LT6340B - DNA SYNTHESIS OF 5-HYDROXIMETHYL-CYCLES - Google Patents

Abstract

A 5-hydroxymethylated CG sequence locus is provided in the genomic DNA method, which involves the action of the DNA under investigation on the nucleic acid polymerase when the nucleic acid polymerase synthesizes the nucleic acid molecule from a matrix having covalent inter-nucleotide linkages at the sites of said 5-hydroxymethylated CG sequences.

Description

Field of the Invention

The present invention relates to sequence-specific modification of methyltransferases and analysis of 5-hydroxymethylcytosine residues in DNA, in particular to the selenols attachment of methyltransferases to the 5-hydroxymethyl group in said residues, and covalent linking of these residues to adjacent D-linked nucleotides. at sites that reveal sites for 5-hydroxymethylcytosine residues in genomic DNA.

BACKGROUND OF THE INVENTION

Covalent modification of cytosine at position 5 is one of the best-studied epigenetic mechanisms of DNA regulation in organisms from plants to mammals. The primary epigenetic modification of DNA is 5-methylcytosine (5mC), which is formed by the transfer of the methyl group from the cofactor SAM by DNA methyltransferases. This DNA modification is widespread in the mammalian genome of CpG sequences. However, new studies have shown that 5mC can be converted to 5-hydroxymethylcytosine (hmC) and then to 5-formylcytosine or 5-carboxylcytosine under the action of TET oxygenases. Although hmC is the second most commonly encountered modification of DNA (Tahiliani et al., 2009, Science, 324, 930-935; Kriaucionis & Heintz, 2009, Science, 324, 929-930), its biological significance has not been sufficiently explored, largely due to the study. imperfection of methods. Recently, we discovered an atypical methyltransferase-mediated reaction that produces hmC. hmC can be further modified by methyltransferase in the absence of its natural cofactor SAM (Liutkeviciute et al., Nat Chem. Biol. 2009, 5: 400-402). Recently, we have discovered that hmC residues can be selectively modified with thiol arselenols to form respectively 5-alkylthiomethylcytosines or 5-alkylselenomethylcytosines in specific DNA sequences in vitro (Liutkeviciute et al., Angew. Chem. Int. Ed. 2011, 50, 2090-2093 ). It has been reported that upon oxidation with mild oxidants, such as NaJO4, similar derivatives of 5arylselenomethylpyrimidines can form covalent methylene bridges with adjacent purines in the same or another chain (Peng et al., 2008, J Am Chem Soc 130,10299-10306; Ding et al. , 2008 J Am Chem Soc 130,17981-17987); the reaction is believed to occur via the sigmatropic rearrangement of 5-arylselene (oxy) methylpyrimidines to form the electrophilic 5-methylencytosine derivative (IV, Fig. 1), which reacts actively with neighboring guanine nucleobases (Romieu et al. 2000 Org Lett2,1085-1088; Bellon et al. 2001 Nucleosides Nucleotides & Nucleic Acids 20, 967-971; Zhang and Wang 2003, J Am Chem Soc 125,12795-12802; Bellon et al. 2006, Org Biomol Chem.

4, 3831-3837; Hong et al. 2006, J Am Chem Soc 128, 485-491; Ding et al. 2008 J Am Chem Soc 130, 17981-17987; Peng et al. 2008; J Am Chem Soc 130,10299-10306).

The essence of the invention

Here, for the first time, it has been demonstrated that sequencing-specific covalent bonds between hmC and adjacent guanine (intra-chain guaninomethylcytosine adduct G ^A mC) are formed by the action of DNA aliphatic selenol and the presence of DNA C5-MTase followed by gentle oxidation of NaJO4; the resulting linkage results in the interruption of DNA polymerase daughter DNA synthesis, which allows the location of hmC in the DNA.

For the analysis of hmC modifications in the CG dinucleotides, we used the MTases M.Sssl and M.Hhal, whose recognition sequences are CG and GCGC (modifies underlined cytosine). In the demonstration experiments we used a model DNA substrate containing hmC nucleotide modified with selenol (2-aminoethane-selenol, R1-SeH; L-selenocysteine, R2-SeH and 2- (2-aminoethoxy) -ethanselenol, R3-SeH) in the presence of one of the MTases. NalO4.

It is known that DNA polymerase DNA strand extension reaction hangs at the bound nucleotides in the matrix to form a shorter daughter strand of DNA. Indeed, during chain extension reactions with T4 DNA pol. (Fig. 2) or Taq DNA pol. (Fig. 3), using DNA matrix-periodinated samples, interruption of DNA strand synthesis at positions corresponding to selenol-modified hmC residues was observed, thereby demonstrating the presence of hmC in the DNA. No chain break was observed in control experiments in the absence of MTase or in the presence of NalO4.

Picture descriptions

The present invention will be further described with reference to the drawings in which:

Fig. 1. Schematic of a chemo-enzymatic reaction which describes MTase-mediated selenol binding, oxidation and covalent hmC residue cross-linking leading to DNA polymerase trapping at the bound nucleotides.

Fig. 2. Sequence-specific detection of hmC modifications in DNA using a polymerase chain extension reaction. DNA-containing hmC modifications in GCGC sequences were incubated with M.Hhal and selenol, oxidized with NalO4, and analyzed by polymerases. Initial extension reactions using DNA matrix-periodinated samples (lanes 2, 4, and 6) resulted in interruption of DNA strand synthesis at positions corresponding to selenol-modified hmC residues. Sanger sequencing tracks (G, C, T, A) enable DNA sequence alignment, GCGC targets are highlighted.

