LU100521B1 - Improved biotechnological production of L-tryptophan - Google Patents
Improved biotechnological production of L-tryptophan Download PDFInfo
- Publication number
- LU100521B1 LU100521B1 LU100521A LU100521A LU100521B1 LU 100521 B1 LU100521 B1 LU 100521B1 LU 100521 A LU100521 A LU 100521A LU 100521 A LU100521 A LU 100521A LU 100521 B1 LU100521 B1 LU 100521B1
- Authority
- LU
- Luxembourg
- Prior art keywords
- ala
- leu
- igps
- gly
- ser
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01048—Indole-3-glycerol-phosphate synthase (4.1.1.48)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
- C12P13/227—Tryptophan
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the biotechnological production of tryptophan and derivatives thereof. The invention provides means for an enhanced microbial L-tryptophan synthesis. In one aspect the invention provides a bacterial cell being genetically modified to express an indole-3- glycerol phosphate synthase, IGPs, the IGPs being less sensitive to inhibition or even being acitiavted by anthranilate compared to the wild type IGPs of the bacterial cell.
Description
IMPROVED BIOTECHNOLOGICAL PRODUCTION OF L-TRYPTOPHAN
DESCRIPTION
The invention relates to the biotechnological production of tryptophan and derivatives thereof. L-tryptophan (L-trp) is a nutritionally essential amino acid widly used in food and pharmaceutical industry. L-trp can also serve as a key precursor for the biosynthesis of diverse biologically active secondary metabolites [1] and antitumor drugs such as violacein and deoxyviolacein [2^4], opening up new possibilities for the biosynthesis of high-value L-trp-based therapeutics. Currently, biotechnological processes, e.g. a microbial synthesis, are often used for producing L-trp on an industrial scale.
In microorganisms tryptophan is produced from chorismate, the end product of the shikimate pathway (shikimic acid pathway). From chorismate, tryptophan is biosynthesized via anthranilate (ANT), phosphoribosylanthranilate (PRA or PA), carboxyphenylamino-deoxyriboluse-5-phosphate (CdRP), indole-3-glycerol phosphate (IGP) and indole. The enzymes involved are anthranilate synthase (EC 4.1.3.27) encoded by the trpE gene, anthranilate phosphoribosyltransferase (EC 2.4.1.28) encoded by the trpD gene, phosphoribosylanthranilate isomerase (EC 5.3.1.24, PRAi) and indole-3-glycerol phosphate synthase (EC 4.1.1.48, IGPs) encoded by the trpC gene, and tryptophan synthase (EC 4.2.1.20) encoded by the trpB and trpA gene. The genes are clustered on the trp operon. TrpC (IGPs) has the activity of phosphoribosylanthranilate isomerase (PRAi) and indole-3-glycerol phosphate synthase (IGPs).
There have been several attempts in the prior art to improve microbial L-tryptophan synthesis. Overexpression of the entire trp operon did not increase productivity but only led to accumulation of anthranilate, the first intermediate in the metabolic chain (Lee KH et al [12]). EP 2803720 A2 suggests the partial overexpression of the trp operon, specifically, overexpression of trpD, trpC, trpB, and trpA, but not trpE. Another known approach is the expression of a yeast phosphoribosyl anthranilate transferase in E. coli (US 2016/0153014 Al).
There is still a need, however, to further improve the biotechnological L-tryptophan production. It is therefore an object of the invention to provide means for an enhanced microbial L-tryptophan synthesis.
In a first aspect the invention provides a bacterial cell being genetically modified to express an indole-3-glycerol phosphate synthase, IGPs, the IGPs being less sensitive to inhibition by anthranilate compared to the wild type IGPs of the bacterial cell.
The invention is based on the surprising finding that microbial indole-3-glycerol phosphate synthase (IGPs), e.g. IGPs from Escherichia coli, is sensitive to inhibition by anthranilate. Since anthranilate is an intermediate in the synthesis pathway from chorismate to L-tryptophan, which is synthesized before IGPs is involved, this type of inhibition will also be termed “feed-forward inhibition”. The inventors have found that previous approaches for enhancing tryptophan productivity may habe been unsuccessful or unsatisfactory because this feed-forward inhibition mechanism has not been considered before. The present invention, however, solves the problem by taking into account the negative regulation of IGPs by anthranilate. By using an IGPs or an enzyme having IGPs activity, which is less sensitive to inhibition by anthranilate than the wildtype enzyme of the bacterial cell, the tryptophan productivity can be considerably improved.
The term "heterologous" is used herein in its meaning known to those skilled in the art, and refers to the foreign origin of an element, for example an enzyme or other protein. "Foreign" means that the element thus does not occur in the target cell, and for example originates from a cell or an organism with different genetic makeup, such as an organism of a different species.
The term "homologous" is used herein with respect to an enzyme or protein to refer to it as a native enzyme or protein, i.e an enzyme or protein naturally occurring in the target cell, in contrast to a heterologous enzyme or protein.
By "expression" is meant here the conversion of a genetic information into a product, for example the formation of a protein or a nucleic acid on the basis of the genetic information. In particular, the term encompasses the biosynthesis of a protein based on genetic information including previous processes such as transcription, i.e. the formation of mRNA based on a DNA template.
The term “bacterial cell genetically modified to express an indole-3-glycerol phosphate synthase” relates to a bacterial cell, which is genetically engineered, such that an indole-3-glycerol phosphate synthase is expressed, i.e. produced, in the cell. The term “indole-3-glycerol phosphate synthase” (IGPs) relates to an enzyme having IGPs (EC 4.1.1.48) activity, i.e. the enzymatic activity of catalyzing the conversion of carboxyphenylamino-deoxyriboluse-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP). The term encompasses a bi- or multifunctional enzyme having, besides IGPs activity, one or more other activities, e.g. PRAi activity.
The term “less sensitive to inhibition by anthranilate” in relation to a first enzyme compared to a second enzyme means that the enzymatic activity of the first enzyme is higher than the enzymatic activity of the second enzyme in the presence of a given concentration of anthranilate and under similar conditions (e.g. temperature, pH, salt concentration etc.), in relation to the same enzymatically catalyzed reaction.
The term “mutated variant” in relation to a protein, e.g. an enzyme, relates to a protein or enzyme having a different amino acid sequence compared to the wildtype protein or enzyme. The term encompasses a protein having an altered amino acid sequence in comparison to the wildtype protein as a result of a mutation in the gene encoding the protein.
The term “heterologous enzyme having IGPs activity” relates to a heterologous enzyme having an enzymatic activity of an indole-3-glycerol phosphate synthase. The enzyme may also have one or more other enzymatic activities, e.g. phosphoribosylanthranilate isomerase (PRAi) activity or anthranilate synthase activity.
The term “anthranilate synthase II domain ” or “AS II domain” relates to component II of the multifunctional enzyme anthranilate synthase comprising glutamine amidotransferase activity. Anthranilate synthase activity catalyzing the formation of anthranilate from chorismate could be provided by anthranilate synthase component I or component II. Component I uses ammonia rather than glutamine, whereas component II provides glutamine amidotransferase activity.
In a preferred embodiment of the invention the bacterial cell of the invention is genetically modified to express a) a mutated variant of a bacterial IGPs, the mutated IGPs variant being less sensitive to inhibition by anthranilate compared to the wild type IGPs of the bacterial cell, or b) a heterologous enzyme having IGPs activity, the enzyme being less sensitive to inhibition by anthranilate compared to the wild type IGPs of the bacterial cell.
The inventors have found that bacterial IGPs has a anthranilate binding domain binding anthranilate with the result that the enzymatic conversion of phosphoribosylanthranilate (PRA or PA) via carboxyphenylamino-deoxyriboluse-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP) catalyzed by IGPs is noncompetetively inhibited by anthranilate, and that the bacterial IGPs can be engineered in order to make them less sensitive to inhibition by anthranilate. The invention thus provides mutated variants of a bacterial IGPs, the mutated IGPs variants being less sensitive to inhibition by anthranilate in comparison to the wild type IGPs of the bacterial cell.
In a preferred embodiment, the bacterial cell of the invention expresses a mutated variant of a bacterial IGPs, which is homologous to the genetically modified bacterial cell. Preferably, the genetically modified bacterial cell is an E. coli cell expressing a mutated variant of the E.-coli IGPs.
Alternatively, the bacterial cell of the invention may be genetically modified to express a heterologous enzmye having IGPs activity, but being less sensitive to inhibition by anthranilate compared to the wild type IGPs of the bacterial cell. The inventors have found that some enzymes from non-bacterial species, e.g. from Saccharomyces or Aspergillus have IGPs activity, but are insensitive to anthranilate or even stimulated by anthranilate. In one embodiment of the invention, the bacterial cell of the invention is thus genetically modified in that it expresses such a heterologous enzyme having an IGPs activity, but being insensitive to and/or stimulated by anthranilate, e.g. an enzyme having an anthranilate synthase II domain, for example an enzyme from a Saccharomyces or Aspergillus species, especially preferred from Saccharomyces cerevisiae or Aspergillus niger.
In a further preferred embodiment the mutated variant of a bacterial IGPs has, compared to the wild-type bacterial IGPs, at least one amino acid replaced with a different amino acid in the anthranilate binding site of the bacterial IGPs, with the proviso that the mutated variant still has IGPs activity and is less sensitive to inhibition by anthranilate in comparison to the non-mutated IGPs, i.e. the wild type IGPs.
In a further preferred embodiment of the invention the mutated variant of a bacterial IGPs has a) adenine or guanine at position 60 instead of serine, and/or valine at position 8 instead of isoleucine, and/or phenylalanine at position 188 instead of leucine, compared to the sequence of SEQ ID NO: 1, or b) the sequence of SEQ ID NO: 1, with the exception that at least one of the amino acids at positions 8 to 188 is replaced with a different amino acid, with the proviso that the mutated IGPs variant has IGPs activity and is less sensitive to inhibition by anthranilate compared to the wild type IGPs having the sequence of SEQ ID NO: 1.
In a preferred embodiment the mutated variant of a bacterial IGPs has the sequence of one of SEQ ID NO: 2 to SEQ ID NO: 5.
Preferably the genetically modified bacterial cell is an Escherichia coli cell.
The wild-type sequence of E. coli IGPs (EcTrpC) is presented in SEQ ID NO: 1. Mutated versions of E. coli IGPs are given in SEQ ID NO: 2 (18V), SEQ ID NO: 3 (S60A), SEQ ID NO: 4 (S60G) and SEQ ID NO: 5 (L188F). The wild-type sequence of ScTrpC is given in SEQ ID NO: 6, and the wild-type sequence of AgTrpC is given in SEQ ID NO: 7.
In a second aspect the invention also relates to an isolated or synthetic enzyme having the sequence of one of SEQ ID NO: 2 to SEQ ID NO: 5.
