide production (see Fig. 4A) Bsal-BBPre-NOT_MIcRE-Bsal was amplified by PCR as described above.

BBPre-BjolT- OmpTSite-FLAG-BBSuf (SEQ ID NO: 68) was synthesized by IDT, and synthetic DNA was amplified by PCR, employing primers Bsal_BjaIT_f and Bsal BjaIT_r.

BBa K554002 was amplified from pSB1C3-BBa_K554002 (SEQ ID NO: 61) by PCR, employing primers Bsal hlyA fand Bsal BBSuf r. pGGA and all PCR products were assembled by GoldenGate Assembly, under digestion with Bsal and ligation with T4 DNA ligase from NEB Golden Gate Assembly Mix according to the protocol supplied with the kit, giving rise to pPGGA-BBPre-NOT_MIcRE-BBa_B0034-BjalT- Linker-OmpTSite-FLAG-HlyA-BBSuf. pGGA-BBPre-NOT_MIcRE-BBa_B0034-BjalT- Linker-OmpTSite-FLAG-HlyA-BBSuf and pSB1C3 were digested with EcoRI and PstI, and ligated, creating pSB1C3-NOT_MIcRE-BBa_B0034-BjalT-Linker-OmpTSite-FLAG-HIyA.

Glucose-induced insecticide production is characterized by transforming competent Æ. coli DH5a with pSB1C3-NOT_MIcRE-BBa_B0034-BjaIT-Linker-OmpTSite-FLAG-HlyA.

Cells are grown at 37°C until OD600 of 0.2 prior to induction with glucose and incubation at 37°C for 2 h.

Cell lysate is analyzed by SDS PAGE and Western Blot, employing [animal]-anti- FLAG primary and [animal2]-anti-[animal]-HRP conjugated secondary antibodies.

Insecticide secretion (see Fig. 4B) BBa_K206000 was amplified by PCR from pSB1C3-BBa_K206000 (SEQ ID NO: 60), employing primers Bsal BBPre_f and Bsal pBAD_r.

RBS-HlyB-RBS-HlyD-RBS-TolC was amplified by PCR from pSB1C3-BBa_K554013 (SEQ ID NO: 62) in two segments, employing primers Bsal HlyB_f and Bsal HlyB _r for the first segment, and Bsal_TolC_f, and Bsal_TolC r for the second segment.

OmpT was amplified by PCR from E. coli genome, employing primers Bsal OmpT_f and Bsal OmpT r.

© PAT 1681 LU —14- LU100920pGGA and all PCR products were assembled by GoldenGate Assembly, under digestion with Bsal and ligation with T4 DNA ligase from NEB Golden Gate Assembly Mix according to the protocol supplied with the kit, giving rise to pGGA-BBPre-BBa_K206000-HlyB-HlyD-TolC- OmpT-BBSuf. pGGA-BBPre-BBa_K206000-HlyB-HlyD-TolC-OmpT-BBSuf and pSB1K3 were digested with EcoRI and Pstl, and ligated, creating pSB1K3-BBa_K206000-HlyB-HlyD- TolC-OmpT.

Competent E. coli DH5a are transformed with pSB1K3-BBa_K206000-HlyB-HlyD-TolC- OmpT and pSB1C3-NOT_MIcRE-BBa_B0034-BjalT-Linker-OmpTSite-FLAG-HIyA.

Cells are grown at 37°C until OD600 of 0.2 prior to induction with glucose and incubation at 37°C for 2 h.

Cell lysate and medium supernatant are analyzed by SDS PAGE and Western Blot, employing [animal]-anti-FLAG primary and [animal2]-anti-[animal}-HRP conjugated secondary antibodies.

To test insecticide function, a cotton pad is soaked with medium supernatant containing BjolT and placed in a mosquito cage.

Mosquito survival rate upon contact with the pad is observed over several hours.

Growth inhibition (see Fig. 4C) BBPre-BBa_1718018-BBSuf (SEQ ID NO: 67) was synthesized by IDT, and synthetic DNA was amplified by PCR, employing primers Bsal BBPre f and Bsal dapAP_r.

RBS-cbtA was amplified by PCR from E. coli genome using Bsal30cbtA, Bsal32cbtA and Bsal34cbtA as forward primers and Bsal cbtA_r as reverse primer.

RBS-cspD was amplified by PCR from E. coli genome using Bsal30cspD, Bsal32cspD and Bsal34cspD as forward primers and Bsal_cspD r as reverse primer.

RBS-mraZ was amplified by PCR from E. coli genome using Bsal30mraZ, Bsal32mraZ and Bsal34mraZ as forward primers and Bsal mraZ r as reverse primer.

RBS-sulA was amplified by PCR from E. coli genome using Bsal30sulA, Bsal32sulA and Bsal34sulA as forward primers and Bsal sulA_r as reverse primer. pGGA and all PCR products were assembled by GoldenGate Assembly, under digestion with Bsal and ligation with T4 DNA ligase from NEB Golden Gate Assembly Mix according to the

- PAT 1681 LU —15- LU100920 protocol supplied with the kit, giving rise to a mixture of pGGA-BBPre-BBa_1718018-RBS- cbtA-RBS-cspD-RBS-mraZ-RBS-sulA-BBSuf containing a random combination of BBa_B0030, BBa_B0032, and BBa_B0034 as ribosome binding sites.

