LT4034B - Process for enzymatic decomposition of recombinant proteins by means of iga-protease, fused protein, recombinant dna, cell - Google Patents

Abstract

A method is claimed for prepg. proteins or peptides without a terminal methionine gp. from peptides and proteins with the sequence Met-Y-X-Pro-A (I), where X = Thr, Ala or Ser; Y = an amino acid sequence contg. at least two residues, which ends with the sequence Pro (or when X = Ser) can end with Pro-Ala-Pro; A = a further amino acid sequence. The method involves transforming a prokaryotic cell with a recombinant DNA and/or a recombinant vector coding for (I). The transformed cell is cultivated and the Met-Y-X-Pro-A is recovered from the medium, and cleaved with an IgA protease. The first cleavage prod., a G-CSF deriv. which has the sequence X-Pro-A, is isolated. Also claimed is the recombinant G-CSF itself and medicaments contg. it. USE/ADVANTAGE - The X-Pro-A produced has no N-terminal methionine; such peptides are difficult to synthesise by prior methods. It is a G-CSF deriv. useful for treatment of cancer and leukaemia, in bone marrow transplants, and for treating burns and opportunistic infections affecting patients with weakened immune systems.

Description

The invention relates to a sequence-specific digestion of protein obtained by biotechnology using IgA-proteinaseases (also called truths), and more particularly to a method for obtaining N-terminal amino acid residues from recombinant proteins or peptides.

Biotechnology produces proteins using microorganisms that are easily cultured and purified in a simple way. Suitable microorganisms are, for example, the gram-negative bacteria Escherichia coli, the gram-positive bacterium Streptococcus carnocus and the baking yeast Saccharomyces cerevisiae. But, the expression of authentic foreign genes in such microorganisms is frequent

For example, E. coli transmissions at the N-terminus have present natural disadvantages. in proteins, methionine in proteins is efficiently cleaved by proteinases in most cases. But the first amino acid residue of a foreign protein is only partially cleaved at the N-terminus of the protein. Therefore, the preferred method of preparing such proteins having an amino acid residue other than methionine at the N-terminus is to first obtain the fusion protein and then cleave it with a specific proteinase.

In addition, unlike authentic proteins, fusion proteins have the advantage that they are incorporated into embedded cells in the microorganism cell during expression and can be easily separated from other parts of the cell and thus facilitate the isolation and purification of the target protein. On the other hand, carrier proteins that are fused to the target protein by genetic engineering, the target fusion protein acquires resistance to nonspecific proteinolysis; this problem of proteolysis of foreign proteins is crucial for the production of small peptides by biotechnology. Using other carrier proteins, it is possible to make the target protein localized at certain locations in the cell where it is stable and / or readily available, which allows for the purification of the target protein easily. Finally, carrier proteins can have specific properties and can effectively purify fused proteins, for example by affinity chromatography. In most cases, such a fusion protein is constructed with a carrier protein at its N-terminus and a target protein at its C-terminus. However, in some cases, the reverse variant may be useful or the target protein is fused to two proteins at the ends of the target protein. In addition, it may be advantageous to reverse the target protein in the fusion protein.

To obtain the free target protein from the fusion protein, it is necessary to cleave the covalently linked proteins. This can be done using chemical or biochemical (enzymatic) methods. But often this is limited by the low specificity of the approaches to date; since cleavage at the junction of the two components, i.e., in the intermediate region, but in no way additionally outside the target protein, is important to obtain the target protein. Therefore, the breakdown of the components must be very specific.

To date, chemical methods of fusion protein cleavage have been used, such as cyanide bromide cleavage through a methionine residue in the middle of the protein and cleavage between AspPro in acidic medium with formic acid. But these pathways are appropriate only when the specific cleavage site does not replicate in the target protein. In general, biochemical cleavage methods are more favorable than chemical ones, since biochemical cleavage is carried out under physiological or, at worst, chemically mild reaction conditions without affecting the target protein.

an overview of the methods used so far

Specific proteinases are used in biochemical cleavage of fusion proteins. For example, trypsin cleaves an intrinsic peptide junction between arginine or lysine protein inside. Specificity can be increased by pre-chemically modifying lysine, in which case cleavage will only occur after the arginine residue. Another proteinase used in biotechnology is clostripain; this enzyme cleaves the peptide to link between arginine and any other amino acid residue behind it. Prior to enzymatic cleavage of fusion proteins, it has been written by G. A. O. Ma ([D.M. Clover, E.]: DNA Cloning III, IRL Press, Oxford, Vashington, 1987). Enzymatic cleavage pathways have limitations because the specific cleavage site may also be present in the target protein. Therefore, enzymes whose specificity is determined not by a single amino acid residue but by a certain recognizable sequence of amino acid residues are best suited for the biochemical degradation of fusion proteins; the likelihood of repetition of the recognition sequence to be between the fused components in the target protein is reduced, the more amino acid residues are present in the recognition and cleavage sequence.

Proteinases are known to cleave proteins very specifically. Although most such specific proteinases (which are present, for example, in the complementary human blood clotting system) are cleaved at a particular site on the substrate; but when this cleavage site is transferred to another protein (such as a fusion protein), proteinases, as a rule, fail to cleave the protein. This is due to various reasons, such as these proteinases recognizing the secondary and tertiary structure of the substrate or rendering the fusion protein inaccessible to the enzyme.