In a third aspect the invention relates to a method for the biotechnological production of L-tryptophan, comprising the steps of growing a genetically modified bacterial cell according to the first aspect of the invention in a suitable growth medium in a bioreactor.
Preferably, the genetically modified bacterial used in the method of the invention is an Escherichia coli cell.
In a still further aspect the invention relates to the use of a bacterial cell according to the first aspect of the invention or an enzyme according to the second aspect of the invention, for the production of L-tryptophan, preferably for the production of L-tryptophan in an industrial scale in a bioreactor.
In the following, the invention will be described in further detail by way of example only with reference to the accompanying figures.
Figure 1. Scheme of the biosynthesis of L-trp from chorismate in E. coli.
Figure 2. Effect of anthranilate on eIGPS activity. Anthranilate inhibits eIGPS enzyme activity (a) and shows a noncompetitive inhibition of eIGPs (b).
Figure 3. Effects of anthranilate on the activities of the wild-type and mutant eIGPs.
Figure 4. The gene types (top) and the fermentation results (bottom) of the four strains S028/ptrpE(S40F), S028TC/ptrpE(S40F), S028/ptrc99A, and S028TC/ptrc99A. (a) Growth, (b) glucose consumption, (c) accumulation of dehydroshikimate (DSA), (d) accumulation of shikimate (SA), (e) ammonium ion consumption, (f) L-trp production, (g) L-tyr formation, and (h) L-phe formation. The induction was carried out at 3 h of the fermentation time by adding 0.2 mM IPTG
Figure 5. Production and specific formation rates of Trp, anthranilate, Phe, and Tyr during batch fermentation of the strains S028/ptrpE(S40F) and S028TC/ptrpE(S40F). TP1 to TP6 are respectively corresponded to the fermentation time period 3-8.5, 8.5-14.5, 14.5-22.5, 22.5-27.5, 27.5-33, and 33-37.5h.
Figure 6. The specific production rates of L-trp of the strains S028/ptrc99A (black bar) and S028TC/ptrc99A (white bar) during the batch fermentation in shake flasks. See Figure 5 for TP1 to TP6.
Figure 7. Feed-forward regulation of the activity of indole glycerol phosphate synthase in TrpC by anthranilate. EcTrpC, TrpC from E. coli, is subjected to negative feed-forward regulation by anthranilate while ScTrpC and AgTrpC, TrpC from Saccharomyces cerevisiae and Aspergillus niger, respectively, are positively regulated by anthranilate.
Figure 8. Effects of anthranilate on the activities of ScTrpC and ScIGPs (ScIGPs = ScTrpC without anthranilate synthase II domain).
Figures 9 to 11. Maps of plasmids pAgTrpC, pEcTrpC, and pScTrpC.
As shown in Figure 1, L-trp is biosynthesized from chorismate, which is a common precursor for the biosynthesis of other two aromatic amino acids, namely L-phenylalanine (L-phe) and L-tyrosine (L-tyr). In Escherichia coli L-trp is biosynthesized from chorismate by the action of five enzymes encoded by the genes trpEDCBA organized as the trp operon. Previous studies showed that the trp operon is strictly regulated by feedback inhibition, repression, and attenuation through the end-product L-trp [7-10]. Biosynthesis of L-trp involves six reactions catalyzed by five enzymes: TrpE, TrpD, TrpC, TrpA, and TrpB. The bifunctional TrpC has phosphoribosylanthranilate isomerase (PRAi) and indole-3-glycerol phosphate synthase (IGPs) activity. Chorismate is first converted to anthranilate (ANT) by anthranilate synthase (EC
4.1.3.27) encoded by the trpE gene, which subsequently is converted to phosphoribosylanthranilate (PRA or PA) by anthranilate phosphoribosyltransferase (EC 2.4.1.28) encoded by the trpD gene. PRA is converted to carboxyphenylamino-deoxyriboluse-5-phosphate (CdRP) by phosphoribosylanthranilate isomerase (EC 5.3.1.24, PRAi) and CdRP is converted to indole-3-glycerol phosphate (IGP) by indole-3-glycerol phosphate synthase (EC 4.1.1.48, IGPs). Both reactions are catalyzed by the gene product of trpC. IGP is converted to Indole and subsequently to L-tryptophan by tryptophan synthase (EC 4.2.1.20) encoded by the trpB and trpA gene.
Plasmids and strain construction
The plasmids and strains used in this study are tabulated in Table 1.
Table 1. Plasmids and strains used in this study.
Designation Description
Plasmids: pTrc99A Vector with trc promoter [20]
ptrpE(S40F) pTrc99A inserted with the trpES40F gene under the trc promoter pET-elGPs(WT) pET22(b) vector inserted with the encoding gene for eIGPs-6His póHTrpC pTrc99A inserted with the encoding gene for 6His-TrpC p6HeIGPs pTrc99A inserted with the encoding gene for 6His-eIGPs
Strains: S028 An L-trp production strain [11] S028TC The wildtype trpC gene replaced by the mutant trpCS60A in S028
The primers used in this study are listed in Table 2.
Table 2. Primers
Primers Sequence
Smal-trpE ttgttcccgggtataaaggaggccatccatgcaaacacaaaaaccgactc (SEQ ID NO: 8) trpE-Xbal gcagaatctagatcatcagaaagtctcctgtgcatg(SEQ ID NO: 9) trpC-ΟΙ gcgctacagggtgcgcgcacggcgtttattctggagtgcaagaaagcgtcgttgacagctagctcagtcc (SEQ ID NO: 10) trpC-O2 gatgccggattcgctgattaccgtcacgttgtgccccagtttcggcgcaaatttgatgcctgggcatgcg (SEQ ID NO: 11) trpC-INF atgcaaaccgttttagcgaa (SEQ ID NO: 12) trpC-INR caaatcgtcatgggccatca (SEQ ID NO: 13)
Ndel-eIGPs gcaacgcatatgcaaaccgttttagcgaaaatcgtcg (SEQ ID NO: 14) eIGPs-XhoI agtcgcctcgagtactttattctcacccagcaacacc (SEQ ID NO: 15)
EcoRI-6H-trpC cggcgcgaattcagaaggagatatacatatgcaccaccaccaccaccaccaaaccgttttagcgaaaatcgtcg (SEQ ID NO: 16) trpC-Xbal agcgtctctagacttaatatgcgcgcagcgt (SEQ ID NO: 17) eIGPs-Xbal agcgtctctagacttatactttattctcacccagcaacacc (SEQ ID NO: 18)
The tryptophan resistant gene trpES40F in the strain E.coli S028 (Table 1) was amplified with primers Smal-trpE and TrpE-Xbal (Table 2) and subcloned into the vector pTrc99A (Table 1) at the sites Smal and Xbal resulting in the plasmid ptrpE(S40F) (Table 1). The ORF of eIGPs (eIGPs, the IGPs in E. coli TrpC, EcTrpC) was isolated from the trpC gene in E. coli S028 with primers Ndel-eIGPs and eIGPs-XhoI (Table 2). It was then inserted into the vec-tor pET22(b) at the sites Ndel and Xhol, generating the plasmid pET-elGPs(wt). The theoretical peptide encoded by the isolated gene contains the first 259 residues of TrpC and a tag LGHHHHHH at the C-terminus for purification. The mutants of eIGPs were generated by using a typical pair of mutagenic primers (Table 2) to amplify the whole plasmid pET-elGPs(WT). Those plasmids were named as pET-eIGPs(I8V), pET-eIGPs(I8A), pET-eIGPs(S60A), pET-eIGPs(S60G), pET-eIGPs(L188A), and pET-eIGPs(L188F), respectively. The plasmid p6HTrpC is constructed by inserting the PCR products amplified from E. coli S028 with primers EcoRI-6H-trpC and trpC-Xbal (Table 2) into the plasmid pTrc99A. The construction of the plasmid p6HeIGPs was done in the same way but with primers EcoRI-6H-trpC and eIGPs-Xbal (Table 2). As a result, the encoded proteins from the plasmid p6HTrpC and p6HeIGPs have 6His-tag at the N-terminus.
To construct the strain S028TC (Table 1), the approach based on selection/counterselection of markers for seamlessly chromosomal modification was implemented with the same procedure as reported previously by Lin et al [11]. The selection/counterselection marker cassette was amplified with primers trpC-ΟΙ and trpC-O2 (Table 2) from the template plasmid pJLK [11], The DNA fragment containing the mutation point (S60A) was amplified from the plasmid pET-eIGPs(S60A) with the primer pair trpC-INF/trpC-INR (Table 2). After recombination and selections, the final variant was confirmed by sequencing.
Cultivation conditions
Batch fermentations were carried out in shake flasks. The seed medium and the fermentation medium are described in [11]. All batch fermentations were carried out at 37°C and 250 rpm. An isolated colony was inoculated into 5 mL LB medium in the conical tube (50 mL) and grown overnight as preculture. The preculture was inoculated into 10 mL of seed medium in the baffled shake flask (100-mL) with the initial OD600 = 0.2. After grown for 8-10 hours, the seed culture was inoculated into 30 ml of fermentation medium in 300 mL baffled shake flasks to an initial OD600 = 0.1 in triplicate. After grown for 3 hours (OD600 was about 0.9), 0.2 mM IPTG was added into for induction. In all the cultivations, 100 pg/mL ampicillin was supplemented.
Docking study
The complex of eIGPs with IGP was built up by duplicating the conformation of IGP from mIGPs (Mycobacterium tuberculosis IGPs) to eIGPs with the computer program UCSF Chimera [21]. The research of flexible ligand docking to the rigid receptor was carried out with AutoDock Vina [22] integrated in Chimera.
Expression and purification of eIGPs
The plasmids pET-elGPs(wt) and those containing the mutant of eIGPs were transformed into the host E. coli BL21. The plasmids póHTrpC and p6HeIGPs were transformed into the host E. coli ToplO. Overnight cultures grown at 37°C from isolated colonies were diluted 50-fold in 50 mL LB medium in shake flasks (300 mL). After grown at 37°C, 220 rpm to OD600 is about 0.6, inductions were started by adding 0.5 mM IPTG and then grown at 20°C, 220 rpm for 12-16 h. After cooling down on ice for 30 min, the cells were harvested by centrifugation at 4°C, 5000 rpm and washed once with 30 mL binding buffer (20 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 7.4). The pellets were resuspended in 3 mL of binding buffer and disrupted through the multidirectional, simultaneous beating of specialized lysing matrix beads on them with the FastPrep®-24 instrument. The samples were then centrifuged at 4°C, 13000 rpm for 20 min. The targeted proteins were purified from the supernatants with prepacked His SpinTrap columns (GE Healthcare) with the user guide and eluted in 400 μΐ elution buffer (20 mM sodium phosphate, 500 mM NaCl, 500 mM imidazole, pH 7.4). The elution buffer was subsequently changed into the HEPPS buffer (50 mM HEPPS pH 7.5, 4 mM EDTA) for enzyme assay by using the Amicon® Ultra-0.5 Centrifugal Filter Devic-es at 4°C.