Competent E. coli DH5a were transformed with pGGA-BBPre-BBa_1718018-RBS-cbtA-RBS-cspD-RBS-mraZ-RBS- sulA-BBSuf and grown on LB-Agar plates containing chloramphenicol and diaminopimelic acid.

A construct containing a working ribosome binding site combination is selected from the random pool of colonies.

LB medium containing chloramphenicol is inoculated with cells dyed with CFDA.

Cells are incubated at 37°C for two days and selected for high CFDA fluorescence indicating limited cell division rates by FACS.

Sorted cells are grown on LB-Agar plates containing chloramphenicol and diaminopimelic acid.

Colonies are screened by Sanger Sequencing, and the most common combination of ribosome binding sites is selected as final construct.

Primers used: Name Sequence SEQ ID NO: Bsal BBPre f ccatgaggtctccggaggaattcgcggecgcttct 01 Bsal BBSuf r gcttcaggtctccatggetgcageggecgctacta 02 BBPre Syn f caattgaattcgcggccegcttctaga 03 BBSuf Syn r gttaactgcagcggccgcetactagt 04 Pre MIcRE f caatgaattcgcggccgcttctagagtttttttaaagctcgtaattaatggetaaaacgag 04 MIcRE Suf r cggactgcagcggecgcetactagtagegecctttatttattacacagagtaaaataattc 06 Xbal 34 1dhA_f gccgcttctagagaaagaggagaaatactagatgaaactcgccgtttatagcacaaaac 07 IdhA Suf r cegactgcagegeccectactagtaaaccagttcettcegecagg 08 Bsal RnaGr ggacttggtctccaatctttttttaaagctcgtaattaatggctaaaacgagt 09 Bsal ADH2 f acaagcggtctccgattaaagaggagaaatactagatgtccattcctgagactcaaaagge 10 Bsal ADH2 r acaagcggtctcctctttttatttagatgtatccacgacgtaccgge 11 Bsal kivD f acaagcggtctcgaagaggagaaatactagatgtatacagtaggagattacctattagaccgattac 12 Bsal kivD r acaagcggtctcggatttattttgttcagcaaatagtttgcccat 13 Bsal LeuA f acaagcggtctccaatcataaaaaagagacaaggacccaaaccatgagcec 14 Bsal LeuA r acaagcggtctcccgacatcacacggtttecttgttg 15 y

© PAT 1681 LU —16— LU100920 Bsal LeuB f acaagcggtctccgtcgaagaattaccatattgeegtattge 16 Bsal JeuB r — acaagcggtetcctacacccettctgctacatagcgg 17 Bsal LeuC f acaagcggtctcgtgtaatcatggcetaagacgttatacgaaaaattg 18 Bsal LeuCr acaagcggtctcggtgctecttatttaatgttgegaatgtcg 19 Bsal LeuD f acaagcggtctccgeacaccatggeagagaaatttatcaaac 20 Bsal_leuD_r acaageggtetccatgectgcageggccgctactagtattaattcataaacgcagettgttitgette 21 Bsal accA f gatcacggtctccgattattaaagaggagaaatactagatgagtctgaatttecttgattttgaacagee 22 Bsal accA r gatcacggtetccatgacattacgcgtaaccgtagctcatcag 23 Bsal accB f gatcacggtctcccacacaggaaagtactagatggatattcgtaagattaaaaaactgatcgagetg 24 Bsal_accB r gatcacggtctccttactcgatgacgaccagegg 25 Bsal tesA f gatcacggtctccactagagtcacacaggaaacctactagatgatgaacttcaacaatgttttccgetg 26 Bsal tesA r gatcacggtctccatggetgeageggecgcetactagtattatgagtcatgatttactaaaggcetgeaactg2 7 Bsal accC f gatcacggtctccgtaatgettgacaagatcgttattgccaac 28 Bsal accC_r gatcacggtctcctagtattatttttcttgcagtccaagctttttttctaaataatgaatat 29 Bsal accD f gatcacggtctcctcatggatcgaacgaataaaatctaacattacge 30 Bsal accD r gatcacggtctcctgtgactctagtattaagettccggttectgatee 31 Bsal BjaIT_f ggacttggtctcggattaaagaggagaaatactagatgggtcgggatgcttatattgeg 32 Bsai BjaIT r ggacttggtctcgctaatttatcgtcgteatctttataatcgeeg 33 Bsal HlyA f ggacttggtctcgttagcctatggaagtcagggtgatct 34 Bsal pBAD r agagacggtctccaatcgctagcccaaaaaaacggtatggag 35 Bsal HlyB f tcccaaggtctccgattattaaagaggagaaaatggattcetgtcacaag 36 Bsal HlyB r tcccaaggtctcccagacccagcetgtggtaacage 37 Bsal TolC f tcccaaggtctegtetgggegeggattatacatacag 38 Bsal TolC r teccaaggtetcgcgcatttattaattgecggaacggattatgeccg 39 Bsal OmpT f tcccaaggtctcgtgegattaaagaggagaaaatgegggcgaaacttctgggaatag 40 Bsal OmpT r gcttcaggtctccatggetgecageggecgetactagtaaaatgtgtacttaagaccageagtagtg 41 Bsal dapAP r ccatgaggtctccaatccatcctetgtgcaaacaagtgt 42 Bsal30cbtA f ccatgaggtctccgattattaaagaggagaaatactagatgaaaacattacctgtattacccggge 43 Bsal30cspD f ccatgaggtctcctgaaattaaagaggagaaatactagatggaaaagggtactgttaagtggttcaac 44 Bsal30mraZ f ccatgaggtctccgtcgattaaagaggagaaatactagatgttccggggagcaacg 45 Bsal3OsulA À ccatgaggtctcctctaattaaagaggagaaatactagatgtacacttcaggctatgcacatc 46 Bsal32cbtA f ccatgaggtctccgatttcacacaggaaagtactagatgaaaacattacctgtattacccggge 47 h-

