LU100734B1 - Synthetic transfer RNA with extended anticodon loop - Google Patents

Abstract

The invention relates to a synthetic transfer RNA with an extended anticodon loop. The invention provides a synthetic suppressor transfer RNA useful for the treatment of a genetic disease like cystic fibrosis associated with a nonsense mutation. The synthetic transfer RNA comprises an extended anticodon loop with two consecutive anticodon base triplets being able to base-pair to two consecutive codon base triplets on an mRNA. The first anticodon base triplet or the second anticodon base triplet is able to base-pair to a stop codon base triplet on the mRNA.

Description

PAT 1612 LU _1~ LU 100734

SYNTHETIC TRANSFER RNA WITH EXTENDED ANTICODON LOOP

DESCRIPTION

The invention relates to a synthetic transfer RNA with an extended anticodon loop.

Transfer ribonucleic acids (tRNAs) are an essential part of the protein synthesizing machineryof living cells as necessary components for translating the nucleotide sequence of a messengerRNA (mRNA) into the amino acid sequence of a protein. Naturally occurring tRNAs comprisean amino acid binding stem being able to covalently bind an amino acid and an anticodon loopcontaining a base triplet called “anticodon”, which can bind non-covalently to a correspondingbase triplet called “codon” on an mRNA. A protein is synthesized by assembling the aminoacids carried by tRNAs using the codon sequence on the mRNA as a template with the aid of amulti component system comprising, i.a., the ribosome and several auxiliary enzymes.

Some diseases belonging to the group of genetic diseases are based on a change in the geneticinformation, e.g. a mutation in the DNA of the encoding genes. In this case the mRNAtranscribed from the mutated gene will also carry the altered genetic information and anaberrant, possibly non-functional protein is formed. A mutation may, for example, lead to theintroduction of a stop codon within a coding region resulting in premature termination ofprotein synthesis and the production of a truncated protein. As an example, disease cysticfibrosis (CF) can be caused by a mutation of the gene coding for the membrane protein "cysticfibrosis transmembrane conductance regulator" (CFTR). In this case, the mutation introduces apremature termination codon (PTC) or stop codon within the reading frame of the CFTR gene(Vallières E, Elbom JS, Cystic fibrosis gene mutations: evaluation and assessment of diseaseseverity. Advances in Genomics and Genetics, Volume 2014:4 Pages 161-172; Wilschanski M.Class 1 CF Mutations. Frontiers in Pharmacology. 2012;3:117. doi:10.3389/fphar.2012.00117;Gambari R, Breveglieri G, Salvatori F, Finotti A, Borgatti M, 2015, Therapy for Cystic FibrosisCaused by Nonsense Mutations, Cystic Fibrosis in the Light of New Research, Wat D. (Ed.),InTech, DOI: 10.5772/61053).

PAT 1612 LU LU100734

Stop codon suppressor agents like aminoglycosides promoting translational readthrough forrecovering a functional CFTR in CF with PTCs have been described in the prior art (see, e.g.,Mutyam V, Du M, Xue X, Keeling KM, White EL, Bostwick JR, Rasmussen L, Liu B, MazurM, Hong JS, Falk Libby E, Liang F, Shang H, Mense M, Suto MJ, Bedwell DM, Rowe SM.Discovery of Clinically Approved Agents That Promote Suppression of Cystic FibrosisTransmembrane Conductance Regulator Nonsense Mutations. Am J Respir Crit Care Med. 2016 Nov 1 ; 194(9):1092-1103. doi 10.1164/rccm.201601-01540C; Gambari R, Breveglieri G,Salvatori F, Finotti A, Borgatti M, 2015, Therapy for Cystic Fibrosis Caused by NonsenseMutations, Cystic Fibrosis in the Light of New Research, Wat D. (Ed.), InTech, DOI:10.5772/61053). Such agents, however, are often neither effective nor well tolerated.

Although still in its beginnings, gene therapy involving the introduction of corrective geneticmaterial into the cells of a patient, is becoming more and more important for treating geneticdiseases. Currently, gene therapy approaches are primarily based on the use of mRNA in orderto replace and compensate for a mutated “defective” mRNA. However, mRNA is short-livedand the length of the mRNA sequences presents problems for therapeutic application. Aparticular mRNA may, for example, be longer than the cargo capacity of currently availablevectors for gene delivery and therapy.

Compared to mRNA, tRNA molecules offer significantly higher stability and are on average10-fold shorter, alleviating the problem of introduction into the target tissue. This has led toattempts to use tRNA in gene therapy in order to prevent the formation of a truncated proteinfrom an mRNA with a premature stop codon and to introduce the correct amino acid instead(see, e.g., Koukuntla, R 2009, Suppressor tRNA mediated gene therapy, Graduate Theses andDissertations, 10920, Iowa State University, http://lib.dr.iastate.edu/etd/10920; US2003/0224479 Al; US 6964859).

Lueck et al. (Lueck, J.D., Infield, DT, Mackey, AL, Pope, RM, McCray, PB, Ahem, CA.Engineered tRNA suppression of a CFTR nonsense mutation, bioRxiv 088690; doi: 10.1101/088690), for example, describe a codon-edited tRNA enabling the conversion of an in-frame stop codon in the CFTR gene to the naturally occurring amino acid in order to restore thefull-length wild type protein. ƒ

PAT 1612 LU -J- LU 100734

Sako et al. (Sako Y, Usuki F, Suga H. A novel therapeutic approach for genetic diseases byintroduction of suppressor tRNA. Nucleic Acids Symp Ser (Oxf). 2006;(50):239-40. PubMedPMID: 17150906, doi: 10.1093/nass/nrll 19) describe an approach to read through PTC-containing mRNAs using suppressor tRNA that is introduced to cells by transfection. Nonsensetriplet codons were suppressed and four-base codons were read by the corresponding suppressortRNAs derived from human tRNA(Ser). tRNAs with an extended anticodon loop comprising a four-base or five-base anticodon havealso been described for incorporating unnatural amino acids into proteins (US 2006/0177900Al; WO 2005/007870; Hohsaka T, Ashizuka Y, Murakami H, Sisido M. Five-base codons forincorporation of nonnatural amino acids into proteins. Nucleic Acids Research. 2001 ;29(17):3646-3651; Hohsaka T, Sisido M. Incorporation of non-natural amino acids intoproteins. Curr Opin Chem Biol. 2002 Dec;6(6):809-15. Review. PubMed PMID: 12470735).

Anderson et al. (Anderson JC, Magliery TJ, Schultz PG. Exploring the limits of codon andanticodon size. Chem Biol. 2002 Feb;9(2):237-44. DOI: 10.1016/S1074-5521(02)00094-7)describe the suppression of two-, three-, four-, five-, and six-base codons with tRNAscontaining 6-10 nt in their anticodon loops.