Enzymes assay of IGPs
The activity of IGPs from E. coli was measured by monitoring the formation of IGP via absorbance at 278 nm [23] with a molar extinction coefficient value of 5500 M1 cm'1 [24]. Assays were performed in 50 mM HEPPS pH 7.5, 4 mM EDTA at 30°C with 20-25 pg/mL of purified enzymes in cuvettes. To investigate the effect of anthranilate on the activity of IGPs, the activities were measured in the presence of different concentrations of anthranilate. Unless stated otherwise, the reactions were started by adding 180 μΜ of the substrate CdRP. The synthesis of CdRP was performed by following the improved method reported by Kirschner et al. [24]. The concentration of the synthesized CdRP in the stock solution was determined by measuring the concentrations of the product IGP with completely converted reactions.
Analytical methods
The quantification of glucose, 3-dehydroshikimate (DSA), and shikimate (SA) was determined by HPLC as reported in [25, 26]. The determination of L-trp was carried out by using a sensitive spectrophotometric method [27]. Other amino acids, ammonium, and anthranilate were quantified by HPLC after the derivatization with 6-Aminoquinolyl-N-Hydroxysuccinimidyl carbamate (Waters AccQ, Flour Reagent kit, USA) as reported by da Luz et al [25],
Structure-based studies of the potential anthranilate binding site in eIGPs A series of crystal structures of IPGs have been solved, including the crystal structure of mIGPs in complex with the product IGP and anthranilate (PDB ID: 3T44), the complex of IGPs with IGP from Sulfolobus solfataricus (sIGPs, PDB ID: 1A53) [28], and E. coli TrpC (PDB ID: 1PII) [29]. The crystal structure of mIGPs in complex with the product IGP and anthranilate shows that the residues involved in the anthranilate binding site are located in a helix and three loops forming a ‘gate’. Anthranilate binds to IGPs and interacts with the product IGP by non bonded contacts that may prevent the product IGP being released from the catalytic site. The secondary structures are quite conserved among the sequences of sIGPs, mIGPs, and eIGPs, although very much low identities were found among them (the identities between them are less than 30%). It was found that the residues involved in the binding site of anthranilate in mIGPs are 100 % conserved in mIGPs and eIGPs. All three IGPs are (beta/alpha)8 barrel proteins, and almost all beta/alpha-structures are precisely aligned. Compared to eIGPs, one and two additional helices are inserted before the first beta strand of sIGPs and mIGPs, respectively. However, the active sites are highly conserved among them. The binding of anthranilate could make the product IGP bind more tightly at the active site because the indole ring of IGP is a little closer to the bottle of the barrel in mIGPs than in sIGPs (not shown).
To figure out whether there is a potential binding site of anthranilate in eIGPs, a docking study was carried out. The results showed that anthranilate can be docked into the complex of eIGPs with IGP. The top three docked anthranilates appear to be face to face with IGP (not shown). Whereas the benzoic rings of all the top five anthranilates docked to the complex of mIGPs with IGP, together with the reference one, are on the same surface which appears to be perpendicular to the surface of the indole group in IGP (not shown). Among them, the highest score of the docking results of anthranilate to mlGPs(IGP) and elGPs(IGP) are 7.5 and 6.5, respectively. The comparable score may suggest a high probability that anthranilate can bind to eIGPs. Combined with the fact that the residues involved in binding anthranilate in mIGPs are 100 % conserved in eIGPs and sIGPs, these results suggest that the anthranilate binding sites of eIGPs and mIGPs are the same. However, the configurations of the involved residues may be adjusted upon binding of anthranilate.
Anthranilate noncompetitively inhibits the activity of eIGPs
To elucidate the effect of anthranilate on the enzyme activity of eIGPs, the catalytic activity of the isolated eIGPs (eIGPs-6His) was examined in the presence of different concentrations of anthranilate. The plot of the eIGPs activity against anthranilate showed that the activity was significantly decreased with the increase of anthranilate concentration (Fig 2a). It was revealed that 46% of the activity of eIGPs can be inhibited by 0.5 mM anthranilate and more than 70% of activity is lost in the presence of 2 mM of anthranilate. The inhibition constant (IC50, 50 % inhibitory concentration) of eIGPs-6His was measured to be about 0.70 mM. E. coli TrpC has two distinct but covalently linked domains (the PRAi domain and the IGPs domain), each having distinguished activity catalyzing one of the reactions illustrated in Fig. 1. However, in many other organisms, IGPs exists as single chain enzyme [6]. Previous study showed that the PRAi domain may facilitate stabilizing the IGPs domain [30]. In order to figure out whether the PRAi domain has an influence on the inhibition resistance of eIGPs, the effect of anthranilate on the activity of IGPs in the form of eIGPs-PRAi (6His-TrpC) was tested. Considering the preciseness of the experiment, the isolated form 6His-eIGPs had been taken as a reference. The results show that the activity of eIGPs is notably inhibited by anthranilate either in the form of 6His-TrpC or in the form of 6His-eIGPs (Fig 2a). The IC50 of 6His-eIGPs for anthranilate was estimated to be about 0.4 mM, while it is about 1.3 mM for 6His-TrpC. It can be concluded that the PRAi domain may assist the IGPs against the inhibition by anthranilate.
To identify the mechanism of the inhibition of eIGPs by anthranilate, the effect of the inhibitor on the Michaelis constants of eIGPs was investigated with 6His-TrpC. Various concentration of CdRP (from 2.6 to 260 μΜ) were used when the reactions carried out in the absence of anthranilate and in the presence of 0.5 mM anthranilate, respectively. The Lineweaver-Burk plot shows that the inhibitor anthranilate reduces the Vmax but almost has no effect on the Km (Fig 2a). From the linear fit functions, the values of Vmax and Km were calculated to be 3.64 vs 2.63 pmol/min/mg and 1.57 vs 1.53 μΜ, respectively, with no anthranilate and with 0.5 mM of anthranilate. It suggests that anthranilate is a noncompetitive inhibitor of eIGPS. It is somewhat consistent with the fact that anthranilate has a distinguished binding site from the catalytic site based on the crystal structure analysis [19].
Mutational analysis of the anthranilate binding site of eIGPs
It was hypothesized that the observed failure to increase the production yield of L-trp by enhancing the trp operon [12] was caused by a feed-forward inhibition of IGPs due to accumulation of anthranilate. To test this hypothesis, the wild-type IGPs in the trp operon was replaced with an anthranilate-resistant mutant having mutations in the potential anthranilate binding site. To this end, structure-based approaches were used to guide the engineering of anthranilate-resistant IGPs. Since the N-terminal His-tag is too close to the binding site that somehow might affect the inhibition study as shown above as well as 6His-eIGPs has much poorer solubility than eIGPs-6His (data not show). All the mutational analysis was carried out based on eIGPs-6His.
The residues involved in the anthranilate binding site are highly conserved between eIGPs and mIGPs. A list of residues and the respective positions in elGP and mIGP are given in Table 3.
Table 3. Examples of conserved residues and their respective positions in the anthranilate binding sites of eIGPs and mIGPs.
Amino acid Position in eIGPs Position in mIGPs I 810 S 5862 P 5963 S 6064 F 9398 R 186191 L 188193 L 191196
Among them, the three residues 18, S60, and LI 88 were chosen as candidates. A series of single point mutations based on these residues were generated by using non-complementary mutagenic primers (Table 4).
Table 4. Mutagenic primers.
Primers Sequence eIGPs-I8X-F gcagacaaggcgatttgggtag (SEQ ID NO: 19) eIGPs-I8A-R gacggctttcgctaaaacggtttgcat (SEQ ID NO: 20) eIGPs-I8V-R gacgactttcgctaaaacggtttgcat (SEQ ID NO: 21) eIGPs-S60A_F gcaaaaggcgtgatccgtgat (SEQ ID NO: 22) eIGPs-S60A_R cggcgacgctttcttgcact (SEQ ID NO: 23) eIGPs-S60G_F tcgccgggaaaaggcgtgatccgtgatg (SEQ ID NO: 24) eIGPs-S60G_R cgctttcttgcactccaga (SEQ ID NO: 25) eIGPs-L188A_R atcgcggttgttgatgccaac (SEQ ID NO: 26) eIGPs-L188A_F gcgcgtgatttgtcgattga (SEQ ID NO: 27) eIGPs-L188F_R gttgttgatgccaacgacc (SEQ ID NO: 28) eIGPs-L188F_F cgcgattttcgtgatttgtcgattgatctcaacc (SEQ ID NO: 29) SDS-PAGE analysis showed that all the mutants, especially I8V, have poorer solubility than the wild-type eIGPs (data not shown). The sensitivity of mutant I8A to anthranilate was significantly reduced but it has very low activity and solubility (data not show). While the mutant L188A has no detectable activity under the same condition. Therefore, the effect of anthranilate on the activity of this mutants was not investigated. Enzyme inhibition study on other mutants showed that all of them are less sensitive to anthranilate than the wild-type eIGPs (Fig 3). Among them, the anthranilate resistance of the mutants I8V and L188F were slightly increased while it was significantly improved for the mutants S60A and S60G. In the presence of 2 mM of anthranilate, only 20% and 46% of the activities of the mutants S60G and S60A were inhibited while 70% of activity of the wild type was lost (data not shown). The IC50 of mutant S60A was measured to be about 2.0 mM, which is about 3 times as much as that of the wild-type eIGPs. These results suggest that the residues 18, S60, and LI 88 are involving in the potential binding site of anthranilate of eIGPs.
Among these mutants, S60A has the highest specific activity, but it is lower than that of the wild type in the absence of anthranilate (Table 5).
Table 5. Specific activities of wild-type and mutant eIGPs. The concentration of CdRP was determined from the converted IGP with a molar extinction coefficient value of 5500 M1 cm'1 [24]. The data are presented as average value ± standard deviation, — enzyme assays were not carried out.
CdRP/μΜ Specific activity (pmol/min/mg) in the absence of anthranilate.
WT I8V S60A S60G L188F 180 2.46±0.09 0.90±0.03 2.13±0.01 1.92±0.02 1.04±0.02 60 2.54±0.11 - 2.05±0.06 1.75±0.03 18 2.17±0.03 - 1.60±0.03 1.13±0.02
The specific activities of both S60A and S60G were higher than that of the wild type in the presence of more than 0.1 mM of anthranilate and with 180 μΜ of CdRP. It was reported that the efficiency (Kcat/Km) of the mutant S60A was only about 30% of that of the wild-type enzyme in the two-domain form due to the decreased affinity of the substrate [31]. The lower catalytic efficiency was also found in the single-domain form as shown in Table 5. In the presence of 18 μΜ CdRP and in the absence of anthranilate, the activities of the mutants S60A and S60G are only 74 and 52 % of that of the wild-type enzyme (data not shown). The rates of increased absorbance (data not shown) suggested that S60G held the largest Km among these three enzymes.