Factor Xa is one of the specific sequence-recognizing proteinases that have hitherto been used to cleave fusion proteins. This proteinase cleaves the specific sequence Ile-Glu-Gly-Arg-. |.-X, where |. is the cleavage site and X is any amino acid residue. However, this proteinase is also not universal for fusion protein cleavage, which has a recognition and cleavage site in the intermediate region; often such substrates (i.e., fusion proteins containing the target protein covalently linked to a carrier protein) are not cleaved at all, only very weakly cleaved, or cleaved when the fusion protein is dissolved.

Efficient cleavage of the fusion protein is crucial for the production of recombinant proteins in prokaryotes. Cloning in the DNA sequence requires the start codon AUG before the protein coding sequence. As a result, prokaryotes, such as E. coli, express proteins in which the first amino acid residue is methionine.

methionine. Such prokaryotes can be assisted by peptidase which

In most cases, it is necessary to obtain recombinant proteins in which the first amino acid residue does not contain proteins synthesized to produce methionine-specific cleaves methionine at the N-terminus of the protein. But this method is susceptible because the cleavage can only be verified by detecting the amino acid residue at the N-terminus of the protein. In addition, it is very difficult, or incomplete, to distinguish between a protein having a methionine at its N-terminus and a protein with cleaved methionine, since these proteins have nearly the same molecular weight.

PCT application WO84 / 02351 discloses the cleavage of amino acid residues at the N-terminus of fusion proteins.

Many amino acid residues at the N-terminus of the protein are sequentially cleaved by exopeptidase, preferably leucine peptidase, to the Χ-Pro sequence. The Χ-Pro sequence is cleaved from the product either in two or one reaction step using postproline-dipeptidyl-aminopeptidase (EC 3.4.14). However, this method has the disadvantage that cleavage of one amino acid residue from one end of the N-protein results in a mixture of products containing, in addition to the target product, a protein which does not contain all the amino acid residues at its N-terminus.

Another method of enzymatic cleavage is disclosed in European patent no. 0 020 290. This method of cleaving fusion proteins having the appropriate recognition sequence utilizes collagenase. After digestion with collagenase, other amino acid residues of the fusion protein can be removed by a second enzymatic digestion. Collagenase and other endopeptidases have been found to have low specificity (see Biocim. Biophys. Act 271 (1972), 133-144). In addition, collagenase is active when proteins have a spatial structure specific for collagenase.

The use of the aforementioned factor Xa to cleave the N-terminus of the fusion proteins is known. However, in addition to the problems of efficient cleavage already mentioned, this method has other disadvantages, such as: apparently, this enzyme recognizes and cleaves the internal regions of the protein. In addition, factor Xa must be purified from the serum of horns and cleaved with proteins used in medical practice, and then further purified and analyzed for evidence of pathogenic factors or viruses.

Various pathogenic bacteria (eg species

Neisseria such as Neisseria gonorrhocae and

Neisseria meningitalis or Haemophillus species (such as Haemophillus_influenzae and Haemophillus aegypticus), which grow in the human mucosa, produce proteinases that are secreted by their sequences, which are closely related to human-specific IgAs, and are therefore called IgA-proteinases or true. Immunoglobulin IgAI is an important component of the secretory immune response that prevents infection of such pathogenic microorganisms (Review: Kornfeld and Plant, Rev. Infect. Dis. 3 (1981), 521-534). In addition, IgA proteinase cleaves its probaltim. Synthesis of IgA-proteinase from Neisseria gonorrhocae MSLL in authentic bacterial strain and Gram-negative host cells is described in detail (VFR Patent No. 36 22 221.6).

IgA proteinase cleaves as described by Pohlner (Nature 325 (1987), 458-462), for example, the following recognition sequences:

1. Pro-Ala-Pro-.-Ser-Pro,

2. Pro-Pro-. | .-Ser-Pro,

3. Pro-Pro. |. -Ala-Pro,

4. Pro-Pro-. |.-Thr-Pro.

Symbol. indicates the IgA-proteinase cleavage site. IgAproteinase cloning is described by Pohlner et al., 1987.

Therefore, it was an object of the present invention to provide an improved biochemical (enzymatic) cleavage method for fusion proteins, wherein the fusion proteins derived from genetic engineering consisting of any component and a specific cleavage site in the intermediate region could be used as substrates to obtain the desired high yield proteins. to make this way repeatable.

This problem was solved by genetic engineering by introducing a recognition sequence or cleavage site Pro-. | -X-Pro into the intermediate region of the fusion protein, specifically cleaving it with an IgA-proteinase-tagged character. where X is preferred for Ser, Thr, Ala, and is particularly preferred for Ser or Thr, but other amino acid residues may also be present.

It is therefore an object of the present invention to provide a method for enzymatically digesting a fusion protein and to obtain a target fusion protein which is characterized in that (1) the intermediate region joining the two fusion proteins is modified by genetic engineering to provide at least one IgA- the proteinase recognition site containing the amino acid residue Y-Pro-. | .-Χ-Pro, where X can be any amino acid residue and Y is one or more amino acid residues, (2) the resulting fusion protein of step (1) is cleaved by an IgA-proteinase symbol. . and (3) upon cleavage one or more desired portions of the fusion protein are obtained.