There is still a need for counteracting the effects of and/or suppressing a nonsense mutation. Itis therefore an object of the invention to provide such means, in a particular a nonsensemutation suppressor for the treatment of a genetic disease like cystic fibrosis associated with anonsense mutation.

In one aspect the invention provides a synthetic transfer ribonucleic acid (tRNA), the synthetictransfer RNA comprising an extended anticodon loop with two consecutive anticodon basetriplets being able to base-pair to two consecutive codon base triplets on an mRNA, wherein thefirst anticodon base triplet or the second anticodon base triplet is able to base-pair to a stopcodon base triplet on the mRNA.

The invention provides novel suppressor tRNAs that can be used to suppress a nonsensemutation, e.g. for restoring the ability of a cell to synthesize a functional protein from an

PAT 1612 LU LU100734 mRNA having a mutation in its coding sequence, which would otherwise lead to prematurecessation of translation and a truncated protein. The synthetic tRNA of the invention comprisesan extended anticodon loop having two consecutive anticodon base triplets, at least one ofwhich being able to base-pair to a stop codon base triplet on an mRNA. The synthetic tRNA ofthe invention is thus able to bind to two adjacent codons on the mRNA, one being a prematuretermination codon (PTC), which are complementary to the two anticodon base triplets. Thesynthetic tRNA of the invention not only base-pairs with the PTC but also with the preceding orfollowing codon on the mRNA resulting in the incorporation of an amino acid carried by thetRNA into the growing amino acid chain instead of a premature termination of the proteinsynthesis. Unless the synthetic tRNA of the invention is (pre)aminoacylated with a dipeptide,the resulting protein will have one amino acid less than the wild-type protein, i.e. a proteinsynthesized from the wild-type mRNA without the PTC, but the chances are good that this willnevertheless lead to a functional protein. Advantageously, the base-pairing of the synthetictRNA of the invention with two adjacent codons, one of which being a PTC and the other beinga specific codon adjacent to the PTC, on the mRNA is associated with higher specificitycompared to suppressor tRNAs binding only to a single codon, i.e. a stop codon. Consequently,the synthetic tRNA of the invention can be designed to only bind to a specific combination of aPTC and one of its neighbouring codons, considerably reducing the risk of unwanted pairing toPTCs or “normal” stop codons on non-targeted mRNA.

The terms “transfer ribonucleic acid” or “tRNA” refers to RNA molecules typically 73 to 90nucleotides in length serving the translation of a nucleotide sequence in an mRNA into theamino acid sequence of a protein. tRNAs are able to covalently bind a specific amino acid attheir 3' CCA tail at the end of the acceptor stem, and to base-pair via a three-nucleotideanticodon in the anticodon loop of the anticodon arm with a three-nucleotide sequence (codon)in the messenger RNA. Some anticodons can pair with more than one codon due to aphenomenon known as wobble base pairing. The secondary “cloverleaf’ structure of tRNAcomprises the acceptor stem binding the amino acid and three arms (“D arm”, “T arm” and“anticodon arm”) ending in loops (D loop, T\|/C loop, anticodon loop), i.e. sections withunpaired nucleotides. Aminoacyl tRNA synthetases charge (aminoacylate) tRNAs with aspecific amino acid. Each tRNA contains a distinct anticodon triplet sequence that can base-pairto one or more codons for an amino acid. By convention, the nucleotides of tRNAs are often

PAT 1612 LU LU100734 -5- numbered 1 to 76, starting from the 5'-P terminus, based on a “consensus” tRNA moleculeconsisting of 76 nucleotides, and regardless of the actual number of nucleotides in the tRNA,which may deviate from 76 due to variable portions, e.g. the D loop, in the tRNA. Followingthis convention, nucleotide positions 34-36 of naturally occurring tRNA refer to the threenucleotides of the anticodon, and positions 74—76 refer to the terminating CCA tail. Any“supernumerary” nucleotide can, e.g., be numbered by adding alphabetic characters to thenumber of the previous nucleotide being part of the consensus tRNA and numbered accordingto the convention, e.g. 20a, 20b etc.

The terms “synthetic transfer ribonucleic acid” or “synthetic tRNA” refer to a non-naturallyoccurring tRNA. The term also encompasses analogues to naturally occurring tRNAs, i.e.tRNAs being structurally similar to naturally occurring tRNAs, but being modified in the basecomponent, the sugar component and/or the phosphate component of one or more of thenucleotides, of which the tRNA is composed. The modified tRNA may, for example, have thephosphodiester backbone modified in that the phosphodiester bridge is replaced by aphosphorothioate, phosphoramidate or methyl phosphonate bridge. The sugar component may,for example, be modified at the 2' OH group, e.g. by dehydroxylating it to a deoxyribonucleotide, or by replacing it with a methoxy-, methoxyethoxy- or aminoethoxy group. Asynthetic transfer ribonucleic acid can, for example, be synthesized chemically and/orenzymatically in vitro, or in a cell based system, e.g. in a bacterial cell in vivo.

The term “codon” refers to a sequence of nucleotide triplets, i.e. three DNA or RNAnucleotides, corresponding to a specific amino acid or stop signal during protein synthesis. Alist of codons (on mRNA level) and the encoded amino acids are given in the following:

Amino acid One Letter Code Codons Ala A GCU, GCC, GCA, GCG Arg R CGU, CGC, CGA, CGG, AGA, AGG Asn N AAU, AAC Asp D GAU, GAC Cys C UGU, UGC Gin Q CAA, CAG

PAT 1612 LU LU100734

Glu E GAA, GAG Gly G GGU, GGC, GGA, GGG His H CAU, CAC lie I AUU, AUC, AUA Leu L UUA, UUG, CUU, CUC, CUA, CUG Lys K AAA, AAG Met M AUG Phe F UUU, UUC Pro P CCU, CCC, CCA, CCG Ser S UCU, UCC, UCA, UCG, AGU, AGC Thr T ACU, ACC, ACA, ACG Trp w UGG Tyr Y UAU, UAC Vai V GUU, GUC, GUA, GUG

START: AUG STOP: UAA, UGA, UAG, abbreviated “X”

The term “sense codon” as used herein refers to a codon coding for an amino acid. The term“stop codon” or “nonsense codon” refers to a codon, i.e. a nucleotide triplet, of the genetic codenot coding for one of the 20 amino acids normally found in proteins and signalling thetermination of translation of a messenger RNA. Stop codons (on mRNA level) are UAA(“ochre”), UAG ("amber"), or UGA (“opal”). The letter “X” is used analogously to the one-letter amino acid code to denote a stop codon. A nonsense mutation in a protein is often denotedwith the wild-type amino acid, followed by the position of the amino acid in the protein, and an“X”. As an example, “R553X” denotes a mutation of the codon coding for arginine (one-lettercode R) to a stop codon (X) at position 553 in the protein (CFTR). A stop codon in an mRNAwithin an open reading frame leads to the production of a truncated, mostly non-active proteinfragment.