Impact of anthranilate-resistant eIGPs on L-trp production
In order to demonstrate the inhibition of eIGPs by anthranilate in vivo and to explore whether an anthranilate-resistant eIGPs is better for L-trp production as anthranilate is accumulated, it’s necessary to construct a recombinant strain containing anthranilate-resistant eIGPs. As presented above, the mutant S60A has the highest catalytic efficiency among the mutants. It also has significantly reduced sensitivity to anthranilate compared to the wild-type eIGPs. Therefore, we replaced the wild-type gene trpC in the strain S028 with the mutant gene trpCS60A, resulting in the recombinant strain S028TC (Table 1). To accumulate anthranilate intracellularly to the level which could significantly inhibit the activity of IGPs, the first reaction of the trp operon, which converts chorismate to form anthranilate, requires to be enhanced. To this end, the availability of the feedback-inhibition-resistant anthranilate synthase (TrpES40F) was increased by overexpressing the gene trpES40F with the plasmid ptrpE(S40F) (Table 1). The plasmid ptrpE(S40F) was introduced into the strains S028 and S028TC, generating the strains S028/ptrpE(S40F) and S028TC/ptrpE(S40F). In the meanwhile, the reference strains S028/ptrc99A and S028TC/ptrc99A were constructed by introducing the blank vector ptrc99A into the hosts. The differences between these four strains were illustrated in Figure 4.
As shown in Fig. 4a, the strain S028TC/ptrc99A, containing the mutant TrpCS60A which has a lower IGPs activity than that of the wild-type TrpC contained in the strain S028/ptrc99A, showed a higher growth rate and obtained a higher production of biomass. It seemed that the higher growth rate reasonably resulted in the higher glucose consumption rate, however, it reduced the metabolic flux for biosynthesis of L-trp. During the fermentation time from 8.5 to 27.5 h, the glucose consumption rates for the strains S028/ptrc99A and S028TC/ptrc99A were calculated to be 1.06 (R2=0.9764) and 1.47 g/L/h (R2=0.9807), respectively (Fig. 4b). For both of them, the intermediates DSA (Fig. 4c) and SA (Fig. 4d) were notably accumulated during the fermentations. Although the accumulation of the intermediates in the strain S028/ptrc99A was higher than that in the strain S028TC/ptrc99A, the maximal L-trp production of the former strain was much higher (about 1.7 times) than that of the latter one (Fig. 4f). Meanwhile, the strain S028/ptrc99A produced fewer byproducts Tyr (Fig. 4g) and Phe (Fig. 4h) compared to the strain S028TC/ptrc99A. At the end of the fermentation, the sum of all the measurable intermediates (DSA and SA), byproducts (Tyr and Phe) and L-trp for the strain S028/ptrc99A was about 20 mM, while it was about 12 mM for the strain S028TC/ptrc99A. This difference indicated that less metabolic flux was redirected into the chorismate pathway while more metabolic flux was used for cell growth caused by the seriously reduced catalytic efficiency of IGPs in the L-trp branch pathway. It indicated that higher activity of IGPs is essential for achieving higher efficiency of trp operon.
It is notable that nitrogen was exhausted earlier than glucose during the fermentation (Fig. 4b and 4e). And it seems that the L-trp production was limited by nitrogen supply when glucose was not a limitation yet. As shown in 4e, f, g, and h, the nitrogen limitation could stop the L-trp production and trigger the accumulation of the byproducts (Phe and Tyr). NH4 is required for biosynthesis of L-gln which is a substrate for L-trp production. The shortage of NH4 can, therefore, stop the reaction which converts chorismate into the L-trp branch pathway. As a result, the availability of chorismate was increased for biosynthesis of Phe and Tyr. From this point of view, the L-trp production and yield would be improved if the shortage of nitrogen was eliminated. Thus, it is necessary to add more nitrogen source in the newly designed fermentation medium.
Interestingly, it was found that the cell growth was significantly inhibited when the gene trpES40F was overexpressed either in S028 or S028TC, but the reason is unclear. As a result, the glucose consumption rates, as well as the accumulation of the intermediates (DSA and SA) for these two strains were relatively low (Fig. 4a, b, c and d).
As shown in Figure 5a, L-trp production of the strain S028TC/ptrpE(S40F) was much higher than that of the reference strain S028/ptrpE(S40F). It seems that both strains almost stopped producing L-trp after 27.5 h, but the L-trp production (575±33 mg/L) of the strain S028TC/ptrpE(S40F) was significantly higher (57%) than that (366±22 mg/L) of the reference strain at the end of fermentation (37.5h). As expected, intermediate anthranilate was accumulated as a result of the overexpression of the gene trpES40F but it was much serious in the reference strain (Fig. 5b). Not like L-trp, the accumulation of anthranilate kept constantly increasing after the induction. At the end of fermentation, the accumulated anthranilate in the reference strain reached 32.3Ü.3 mg/L, which is 1.4 times higher than that (13.2±3.9 mg/L) of the strain S028TC/ptrpE(S40F). Similarly, much higher concentrations of the byproducts Phe (Fig. 5c) and Tyr (Fig. 5d) were also produced by the reference strain.
Note that the specific production rates of L-trp (qTrp) for both strains kept decreasing while the specific formation rates of anthranilate, Phe, and Tyr kept increasing rapidly after the induction and became, somehow, stable after that. However, the qTrp of the strain S028TC/ptrpE(S40F), which expressed the mutant TrpC(S60A) less sensitive to anthranilate, was higher than that of the reference strain. Since the strain S028/ptrpE(S40F) and S028TC/ptrpE(S40F) showed almost the same growth curve (Fig. 4a), it was assumed that the substrates involved in the L-trp branch and derived from other pathways were supplied in nearly the same amount. Combined with the fact that the activity of eIGPs is inhibited by anthranilate in vitro, these results suggested the inhibition can happen in vivo too. The phenomenon that the increased accumulation of anthranilate, Phe, and Tyr with the stable production of L-trp implied that the activities of IGPs in both strains may be significantly inhibited after 27.5 h.
As shown in Figure 6, the qTrp of the strain S028/ptrc99A was not decreased after the induction when there was no limitation of nitrogen and glucose. While the qTrp of the strain S028TC/ptrc99A was decreased during the fermentation time TP2 (from 8.5 to 14.5 h) when nitrogen and glucose were sufficiently supplied. These indicated that the intracellular concentration of anthranilate in the strain S028/ptrc99A did not reach to the level which can significantly inhibit the activity of IGPs. However, in the strain S028TC/ptrc99A, it may get to the level which can inhibit the IGPs notably, although there was no extracellular anthranilate detected in four-time diluted samples during the fermentation.
The above described structural studies and docking results showed that anthranilate is able to bind to eIGPs. It was shown by the enzyme assay that anthranilate feed-forward inhibits the enzyme activity of eIGPs in a noncompetitive manner. A mutational study of the anthranilate binding site of eIGPs for three of the residues involved (18, S60, and LI 88) showed that single point mutants, especially S60A and S60G, resulted in significantly reduced anthranilate sensitivity. However, all of the mutations of these residues led to a dramatical decline in the enzyme catalytic efficiency. In vivo study showed that the partially anthranilate-resistant mutant of IGPs, S60A, even though it has lower catalytic efficiency, is much more beneficial for producing L-trp than the wild type IGPs when anthranilate is accumulated during the fermentation.
Fungal IGPs having a anthranilate synthase II domain are not inhibited by anthranilate
As shown in Figure 7, TrpC from Saccharomyces cerevisiae and Aspergillus niger, ScTrpC and AgTrpC are activated by anthranilate. Structural analysis show that the positively regulated TrpC (ScTrpC and AgTrpC) contain the anthranilate synthase II domain (AS II domain) while the negatively regulated E. coli TrpC (EcTrpC) do not contain this domain. After removing the anthranilate synthase II domain from ScTrpC, no activation was observed for the resulting ScIGPs (Figure 8). This suggest that the anthranilate synthase II domain is essential for possessing the positive regulation.
Impact of anthranilate-activated TrpC on L-trp production
To investigate the effect of anthranilate-activated TrpC on L-trp production, a trpC defective strain S092 was generated by deleting the trpC gene from tryptophan producing strain S028. Then, EcTrpC, ScTrpC, and AgTrpC were introduced into S092, respectively, in order to obtain recombinant strains S092/pEcTrpC, S092/pScTrpC, and S092/pAgTrpC. Plasmids used are shown in Fig. 9 to 11. Batch fermentations were performed with these three strains in a bioreactor. As summarized in Table 6, both the strains S092/pScTrpC and S092/pAgTrpC have higher tryptophan production and yield than the control strain S092/pEcTrpC. These results suggest anthranilate-activated TrpC benefits tryptophan production.
Table 6. Comparison of tryptophan productivity between the strains having the EcTrpC, ScTrpC and AgTrpC.