Figure 3. Detection of hydroxymethylated CG targets in DNA using polymerase chain extension reaction. The 618 bp DNA fragment, in which all cytosines were converted to hmC, was incubated with M.sssl and selenol oxidized with sodium periodate and finally analyzed in Taq polymerase primer extension reactions. Initial extension reactions using periodate oxidized samples (lanes 3 and 5) clearly show the formation of shorter DNA strands terminating at hmC nucleotides. Sanger sequencing tracks (G, C, T, A) enable DNA sequence alignment, CG targets are highlighted.

Detailed Description of the Invention

Preparation of DNA substrates

Oligonucleotides

DNA oligonucleotides (purified by HPLC) were obtained from IDT (US), IBA (Germany) or Metabion (German)

Preparation of DNA substrates

The 618 bp and 1252 bp DNA fragments were prepared by standard PCR using the pUC19 plasmid template and primer pairs 5'AACGTTGTTGCCATTGCTAC, 5'-GCTCATGAGACAATAACCCTGA or 5'CTCAACCAAGTCATTCTGAGAATAGTG, 5'-GATGTG, respectively. After PCR amplification, DNA fragments were purified using the QIAquic PCR Purification kit (Qiagen). DNA containing hmC residues in GCGC sequences prepared by (Liutkeviciute et al., Nat Chem. Biol., 2009, 5: 400-402) was incubated with 120 ng / μΙ DNA with 8 μΜ M.Hhal and 13 mM formaldehyde for 1 h. at room temperature in reaction buffer (10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 0.5 mM Na2EDTA 0.2 mg / ml BSA) and purification of the resulting DNA with QIAquick PCR Purification Kit.

Sequence-Specific Detection of hmC Modifications in DNA Using Primer Extension Reaction hmC analysis of GCGC sequences (M.Hhal reactions). The 1252 bp PCR fragment (38 ng / pl, 0.44 μΜ target almost) was exposed to M.Hhal (5 μΜ) and 12.5 mM selenol in reaction buffer (15 mM Na-citrate pH 5.5, 0.2 mg / ml BSA) 1 or. at room temperature. DNA was purified using the QIAquick PCR Purification Kit and incubated with 10 mM NalO4 (10 mM Na-PO4 in pH 7.5 buffer) for 1 h. at room temperature, and purification by kit is repeated.

Primer extension reactions using T4 DNA polymerase. Modified DNA was heated for 3 min. 95 ° C and then suddenly transferred to ice. 20 nM 5 'labeled primer (5'-GATACCGCTCGCCGCAG), 0.2 mM dNTP and buffer (T4 polymerase buffer, Thermo Fisher Scientific) were added to the denatured cold DNA solution. Primer hybridization was performed for 3 min. 54 ° C, then transferring the sample to ice again. Samples were incubated for 20 min with the addition of T4 polymerase (0.031 units / pl). 37 ° C temp. The reaction was stopped by the addition of 1/3 volume of STOP solution (Thermo Fisher Scientific).

DNA sequencing reactions (for comparison runs) were performed using the CycIeReader ™ DNA Sequencing Kit (Thermo Fisher Scientific).

hmC analysis in CG sequences (M.Sssl reactions). The 618 bp PCR fragment (63 ng / pl, 5 pM target almost) was exposed to M.Sssl (10 pM) and 12.5 mM selenol in reaction buffer (50 mM Na-acetate pH 6.0, 0.2 mg / ml BSA). ) 1 or. at room temperature. DNA was purified using the QIAquick PCR Purification Kit and incubated with 10 mM NalO4 (10 mM Na-PO4 in pH 7.5 buffer) for 1 h. at room temperature, and purification by kit is repeated.

Primer extension reactions using Tag DNA polymerase. Modified DNA and controls were sequenced using 0.2 mM dNTP, 130 ng DNA, 50 nM 5 'labeled primer 5'-AACGTTGTTGCCATTGCTAC and 0.125 units / Ta Taq pol. 8 pi in reaction volume with Sequencing buffer. PCR reaction conditions: 1) 95 ° C for 3 min, 2) 95 ° C for 1 min, 3) 49 ° C for 1 min, 4) 72 ° C for 1 min; steps 2-4 are repeated 25 times. The PCR reaction was stopped by the addition of 4 pi STOP solution (Thermo Fisher Scientific).

Preparation of Selenol

Selenols (R-SeH) were prepared immediately before use from the corresponding diselenides (RSe-Se-R) by reduction with dithiothreitol (DTT). The diselenides R1-Se-Se-R1 and R2Se-Se-R2 are commercially available compounds, at which point diselenide R3-Se-Se-R3 was synthesized according to the following procedures:

Claims (5)

DEFINITION OF INVENTION CLAIMS 1. A method for determining 5-hydroxymethylated CG sequences in DNA, comprising the step of subjecting a matrix nucleic acid sequence to a nucleic acid polymerase under conditions which allow the nucleic acid molecule to produce a nucleic acid molecule from the matrix. -hydroxymethylated CG at position. 2. The method of claim 1, wherein said internucleotide covalent bond at the 5-hydroxymethylated CG site is achieved by treatment of DNA with aliphatic selenol in the presence of methyltransferase followed by oxidation with mild reagents. 3. A process according to claim 2, wherein the aliphatic selenol is selected from 2-aminoethylselenol, L-selenocysteine and 2- (2-aminoethoxy) ethylselenol. 4. The method according to claim 2 or 3, wherein said methyltransferase is DNA cytosine-5 methyltransferase, preferably M.Hhal or M.SssI. 5. A process according to any one of claims 2-4, wherein said mild reagent is NalO4.