The term IgA-proteinase according to the present invention encompasses proteinases which specifically cleave IgA which are described, e.g. Infect. Dis. 3, 5215344 (1981). Suitable and recombinant IgA proteinases are described, for example, in the application of VFR patent no. 36 22 221, Proc. Natl. Acad. Sci USA 79 (1982), 7881-7885, Proc. Natl. Acad. Sci USA 80 (1983), 26818

2685, Nature 325 (1987), 458-462 and EMBO Journ. 3 (1984), 1595-1601.

The method of the present invention involves modification of the fusion protein intermediate region, in particular by inserting a nucleotide sequence encoding the IgA-proteinase recognition site into the fusion protein intermediate region, which is inserted before or / and after one or more DNA segments encoding the desired fraction of fused proteins. Chemically synthesized nucleotide sequences are mainly used for this purpose.

Unexpectedly, the method of the present invention has also been found to be particularly suitable for the cleavage of fusion proteins which have no (i.e., pre-intermediate region modification) site of IgA-proteinase recognition.

The IgA proteinase recognition site for the present invention is determined by the amino acid sequence Y-Pro-. Where X may be any amino acid residue and Y may be one or more of any amino acid residue. Preferably X is Ser, Thr or Ala, and it is particularly preferred that Ser or Thr. Y can be a variety of amino acid sequences ending in Pro, Pro-Ala, Arg-Pro, Pro-Arg-Pro, Ala-Pro-Arg-Pro or Pro-Ala-Pro-Arg-Pro.

Therefore, the method of the present invention discloses that the IgAproteinase recognition site together with the cleavage site Pro-? -? - Pro can be inserted into an intermediate region of the fusion protein, e.g., between the protein carrier and the desired protein, using the IgA proteinase to cleave it. the desired protein. At the cleavage site, Pro-. |.-Χ-Pro is inserted at the X position, essentially Ser, Ala or Thr. Further special amino acid residues, especially Pro, can be inserted at the cleavage site for further optimization of the cleavage site.

Particularly desirable amino acid sequences:

a) Pro-Ala-Pro. | Ser-Pro,

b) Pro-Pro. | Ser-Pro,

c) Pro-Arg-Pro-Pro. | Sub-Pro,

d) Pro-Pro .Thr-Pro,

e) Ala-Pro-Arg-Pro-Pro.j .Thr-Pro or

f) Pro-Ala-Pro-Agr-Pro-Pro .Thr-Pro.

Adaptation of the fusion protein cleavage method of the present invention wherein the desired protein is coupled to a protein moiety after cleavage of IgA-proteinase results in a protein having the Χ-Pro sequence at its N-terminus. This sequence, as part of the desired protein, may be useful, useless, or unimportant. This sequence is useful when the desired protein produced by genetic engineering and the native has the corresponding amino acid residues XPro at its N-terminus. Important proteins in biotechnology that have the Χ-Pro sequence at their N-terminus are found in nature.

In contrast to other known fusion protein cleavages, the method of the present invention has the advantages of being unexpectedly universally applicable to cleavage of fusion proteins having a cleavage site in their intermediate region, and of insoluble, soluble, localized membrane for the degradation of bound cell fusion proteins. In addition, the particular advantage of this technique is the ability to digest fusion proteins when they are obtained in microorganisms as inclusion bodies which are easy to purify. Another advantage of this method is that the enzyme used for the cleavage of io can be obtained from the culture fluid of non-pathogenic bacteria at no great cost.

Insertion of the IgAs cleavage site into the intermediate region of the fusion protein is accomplished by genetic engineering. Thus, for example, a nucleotide sequence, or a nucleotide sequence encoding a cleavage site or portion thereof, can be chemically synthesized and inserted by known genetic engineering techniques between the protein-carrier DNA fragments and the desired protein. Accordingly, it is also possible to insert natural nucleotide sequences which encode a suitable cleavage site or part thereof. The gene encoding the fusion protein is inserted in such a way that its expression is controlled (mainly by induction) by a promoter so as to meet the desired requirements for fusion protein synthesis. Prokaryotic or eukaryotic recipients (both of plant and animal origin) can be used for fusion protein synthesis; but potential recipients who do not have a cellular system. Optional carrier proteins may have various functions, depending on what properties they provide to the fusion protein, transfer functions, properties that facilitate purification of the fusion protein, or properties that enhance fusion protein stability, and others. The preferred carrier proteins are explained below.

A corresponding method of cleaving the fusion protein of the present invention is accomplished with the aid of IgAs obtained from a supernatant of a non-pathogenic bacterial strain by purification from a culture fluid (see, for example, VFR Patent No. 36,2221).

The method of the present invention can be used for both preparative and analytical purposes. Biotechnology can provide important proteins that can be applied, for example, in medical practice, research, environmental conservation, industrial processes or products. When used for analytical purposes with other suitable expression systems, this technique can be used, for example, to study standard gene fusion.

Preferred is the method of the present invention for the enzymatic cleavage of a fusion protein to produce portions of a desired fusion protein, wherein (1) the cell is transformed with recombinant DNA or a recombinant carrier, wherein the DNA or carrier comprises at least one gene encoding the fusion protein. at least an IgA proteinase recognition site in the fusion protein copy, (2) transformed cells are grown in a suitable medium, (3) expression of the gene encoding the fusion protein in the transformed cell is achieved, (4) the fusion protein is digested with IgA proteinase, and (5) isolating one or more target portions of the fusion protein.