Strain Glucose consumed (g) Trp produced (g) Yield (g/g) S092/pEcTrpC#l 16.15 1.070.067 S092/pEcTrpC#2 15.60 1.160.074 S092/pScTrpC 14.60 1.560.107 S092/pAgTrpC 15.50 1.630.105
References: 1. Wunsch C, Mundt K, Li S-M (2015) Targeted production of secondary metabolites by coexpression of non-ribosomal peptide synthetase and prenyltransferase genes in As-pergillus. Appl Microbiol Biotechnol 99(10): 4213-4223. doi: 10.1007/s00253-015-6490-8 2. Fang M-Y, Zhang C, Yang S et al. (2015) High crude violacein production from glucose by Escherichia coli engineered with interactive control of tryptophan pathway and viola-cein biosynthetic pathway. Microb. Cell Fact. 14: 8. doi: 10.1186/sl2934-015-0192-x 3. Fang M, Wang T, Zhang C et al. (2016) Intermediate-sensor assisted push-pull strategy and its application in heterologous deoxyviolacein production in Escherichia coli. Metab Eng 33: 41-51. doi: 10.1016/j.ymben.2015.10.006 4. Rodrigues AL, Trachtmann N, Becker J et al. (2013) Systems metabolic engineering of Escherichia coli for production of the antitumor drugs violacein and deoxyviolacein. Metab. Eng. 20: 29^11 6. Merino E, Jensen RA, Yanofsky C (2008) Evolution of bacterial trp opérons and their regulation. Curr Opin Microbiol 11(2): 78-86. doi: 10.1016/j.mib.2008.02.005 7. Bertrand K, Yanofsky C (1976) Regulation of Transcription Termination in Leader Region of Tryptophan Operon of Escherichia-Coli Involves Tryptophan or Its Metabolic Product. J. Mol. Biol. 103(2): 339-349 8. Kwak JH, Hong KW, Lee SH et al. (1999) Identification of amino acid residues involved in feedback inhibition of the anthranilate synthase in Escherichia coli. J. Biochem. Mol. Bi-ol. 32(1): 20-24 9. Platt T (1981) Termination of Transcription and Its Regulation in the Tryptophan Operon of Escherichia-Coli. Cell 24(1): 10-23 10. Zurawski G, Elseviers D, Stauffer GV et al. (1978) Translational control of transcription termination at the attenuator of the Escherichia coli tryptophan operon. Proc. Natl. Acad. Sci. U.S.A. 75(12): 5988-5992 11. Chen L, Zeng A-P (2017) Rational design and metabolic analysis of Escherichia coli for effective production of L-tryptophan at high concentration. Appl Microbiol Biotechnol 101(2): 559-568. doi: 10.1007/s00253-016-7772-5 12. Lee KH, Park HM, Lee HH et al. (2014) Microorganisms of Escherichia coli having enhanced L-tryptophan production and method for producing L-tryptophan by using same(EP2803720) 19. Reddy M, Bruning JB, Thurman C et al. (2012) Crystal structure of Mycobacterium tuberculosis Indole Glycerol Phosphate Synthase (IGPS) in complex with indole glycerol phosphate (IGP) amd anthranilate, doi: 10.2210/pdb3t44/pdb 20. Amann E, Ochs B, Abel KJ (1988) Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene 69(2): 301-315 21. Pettersen EF, Goddard TD, Huang CC et al. (2004) UCSF Chimera—a visualization system for exploratory research and analysis. J Comput Chem 25(13): 1605-1612. doi: 10.1002/jcc.20084 22. Trott O, Olson AJ (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31(2): 455-461. doi: 10.1002/jcc.21334 23. Zaccardi MJ, Mannweiler O, Boehr DD (2012) Differences in the catalytic mechanisms of mesophilic and thermophilic indole-3-glycerol phosphate synthase enzymes at their adaptive temperatures. Biochem. Biophys. Res. Commun. 418(2): 324—329. doi: 10.1016/j.bbrc.2012.01.020 24. Kirschner K, Szadkowski H, Jardetzky TS et al. (1987) Phosphoribosylanthranilate isomerase—indoleglycerol-phosphate synthase from Escherichia coli. In: Metabolism of Aromatic Amino Acids and Amines, vol 142. Academic Press, pp 386-397 25. da Luz JA, Hans E, Zeng A-P (2014) Automated fast filtration and on-filter quenching improve the intracellular metabolite analysis of microorganisms. Eng. Life Sci. 14(2): 135-142. doi: 10.1002/elsc.201300099 26. Rajesh Reddy Bommareddy, Zhen Chen, Sugima Rappert et al. (2014) A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicum by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogen-ase. Metab. Eng. 25(0): 30-37. doi: 10.1016/j.ymben.2014.06.005 27. Nagaraja P, Yathirajan HS, Vasantha RA (2003) Highly sensitive reaction of tryptophan with p-phenylenediamine. Anal. Biochem. 312(2): 157-161. doi: 10.1016/S0003-2697(02)00504-3 28. Hennig M, Darimont B, Jansonius J et al. (2002) The Catalytic Mechanism of Indole-3-glycerol Phosphate Synthase: Crystal Structures of Complexes of the Enzyme from Sul-folobus solfataricus with Substrate Analogue, Substrate, and Product. J. Mol. Biol. 319(3): 757-766. doi: 10.1016/S0022-2836(02)00378-9 29. Wilmanns M, Priestle JP, Niermann T et al. (1992) Three-dimensional structure of the bifunctional enzyme phosphoribosylanthranilate isomerase: indoleglycerolphosphate synthase from Escherichia coli refined at 2.0 A resolution. Journal of Molecular Biology 223(2): 477-507 30. Eberhard M, Tsai-Pflugfelder M, Bolewska K et al. (1995) Indoleglycerol phosphate syn-thase-phosphoribosyl anthranilate isomerase: comparison of the bifunctional enzyme from Escherichia coli with engineered monofunctional domains. Biochemistry 34(16): 5419-5428 31. Darimont B, Stehlin C, Szadkoski H et al. (1998) Mutational analysis of the active site of indoleglycerol phosphate synthase from Escherichia coli. Protein Sci. 7(5): 1221-1232. doi: 10.1002/pro.5560070518
SEQUENCE LISTING <110> Technische Universität Hamburg-Harburg
<120> IMPROVED BIOTECHNOLOGICAL PRODUCTION OF L-TRYPTOPHAN
<130> PAT 1630 LU <160> 29 <170> BiSSAP 1.3.6 <210> 1 <211> 452
<212> PRT <213> Escherichia coli <400> 1
Met Gin Thr Vai Leu Ala Lys Ile Vai Ala Asp Lys Ala Ile Trp Vai 15 1015
Glu Ala Arg Lys Gin Gin Gin Pro Leu Ala Ser Phe Gin Asn Glu Vai 20 2530
Gin Pro Ser Thr Arg His Phe Tyr Asp Ala Leu Gin Gly Ala Arg Thr 35 4045
Ala Phe lie Leu Glu Cys Lys Lys Ala Ser Pro Ser Lys Gly Vai lie 50 5560
Arg Asp Asp Phe Asp Pro Ala Arg lie Ala Ala lie Tyr Lys HisTyr 65 70 7580
Ala Ser Ala lie Ser Vai Leu Thr Asp Glu Lys Tyr Phe Gin GlySer 85 9095
Phe Asn Phe Leu Pro Ile Vai Ser Gin lie Ala Pro Gin Pro lie Leu 100 105110
Cys Lys Asp Phe lie lie Asp Pro Tyr Gin lie Tyr Leu Ala Arg Tyr 115 120125
Tyr Gin Ala Asp Ala Cys Leu Leu Met Leu Ser Vai Leu Asp Asp Asp 130 135140
Gin Tyr Arg Gin Leu Ala Ala Vai Ala His Ser Leu Glu Met Gly Vai 145 150 155160
Leu Thr Glu Val Ser Asn Glu Glu Glu Gin Glu Arg Ala Ile Ala Leu 165 170175
Gly Ala Lys Val Val Gly Ile Asn Asn Arg Asp Leu Arg Asp Leu Ser 180 185190
Ile Asp Leu Asn Arg Thr Arg Glu Leu Ala Pro Lys Leu Gly His Asn 195 200205
Val Thr Val Ile Ser Glu Ser Gly Ile Asn Thr Tyr Ala Gin Val Arg 210 215220
Glu Leu Ser His Phe Ala Asn Gly Phe Leu Ile Gly Ser Ala LeuMet 225 230 235240
Ala His Asp Asp Leu His Ala Ala Val Arg Arg Val Leu Leu GlyGlu 245 250255
Asn Lys Val Cys Gly Leu Thr Arg Gly Gin Asp Ala Lys Ala Ala Tyr 260 265270
Asp Ala Gly Ala Ile Tyr Gly Gly Leu Ile Phe Val Ala Thr Ser Pro 275 280285
Arg Cys Val Asn Val Glu Gin Ala Gin Glu Val Met Ala Ala Ala Pro 290 295300
Leu Gin Tyr Val Gly Val Phe Arg Asn His Asp Ile Ala Asp ValVal 305 310 315320
Asp Lys Ala Lys Val Leu Ser Leu Ala Ala Val Gin Leu His GlyAsn 325 330335
Glu Glu Gin Leu Tyr Ile Asp Thr Leu Arg Glu Ala Leu Pro Ala His 340 345350
Val Ala Ile Trp Lys Ala Leu Ser Val Gly Glu Thr Leu Pro Ala Arg 355 360365
Glu Phe Gin His Val Asp Lys Tyr Val Leu Asp Asn Gly Gin Gly Gly 370 375380
Ser Gly Gin Arg Phe Asp Trp Ser Leu Leu Asn Gly Gin Ser LeuGly 385 390 395400
Asn Val Leu Leu Ala Gly Gly Leu Gly Ala Asp Asn Cys Val GluAla 405 410415
Ala Gin Thr Gly Cys Ala Gly Leu Asp Phe Asn Ser Ala Val Glu Ser 420 425430
Gin Pro Gly Ile Lys Asp Ala Arg Leu Leu Ala Ser Val Phe Gin Thr 435 440445
Leu Arg Ala Tyr 450 <210> 2 <211> 452
<212> PRT <213> Artificial Sequence <220>
<223> EcTrpC I8V <400> 2
Met Gin Thr Val Leu Ala Lys Val Val Ala Asp Lys Ala Ile Trp Val 15 1015