- PAT 1681 LU —17- LU100920 Bsal32cspD_f ccatgaggtctcctgaatcacacaggaaagtactagatggaaaagggtactgttaagtggttcaac 48 Bsal32mraZ f ccatgaggtetccgtegtcacacaggaaagtactagatettccggegagcaacg 49 Bsal32sulA f ccatgaggtetcetctatcacacaggaaagtactagatgtacacttcaggctatgcacate 50 Bsal34cbtA_f ccatgaggtetccgattaaagaggagaaatactagatgaaaacattacctgtattacccggge 51 Bsal34cspD_f ccatgaggtctcctgaaaaagaggagaaatactagatggaaaagggtactgttaagtggttcaac 52 Bsal34mraZ f ccatgaggtctccgtcgaaagaggagaaatactagatgttccggggageaacg 53 Bsal34sulA f ccatgaggtctcctctaaaagaggagaaatactagatgtacacttcaggctatgeacate 54 Bsal cbtA r ccatgaggtctccttcatttcgectccggatacttace 55 Bsal cspD r ccatgaggtctcccgaccttatgegactgecgcettctactt 56 Bsal mraZ r ccatgaggtctcgtagattatagagacaagtcttgcagtcge 57 r

Claims (13)

a ® 6 PAT 1681 LU 197 LU100920 CLAIMS

1. An animal luring device (1), comprising a) a first compartment (2) containing genetically engineered first microorganisms, the genetically engineered first microorganisms being genetically engineered in that they produce and release i) an attractant attracting an animal and ii) an active agent, b) an area or second compartment (3), which is freely accessible to the animal, and connected to the first compartment (2) in a manner that the attractant and the active agent are able to pass to the area or second compartment (3), whereas the genetically engineered first microorganisms are not, and c) a nutrient source for the genetically engineered first microorganisms.

2. The animal luring device (1) according to claim 1, wherein the nutrient source is a sustained-release nutrient source.

3. The animal luring device (1) according to claim 1 or 2, comprising d) a third compartment (4) containing second microorganisms providing a nutrient source for the genetically engineered first microorganisms, wherein the third compartment (4) is connected to the first compartment (2) in a manner that the nutrient source is able to pass to the first compartment (2), whereas the second microorganisms are not, and wherein the first microorganisms are not able to pass to the third compartment (4).

4. The animal luring device (1) according to claim 3, wherein the second microorganisms are Cyanobacteria and the third compartment (4) is permeable to light and carbon dioxide.

5. The animal luring device (1) according to claim 3 or 4, wherein the second | microorganisms are genetically engineered in that they produce and release a nutrient source for the genetically engineered first microorganisms.

6. The animal luring device (1) according to one of the preceding claims, wherein the animal luring device (1) comprises a polymer that is enzymatically degradable by the genetically engineered first microorganisms as a nutrient source.

À …" PAT 1681 LU -50- LU100920

7. The animal luring device (1) according to one of the preceding claims, wherein the genetically engineered first microorganisms are growth inhibited, preferably genetically engineered in that they are growth-inhibited.

8. The animal luring device (1) according to one of the preceding claims, wherein the attractant is selected from heat, lactate, 3-methyl-1-butanol and myristic acid, or a combination thereof.

9. The animal luring device (1) according to one of the preceding claims, wherein the active agent is a compound or composition toxic to the animal, or is a compound or composition being toxic for a pathogen infesting the animal, or is a compound or composition immunizing or vaccinating the animal against a pathogen infesting the animal.

10. The animal luring device (1) according to claim 9, wherein the active agent is a scorpion toxin.

11. The animal luring device (1) according to one of the preceding claims, wherein the animal is an insect, preferably a mosquito, or an arachnid, preferably a mite.

12. The animal luring device (1) according to one of the preceeding claims, wherein the genetically engineered first microorganisms are genetically engineered E. coli cells.

13. The animal luring device (1) according to one of claims 4 to 12, wherein the genetically engineered first microorganisms are genetically engineered E. coli cells and the second microorganisms are genetically engineered Cyanobacteria genetically engineered in that they produce and release a nutrient source for the genetically engineered E. coli cells.

I