LT6625B - Bacterial preparation for oxydation of oil products and their use - Google Patents

Abstract

The present invention relates to biological degradation of oil hydrocarbons in soil. To achieve this goal, a biopreparation containing non-pathogenic Acinetobacter calcoaceticus BT 8 bacteria, capable of digesting hydrocarbons and, in addition, absorbing nitrogen from the air and using it as a mineral, is used. The amount and mineral composition of the biopreparation are chosen based on the concentration of oil pollutants in the contaminated soil.

Description

Field of the Invention

The present invention relates to a composition of an oil-decomposing microorganism and its use for the recovery of oil and its derivatives from contaminated soil.

State of the art

Oil is a complex mixture of hydrocarbons and other organic compounds. It contains hundreds or thousands of aliphatic, branched, and aromatic hydrocarbons (Wang et al. 1998), most of which are toxic to living organisms.

Physico-chemical and biological methods are commonly used for cleaning contaminated soil. Physico-chemical treatment methods include incineration, thermal desorption, coking, solvent extraction, landfilling and so on. However, these techniques either render the soil unusable (incineration) or do not eliminate the underlying problem (landfill). In addition, in Europe, legislation requires that all landfills be reduced and that as much waste as possible be recycled.

Back in 1946 Claude E. ZoBelI discovered that many microorganisms can use hydrocarbons as their sole source of carbon and energy. He also found that the use of hydrocarbons was highly dependent on the chemical nature and environmental factors of the components of petroleum blends (Jain et al. 2011). The use of microorganisms for the rehabilitation of hydrocarbon contaminated sites is carried out by utilizing oil oxidizing microorganisms, in particular native bacteria and fungi in the soil. These microorganisms can degrade many of the constituents present in petroleum waste (Eriksson, Dalhammar, and Borg-Karlson 1999; Barathi and Vasudevan 2001; Mishra et al. 2001). Although fungi also have oil-oxidizing properties, their growth is relatively slow, making them difficult to adapt to field conditions and high levels of contamination (Mohsenzadeh, Chehregani Rad, & Akbari 2012). To accelerate the biodegradation of oil-contaminated soils, the soil is treated with artificially cultivated oil-oxidizing microorganisms that use petroleum hydrocarbons as a food source and decompose them into harmless substances: CO2 and H2O.

Acinetobacter species are widespread and can be extracted from water, soil, living organisms and even from human skin. These are immobile, negative oxidases, strictly aerobic, gram negative cocobacilli. They can use a variety of carbon sources for growth and can be grown in relatively simple media, including nutrient agar or trypticase soy agar (Abdelhaleem 2003). The bacteria of the genus Acinetobacter, due to their diversity, produce many substances used in biotechnology. Some species of Acinetobacter produce large amounts of polysaccharides, polyesters and lipases. However, industrially important emulsifiers such as emulsin (Gutnick et al. 1980), OmpA (Walzer, Rosenberg, and Ron 2006) or Alasan (Toren et al. 2002) are important. Emulsifiers are particularly useful in the decomposition of hydrocarbons because they help to emulsify petroleum and its derivatives, thereby accelerating the degradation process. Some Acinetobacter species have been observed for a couple of decades ago to decompose oil and its derivatives, but good results have been achieved only under laboratory conditions due to the inhibitory properties of oil and the lack of aeration in soil and liquid media (Hanson et al. 1997). Not only nutrients, but also micronutrients such as nitrogen, potassium, phosphorus, sulfur, magnesium, calcium, etc., are essential for the growth and growth of all microorganisms. Some of them are vital because they contain DNA (nitrogen, phosphorus), amino acids (nitrogen, sulfur) and cell walls (phosphorus, calcium).

However, trace elements can also influence the bioremediation of various petroleum components. Biodegradation of aromatic hydrocarbons is particularly sensitive to changes in pH. Foght et al. 1999 investigated the role of the nitrogen source in the biodegradation of petroleum components under cold marine conditions (10 ° C). Nitrates had no effect on pH, but changes in ammonium led to acidification, which reduced the degradation of aromatic compounds (Margesin and Schinner2001). Such results indicate the importance of proper adaptation of the conditions in which the microorganisms decompose contaminants and the constant monitoring of changes in those conditions. Due to the volatile weather conditions and the absence of observations, many bacterial agents do not perform as expected in laboratory experiments alone. Thus, many inventions related to the biodegradation of petroleum are not practicable or operate only under closed and controlled conditions and cannot be applied to large areas of contaminated soil.

The essence of the invention

The technology for utilizing a bacterial agent to decompose oil contaminants comprising microorganisms of Acinetobacter calcoaceticus BT 8 is based on the cultivation of bacteria selected from the soil and their use for oil degradation. The present invention accelerates the soil remediation process and is superior to other industrially prepared formulations because it utilizes the ability of the microorganism to fix nitrogen in the air, thereby reducing the need for added fertilizers.