Glu Ala Arg Lys Gin Gin Gin Pro Leu Ala Ser Phe Gin Asn Glu Val 20 2530
Gin Pro Ser Thr Arg His Phe Tyr Asp Ala Leu Gin Gly Ala Arg Thr 35 4045
Ala Phe lie Leu Glu Cys Lys Lys Ala Ser Pro Ser Lys Gly Val Ile 50 5560
Arg Asp Asp Phe Asp Pro Ala Arg Ile Ala Ala Ile Tyr Lys HisTyr 65 70 7580
Ala Ser Ala Ile Ser Val Leu Thr Asp Glu Lys Tyr Phe Gin GlySer 85 9095
Phe Asn Phe Leu Pro Ile Val Ser Gin lie Ala Pro Gin Pro Ile Leu 100 105110
Cys Lys Asp Phe Ile Ile Asp Pro Tyr Gin lie Tyr Leu Ala Arg Tyr 115 120125
Tyr Gin Ala Asp Ala Cys Leu Leu Met Leu Ser Vai Leu Asp Asp Asp 130 135140
Gin Tyr Arg Gin Leu Ala Ala Vai Ala His Ser Leu Glu Met GlyVai 145 150 155160
Leu Thr Glu Vai Ser Asn Glu Glu Glu Gin Glu Arg Ala lie AlaLeu 165 170175
Gly Ala Lys Val Vai Gly lie Asn Asn Arg Asp Leu Arg Asp Leu Ser 180 185190 lie Asp Leu Asn Arg Thr Arg Glu Leu Ala Pro Lys Leu Gly His Asn 195 200205
Val Thr Vai lie Ser Glu Ser Gly lie Asn Thr Tyr Ala Gin Vai Arg 210 215220
Glu Leu Ser His Phe Ala Asn Gly Phe Leu lie Gly Ser Ala Leu Met 225 230 235240
Ala His Asp Asp Leu His Ala Ala Vai Arg Arg Val Leu Leu Gly Glu 245 250255
Asn Lys Vai Cys Gly Leu Thr Arg Gly Gin Asp Ala Lys Ala Ala Tyr 260 265270
Asp Ala Gly Ala Ile Tyr Gly Gly Leu Ile Phe Vai Ala Thr Ser Pro 275 280285
Arg Cys Val Asn Vai Glu Gin Ala Gin Glu Vai Met Ala Ala Ala Pro 290 295300
Leu Gin Tyr Val Gly Vai Phe Arg Asn His Asp lie Ala Asp ValVai 305 310 315320
Asp Lys Ala Lys Vai Leu Ser Leu Ala Ala Vai Gin Leu His GlyAsn 325 330335
Glu Glu Gin Leu Tyr lie Asp Thr Leu Arg Glu Ala Leu Pro Ala His 340 345350
Vai Ala lie Trp Lys Ala Leu Ser Vai Gly Glu Thr Leu Pro Ala Arg 355 360365
Glu Phe Gin His Val Asp Lys Tyr Vai Leu Asp Asn Gly Gin Gly Gly 370 375380
Ser Gly Gin Arg Phe Asp Trp Ser Leu Leu Asn Gly Gin Ser LeuGly 385 390 395400
Asn Vai Leu Leu Ala Gly Gly Leu Gly Ala Asp Asn Cys Vai GluAla 405 410415
Ala Gin Thr Gly Cys Ala Gly Leu Asp Phe Asn Ser Ala Vai Glu Ser 420 425430
Gin Pro Gly He Lys Asp Ala Arg Leu Leu Ala Ser Vai Phe Gin Thr 435 440445
Leu Arg Ala Tyr 450 <210> 3 <211> 452
<212> PRT <213> Artificial Sequence <220>
<223> EcTrpC S60A <400> 3
Met Gin Thr Val Leu Ala Lys Ile Val Ala Asp Lys Ala Ile Trp Val 15 1015
Glu Ala Arg Lys Gin Gin Gin Pro Leu Ala Ser Phe Gin Asn Glu Val 20 2530
Gin Pro Ser Thr Arg His Phe Tyr Asp Ala Leu Gin Gly Ala Arg Thr 35 4045
Ala Phe lie Leu Glu Cys Lys Lys Ala Ser Pro Ala Lys Gly Val Ile 50 5560
Arg Asp Asp Phe Asp Pro Ala Arg Ile Ala Ala Ile Tyr Lys HisTyr 65 70 7580
Ala Ser Ala Ile Ser Val Leu Thr Asp Glu Lys Tyr Phe Gin GlySer 85 9095
Phe Asn Phe Leu Pro Ile Val Ser Gin lie Ala Pro Gin Pro Ile Leu 100 105110
Cys Lys Asp Phe Ile Ile Asp Pro Tyr Gin lie Tyr Leu Ala Arg Tyr 115 120125
Tyr Gin Ala Asp Ala Cys Leu Leu Met Leu Ser Vai Leu Asp Asp Asp 130 135140
Gin Tyr Arg Gin Leu Ala Ala Vai Ala His Ser Leu Glu Met GlyVai 145 150 155160
Leu Thr Glu Vai Ser Asn Glu Glu Glu Gin Glu Arg Ala lie AlaLeu 165 170175
Gly Ala Lys Val Vai Gly lie Asn Asn Arg Asp Leu Arg Asp Leu Ser 180 185190 lie Asp Leu Asn Arg Thr Arg Glu Leu Ala Pro Lys Leu Gly His Asn 195 200205
Val Thr Vai lie Ser Glu Ser Gly lie Asn Thr Tyr Ala Gin Vai Arg 210 215220
Glu Leu Ser His Phe Ala Asn Gly Phe Leu lie Gly Ser Ala LeuMet 225 230 235240
Ala His Asp Asp Leu His Ala Ala Vai Arg Arg Vai Leu Leu GlyGlu 245 250255
Asn Lys Vai Cys Gly Leu Thr Arg Gly Gin Asp Ala Lys Ala Ala Tyr 260 265270
Asp Ala Gly Ala Ile Tyr Gly Gly Leu Ile Phe Vai Ala Thr Ser Pro 275 280285
Arg Cys Val Asn Vai Glu Gin Ala Gin Glu Vai Met Ala Ala Ala Pro 290 295300
Leu Gin Tyr Val Gly Val Phe Arg Asn His Asp He Ala Asp ValVai 305 310 315320
Asp Lys Ala Lys Vai Leu Ser Leu Ala Ala Vai Gin Leu His GlyAsn 325 330335
Glu Glu Gin Leu Tyr He Asp Thr Leu Arg Glu Ala Leu Pro Ala His 340 345350
Vai Ala lie Trp Lys Ala Leu Ser Vai Gly Glu Thr Leu Pro Ala Arg 355 360365
Glu Phe Gin His Val Asp Lys Tyr Vai Leu Asp Asn Gly Gin Gly Gly 370 375380
Ser Gly Gin Arg Phe Asp Trp Ser Leu Leu Asn Gly Gin Ser LeuGly 385 390 395400
Asn Vai Leu Leu Ala Gly Gly Leu Gly Ala Asp Asn Cys Vai GluAla 405 410415
Ala Gin Thr Gly Cys Ala Gly Leu Asp Phe Asn Ser Ala Vai Glu Ser 420 425430
Gin Pro Gly lie Lys Asp Ala Arg Leu Leu Ala Ser Vai Phe Gin Thr 435 440445
Leu Arg Ala Tyr 450 <210> 4 <211> 452
<212> PRT <213> Artificial Sequence <220>
<223> EcTrpC S60G <400> 4
Met Gin Thr Val Leu Ala Lys Ile Vai Ala Asp Lys Ala He Trp Vai 15 1015
Glu Ala Arg Lys Gin Gin Gin Pro Leu Ala Ser Phe Gin Asn Glu Vai 20 2530
Gin Pro Ser Thr Arg His Phe Tyr Asp Ala Leu Gin Gly Ala Arg Thr 35 4045
Ala Phe He Leu Glu Cys Lys Lys Ala Ser Pro Gly Lys Gly Vai He 50 5560
Arg Asp Asp Phe Asp Pro Ala Arg lie Ala Ala Ile Tyr Lys His Tyr 65 70 7580
Ala Ser Ala lie Ser Val Leu Thr Asp Glu Lys Tyr Phe Gin GlySer 85 9095
Phe Asn Phe Leu Pro Ile Vai Ser Gin lie Ala Pro Gin Pro lie Leu 100 105110
Cys Lys Asp Phe lie lie Asp Pro Tyr Gin lie Tyr Leu Ala Arg Tyr 115 120125
Tyr Gin Ala Asp Ala Cys Leu Leu Met Leu Ser Vai Leu Asp Asp Asp 130 135140
Gin Tyr Arg Gin Leu Ala Ala Vai Ala His Ser Leu Glu Met GlyVai 145 150 155160
Leu Thr Glu Vai Ser Asn Glu Glu Glu Gin Glu Arg Ala lie AlaLeu 165 170175
Gly Ala Lys Val Vai Gly lie Asn Asn Arg Asp Leu Arg Asp Leu Ser 180 185190 lie Asp Leu Asn Arg Thr Arg Glu Leu Ala Pro Lys Leu Gly His Asn 195 200205
Val Thr Vai lie Ser Glu Ser Gly He Asn Thr Tyr Ala Gin Vai Arg 210 215220
Glu Leu Ser His Phe Ala Asn Gly Phe Leu He Gly Ser Ala LeuMet 225 230 235240
Ala His Asp Asp Leu His Ala Ala Vai Arg Arg Vai Leu Leu GlyGlu 245 250255
Asn Lys Vai Cys Gly Leu Thr Arg Gly Gin Asp Ala Lys Ala Ala Tyr 260 265270
Asp Ala Gly Ala Ile Tyr Gly Gly Leu Ile Phe Vai Ala Thr Ser Pro 275 280285
Arg Cys Val Asn Vai Glu Gin Ala Gin Glu Vai Met Ala Ala Ala Pro 290 295300
Leu Gin Tyr Val Gly Vai Phe Arg Asn His Asp He Ala Asp ValVai 305 310 315320
Asp Lys Ala Lys Vai Leu Ser Leu Ala Ala Vai Gin Leu His GlyAsn 325 330335
Glu Glu Gin Leu Tyr He Asp Thr Leu Arg Glu Ala Leu Pro Ala His 340 345350
Vai Ala He Trp Lys Ala Leu Ser Vai Gly Glu Thr Leu Pro Ala Arg 355 360365
Glu Phe Gin His Val Asp Lys Tyr Vai Leu Asp Asn Gly Gin Gly Gly 370 375380
Ser Gly Gin Arg Phe Asp Trp Ser Leu Leu Asn Gly Gin Ser LeuGly 385 390 395400
Asn Vai Leu Leu Ala Gly Gly Leu Gly Ala Asp Asn Cys Vai GluAla 405 410415
Ala Gin Thr Gly Cys Ala Gly Leu Asp Phe Asn Ser Ala Vai Glu Ser 420 425430
Gin Pro Gly He Lys Asp Ala Arg Leu Leu Ala Ser Vai Phe Gin Thr 435 440445
Leu Arg Ala Tyr 450 <210> 5 <211> 452
<212> PRT <213> Artificial Sequence <220>
<223> EcTrpC L188F <400> 5
Met Gin Thr Vai Leu Ala Lys He Vai Ala Asp Lys Ala Ile Trp Vai 15 1015
Glu Ala Arg Lys Gin Gin Gin Pro Leu Ala Ser Phe Gin Asn Glu Vai 20 2530
Gin Pro Ser Thr Arg His Phe Tyr Asp Ala Leu Gin Gly Ala Arg Thr 35 4045
Ala Phe He Leu Glu Cys Lys Lys Ala Ser Pro Ser Lys Gly Vai lie 50 5560
Arg Asp Asp Phe Asp Pro Ala Arg lie Ala Ala lie Tyr Lys HisTyr 65 70 7580
Ala Ser Ala lie Ser Vai Leu Thr Asp Glu Lys Tyr Phe Gin GlySer 85 9095
Phe Asn Phe Leu Pro Ile Vai Ser Gin He Ala Pro Gin Pro He Leu 100 105110
Cys Lys Asp Phe lie He Asp Pro Tyr Gin He Tyr Leu Ala Arg Tyr 115 120125
Tyr Gin Ala Asp Ala Cys Leu Leu Met Leu Ser Vai Leu Asp Asp Asp 130 135140
Gin Tyr Arg Gin Leu Ala Ala Vai Ala His Ser Leu Glu Met GlyVai 145 150 155160
Leu Thr Glu Vai Ser Asn Glu Glu Glu Gin Glu Arg Ala He AlaLeu 165 170175
Gly Ala Lys Val Vai Gly lie Asn Asn Arg Asp Phe Arg Asp Leu Ser 180 185190 lie Asp Leu Asn Arg Thr Arg Glu Leu Ala Pro Lys Leu Gly His Asn 195 200205
Val Thr Vai lie Ser Glu Ser Gly He Asn Thr Tyr Ala Gin Vai Arg 210 215220
Glu Leu Ser His Phe Ala Asn Gly Phe Leu He Gly Ser Ala LeuMet 225 230 235240
Ala His Asp Asp Leu His Ala Ala Vai Arg Arg Vai Leu Leu GlyGlu 245 250255
Asn Lys Vai Cys Gly Leu Thr Arg Gly Gin Asp Ala Lys Ala Ala Tyr 260 265270