PAT 1612 LU -Ί - LU100734

The term “anticodon” refers to a sequence of three nucleotides that correspond, i.e. hybridize orbase-pair, to the three bases of the codon on the mRNA. An anticodon may also containnucleotides with modified bases.

The term “anticodon loop” refers to the unpaired nucleotides of the anticodon arm containingthe anticodon. Naturally occurring tRNAs usually comprise seven nucleotides in their anticodonloop, three of which pair to the codon in the mRNA.

The term “extended anticodon loop” refers to an anticodon loop with a higher number ofnucleotides in the loop than in naturally occurring tRNAs. An extended anticodon loop may, forexample, contain more than seven nucleotides, e.g. eight, nine, ten or eleven nucleotides.

The terms “codon base triplet” or “anticodon base triplet” refer to sequences of threeconsecutive nucleotides representing a codon or anticodon. The terms are used in order toclarify that the terms “codon” or “anticodon” as used herein in relation to the invention refer tonucleotide triplets, and not to sequences of four or more nucleotides, e.g. nucleotide quadruplets(“four base codons”) etc. The two consecutive anticodon base triplets in the anticodon loop of asynthetic tRNA of the invention may, however, also be called “anticodon pair”, “anticodondouble” or “anticodon duplex”, and, correspondingly, the two consecutive codon base triplets inthe mRNA “codon pair”, “codon double” or “codon duplex”.

The term “base pair” relates to any of the pairs of the hydrogen-bonded purine and pyrimidinebases that form the links between the sugar-phosphate backbones of nucleic acid molecules. InRNA the bases adenine and uracil and the bases guanine and cytosine form base pairs. The term“being able to base-pair” in relation to a nucleotide or nucleotide sequence refers to the abilityof the nucleotide or nucleotide sequence to hybridize to, i.e. form hydrogen bonds with, acorresponding, i.e. complementary, nucleotide or nucleotide sequence.

The term “PTC” refers to a premature termination codon, i.e. a stop codon introduced into acoding nucleic acid sequence by a nonsense mutation, i.e. a mutation in which a sense codoncoding for one of the twenty amino acids specified by the genetic code is changed to a chain-terminating codon. The term thus refers to a premature stop signal in the translation of the

PAT 1612 LU -δ- ω 100734 genetic code contained in mRNA. PTCs are implicated in a variety of genetic disorders, e.g.cystic fibrosis (DF), Duchenne muscular dystrophy (DMD) or neurofibromatosis type 1 (NF1).

The term “cystic fibrosis” refers to a genetic disorder inherited in an autosomal recessivemanner. It is caused by mutations in both copies of the gene for the cystic fibrosistransmembrane conductance regulator (CFTR) protein. The term “nonsense mutation cysticfibrosis” (nmCF) may be used for CF caused by a nonsense mutation. Examples for nonsensemutation in the CFTR are W1282X (X = stop codon), G542X, R553X or RI 162X.

The term “Duchenne muscular dystrophy” (DMD) (also “Becker muscular dystrophy”, BMD)refers to a X-linked recessive genetic disorder characterized by progressive muscledegeneration and weakness caused by an absence of a functional dystrophin protein. Theabsence of dystrophin can be caused by a nonsense mutation in the dystrophin gene.

The term “neurofibromatosis type 1” (NF1 or NF-1), also called “Recklinghausen disease”, isan autosomal dominant inherited disorder caused by the mutation of the NF1 gene onchromosome 17 coding for neurofibromin. NF1 causes tumours along the nervous system.

The terms “nonsense suppression” or “nonsense mutation suppression” refer to mechanismsmasking the effects of a nonsense mutation and at least partly restoring the wild-typephenotype.

The term “suppressor tRNA” relates to a tRNA altering the reading of a messenger RNA in agiven translation system. An example for a suppressor tRNA is a tRNA carrying an amino acidand being able to base-pair to a stop codon, so that the translation system can read through thestop codon. tRNAs that can recognize a stop codon are known as nonsense suppressor tRNAsorNSTs.

The term “homology” in relation to a nucleic acid refers to the degree of similarity or identitybetween the nucleotide sequence of the nucleic acid and the nucleotide sequence of anothernucleic acid. Homology is determined by comparing a position in the first sequence with acorresponding position in the second sequence in order to determine whether identical

PAT 1612 LU -9- LU100734 nucleotides are present at that position. It may be necessary to take sequence gaps into accountin order to produce the best possible alignment. For determining the degree of similarity oridentity between two nucleic acids it is preferable to take a minimum length of the nucleic acidsto be compared into account, for example at least 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2% or 99.5% of the nucleotides in therespective sequences. Preferably the full length of the respective nucleic acid(s) is used forcomparison. The degree of similarity or identity of two sequences can, for example, bedetermined by using the computer program BLAST (Altschul SF et al., 1990, Basic localalignment search tool, J Mol Biol 215:403-410), see, e.g.http://www.ncbi.nlm.nih.gov/BLAST/) using standard parameters. Further programs are, forexample, available on the website of the European Bioinformatics Institute (EMBL) (see, e.ghttp://www.ebi.ac.uk/Tools/similarity.html). Where such terms like “x % homologous to” or“homology of x %” are used herein, this means that two nucleic acids have a sequence identityor similarity of x %, e.g. 50%.

The term “aminoacylation” relates to the enzymatic reaction charging a tRNA with an aminoacid. An aminoacyl tRNA synthetase (aaRS) catalyses the esterification of a specific cognateamino acid or its precursor to a compatible cognate tRNA to form an aminoacyl-tRNA. Theterm “aminoacyl-tRNA” thus relates to a tRNA with an amino acid attached to it. Eachaminoacyl-tRNA synthetase is highly specific for a given amino acid, and, although more thanone tRNA may be present for the same amino acid, there is only one aminoacyl tRNAsynthetase for each of the 20 proteinogenic amino acids. The terms “charge” or “load” may alsobe used synonymously for “aminoacylate”. The term “aminoacylated” in relation to thesynthetic tRNA of the invention relates to a synthetic tRNA already charged (precharged) withan amino acid or a dipeptide, such that the tRNA is already acylated when entering the targetcell. The term “preaminoacylated” may synonymously be used in this context.