Cleavage of the fusion protein by IgA proteinase can be performed in culture fluid after cell lysis or / and partial or total removal of cellular protein.

In addition, it is best to cleave the fusion protein, preferably the prokaryotic expression product, immobilized by known immobilization methods known to those skilled in the art, such as those described in European patent no. B 0 141 223; B 0 141 224, IgA proteinase.

It is particularly desirable to use the method of the present invention to obtain recombinant proteins or peptides without methionine at the N-protein end from fusion proteins or peptides having the amino acid residue Met-YPro-. | . -Χ-Pro-A, where X is any amino acid residue, preferably Thr, Ala or Ser, Y is one or more amino acid residues, preferably if X is Thr or Ala, then Y should be Pro, if X is Ser then Y should be Pro-Ala or Pro-Pro, and A is any amino acid residue sequence. The fusion protein or peptide is cleaved by IgAproteinase to give a cleavage product having the amino acid residue sequence: Χ-Pro-A. For example, obtaining the recombinant protein from the N-terminus of prokaryotes without the methionine protein according to this method has the following steps:

(1) transforming a prokaryotic cell into a gene encoding a protein or peptide comprising the amino acid residue Met-Y-Pro-. |.-Χ-Pro-A, wherein X, Y, A are as defined above, (2) ) culturing the transformed cells in a suitable medium and expressing the transformed gene, (3) cleavage of the expression product obtained from the transformed cells comprising the amino acid sequence Met-Y-Pro- | Pro-Pro-A, with (4) followed by a cleavage product containing the amino acid residue sequence Χ-Pro-A but no protein Ngale methionine.

The present invention provides unexpectedly high yield and high specificity single-stage non-methionine-containing proteins having an N-terminal amino acid sequence of Χ-Pro, where X is preferably Thr, Ala or Ser.

The Y portion of the fusion protein carrier is an amino acid sequence of at least one, preferably up to 100 residues, more particularly, having 1 to 50 amino acid residues, and having an IgA-proteinase recognition downstream sequence at its terminus. If X is Ser, then Y should be a Pro-Ala sequence or Pro. If X is Thr or Ala, then Y at the back should be Pro, especially good when Arg-Pro, Pro-Arg-Pro or Ala-Pro-Arg-Pro.

A particularly preferred embodiment is that when Y is a 5 amino acid residue, the end of this sequence should be ProAla-Pro-Arg-Pro. However, all IgA proteinase cleavage sites are used in the method of the present invention.

The y-carrier portion may also contain any other amino acid residue, typically up to 100 residues, most preferably up to 50 amino acid residues. The main amino acid sequences used are those that improve the expression of Met-Y-Pro.? -X-Pro-A at the DNA level and / or facilitate purification of the fusion protein.

The expression of the Met-Y-Pro-.beta.-.alpha.-Pro-A protein at the DNA level can be improved, for example, by fusion to the β-galactosidase gene fragment, i.e., the Y portion of the carrier must contain a portion of the β-galactosidase protein. Other possibilities for increasing the expression of the Met-Y-Pro-. |.-.Alpha.-Pro-A protein are known. When coupled with other polypeptides, particularly those with high charge (e.g., poly (Lys, Arg)) or polypeptides that bind substances with high selectivity (e.g., streptovidin) or proteins that facilitate the isolation and purification of the expression product (see, e.g. , EP No. A 0 089 626, EP No. A 0 306 610).

Another object of the present invention is a fusion protein comprising a plurality of polypeptide moieties which is inserted at least in the intermediate region between the polypeptide moieties and which contains one or more IgA-proteinase recognition domains having the sequence Pro-. wherein X is any amino acid residue, preferably Ser, Thr or Ala. The following recognition sequences are particularly desirable:

(a) Pro-Ala-Pro. | .Ser-Pro, (b) Pro-Pro. | .Ser-Pro, (c) Pro-Arg-Pro-Pro.I.Ala-Pro, (d) Pro- Pro.I.Thr-Pro, (e) Ala-Pro-Arg-Pro-Pro. | .Thr-Pro, or (f) Pro-Ala-Pro-Arg-Pro-Pro. | .Thr-Pro, where the symbol . | indicates the location of cleavage.

The present invention also encompasses a protein or peptide having the following amino acid sequence: Met-Y-Pro-.-XPro-A, wherein X is preferably Thr, Ala or Ser, Y is one or more of any amino acid residue. preferably X is Thr or Ala, then Y must be Pro, or if X is Ser, Y must be Pro-Ala or Pro, and A is any amino acid residue sequence. Such a protein expressed by a peptide according to the present invention is a protein or upon transformation into a recombinant carrier containing at least one copy of a gene encoding such a protein or peptide.

Sequence A represents any sequence of amino acid residues. It is desirable that there is no other IgAproteinase cleavage region within this sequence.

The present invention also relates to recombinant DNA which encodes a protein or peptide and which contains at least an intermediate region of a fusion protein with one or more regions of recognition or cleavage of IgA proteinase.