Detailed Description of the Invention

The present invention describes a novel bacterial preparation capable of efficiently, safely and cheaply oxidizing oil pollutants in soil and converting them into harmless chemicals. The developed bacterial preparation has a lower mineral nitrogen requirement because it uses the A. calcoaceticus BT 8 bacterium to capture gaseous nitrogen in the air and convert it into a mineral to support a variety of vital functions.

In one embodiment of the invention, a bacterial preparation consisting of selected A. calcoaceticus BT 8 bacteria and a mineral fertilizer that is nitrogen-free is used. This preparation was tested under laboratory conditions at a petroleum contaminant concentration of 181 g / kg.

In another embodiment of the invention, a bacterial preparation comprising selected A. calcoaceticus BT 8 bacteria and a mineral fertilizer comprising nitrogen is used. The preparation was tested under laboratory conditions at a concentration of 181 g / kg of oil pollutants.

In another embodiment of the invention, the bacterial preparation is used in a specialized manner by freezing and thawing the bacterial preparation after cultivation only prior to spraying on oil-contaminated soil, wherein the amounts of formulation and mineral fertilizers are selected based on soil contamination and expected additional spraying schedules.

Description of Drawings Fig. Shown are the petroleum hydrocarbons content after a month-long laboratory experiment with an initial contaminant of 181 g / kg. The effect of the biopreparation with and without mineral nitrogen source is compared.

Fig. The breakdown of petroleum hydrocarbons under field conditions with an initial oil concentration of -189 g / kg is shown. Experiment duration - 8 weeks.

Tools and methods

Appliances: KERN PCB 2500 technical scales, KERN ABJ 220 analytical balance, Thermo Scientific laminar flow cabinet, Thermo Scientific MaxQ 4450 shaker, Thermo Scientific Heratherm IGS60 thermo-incubator, EDF-5.4_1 Biotechnical Center , Autoclave AL02-10 Advantage-Lab, GENESYS 10S UV-Vis Spectrophotometer Thermo Scientific.

Reagents:

Table. Reagents used in the preparation of the bacterial preparation.

Yesterday no Regent CAS number Formula Manufacturer 1. Nutrient medium CM001B - Oxoid 2. Bacteriological agar LP011B - Oxoid 3. Diesel - - Statoil 4. Rectified alcohol - - Vilnius Vodka 5. Di-ammonium hydrophosphate 7783-28-0 (NH ₄ ) 2 HPO ₄ Fisher Scientific 6th Ammonium chloride 12125-02-9 nh ₄ ci Acros Organics 7th Potassium dihydrophosphate 7778-77-0 KH2PO4 Fisher Scientific 8th Di-potassium hydrophosphate 7758-11-04 K2HPO4 Fisher Scientific 9th Manganese sulphate 7785-87-7 MnSO4 Roth 10th Moro salt 7783-85-9 FeSO4 • (NH ₄₎ SO 4 Fisher Scientific 11th Calcium chloride 10043-52-4 CaCl ₂ Fisher Scientific 12th Glucose 492-62-6 - Acros Organics 13th Sodium chloride 7647-13-5 NaCl Fisher Scientific 14th Deionized water Water quality level III - - 15th Tap water - - - 16th Sodium alkali 1310-73-2 NaOH Sigma-aldrich 17th Phosphoric acid 13598-36-2 H3PO4 Sigma-aldrich 18th Potassium permanganate 7722-64-7 KMnO ₄ Fisher Scientific 19th Technical oil - - Sanitex 20th Nutritional sugar - - Sanitex 21st Molasses - - Sanitex

Methods:

Selection of microorganisms

In order to develop a bacterial preparation for the treatment of oil pollutants in soil, a selective selection method was used to extract microorganisms from soil samples contaminated with hydrocarbons. Samples were taken from an old garage car repair shop, taking samples of oil-contaminated sludge. Isolation of the desired isolates was performed on the agarized medium by culturing isolated microorganisms where the only source of carbon in the medium was hydrocarbons. The most successful microorganisms were used in other experiments.

Selection of nitrogen fixing microorganisms

Isolated oil-oxidizing isolates were grown on agarized medium without nitrogen sources. During the experiment, only those oil-oxidizing isolates that were capable of trapping gaseous nitrogen in the air and converting it into mineral matter were required to support various vital functions.