The term “modified nucleotides” (or “unusual nucleotides”) in reference to tRNA relates tonucleotides having modified or unusual nucleotide bases, i.e. other than the usual bases adenine(A), uracil (U), guanine (G) and cytosine (C). Examples of modified nucleotides include 4-acetylcytidine (ac4c), 5-(carboxyhydroxymethyl)uridine (chm5u), 2’-O-methylcytidine (cm), 5-carboxymethylaminomethyl-2-thiouridine (cmnm5s2u), 5-carboxymethylaminomethyluridine

PAT 1612 LU -10- LU100734 (cmnm5u), dihydrouridine (d), 2’-O-methylpseudouridine (fin), beta, D-galactosylqueuosine (gal q), 2’-O-methylguanosine (gm), inosine (i), N6-isopentenyladenosine (i6a), 1-methyladenosine (mla), 1-methylpseudouridine (mlf), 1-methylguanosine (mlg), 1-methylinosine (mli), 2,2-dimethylguanosine (m22g), 2'-O-methyladenosine (am), 2-methyladenosine (m2a), 2-methylguanosine (m2g), 3-methylcytidine (m3c), 5-methylcytidine(m5c), N6-methyladenosine (m6a), 7-methylguanosine (m7g), 5-methylaminomethyluridine(mam5u), 5-methoxyaminomethyl-2-thiouridine (mam5s2u), beta, D-mannosylqueuosine (manq), 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2u), 5-methoxycarbonylmethyluridine(mcm5u), 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2’-O-methyluridine(ncm5Um), 5-methoxyuridine (mo5u), 2-methylthio-N6-isopentenyladenosine (ms2i6a), N-((9-beta-D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine (ms2t6a), N-((9-beta-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine (mt6a), uridine-5-oxyacetic acid-methylester (mv), uridine-5-oxyacetic acid (o5u), wybutoxosine (osyw), pseudouridine (p, Ψ),queuosine (q), 2-thiocytidine (s2c), 5-methyl-2-thiouridine (s2t), 2-thiouridine (s2u), 4-thiouridine (s4u), 5-methyluridine (t), N-((9-beta-D-ribofuranosylpurine-6-yl)-carbamoyl)threonine (t6a), 2’-O-methyl-5-methyluridine (tm), 2’-O-methyluridine (um),wybutosine (yw), 3-(3-amino-3-carboxy-propyl)uridine, (acp3)u (x),

The term “corresponding modified nucleotide” relates to a modified nucleotide at a givenposition in a sequence, which base has been modified based on the usual, i.e. unmodified, baseof the nucleotide at the same position in the original sequence to be compared with thesequence containing the modified nucleotide. A corresponding modified nucleotide is thus anynucleotide that, in a cell, is usually produced from a usual nucleotide by modifying the usualnucleotide. A modified nucleotide corresponding to uridine, for example, is thus any nucleotidederived by the modification of uridine. As an example, 5-(carboxyhydroxymethyl)uridine(chm5u) at a particular position in a sequence may be a modified nucleotide corresponding touridine at the same position in the original sequence. Further modified nucleotidescorresponding to uridine are, for example, 5-methyluridine (t), 2’-O-methyl-5-methyluridine(tm), 2’-O-methyluridine (um), or 5-methoxyuridine (mo5u). Inosine, as another example, isproduced from adenosine and thus is a modified nucleotide corresponding to adenosine. if

PAT 1612 LU -11- LU100734

The synthetic transfer RNA of the invention may be synthesized based on a naturally occurringtRNA. However, the tRNA of the invention is preferably designed computationally (“in silico”)and synthesized chemically and/or enzymatically. The computational design of a synthetictRNA according to the invention allows the design and synthesis of a tRNA that does notinterfere with other tRNAs present in the cell. The synthetic tRNA of the invention is selectedor designed in such a manner that an aminoacyl tRNA synthetase that naturally occurs in aliving cell, preferably a mammalian cell, e.g. a human cell, is able to charge the tRNA with aspecific amino acid. Preferably, the tRNA is selected or designed in such a manner that, underconditions within the cell, an amino acid is enzymatically attached to the tRNA that is encodedby the codon in a targeted mRNA next to a premature stop codon or by the wild-type codonmutated to the premature stop codon.

The skilled person is aware of the fact that a tRNA is aminoacylated with a specific amino acidby a specific aminoacyl tRNA synthetase (aaRS), and that the aaRS is able to recognize itscognate tRNA through unique identity elements at the acceptor stem and/or anticodon loop ofthe tRNA. In order to provide a tRNA which is loaded with its cognate amino acid in vivo, theskilled person will design the synthetic tRNA of the invention with suitable unique identityelements.

The tRNA of the invention preferably has a low sequence identity to any naturally occurringtRNA, and has preferably a sequence identity of less than 50%, especially preferred of less than49%, 48%, 47%, 46%, 45%, 44% or 43%.

In the synthetic transfer RNA according to the invention the anticodon loop has been extendedby a large enough number of nucleotides to accommodate the anticodon pair and to allow base-pairing with an mRNA. The anticodon loop of a synthetic transfer RNA of the invention may,for example, consist of 8-12, preferably 9-11, further preferred 9 or 10 nucleotides. Ananticodon loop of 9 nucleotides is especially preferred.

The extended anticodon loop of the synthetic tRNA of the invention comprises two consecutiveanticodon base triplets, which are able to base-pair to two consecutive codon base triplets on anmRNA, the latter preferably being a targeted mRNA carrying a premature termination codon V'

PAT 1612 LU -12- LU100734 (PTC). One of the anticodon base triplets is able to base-pair to a stop codon base triplet on themRNA, whereas the neighbouring anticodon base triplet preferably base-pairs to a sense codonpreceding or following, i.e. 5' or 3' to the stop codon base triplet on the mRNA. The terms“preceding” or “following” relate to the direction of translation, i.e. the 5-3' direction of themRNA.

An example of an anticodon pair in the extended anticodon loop of the synthetic tRNA of theinvention is UGCUCA (in 5'-3' direction, or ACUCGU in 3'-5' direction), matching withUGAGCA (5'-3') in the mRNA, where UCA is able to base-pair with the stop codon UGA, andUGC is able to base-pair with the codon GCA coding for alanine.

The synthetic transfer RNA according to the invention may be aminoacylated, i.e. carrying anamino acid or a dipeptide at the end of its acceptor stem. Preferably, the tRNA is aminoacylatedwith an amino acid being encoded by a sense codon base-pairing with one of the anticodonpairs or with an amino acid being encoded by a codon mutated to a premature terminationcodon and base-pairing with the other anticodon pair. The synthetic tRNA of the invention canbe chemically and/or enzymatically aminoacylated with a single amino acid or dipeptide.Engineered bacterial tRNA synthetases or RNA-based catalysts may, for example, be used toaminoacylate the tRNA with a dipeptide. A dipeptide is preferably composed of the aminoacids encoded by the codon pair corresponding to the anticodon pair present in the synthetictRNA. The use of a synthetic tRNA aminoacylated with such a dipeptide would not only resultin the intended suppression of the PTC and the production of a non-truncated protein, but in theproduction of a protein having the amino acid sequence of the wild-type protein.