The recombinant DNA of the present invention can be obtained by known molecular biology techniques. Typically, it is a carrier that encodes the amino acid residue sequence of A, DNA that is cleaved with endonucleases at the 5 'end of this gene and ligated with oligonucleotides that encode the desired sequence. The oligonucleotide must contain the sequence that encodes the IgA proteinase cleavage site or a portion thereof.

Another object of the present invention is a recombinant carrier containing at least one recombinant DNA copy. Basic carriers suitable for protein cloning into prokaryotic organisms are known in the art. A suitable carrier is one which is capable of obtaining recombinant DNA, a large transcription. Transcription of recombinant DNA is usually controlled by an expression induction signal (Fig., Λ, Tac, Iac or trp promoter).

The carrier may be non-chromosomal integrated (eg bacterophage λ).

(eg plasmid),

Essentially, Carriers in a selected biological eukaryote according to the present invention are carriers suitable for the recipient of the gene.

are known Recipients are plasmid. For cloning, the molecules may be Suitable DNA but most commonly, the prokaryotes carriers for the cloning of the present invention in the prokaryotes are commercially available as pUC and pUR carriers.

Another object of the invention is a cell, especially an E. coli cell, which is transformed with recombinant DNA according to the present invention or / and a recombinant carrier according to the present invention.

Examples of proteins having the X-Pro sequence at the N-terminus, wherein X is Thr, Ala or Ser and obtainable in a single step according to the present invention are human erythropoietin, human T-cell receptor chain, and in particular, human granulocyte colony stimulating agent. factor (G-CSF).

G-CSF is synthesized by the activation of lymphokines from activated monocytes, macrophages and other cell lines. Lymphokines are involved in the maturation of cells in the immune system or the blood system.

They stimulate bone marrow cell maturation to cell differentiation. For example, G-CSF induces formation of neutrophylene and granulocytes.

Because G-CSF can rapidly and significantly increase neutrophil cell populations, G-CSF can be widely used in therapy. The G-CSF factor can be used after chemotherapy for the treatment of cancers that kill immune cells. G-CSF can also be used for bone marrow transplantation in the treatment of severe burns, infections due to weak immunity and leukemia.

G-CSF is a secreted protein molecule. Therefore, the signaling sequence of the translation product G-CSF probalt at the N-terminus of the protein is cleaved during secretion, yielding a mature G-CSF with an N-terminus.

Thr (+1) -Pro (+2) (positions of amino acid residues +1 and +2). In prokaryotes, the G-CSF signal peptide is partially or not cleaved, and to obtain G-CSF in prokaryotes without the signal peptide, it is necessary to clone the AUC (Met) codon as the initiating codon before the mature G-CSF coding sequence beginning with Thr (+ 1) -Pro (+2). As a result, prokaryotes such as E. coli express GCSF in which the first amino acid residue is methionine.

The present invention can readily be obtained in prokaryotes without the first amino acid residue-methionine, G-CSF, which has Thr (+1) -Pro (+2) at the N-terminus.

This is accomplished as follows: a derivative of G-CSF is obtained which has the amino acid residue Thr (+1) -Pro (+2) at the +1 and +2 positions and is preceded by a sequence of amino acid residues recognized by IgAproteinase and can be cleaved from G-CSF sequence that starts with Thr (+1) -Pro (+2).

It is preferred that the G-CSF derivative protein sequence at positions -1 and -2 is Pro, at positions 3 to -1 is the amino acid residue sequence Arg-Pro-Pro, and at positions -4 to -1 is Pro-Arg-Pro -Pro or when the position -5 to -1 contains the amino acid residue sequence AlaPro-Arg-Pro-Pro.

A particularly preferred variant of the G-CSF derivative having amino acid residues from position -6 to -1 in the protein sequence is:

-6; -5; -4; -3; -2; -1

Pro-; Ala-; Pro-; Arg-; Pro-; Pro

G-CSF in the present invention is understood to include G-CSF, the sequence of which has been published, for example, Science 232 (1986), 61, as well as derivatives thereof which are characterized by granulocyte stimulation having an amino acid residue sequence beginning with X (+ 1) -Pro ( +2), where Thr, Ser or Ala is present, a particularly preferred variant when X is Thr.

The G-CSF derivative according to the invention can be cleaved after expression in prokaryotes by IgA-proteinase between amino acid residues -1 and +1 (between Thr (+1) and Pro (1)). As a result, the only hydrolysis step yields G-CSF, which has no methionine at the -1-position, its amino acid residue at the N-terminus begins with Thr (+1) Pro (+2), and such G-CSF is also found in nature.

Expression of G-CSF results in the formation of poorly soluble aggregates in prokaryotes, which have no activity. First of all, in order for a protein to be used for therapeutic purposes, it must be converted into its active form. In known manner (e.g., European Patent No. A 0 219 874, European Patent No. A 0 114 506, WO 84/03711), first, after addition of denaturing agents, it is dissolved, then renatured and, if necessary, purified. Protein cleavage of the protein according to the invention may be performed prior to, after reconstitution or after renaturation of the protein. In the case where protein cleavage by IgA proteinase must be performed after protein dissolution, denaturing agents (such as guanidine hydrochloride, or urea) must be removed prior to the addition of IgA proteinase. Typically, IgA-proteinase cleavage is performed after protein renaturation, in which case higher yields of G-CSF are achieved.