Asp Ala Gly Ala He Tyr Gly Gly Leu Ile Phe Vai Ala Thr Ser Pro 275 280285
Arg Cys Val Asn Vai Glu Gin Ala Gin Glu Vai Met Ala Ala Ala Pro 290 295300
Leu Gin Tyr Val Gly Vai Phe Arg Asn His Asp He Ala Asp ValVai 305 310 315320
Asp Lys Ala Lys Vai Leu Ser Leu Ala Ala Vai Gin Leu His GlyAsn 325 330335
Glu Glu Gin Leu Tyr He Asp Thr Leu Arg Glu Ala Leu Pro Ala His 340 345350
Vai Ala lie Trp Lys Ala Leu Ser Vai Gly Glu Thr Leu Pro Ala Arg 355 360365
Glu Phe Gin His Val Asp Lys Tyr Vai Leu Asp Asn Gly Gin Gly Gly 370 375380
Ser Gly Gin Arg Phe Asp Trp Ser Leu Leu Asn Gly Gin Ser LeuGly 385 390 395400
Asn Vai Leu Leu Ala Gly Gly Leu Gly Ala Asp Asn Cys Vai GluAla 405 410415
Ala Gin Thr Gly Cys Ala Gly Leu Asp Phe Asn Ser Ala Vai Glu Ser 420 425430
Gin Pro Gly lie Lys Asp Ala Arg Leu Leu Ala Ser Vai Phe Gin Thr 435 440445
Leu Arg Ala Tyr 450 <210> 6 <211> 484
<212> PRT <213> Saccharomyces cerevisiae <400> 6
Met Ser Vai His Ala Ala Thr Asn Pro He Asn Lys His Val Vai Leu 15 1015 lie Asp Asn Tyr Asp Ser Phe Thr Trp Asn Vai Tyr Glu Tyr Leu Cys 20 2530
Gin Glu Gly Ala Lys Vai Ser Vai Tyr Arg Asn Asp Ala He Thr Vai 35 4045
Pro Glu He Ala Ala Leu Asn Pro Asp Thr Leu Leu He Ser Pro Gly 50 5560
Pro Gly His Pro Lys Thr Asp Ser Gly He Ser Arg Asp Cys HeArg 65 70 7580
Tyr Phe Thr Gly Lys lie Pro Vai Phe Gly He Cys Met Gly GinGin 85 9095
Cys Met Phe Asp Val Phe Gly Gly Glu Vai Ala Tyr Ala Gly Glu He 100 105110
Vai His Gly Lys Thr Ser Pro lie Ser His Asp Asn Cys Gly lie Phe 115 120125
Lys Asn Vai Pro Gin Gly He Ala Vai Thr Arg Tyr His Ser Leu Ala 130 135140
Gly Thr Glu Ser Ser Leu Pro Ser Cys Leu Lys Vai Thr Ala SerThr 145 150 155160
Glu Asn Gly He Ile Met Gly Vai Arg His Lys Lys Tyr Thr VaiGlu 165 170175
Gly Vai Gin Phe His Pro Glu Ser lie Leu Thr Glu Glu Gly His Leu 180 185190
Met lie Arg Asn He Leu Asn Vai Ser Gly Gly Thr Trp Glu Glu Asn 195 200205
Lys Ser Ser Pro Ser Asn Ser He Leu Asp Arg He Tyr Ala Arg Arg 210 215220
Lys Ile Asp Vai Asn Glu Gin Ser Lys lie Pro Gly Phe Thr Phe Gin 225 230 235240
Asp Leu Gin Ser Asn Tyr Asp Leu Gly Leu Ala Pro Pro Leu Gin Asp 245 250255
Phe Tyr Thr Vai Leu Ser Ser Ser His Lys Arg Ala Val Vai Leu Ala 260 265270
Glu Vai Lys Arg Ala Ser Pro Ser Lys Gly Pro He Cys Leu Lys Ala 275 280285
Vai Ala Ala Glu Gin Ala Leu Lys Tyr Ala Glu Ala Gly Ala Ser Ala 290 295300 lie Ser Vai Leu Thr Glu Pro His Trp Phe His Gly Ser Leu GinAsp 305 310 315320
Leu Val Asn Vai Arg Lys He Leu Asp Leu Lys Phe Pro Pro LysGlu 325 330335
Arg Pro Cys Vai Leu Arg Lys Glu Phe lie Phe Ser Lys Tyr Gin lie 340 345350
Leu Glu Ala Arg Leu Ala Gly Ala Asp Thr Vai Leu Leu He Vai Lys 355 360365
Met Leu Ser Gin Pro Leu Leu Lys Glu Leu Tyr Ser Tyr Ser Lys Asp 370 375380
Leu Asn Met Glu Pro Leu Val Glu Vai Asn Ser Lys Glu Glu LeuGin 385 390 395400
Arg Ala Leu Glu Ile Gly Ala Lys Val Val Gly Vai Asn Asn ArgAsp 405 410415
Leu His Ser Phe Asn Vai Asp Leu Asn Thr Thr Ser Asn Leu Vai Glu 420 425430
Ser He Pro Lys Asp Vai Leu Leu lie Ala Leu Ser Gly lie Thr Thr 435 440445
Arg Asp Asp Ala Glu Lys Tyr Lys Lys Glu Gly Vai His Gly Phe Leu 450 455460
Vai Gly Glu Ala Leu Met Lys Ser Thr Asp Vai Lys Lys Phe He His 465 470 475480
Glu Leu Cys Glu <210> 7 <211> 770
<212> PRT <213> Aspergillus niger <400> 7
Met Ala Asp Ser Gly Leu Vai Asp His Ser Pro His His Pro Thr Lys 15 1015
Ala Ala Gin Leu Asn Thr Ala Ser Asn Val He Leu He Asp Asn Tyr 20 2530
Asp Ser Phe Thr Trp Asn Val Tyr Gin Tyr Leu Vai Leu Glu Gly Ala 35 4045
Thr Val Asn Vai Phe Arg Asn Asp Gin lie Thr Leu Glu Glu Leu He 50 5560
Ala Lys Lys Pro Thr Gin Leu Vai He Ser Pro Gly Pro Gly HisPro 65 70 7580
Glu Thr Asp Ala Gly lie Ser Ser Ala Ala lie Gin Tyr Phe SerGly 85 9095
Lys lie Pro Ile Phe Gly Val Cys Met Gly Gin Gin Cys Ile He Thr 100 105110
Cys Phe Gly Gly Lys Val Asp Vai Thr Gly Glu He Leu His Gly Lys 115 120125
Thr Ser Ala Leu Lys His Asp Gly Lys Gly Ala Tyr Glu Gly Leu Pro 130 135140
Asp Ser Leu Ala Vai Thr Arg Tyr His Ser Leu Ala Gly Thr HisAla 145 150 155160
Thr lie Pro Asp Cys Leu Glu Vai Ser Ser Ser Vai Gin Leu ThrAsp 165 170175
Asp Ser Asn Lys Asp Val He Met Gly Vai Arg His Lys Lys Leu Ala 180 185190
Val Glu Gly Vai Gin Phe His Pro Glu Ser He Leu Thr Glu Tyr Gly 195 200205
Arg Thr Met Phe Arg Asn Phe Leu Lys Leu Thr Ala Gly Thr Trp Glu 210 215220
Gly Asn Gly Lys His Phe Asp Glu Gin Ser Asn Thr Thr Lys AlaThr 225 230 235240
Vai Ser Ser Asn Thr Ala Pro Lys Thr Asp Lys Lys Leu Ser HeLeu 245 250255
Glu Arg He Tyr Asp His Arg Arg Ala Ala Vai Ala Vai Gin Lys Thr 260 265270 lie Pro Ser Gin Arg Pro Ala Asp Leu Gin Ala Ala Tyr Asp Leu Asn 275 280285
Leu Ala Pro Pro Gin Vai Pro Phe Pro Ala Arg Leu Arg Gin Ser Pro 290 295300
Tyr Pro Leu Ser Leu Met Ala Glu lie Lys Arg Ala Ser Pro SerLys 305 310 315320
Gly Met He Ala Glu Asn Ala Cys Ala Pro Ala Gin Ala Arg GinTyr 325 330335
Ala Lys Ala Gly Ala Ser Vai He Ser Vai Leu Thr Glu Pro Glu Trp 340 345350
Phe Lys Gly Ser He Asp Asp Leu Arg Ala Vai Arg Gin Ser Leu Glu 355 360365
Gly Leu Thr Asn Arg Pro Ala He Leu Arg Lys Glu Phe Vai Phe Asp 370 375380
Glu Tyr Gin lie Leu Glu Ala Arg Leu Ala Gly Ala Asp Thr VaiLeu 385 390 395400
Leu He Vai Lys Met Leu Ser Vai Glu Leu Leu Thr Arg Leu TyrHis 405 410415
Tyr Ser Arg Ser Leu Gly Met Glu Pro Leu Val Glu Vai Asn Thr Pro 420 425430
Glu Glu Met Lys lie Ala Vai Asp Leu Gly Ala Glu Val He Gly Vai 435 440445
Asn Asn Arg Asp Leu Thr Ser Phe Glu Vai Asp Leu Gly Thr Thr Ser 450 455460
Arg Leu Met Asp Gin Vai Pro Ser Ser Thr Ile Vai Cys Ala LeuSer 465 470 475480
Gly He Ser Gly Pro Lys Asp Vai Glu Ala Tyr Lys Lys Glu GlyVai 485 490495
Lys Ala He Leu Vai Gly Glu Ala Leu Met Arg Ala Ala Asp Thr Ala 500 505510
Ala Phe He Ala Glu Leu Leu Gly Gly Ser Ser Gin Asn Vai Ser Lys 515 520525
Glu Ser Arg Ser Ser Pro Leu Val Lys He Cys Gly Thr Arg Ser Glu 530 535540
Glu Ala Ala Arg Ala Ala He Glu Ala Gly Ala Asp Leu He GlyHe 545 550 555560
Ile Met Vai Gin Gly Arg Thr Arg Cys Vai Pro Asp Asp Vai AlaLeu 565 570575
Arg He Ser Gin Val Vai Lys Ser Thr Pro Lys Pro Ala Gly Gin Thr 580 585590
Pro Pro Thr Ser Gin Gly Thr Pro Ala Ala Ala Ser Vai Glu Tyr Phe 595 600605
Asp His Ser Ala Arg He Leu Arg His Pro Ser Arg Ala Leu Leu Vai 610 615620
Gly Vai Phe Gin Asn Gin Pro Leu Asp Tyr lie Leu Ser Gin GinGin 625 630 635640
Lys Leu Gly Leu Asp Val Vai Gin Leu His Gly Ser Glu Pro LeuGlu 645 650655
Trp Ala Lys Leu lie Pro Vai Pro Vai lie Arg Lys Phe Gly Leu Asp 660 665670
Glu Pro Ala lie Ala Arg Arg Ala Tyr His Ser Leu Pro Leu Leu Asp 675 680685
Ser Gly Vai Gly Gly Thr Gly Glu Leu Leu Asp Gin Ser Arg Vai Gin 690 695700
Asn Vai Leu Asp Lys Asp Ser Gly Leu Arg Vai lie Leu Ala GlyGly 705 710 715720
Leu Asp Pro Thr Asn Vai Ala Gly He Vai Gin Lys Leu Gly GluSer 725 730735
Gly Arg Lys Val Val Gly Val Asp Vai Ser Ser Gly Vai Glu Ser Asp 740 745750
Gly Ala Gin Asp Vai Gly Lys lie Arg Ala Phe Vai Gin Ala Vai Arg 755 760765
Gly Leu 770 <210> 8 <211> 50
<212> DNA <213> Artificial Sequence <220>
<223> Primer Smal-trpE <400> 8 ttgttcccgg gtataaagga ggccatccat gcaaacacaa aaaccgactc 50 <210> 9 <211> 36
<212> DNA <213> Artificial Sequence <220> <223> Primer trpE-Xbal <400> 9 gcagaatcta gatcatcaga aagtctcctg tgcatg 36 <210> 10 <211> 70
<212> DNA <213> Artificial Sequence <220> <223> Primer trpC-01 <400> 10 gcgctacagg gtgcgcgcac ggcgtttatt ctggagtgca agaaagcgtc gttgacagct 60 agctcagtcc 70 <210> 11 <211> 70
<212> DNA <213> Artificial Sequence <220> <223> Primer trpC-02 <400> 11 gatgccggat tcgctgatta ccgtcacgtt gtgccccagt ttcggcgcaa atttgatgcc 60 tgggcatgcg 70 <210> 12 <211> 20
<212> DNA <213> Artificial Sequence <220>
<223> Primer trpC-INF <400> 12 atgcaaaccg ttttagcgaa 20 <210> 13 <211> 20
<212> DNA <213> Artificial Sequence <220>
<223> Primer trpC-INR <400> 13 caaatcgtca tgggccatca 20 <210> 14 <211> 37
<212> DNA <213> Artificial Sequence <220> <223> Primer Ndel-elGPs <400> 14 gcaacgcata tgcaaaccgt tttagcgaaa atcgtcg 37 <210> 15 <211> 37