In preferred embodiments, the synthetic transfer RNA of the invention has or comprises a) oneof the sequences according to SEQ ID NO: 03-07, 09-17 or 19-23, or b) a sequence having atleast 90%, preferably at least 95%, 96%, 97%, 98% or 99% sequence identity with one of thesequences according to SEQ ID NO: 03-07, 09-17 or 19-23, or c) a sequence according to oneof SEQ ID NO: 03-07, 09-17 or 19-23, where at least one of the nucleotides is replaced with acorresponding modified nucleotide. The term “replaced with a corresponding modifiednucleotide” means that a unmodified nucleotide, e.g. a cytidine nucleotide (C), at a givenposition in a sequence, e.g. SEQ ID NO: 03, is replaced with a corresponding modified

PAT 1612 LU -13- LU100734 nucleotide, e.g. 2’-O-methylcytidine (cm), 3-methylcytidine (m3c) or 5-methylcytidine (m5c).

The synthetic transfer RNA of the invention may, for example, have or comprise a sequencecontaining more than 10, 20 or 30 modified nucleotides.

For clarification, it is noted that the synthetic transfer RNA of the invention may or may not besynthesized to contain any modified nucleotides. The synthetic transfer RNA of the inventionmay thus not contain any modified nucleotide. However, after entering a cell, one or morenucleotides of that synthetic tRNA may nevertheless be modified within the cell by the cellularenzymatic machinery. Consequently, a synthetic tRNA of the invention, which has beendesigned, synthesized and administered without any modified nucleotide, may, in a living cell,contain one or more modified nucleotides due to modifications the cell has made to them. Infact, it is preferred that the synthetic tRNA of the invention is synthesized and also administeredwithout containing any modified nucleotides and to leave any modifications to the cell.

The synthetic transfer RNA of the invention may thus not contain any modified nucleotide.However, after entering a cell, one or more nucleotides of that synthetic tRNA maynevertheless be modified within the cell by the cellular enzymatic machinery. Consequently, asynthetic tRNA of the invention, which has been designed, synthesized and administeredwithout any modified nucleotide, may, in a living cell, contain one or more modifiednucleotides due to modifications the cell has made to them.

If a synthetic tRNA of the invention is synthesized with modified nucleotides, such that thetRNA already contains modified nucleotides prior to administration, it is preferred that thetRNA of the invention contains one or more of the following modified nucleotides (Table 1):Table 1. Possible modified nucleotides and positions within the tRNA (position numberingaccording to the specific tRNA numbering convention for a generalized “consensus” tRNA, seealso Fig. 3)

Position Modification 1 Ψ cm, am

PAT 1612 LU - 14- LU100734 9 12 16 17 18 20, 20a-b 26 28 29 mlgac4cddm2gdm22g Ψ 30 Ψ 32 Ψ, 2'0-methylribose, cm 34 I, Ψ, m5c, cm, gm, 2'0-methylribose, q, mcm5u, ncm5u, ncm5um,mcm5s2u, 35 Ψ mlg, 1-methylguanosine; am, 2’-O-methyladenosine; cm, 2'-O-methylcytidine; gm, 2'-O-methylguanosine; Ψ, pseudouridine; m2g, N2-methylguanosine; ac4c, N4-acetylcytidine; d,dihydrouridine; m22g, N2,N2-dimethylguanosine; m2g, N2-methylguanosine; I, inosine; m5c,5-methylcytidine; mcm5u, 5-methoxycarbonylmethyluridine; mcm5s2u, 5-methoxycarbonyl-methyl-2-thiouridine; ncm5u, 5-carbamoylmethyluridine; ncm5um, 5-carbamoylmethyl-2'-O-methyluridine; q, queuosine; m5c, 5-methylcytidine.

In a further aspect the invention relates to the synthetic transfer RNA according to the firstaspect of the invention for use as a medicament. The transfer RNA of the invention is especiallyuseful for treating patients with a disease associated with a PTC causing the absence ordysfunction of a protein, in particular a disease at least partly caused by a nonsense mutationleading to premature cessation of the translation of an mRNA. Examples for diseases, in whichthe tRNA of the invention may advantageously be employed are cystic fibrosis,neurofibromatosis type 1 or Duchenne muscular dystrophy. Suitable compositions or means fordelivering tRNAs to a cell are known, and comprise, for example, vectors, e.g. viral vectors likeadeno-associated virus (AAV)-based viral vectors, encapsulation in or coupling to nanoparticles etc.

PAT 1612 LU -15- LU100734

The invention will be described in the following by way of examples and the appended figuresfor illustrative purposes only.

Figure 1 Schematic example of a synthetic tRNA of the invention and a targeted mRNA.

Figure 2 Example embodiment of part of a synthetic Ala-tRNA of the invention. N = anynucleotide.

Figure 3 Schematic drawing of a generalized “consensus” tRNA structure and its numberingaccording to tRNA numbering convention.

Figure 1 shows a schematic example of a synthetic tRNA of the invention and a targetedmRNA. The synthetic tRNA 1 of the invention is composed of tRNA nucleotides 11 and hasthe common cloverleaf structure of natural tRNA comprising an acceptor stem 2 with the CCAtail 10, a T arm 3 with the T\|/C loop 6, a D arm 4 with the D loop 7 and an anticodon arm 5with a five nucleotide stem portion 8 and the anticodon loop 9. An amino acid 14 is bound tothe CCA tail 10 of the acceptor stem 2. The extended anticodon loop 9 consists of ninenucleotides 11 and contains two consecutive anticodon base triplets 12, 13. The first anticodonbase triplet 12 (hatched circles) is able to base-pair to a first codon base triplet 17 (also hatched)on a targeted mRNA 15 composed of mRNA nucleotides 16. The second anticodon base triplet13 (solid black circles) is able to base-pair to a second codon base triplet 18 (also solid black)on the mRNA 15. The first codon base triplet 17 may be a premature termination codon (PTC)and the second codon base triplet 18 may code for an amino acid, e.g. alanine, or vice versa. Avariable loop often found in naturally occurring tRNA between the T arm and the anticodonarm is missing here.

Examples:

In silico design of a synthetic tRNA of the invention.

PAT 1612 LU -16- LU100734

Unless otherwise indicated all sequences are in 5'-3' direction. In all sequences, if a minus sign(hyphen, is used this is for clarity only and does not refer to a physical nucleotide. It is apurely typographical convention to align sequences on a page. Further, unless expressly statedotherwise, numbering is according to standard numbering, not according to the tRNAconvention mentioned above.

First of all, a naturally occurring human Leu tRNA was modified only in its anticodon loop.