Specification of the micro-organism

In order to confirm the species isolated, it was identified in the BASECLEAR laboratory in the Netherlands. The microorganism was identified using a validated MicroSeai system from Applied Biosystems. This automated system is based on PCR amplification and DNA sequencing of the bacterial 16S rRNA gene. The A. calcoaceticus BT8 16S rRNA gene sequence - SEQ ID NO. 1:

GATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAGCGGAGTGA TGGTGyTTGCACTATCACTTAGCGGCGGACGGGTGAGTAATGCTTAGGAATCTG CCTATTAGTGGGGGACAACATTTCGAAAGGAATGCTAATACCGCATACGTCCTA CGGGAGAAAGCAGGGGATCTTCGGACCTTGCGCTAATAGATGAGCCTAAGTCG GATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCTGTAGCGGGT CTGAGAGGATGATCCGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG GAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGC CGCGTGTGTGAAGAAGGCCTTATGGTTGTAAAGCACTTTAAGCGAGGAGGAGG CTACTGAAGTTAATACCTTCAGATAGTGGACGTTACTCGCAGAATAAGCACCGG

CTAACTCTGT.

The gene sequence was found to be 99.94% identical to the A. calcoaceticus 16S rRNA gene sequence found in the laboratory database. Species identification confirmed that the bacterium we isolated was non-pathogenic and suitable for use in soil bioremediation.

Preparation of A. calcoaceticus BT 8 biopreparation

To ensure that A. calcoaceticus BT8 will be effective under field conditions, the microorganism is cultured in a simple nutrient medium with reduced mineral nitrogen under aerobic conditions. At the end of cultivation, the biopreparation is prepared for freezing at -18 ° C by adding 10% (v / v) molasses. Mix the culture liquid with molasses well, dispense and freeze.

Examples of use of a biopreparation

Examples of the use of the bacterial preparation are given here. The invention is not limited to the following examples.

example

The cultivated and frozen preparation of A. calcoaceticus BT8 was thawed under laboratory conditions, diluted with water-supplemented mineral fertilizer (P, K) and poured into 50 ml 1 L containers containing oil-contaminated soil. The dishes were stored at room temperature (~ 22 ° C) for one month. Each week, the soil was mixed and additional amounts of biopreparation and water were added. Weekly soil hydrocarbons were measured. The experimental conditions are shown in Table 2.

table

The vessel number 1 2 3 4 Initial oil content in g / kg 181 181 181 181 Amount of biopreparation in ml 0.5 1 2 5 Water content in ml 49.5 49 48 45 Final oil content in g / kg 101 91 84 93

example

The cultivated and frozen preparation of A. calcoaceticus BT8 was thawed under laboratory conditions, diluted with water-supplemented mineral fertilizer (N, P, K) and placed in 50 ml 1 L containers containing oil-contaminated soil. The dishes were stored at room temperature (~ 22 ° C) for one month. Each week, the soil was mixed and additional amounts of biopreparation and water were added. Weekly soil hydrocarbons were measured. The experimental conditions are shown in Table 3.

In this experiment, it was found that the addition of nitrogen to the medium resulted in a slight change in hydrocarbon decomposition. A comparison of the results of the first and second examples is presented in Fig. 1.

table

The vessel number 1 2 3 4 Initial oil content in g / kg 181 181 181 181 Amount of biopreparation in ml 0.5 1 2 5 Water content in ml 49.5 49 48 45 Final oil content in g / kg 99 88 80 94

example

The cultivated and frozen preparation of A. calcoaceticus BT8 was thawed before use and after 1 L was applied to 4 m ² soil contaminated with oil (189 g / kg). The preparation was diluted 1:20 with mineral fertilizers (P, K, N) and water. The nitrogen content of the mineral fertilizer mixture was reduced to 50 mg / kg of contaminated soil. Half of the diluted biopreparation was sprayed on the rotated soil with a layer thickness of ~ 30 cm, after the application the soil was rotated again and the second part of the biopreparation was sprayed. Each week the soil was remixed and biopreparation and water were added. Weekly soil hydrocarbons were measured. The field experiment lasted 2 months. The experimental conditions are shown in Table 4.

table

The week 0 1 2 3 4 5 6th 7th 8th Oil hydrocarbons in g / kg 189 165 143 119 90.6 79.7 69.6 53.2 41.3

This experiment has shown that, according to our invention, smaller amounts of nitrogen fertilizers are required for efficient hydrocarbon decomposition under field conditions.

The optimal operating conditions and explanations of the bacterial preparation we have developed are presented in Table 5.

Table. Optimal parameters of bacterial preparation.