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-XhoI <400> 15 agtcgcctcg agtactttat tctcacccag caacacc 37 <210> 16 <211> 74
<212> DNA <213> Artificial Sequence <220>
<223> Primer EcoRI-6H-trpC <400> 16 cggcgcgaat tcagaaggag atatacatat gcaccaccac caccaccacc aaaccgtttt 60 agcgaaaatc gtcg 74 <210> 17 <211> 31
<212> DNA <213> Artificial Sequence <220> <223> Primer trpC-Xbal <400> 17 agcgtctcta gacttaatat gcgcgcagcg t 31 <210> 18 <211> 41
<212> DNA <213> Artificial Sequence <220> <223> Primer eIGPs-Xbal <400> 18 agcgtctcta gacttatact ttattctcac ccagcaacac c 41 <210> 19 <211> 22
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-I8X-F <400> 19 gcagacaagg cgatttgggt ag 22 <210> 20 <211> 27
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-I8A-R <400> 20 gacggctttc gctaaaacgg tttgcat 27 <210> 21 <211> 27
<212> DNA <213> Artificial Sequence <220>
<223> Primer elGPs-I8V-R <400> 21 gacgactttc gctaaaacgg tttgcat 27 <210> 22 <211> 21
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-S60A_F <400> 22 gcaaaaggcg tgatccgtga t 21 <210> 23 <211> 20
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-S60A_R <400> 23 cggcgacgct ttcttgcact 20 <210> 24 <211> 28
<212> DNA <213> Artificial Sequence <22 0 >
<223> Primer eIGPs-S60G_F <400> 24 tcgccgggaa aaggcgtgat ccgtgatg 28 <210> 25 <211> 19
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-S60G_R <400> 25 cgctttcttg cactccaga 19 <210> 26 <211> 21
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-L188A_R <400> 26 atcgcggttg ttgatgccaa c 21 <210> 27 <211> 20
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-L188A_F <400> 27 gcgcgtgatt tgtcgattga 20 <210> 28 <211> 19
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-L188F_R <400> 28 gttgttgatg ccaacgacc 19 <210> 29 <211> 34
<212> DNA <213> Artificial Sequence <220>
<223> Primer eIGPs-L188F_F <400> 29 cgcgattttc gtgatttgtc gattgatctc aacc 34
Claims (13)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| LU100521A LU100521B1 (en) | 2017-11-15 | 2017-11-15 | Improved biotechnological production of L-tryptophan |
| EP18804259.2A EP3710593A1 (en) | 2017-11-15 | 2018-11-12 | Improved biotechnological production of l-tryptophan |
| US16/763,017 US10947523B2 (en) | 2017-11-15 | 2018-11-12 | Biotechnological production of L-tryptophan |
| CN201880073668.5A CN111406111A (en) | 2017-11-15 | 2018-11-12 | Improved method for producing L-tryptophan by biotechnology |
| PCT/EP2018/080908 WO2019096727A1 (en) | 2017-11-15 | 2018-11-12 | Improved biotechnological production of l-tryptophan |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| LU100521A LU100521B1 (en) | 2017-11-15 | 2017-11-15 | Improved biotechnological production of L-tryptophan |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| LU100521B1 true LU100521B1 (en) | 2019-05-27 |
Family
ID=60943080
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| LU100521A LU100521B1 (en) | 2017-11-15 | 2017-11-15 | Improved biotechnological production of L-tryptophan |
Country Status (1)
| Country | Link |
|---|---|
| LU (1) | LU100521B1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520652A (en) * | 2016-11-29 | 2017-03-22 | 天津科技大学 | Corynebacterium glutamicum, and key tryptophan synthesis gene thereof |
-
2017
- 2017-11-15 LU LU100521A patent/LU100521B1/en active IP Right Grant
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520652A (en) * | 2016-11-29 | 2017-03-22 | 天津科技大学 | Corynebacterium glutamicum, and key tryptophan synthesis gene thereof |
Non-Patent Citations (5)
| Title |
|---|
| CHITTUR S V ET AL: "Expression and Purification of Imidazole Glycerol Phosphate Synthase from Saccharomyces cerevisiae", PROTEIN EXPRESSION AND PURIFICAT, ACADEMIC PRESS, SAN DIEGO, CA, vol. 18, no. 3, 1 April 2000 (2000-04-01), pages 366 - 377, XP004435552, ISSN: 1046-5928, DOI: 10.1006/PREP.2000.1207 * |
| J S HORNG ET AL: "Cloning and characterization of the trpC gene from an aflatoxigenic strain of Aspergillus parasiticus", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 1 October 1989 (1989-10-01), UNITED STATES, pages 2561 - 2568, XP055479100, Retrieved from the Internet <URL:http://aem.asm.org/content/55/10/2561.full.pdf> * |
| LIN CHEN ET AL: "Discovery of feed-forward regulation in L-tryptophan biosynthesis and its use in metabolic engineering of E. coli for efficient tryptophan bioproduction", METABOLIC ENGINEERING, vol. 47, 5 May 2018 (2018-05-05), US, pages 434 - 444, XP055479146, ISSN: 1096-7176, DOI: 10.1016/j.ymben.2018.05.001 * |
| M MELANIE YELTON ET AL: "Transformation of Aspergillus nidulans by using a trpC plasmid (hybrid plasmid/gene transfer/chromosome integration)", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 81, no. 5, 1 December 1983 (1983-12-01), US, pages 1470 - 1474, XP055479129, ISSN: 0027-8424 * |
| ZHI-JUN ZHAO ET AL: "Development of-tryptophan production strains by defined genetic modification in", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY ; OFFICIAL JOURNAL OF THE SOCIETY FOR INDUSTRIAL MICROBIOLOGY, SPRINGER, BERLIN, DE, vol. 38, no. 12, 4 May 2011 (2011-05-04), pages 1921 - 1929, XP019982205, ISSN: 1476-5535, DOI: 10.1007/S10295-011-0978-8 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Webb et al. | Biosynthesis of pantothenate | |
| Zhang et al. | Tyrosine decarboxylase from Lactobacillus brevis: soluble expression and characterization | |
| JP2023507482A (en) | Method for producing guanidinoacetic acid by fermentation | |
| KR101991206B1 (en) | cAMP receptor protein variant and method for producing L-amino acid using the same | |
| WO2007047680A2 (en) | Increasing the activity of radical s-adenosyl methionine (sam) enzymes | |
| KR101996767B1 (en) | cAMP receptor protein variant and method for producing L-amino acid using the same | |
| US10385322B2 (en) | Mutant glutamate dehydrogenase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate | |
| KR101991207B1 (en) | cAMP receptor protein variant and method for producing L-amino acid using the same | |
| US9611490B2 (en) | Biological method for producing cis-5-hydroxy-L-pipecolic acid | |
| US20220348974A1 (en) | Biotin synthases for efficient production of biotin | |
| KR20140040509A (en) | Method for preparing d- chiro-inositol by using the microorganism | |
| KR102149044B1 (en) | Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid | |
| US9353390B2 (en) | Genetically engineered microbes and methods for producing 4-hydroxycoumarin | |
| EP2820141B1 (en) | Novel oxidoreductases for enantioselective reactions | |
| LU100521B1 (en) | Improved biotechnological production of L-tryptophan | |
| US20170089931A1 (en) | METHOD FOR CELL-FREE PROTEIN SYNTHESIS INVOLVED WITH pH CONTROL BY USING ENZYME | |
| KR101762135B1 (en) | Analysis method of activity for human phenylalanine hydroxylase using Dictyostelium discoideum | |
| EP2559758A1 (en) | Modified glyceraldehyde-3-phosphate dehydrogenase from corynebacterium glutamicum and uses thereof | |
| US10947523B2 (en) | Biotechnological production of L-tryptophan | |
| EP3333263B1 (en) | Diphosphomevalonate decarboxylase variant and method for manufacturing olefin compound using same | |
| US6800464B2 (en) | Arthrobacter D-carbamoylase and methods of preparing enantiomerically enriched D-amino acids | |
| US11162082B2 (en) | Mutant phosphoserine aminotransferase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate | |
| US7198932B1 (en) | Gdp-4-keto-6-deoxy-d-mannose-3,5-epimerase-4-reductase gene derived from arabidopsis thaliana | |
| US9499825B2 (en) | Dual inducible system for the condensed single protein production system | |
| US20240294927A1 (en) | Polyamine conjugate producing yeasts |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FG | Patent granted |
Effective date: 20190527 |