Original human tRNA-Leu (M2GAA) (genbank accession X04700.1; anticodon underlined),SEQ ID NO: 01:

GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUNAAGUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

The above naturally occurring tRNA contains, when isolated from a cell, modified bases in itssequence, which are represented in the above sequence by N or the corresponding unmodifiedbases. As an example, N at position 35 (corresponding to position 34 according to the specifictRNA numbering convention mentioned above) represents m22g (2,2-dimethylguanosine). tRNAs were designed in order to be able to correct a mutation in CFTR leading to a stop codon (X) next to a codon coding for leucine (leu, L): 5'-CAGUUA-3' 6nt anticodon pair complementary to the following codons: 3'-GUCAAU-5' mRNA sequence (5'-stop-leu-3') shall be recognized

In addition to a tRNA based on the natural tRNA modified in only one base in the normalanticodon, five tRNAs (designs 1.1 to 1.5) with an extended anticodon loop were designed. Asmentioned above, modified nucleotides may or may not also be present in the modifiedsequences, i.e. the sequences given below for the designed tRNAs may contain one or morecorresponding modified nucleotides instead of the unmodified bases. Number and kind ofmodified nucleotides may be the same or different from the ones in the natural tRNA template.Any unmodified nucleotide in a sequence for a synthetic tRNA of the invention may thus be

PAT 1612 LU -17- LU100734 replaced with a corresponding modified nucleotide. The symbols A, C, G or U in the belowsequences for designed tRNAs may therefore represent an unmodified or any correspondingmodified base. An A in a sequence may, for example, represent an adenine nucleotide (A) or acorresponding modified nucleotide, e.g. 1-methyladenosine (mla). When synthesized in vitro,the tRNAs are preferably unmodified, but may be subsequently modified chemically and/orenzymatically in vitro. Once introduced or incorporated in a cell, the tRNAs, whether in vitrosynthesized with unmodified or modified nucleotides, may be modified by the cell.

tRNA-Leu (UAA) with substituted base U at position 35 (34 according tRNA numberingconvention), SEQ ID NO: 02GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUUAAGUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

Design 1.1: tRNA-Leu CAGUUA anticodon pair (underlined), lOnt anticodon loop, SEQ IDNO: 03GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUÇAGUUAGUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

Design 1.2: tRNA-Leu-CAGUUA anticodon, 9nt anticodon loop (deleted C33, compared todesign 1.1 ), SEQ ID NO: 04GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGAUÇAGUUAGUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

Design 1.3: tRNA-Leu-CAGUUA anticodon, 9nt anticodon loop (deleted U34, compared todesign 1.1 ), SEQ ID NO: 05GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACCAGUUAGUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

Design 1.4: tRNA-Leu-CAGUUA anticodon, 9nt anticodon loop (deleted G41, compared todesign 1.1 ), SEQ ID NO: 06

GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUÇAGUUAUUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

PAT 1612 LU -18- LU100734

Design 1.5: tRNA-Leu-CAGUUA anticodon, 9nt anticodon loop (deleted U42, compared todesign 1.1), SEQ ID NO: 07

GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUÇAGUUAGUCUGGUCUCCGGAUGGAGCGUGGGUUCGAAUCCCACUUCUGACACCA

The optimal anticodon loop length was 9nt.

Starting from design 1.4 (CAGUUA anticodon, 9nt anticodon loop (deleted G41)), further LeutRNA (with 6nt anticodon pair) were designed with less similarity to the naturally occurringtRNAs, based on the crystal structure from a tRNA-Leu from Thermus thermophilus: tRNA-Leu-CAG from Thermus thermophilus (3nt anticodon, sequence is from RCSB Protein

Data Bank identifier 2bte.b; any modified nucleotides present in the sequence are representedby their respective unmodified nucleotides). SEQ ID NO: 08

GCCGGGGUGGCGGAAUGGGUAGACGCGCAUGACUÇAGGAUCAUGUGCGCAAGCGUGCGGGUUCAAGUCCCGCCCCCGGCACCA

This resulted in the design of the following tRNA-Leu-CAGUUA (Leu-Stop) having 6ntanticodon pairs based on design 1.4 (9nt anticodon loop) above:

Design 2.1 (SEQ ID NO: 09):

GGCAGGCUGAGGGAGAUGGUCAACCUAGCCAGCUÇAGUUAGCUGGCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGCCUGCCACCA

Design 2.2 (SEQ ID NO: 10):

GACAGGCUGAGGGAGAUGGUCAACCUAGCAGCCUÇAGUUAGGCUGCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGCCUGUCACCA

Design 2.3 (SEQ ID NO: 11):

PAT 1612 LU -19- LU100734

GCCAGCCUGAGGGAGAUGGUCAACCUAGCCAGCUÇAGUUAGCUGGCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGGCACCA

Design 2.4 (SEQ ID NO: 12):

GGCAGCCUGAGGGAGAUGGUCAACCUAGCAGCCUÇAGUUAGGCUGCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGCCACCA

Design 2.5 (SEQ ID NO: 13):

GCCAGCCUGAGGGAGAUGGUCAACCUAGGUGCCUÇAGUUAGGCACCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGGCACCA

Design 2.6 (SEQ ID NO: 14):

GCCAGCCUGAGGGAGAUGGUCAACCUACUGGACUÇAGUUAGUCCAGUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGGCACCA

Design 2.7 (SEQ ID NO: 15):

GCCAGCCUGAGGGAGAUGGUCAACCUACCGGACUÇAGUUAGUCCGGUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGGCACCA

Design 2.8 (SEQ ID NO: 16):

GCCAGCCUGAGGGAGAUGGUCAACCUACCUGCCUÇAGUUAGGCAGGUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGGCUGGCACCA

Design 2.9 (SEQ ID NO: 17):

GCCAGGCUGAGGGAGAUGGUCAACCUAGCUCACUÇAGUUAGUGAGCUCUCCGGAUGGAGCGUGGCUUCGAAUGCCACGCCUGGCACCA

Again, any modified nucleotide present in the natural sequence taken as a template for thedesign of the synthetic tRNAs may or may not also be present in the designed sequences. Thedesigned tRNAs above thus may or may not contain one or more corresponding modifiednucleotides instead of the unmodified bases.

Is

PAT 1612 LU -20- LU100734

For the correction of a further stop mutation (at position 553) in the CFTR gene (R553X),mutating the wild-type codon CGA coding for arginine (R), and flanked by codons coding forglutamine (Q) and alanine (A), to a stop codon (TGA on gene level) CAACGA GCA (wildtype nucleotide sequence) Q R A CAA TGA GCA (wildtype amino acid sequence) (mutated nucleotide sequence) Q X A (mutated nucleotide sequence) the tRNA was designed to have a 6nt anticodon pair (UGCUCA) and to be aminoacylated withalanine (Ala, A), i.e. to have the identity of a Ala-tRNA. Ala is the amino acid following thestop codon (in 3' direction of the mRNA).