The parameter Boundaries Explanations Petroleum products concentration, g / kg 1-300 Concentration of petroleum products does not significantly influence the efficiency of petroleum hydrocarbon decomposition Oil-oxidizing micro-organisms, CFU / g > 10 ⁶ At lower titres, the soil is further treated with a biological preparation Humidity,% 35-60 <35 - additional watering required > 60 - more frequent application of soil is required Orthophosphates, mg / kg 1000-3000 In the event of a deficiency of orthophosphates, an estimated amount of fertilizer is added pH 5.7-8.2 The pH is adjusted with 0.1% NaOH / HsPCU aqueous solution

Literature

1. Abdelhaleem, Desouky. 2003. Acinetobacter: Environmental and Biotechnological Applications. T. 2.

2. Barathi, S., and N. Vasudevan. 2001. "Utilization of Petroleum Hydrocarbons by Pseudomonas Fluorescens Isolated from a Petroleum-Contaminated Soil." Environment International 26 (5-6): 413-16.

3. Eriksson, M., G. Dalhammar, and A. K. Borg-Karlson. 1999. "Aerobic Degradation of a Hydrocarbon Mixture in Nature Uncontaminated Potting Soil by Indigenous Microorganisms at 20 Degrees C and 6 Degrees C." Applied Microbiology and Biotechnology 51 (4): 532-35.

4. Gutnick, DL, EA Bayer, C Rubinovitz, O Pines, Y Shabtai, and E Rosenberg. 1980. Emulsan production in Acinetobacter RAG-1. Adv. Biotechnol 11: 455-59.

5. Hanson, K. G., A. Nigam, M. Kapadia, and A. J. Desai. 1997. Bioremediation of Crude Oil Contamination with Acinetobacter Sp. A3. ”Current Microbiology 35 (3): 191-93.

6. Jain, PK, VK Gupta, RK Gaur, M Lowry, DP Jaroli, and UK Chauhan. 2011. Bioremediation of petroleum oil contaminated soil and water. Research journal of environmental toxicology 5 (1): 1.

7. Margesin, R., and F. Schinner. 2001. "Biodegradation and Bioremediation of Hydrocarbons in Extreme Environments." Applied Microbiology and Biotechnology 56 (5-6): 650-63.

8. Mishra, S., J. Jyot, R. C. Kuhad, and B. Lai. 2001. Evaluation of Inoculum

Addition to Stimulate in Sith Bioremediation of Oily-Sludge-Contaminated Soil. ”Applied and Environmental Microbiology 67 (4): 1675-81.

doi: 10.1128 / AEM.67.4.1675-1681.2001.

9. Mohsenzadeh, Fariba, Abdolkarim Chehregani Rad, and Mehrangiz Akbari. 2012. "Evaluation of oil removal efficiency and enzymatic activity in some fungal strains for petroleum-polluted soils". Iranian Journal of Environmental Health Science & Engineering 9 (1): 26. doi: 10.1186 / 1735-2746-9-26.

10. Toren, Amir, Elisha Orr, Yossi Paitan, Eliora Z. Ron, and Eugene Rosenberg. 2002. "The Active Component of the Bioemulsifier Alasan from Acinetobacter Radioresistens KA53 Is An OmpA-Like Protein." Journal of Bacteriology 184 (1): 165-70.

11.Valzer, Gil, Eugene Rosenberg, and Eliora Z. Ron. 2006. "The Acinetobacter Outer Membrane Protein A (OmpA) is a Secreted Emulsifier." Environmental Microbiology 8 (6): 1026-32. doi: 10.1111 / j.1462-2920.2006.00994.x.

12. Wang, Z., M. Fing, S. Blenkinsopp, G. Sergy, M. Landriault, L. Sigouin, J. Foght, K. Semple, and D. W. Westlake. 1998. "Comparison of Oil Composition Changes Due to Biodegradation and Physical Wetting in Different Oils." Journal of Chromatography. A 809 (1-2): 89-107.

Claims (8)

Definition of the invention 1. A bacterial preparation for the oxidation of petroleum products, characterized by the use of the microorganisms of Acinetobacter calcoaceticus BT 8 and the additional micro-nutrients necessary for the growth and development of microorganisms, where the micro-organisms of A. calcoaceticus BT 8 carry out the fixation of airborne nitrogen. A bacterial preparation according to claim 1, characterized in that the trace elements are selected from the group consisting of phosphorus, potassium and nitrogen. The bacterial preparation according to claims 1-2, characterized in that the nitrogen content of the biopreparation is up to 50 mg / kg of contaminated soil. The bacterial preparation according to claims 1 to 3, characterized in that the A. calcoaceticus 16S rRNA sequence is at least 99% identical to SEQ ID NO. 1. A bacterial preparation according to claims 1-4, characterized in that the preparation prepared is frozen before use. Use of a bacterial preparation according to claims 1-5 for the degradation of oil contaminants in the soil. Use of a bacterial preparation according to claim 6, characterized in that soil aeration and irrigation are used to accelerate the decomposition of the pollutants. Use of a bacterial preparation according to claims 6-7, characterized in that the bacterial preparation is sprayed on the soil twice a week.