The conditions for cleavage of G-CSF or other cleaved protein by IgAproteinase can vary. However, it is desirable that the cleavage be carried out at a weight ratio of G-CSF (or other protein) to IgAproteinase of from 1: 1 to 100: 1. The digestion is carried out in an aqueous buffer solution with a pH preferably between 6.5 and 8.5. The concentration of the buffer solution should be between 50 mmol / l and 300 mmol / l and, if necessary, between 20 and 100 mmol / l of sodium chloride. The digestion is carried out at room temperature for more than 20-60 minutes.

After the protein is dissolved, renatured, and cleaved by IgAproteinase, the resulting cleavage product is typically purified by ion-exchange chromatography and coarse fractionation. The G-CSF thus obtained, which does not contain methionine at the -1 position, has a foreign protein content of less than 0.1% and usually less than 10 ' ³ %.

Thus, G-CSF, which does not contain the N-terminal methionine produced by cleavage with IgA-proteinase, can be isolated and purified from the fusion protein containing methionine.

The method of the present invention provides recombinant GCSF in prokaryotes containing less than 0.1%, and usually less than 10 ³ % of foreign proteins, and free of G-CSF obtained in prokaryotes having the methionine at position -1.

The present invention also provides a pharmaceutical composition comprising the active ingredient in prokaryotic G-CSF of the invention as an active ingredient, and if desired, conventional pharmaceutical carriers, excipients and excipients. Such a drug is particularly suitable for treatment requiring stimulation of granulocytes, particularly neutrophils.

In general, the dosage form according to the invention is an injection solution containing the components of the present invention.

Lyophilized pharmaceutical forms are also available. The latter, which are usually suitable for injection, may be physiologically prepared by the use of known techniques, solutions or solutions. The solvent used is water containing the usual additives used, such as stabilizers, solubilizers, buffers, additives to form an isotonic solution such as sodium chloride. Additives include mannitol, tartrate or citrate buffer, ethanol, complexing agents such as ethylenediaminetetraacetic acid and its non-toxic salts, as well as high molecular weight polymers such as polyethylene oxide, which are used to alter viscosity. Liquids used as carriers for injection should be simply filled into ampoules.

sterile, and

Finally, the present invention encompasses the use of a non-prokaryotic sequence at position -1 to obtain pharmaceutical compositions of the present invention.

G-CSF, a protein of methionine, is obtained

In the event that cleavage of any other fusion protein of the present invention results in the product Χ-Pro-A (wherein X is any amino acid residue and A is any amino acid sequence) having an undesired dipeptide Χ-Pro at the N-terminus, this dipeptide can be cleaved by dipeptidylaminopeptidase (DPAP).

Dipeptidylaminopeptidases have been found in some microorganisms, insects, amphibians, and various human tissues. They are required for the / gradual modification of probalt proteins and exhibit high specificity for the N-terminal dipeptide X-Pro (X-ProDPAPases: G. Kreil, Trends in Biochemical

Sciences 15, 23-26, 1990). Therefore, the combination of the present invention, true digestion and X-Pro-DPAP, can provide the desired proteins with the desired amino acid residues at the N-terminus of the protein.

Now, using the combination of truth and X-ProDPAP cleavage described above, it is also possible to obtain prokaryotic proteins with a different amino acid residue at the N-terminus of the protein in the absence of methionine at position -1. This initially results in a fusion protein having the amino acid residue sequence Met-Y-Pro-.beta.-Χ-Pro-A, in which case A is the preferred amino acid residue sequence of the expressed protein in addition to the two amino acid residues at the N-terminus.

A prokaryotic cell expression product having the amino acid residue sequence Met-Y-Pro-? -? - Pro-A, initially cleaved by IgA-proteinase, produces the first cleavage product having the X-ProA amino acid sequence.

Such a protein as described above can be cleaved with dipeptidylaminopeptidase, which specifically recognizes the sequence Χ-Pro and cleaves beyond Pro. In this way, a second cleavage product is obtained, the sequence of which A can be freely chosen. Therefore, the process of the present invention may be particularly useful for the production of a wide variety of non-methionine-free proteins at the N-terminus, and is not limited to the production of proteins at the N-terminus of the Χ-Pro sequence where X is typically Ser, Thr or Ala.

Finally, the invention also encompasses recombinant DNA containing a cloned (as defined above) IgAproteinase recognition sequence and suitable for insertion into an intermediate region of a fusion protein. Essentially, a DNA sequence fragment is obtained by chemical synthesis with one or more suitable overlapping regions at its ends.

Terms

The method of the present invention involves the production of the desired proteins by biotechnological methods. Biotechnology is understood to mean that the desired protein or intermediate is obtained by genetic engineering and other biotechnology techniques (for example, culturing microorganisms).

The desired protein is an intermediate or end product that can be used, for example, in medicine, research, environmental protection or in industrial processes or products.

The method of the present invention also encompasses that the desired protein is derived from a fusion protein wherein the fusion protein comprises covalently linked components fused to one another. One of the fusion components is the target protein. The sequence of the components and their repetition in the fusion protein may be any; but usually the fusion protein has a carrier at the N-terminus and a target protein at the C-terminus.