The goal was to design a tRNA that would be able to read through a stop codon and deliver aAla to the protein being translated (read through a premature stop codon caused by mutationwhich would otherwise lead to a truncated protein). 5'-UGCUCA-3' 6nt anticodon pair complementary to the two codons below3'-ACGAGU-5' mRNA sequence (5-Stop-Ala-3'; XA) to be recognised

Similar to the Leu-tRNAs at first a natural human Ala-tRNA was minimally changed, i.e. onlyin the anticodon loop. Again, any modified nucleotides in the sequence are represented by theirunmodified equivalents, and the synthetic tRNAs designed based on the natural tRNA may ormay not contain all or part of the modified nucleotides of the natural sequence. The designedtRNAs may also contain more or other modified nucleotides than the ones present in thenaturals sequence and/or at another position.

tRNA-Ala-AGC (SEQ ID NO: 18), without free 3' end ACC A:GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGÇAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCC

Design 3.1 (lOnt anticodon loop) (SEQ ID NO: 19)

PAT 1612 LU -21- LU100734

GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUUGÇUÇAAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA

Design 3.2 (9nt anticodon loop) (SEQ ID NO: 20)GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUGÇUÇAAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA

Design 3.3 (9nt anticodon loop) (SEQ ID NO: 21)GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUUGÇUÇAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA

Design 3.4 (9nt anticodon loop) (SEQ ID NO: 22)ggggaauuagcucaaaugguagagcgcucgcuuugçuçaagcgagagguagcggGAUCGAUGCCCGCAUUCUCCACCA

Experiments showed that both 10 nt and 9nt anticodon loop tRNAs formed a secondary structure corresponding to naturally occurring tRNA, and the single-stranded CCA tails wereintact. All tRNAs could be aminoacylated.

Starting from design 1.4 of the Ala-tRNA further Ala-tRNA were designed, such that the tRNAbody did not correspond to the natural human tRNA.

tRNA-Ala-UGCUCA-design 3.4 (SEQ ID NO: 22)GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUUGÇUÇAAGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA A generalized secondary structure of the designed tRNA is depicted in Fig. 2 (sequence shown in the figure given in SEQ ID NO: 24). The free 3' end including the CCA tail portion is notshown.

The sequence of the tRNA based on the Ala-tRNA and having a 9nt anticodon loop with a 2x3nt anticodon (Fig. 2) and including the 3' end portion is as follows (SEQ ID NO: 23):

PAT 1612 LU -22- LU 100734

GGGGNNNUAGCUCAGNNGGUAGAGCGNNNNNCUUGÇUÇAANNNNNANGNCNNNNGUUCGAUCCNNNNNNNCUCCACCA

As already mentioned in connection with other synthetic tRNAs of the invention, the symbolsG, C, A or U may represent the unmodified or any corresponding modified base. The abovedesigned tRNA may thus contain one or more modified nucleotides. N stands for any of the bases A, C, G or U, or any modified base, given that the base doesn’tviolate the base pairing as given in Fig. 2. The allowed base pairs are G-C, C-G, A-U, U-A, G-U, U-G.

Figure 3 depicts an example of a tRNA numbered according to the conventional numberingapplied to a generalized “consensus” tRNA, beginning with 1 at the 5’ end and ending with 76at the 3’ end. In such a “consensus” tRNA the nucleotides of the natural anticodon triplet isalways at positions 34, 35 and 36, regardless of the actual number of previous nucleotides.

Other than the tRNA shown here a tRNA may, for example, also contain additional nucleotidesbetween positions 1 and 34, e.g. in the D loop. Additional nucleotides may be numbered withadded alphabetic characters, e.g. 20a, 20b etc. Modified nucleotides, as e.g. listed in Table 1above, may be present in the sequence.

PAT 1612 LU -23- LU100734

SEQUENCE LISTING <110> Universität Hamburg <120> Synthetic transfer RNA with extended anticodon loop

<130> PAT 1612 LU <160> 24 <170> BiSSAP 1.3.6 <210> 1 <211> 86

<212> RNA <213> Homo sapiens <220> <221> modified_base <222> 35 <223> /mod_base="m22g" <400> 1 gucaggaugg ccgagugguc uaaggcgcca gacunaaguu cuggucuccg gauggagcgu 60 ggguucgaau cccacuucug acacca 86 <210> 2 <211> 86

<212> RNA <213> Artificial Sequence <220> <223> tRNA Leu with modified anticodon <400> 2

PAT 1612 LU -24- LU100734 gucaggaugg ccgagugguc uaaggcgcca gacuuaaguu cuggucuccg gauggagcgu 60 ggguucgaau cccacuucug acacca 86 <210> 3 <211> 89

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 1.1 with lOnt anticodon loop <400> 3 gucaggaugg ccgagugguc uaaggcgcca gacucaguua guucuggucu ccggauggag 60 cguggguucg aaucccacuu cugacacca 89 <210> 4 <211> 88

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 1.2 with 9nt anticodon loop <400> 4 gucaggaugg ccgagugguc uaaggcgcca gaucaguuag uucuggucuc cggauggagc 60 guggguucga aucccacuuc ugacacca 88 <210> 5 <211> 88

<212> RNA <213> Artificial Sequence

PAT 1612 LU » -25- LU100734 <220> <223> tRNA design 1.3 with 9nt anticodon loop <400> 5 gucaggaugg ccgagugguc uaaggcgcca gaccaguuag uucuggucuc cggauggagc 60 guggguucga aucccacuuc ugacacca 88 <210> 6 <211> 88

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 1.4 with 9nt anticodon loop <400> 6 gucaggaugg ccgagugguc uaaggcgcca gacucaguua uucuggucuc cggauggagc 60 guggguucga aucccacuuc ugacacca 88 <210> 7 <211> 88

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 1.5 with 9nt anticodon loop <400> 7 gucaggaugg ccgagugguc uaaggcgcca gacucaguua gucuggucuc cggauggagc 60 guggguucga aucccacuuc ugacacca 88

PAT 1612 LU LU100734 <210> 8 <211> 83 <212> RNA <213> Thermus thermophilus <220> <223> tRNA Leu CAG <400> 8 gccggggugg cggaaugggu agacgcgcau gacucaggau caugugcgca agcgugcggg60 uucaaguccc gcccccggca cca83 <210> 9 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.1 <400> 9 ggcaggcuga gggagauggu caaccuagcc agcucaguua gcuggcucuc cggauggagc60 guggcuucga augccacgcc ugccacca88 <210> 10 <211> 88 <212> RNA <213> Artificial Sequence <220>