The carrier protein or portion thereof is required to provide the desired protein, which is present in the fusion protein, with special properties. These properties may be, for example, enhancement of fusion protein stability, which is based on structural properties, while significantly increasing its resistance to cellular proteinases or localization of fusion proteins in areas with low proteolytic activity. In addition, the carrier protein may have properties that effectively purify the fusion protein. This may include, for example, binding of certain ligands that allow affinity chromatography to be used for protein purification, localization of the fusion protein to the inclusion bodies, which allows their isolation at no cost, and localization of the protein to readily accessible regions.

The areas inside the fusion protein that connect the components of the fusion protein (carrier protein and target protein) to each other are called intermediate regions.

Each intermediate region may be defined by one or more amino acid residue sequences. The amino acid residue sequences (like all other amino acid residue sequences of a protein) are understood and depicted from the N-terminus (left) in the direction of the protein Cgal (right).

In the method of the invention, all amino acid residue sequences in the intermediate regions to be cleaved by IgA proteinase must have cleavage or recognition regions, according to the method of the invention.

The site between two amino acid residue sequences where the fusion protein is cleaved is called the cleavage site.

The method of the present invention encompasses enzymatic cleavage of fusion proteins in intermediate regions using IgA proteinase. The IgA proteinase or rhease, within the scope of the invention, is an IgA proteinase isolated from a strain of Neisseria gonorrhocae MSII and all other enzymes related to this proteinase at the nucleotide level and by the process of formation. Especially included IgAproteinases are from Neisseria and Haemophillus species.

E. coli ED 8654 microorganism was deposited

German Center for Microorganisms, Grizebachstrasse, 8,

3400 Gettingen, giving it the number DSM 2102.

The invention will be explained by the following examples and figures.

Description of figures:

FIG. 1 is a schematic representation of the fusion of MS2-polymerase (99 amino acid residues) and IgA-proteinase from the N. gonorrhocae MSII probaltyme β-region (1195-1505 amino acid residues). The intermediate region between the two moieties contains 12 amino acid residues containing the true-cleavage sequence Pro-Pro-. |.-Thr-Pro. Four oligonucleotides (1) to (4) were inserted into the cleavage site to construct the cleavage site. Obtaining a polypeptide

EcoRI and HindIII and digestion with purified truth are explained in detail in Example 5

FIG. Figure 2 depicts the fusion of the protein carrier (99 amino acid residues are MS2-polymerase and 6 encoded by the plasmid) to the CD8 protein residue of 206 amino acid human T-lymphocytes. The CD8 protein sequence contains a natural sequence for the cleavage of truth (see Example 6).

FIG. Figure 3 depicts protein B63 produced by the secretory system of an E. coli cell. Its N-terminus contains the lower part of the cholera B toxin (103 amino acid residues), an intermediate region (11 amino acid residues) containing the true cleavage site and the β-region of the Protein Protein Protein Protein C-terminus (1097-1160 residues). The Igase cleavage site was inserted between the two proteins by two oligonucleotides Tk 006 and Tk 007.

FIG. 4 is a schematic representation of the fusion of proteins B49 and B59. It is composed of the lower part of the cholera toxin B and the IgA-proteinase probalt β-domains. Between these parts are two different true cleavage sites (Pro-Pro-Ala-Pro and Pro-Pro-Thr-Pro). The cleavage sequences were constructed from synthetic oligonucleotides (see Figure 3).

EXAMPLE I

Plasmid Construction for G-CSF Expression Without Methionine.

Construction was performed using the expression carrier pPZ07 - mgllac (WO 86/09373). For this purpose, the expression carrier pPZ07 - mgllac was cleaved with Ncol and the sticky ends removed with Mung bean nuclease. The carrier is then digested with BamHI. The IgA proteinase recognition sequence at the DNA level was obtained using the following oligonucleotides:

O Oligonucleotide:

5'-AAT TCG GAG GAA ΑΛΑ TTA ATG ACA CAA CTG CGA CCT CCT ACA CCA CTG GGC CCT G-3 '

B Oligonucleotide:

'-GAT CC AGG GCC CAG TGG TGT AGG AGG TCG CAG TGC TGT CAT TAA TTT TTC CTC CGA ATT-3'

Both nucleotides are mixed in equimolar amounts and added to 100 fold excess of pPZ07-mgIlac as described above. After re-ligation, it transforms E. coli K12 cells. By known methods, DNA is isolated from cells and cleaved with Apal and BamHI. The G-CSF fragment, about 520 bp in length, is isolated using the Apal and BamHI restriction enzymes from the G-CSF sequence (Science 232 (1986), 61-65). This fragment is fused to the split Apal and BamHI carrier.

EXAMPLE

In addition to the IgA-proteinase recognition sequence, the fusion protein may contain peptides that facilitate protein purification. It may be the DNA that encodes streptavidin. For this purpose, the streptovidin gene (WO 89/03422) is cloned upstream of the IgA proteinase recognition region sequence.