PAT 1612 LU -27- LU100734 <223> tRNA design 2.2 <400> 10 gacaggcuga gggagauggu caaccuagca gccucaguua ggcugcucuc cggauggagc 60 guggcuucga augccacgcc ugucacca 88 <210> 11 <211> 88

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.3 <400> 11 gccagccuga gggagauggu caaccuagcc agcucaguua gcuggcucuc cggauggagc 60 guggcuucga augccacggc uggcacca 88 <210> 12 <211> 88

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.4 <400> 12 ggcagccuga gggagauggu caaccuagca gccucaguua ggcugcucuc cggauggagc 60 guggcuucga augccacggc ugccacca 88 <210> 13

V

PAT 1612 LU -28- LU100734 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.5 <400> 13 gccagccuga gggagauggu caaccuaggu gccucaguua ggcaccucuc cggauggagc60 guggcuucga augccacggc uggcacca88 <210> 14 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.6 <400> 14 gccagccuga gggagauggu caaccuacug gacucaguua guccagucuc cggauggagc60 guggcuucga augccacggc uggcacca88 <210> 15 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> tRNA design 2.7 <400> 15

PAT 1612 LU -29- LU100734 gccagccuga gggagauggu caaccuaccg gacucaguua guccggucuc cggauggagc 60 guggcuucga augccacggc uggcacca 88 <210> 16 <211> 88 <212>

RNA <213>

Artificial Sequence <220> <223>

tRNA design 2.8 <400> 16 gccagccuga gggagauggu caaccuaccu gccucaguua ggcaggucuc cggauggagc 60 guggcuucga augccacggc uggcacca 88 <210> 17 <211> 88 <212>

RNA <213>

Artificial Sequence <220> <223>

tRNA design 2.9 <400> 17 gccaggcuga gggagauggu caaccuagcu cacucaguua gugagcucuc cggauggagc 60 guggcuucga augccacgcc uggcacca 88

<210> 18 <211> 72 <212> RNA <213> Homo sapiens

PAT 1612 LU -30- LU100734 <220>

<223> tRNA

Ala-AGC <400> 18 ggggaauuag cucaaauggu agagcgcucg cuuagcaugc gagagguagc gggaucgaug 60 cccgcauucu cc 72 <210> 19 <211> 79 <212>

RNA <213>

Artificial Sequence <220> <223>

tRNA design 3.1 <400> 19 ggggaauuag cucaaauggu agagcgcucg cuuugcucaa ugcgagaggu agcgggaucg 60 augcccgcau ucuccacca 79 <210> 20 <211> 78 <212>

RNA <213>

Artificial Sequence <223>

tRNA design 3.2 <400> 20 ggggaauuag cucaaauggu agagcgcucg cuugcucaau gcgagaggua gcgggaucga 60 ugcccgcauu cuccacca 78 <220>

PAT 1612 LU

V -31 - LU 100734 <210> 21 <211> 78

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 3.3 <400> 21 ggggaauuag cucaaauggu agagcgcucg cuuugcucau gcgagaggua gcgggaucga 60 ugcccgcauu cuccacca 78 <210> 22 <211> 78

<212> RNA <213> Artificial Sequence <220> <223> tRNA design 3.4 <400> 22 ggggaauuag cucaaauggu agagcgcucg cuuugcucaa gcgagaggua gcgggaucga 60 ugcccgcauu cuccacca 78 <210> 23 <211> 78

<212> RNA <213> Artificial Sequence <220>

PAT 1612 LU -32- LU100734

<223> 2x3nt anticodon tRNA based on Ala tRNA <220> <221> misc_feature <222> 5..7 <223> /note="A, C, G or U, or any modified base" <220> <221> misc_feature <222> 16..17 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 27..31 <223> /note="A, C, G, or u, or any modified base <220> <221> misc_feature <222> 41..45 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 47 <223> /note="A, C, G, or U, or any modified base <220> <221> misC—feature <222> 49 <223> /note="A, C, G, or u, or any modified base <220> <221> mise feature <222> 51..54 <223> /note="A, C, G, or U, or any modified base <220> <221> mise feature

PAT 1612 LU y -33- LU100734 <222> 64..70 <223> /note="A, C, G, or U, or any modified base" <400> 23 ggggnnnuag cucagnnggu agagcgnnnn ncuugcucaa nnnnnangnc nnnnguucga 60 uccnnnnnnn cuccacca 78 <210> 24 <211> 74

<212> RNA <213> Artificial Sequence <220> <223 > 2x3nt anticodon tRNA based on Ala tRNA without CCA tail <220> <221> misc_feature <222> 5..7 <223> /note="A, C, G or U, or any modified base" <220> <221> misc_feature <222> 16..17 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 27..31 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 41..45 <223> /note="A, C, G, or U, or any modified base <220>

PAT 1612 LU -34- LU100734 <221> misc_feature <222> 47 <223> /note="A, C, G, or U, or any modified base <220> <221> mise feature <222> 49 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 51..54 <223> /note="A, C, G, or U, or any modified base <220> <221> misc_feature <222> 64..70 <223> /note="A, C, G, or U, or any modified base <400> 24 ggggnnnuag cucagnnggu agagcgnnnn ncuugcucaa nnnnnangnc nnnnguucga 60 uccnnnnnnn cucc 74

Claims (8)

A synthetic transfer RNA comprising an extended anticodon loop having two contiguous anticodon base triplets capable of base pairing with two consecutive codon base triplets on an mRNA, the first anticodon base triplet or the second anticodon base triplet in is able to base pair with a stop codon base triplet on the mRNA. The synthetic transfer RNA of claim 1, wherein the anticodon loop consists of 9 or 10 nucleotides. The synthetic transfer RNA of claim 1 or 2, wherein the transfer RNA is aminoacylated. The synthetic transfer RNA of claim 3, wherein the transfer RNA is aminoacylated with a dipeptide. Synthetic transfer RNA according to one of the preceding claims, wherein the synthetic transfer RNA a) has or comprises one of the sequences according to SEQ ID NO: 03-07, 09-17 or 19-23, or b) a sequence with at least 90 %, preferably at least 95%, 96%, 97%, 98% or 99% sequence identity with one of the sequences according to SEQ ID NO: 03-07,09-17 or 19-23 has or comprises, or c) a sequence according to one SEQ ID NO: 03-07, 09-17 or 19-23, wherein at least one of the nucleotides is replaced, has, or comprises a corresponding modified nucleotide. Synthetic transfer RNA according to any one of the preceding claims for use as a medicament. Synthetic transfer RNA according to any one of claims 1 to 5 for use as a medicament in a disease caused, at least in part, by a nonsense mutation leading to premature termination of translation of an mRNA. Synthetic transfer RNA according to any one of claims 1 to 5 for use as a medicament for the treatment of cystic fibrosis, Duchenne muscular dystrophy or type 1 neurofibromatosis.