EXAMPLE

Using the plasmid described in the examples, E. coli K12 cells are transformed (EDS 8654, DSM

2102), selection (ampicillin) and analysis. The selected clone for culture and G-CSF is cultured in complete medium using restriction expression. The antibiotic of this medium is a plasmid for further Cell composition per liter: 16 g of bactotriptone (Difco), 10 g of yeast extract (Difco) and 5 g of sodium chloride. Cells were grown to OD ₅₄₆ = 2.0 followed by induction with 10-3 mol / lIPTG. After 4 hours, the cells are harvested by centrifugation, and lysis cells (IB'S, pal. 0 219 874) are lysed (ethylenediaminetetraacetic acid).

lysozyme with EDTA and G-CSF is secreted

European patent no. A

Denaturation or renaturation of isolated insoluble fusion proteins containing G-CSF is accomplished according to European patent no. A 0 219 874. Denaturation is accomplished by dissolving in 6 mol / L guanidine hydrochloride solution. After denaturation, the precipitated solution is dialyzed against 5 mM potassium phosphate buffer, pH7, and the protein is digested with IgAproteinase (Example 4).

Alternatively, the denaturation is followed by dialysis against guanidine chloride against 5 mmol / l potassium phosphate buffer, pH 7 containing 1 mmol / l GSH and 3 mmol / l GSSG. After renaturation, dialysis is now also performed against 5 mM potassium phosphate buffer pH 7.

EXAMPLE

Cleavage of the Fusion Protein by IgA Proteinase to G-CSF Without Methionine at Position 1.

IgA proteinase is secreted according to EMBO Jour., 3, (1984),

1595 - 1601. 10 µg of renatured or denatured G-CSF according to Example 3 is added with 2-5 µg of IgA proteinase and incubated for 30 minutes at room temperature. Ion exchange sorbents such as Mono-Q or Mono-S can be used to release G-CSF, which has no methionine at its N-terminus. Analysis of the amino acid residues at the N-terminus of the protein indicated that the Thr (+1) -Pro (+2) amino acid residue sequence is required at the N-terminus of G-CSF.

EXAMPLE

Preparation of Fusion Proteins, Cleavage of Insoluble Protein Aggregates in Incorporated Bodies at a Specific Truth Cleavage Site

The prokaryotic expression carrier pEX31C (K. Strebel, Journal of Virology 57, 983-991, 1986) was modified so that the superproduced fusion proteins in this E. coli system could be cleaved into the true protein carrier and the desired protein. For this purpose, there was a synthesized oligonucleotide-derived double-stranded DNA fragment encoding the amino acid sequence Thr-Pro-Ala-Pro-Arg-Pro-Pro-β-Thr-Pro. This DNA fragment was inserted, using genetic engineering techniques, into the Eco RI cleavage site on the expression carrier pEX31C. In addition, two other synthetic DNA fragments containing multiple restriction site cleavage sites and an expression termination codon were inserted at the HindIII site. The expression plasmid pEV 37 thus obtained was inserted through the SmaI and Hind III cleavage sites into the DNA fragment encoding the probe of the IgAproteinase from Neisseria gonorrhocae MSII probalt. This resulted in a hybrid gene which was transformed into E. coli to produce a fusion protein. The fusion protein at the N-terminus was the protein carrier MS2-polymerase, had 99 amino acid residues in length, had a midline region of 12 amino acid residues in the middle spacer, and the desired protein, the β-region of the probe probe MSII. 1). The purified yoke e could be cleaved from the C-terminus of the fusion protein C-terminal MSII probaltim β, at the intermediate cleavage site Pro-. -Thr.

The hybrid gene plasmid was transformed into E. coli 85 * 7 cells containing the regulatory factor CI from the bacterophage λ (E. Remaut, Gene 22, 103-113, 1983). Raising the temperature from 28 ° to 42 ° resulted in the inactivation of the CI repressor, resulting in the activation of protein synthesis in recombinant E. coli cells. For this, 50 ml of a suspension of E. coli cells grown for 12 hours at 28 ° C was transferred to 200 ml of pre-warmed to 45 ° C and then cultured for 2 hours at 42 ° C. At this stage, large amounts of fusion protein accumulated in the form of inclusions in the bacterial cytoplasm. Cells were harvested by centrifugation, resuspended in 20 mL of lysate buffer (10% sucrose, 50 mmol Tris-HCl, pH 8.0, 1 mmol EDTA) and incubated with 400 μΐ lysozyme solution (5 mg / mL) for 30 min at $ 22. After the addition of Triton Χ-100 detergent to a final concentration of 0.1%, it was incubated again for 30 minutes. During the rupture, DNA was digested with ultrasound, the pellet was separated by centrifugation in the inlet, and the fusion proteins were separated and then washed with 5 ml of HINTE buffer (1 mol. Urea, 50 mmol NaCl, 50 mmol Tris-HCl, pH 8.0). , 1 mmol EDTA). After repeated centrifugation, the pellet was resuspended by sonication in 5 mL of PBS (20 mmol potassium phosphate, pH 7.5, 140 mmol NaCl) and washed. This step was repeated several times to remove urea residues. Finally, the insoluble fraction containing the fusion protein was resuspended by ultrasound in 5 ml

PBS.

The purity and amount of the suspended fusion proteins were determined by SDS PAGE (electrophoresis under denaturing conditions on a polyacrylamide gel), gel concentration 12.5%, stained with Coomasie Briliant Blue. After digestion of the fusion proteins, the suspension was incubated with enzyme / substrate ratio: 1/100 (w / w) for 3 hours at 37 ° C. After digestion, the mixture was analyzed by SDS PAGE and the β-protein of the required length was determined to be formed. This protein was transferred onto a nitrocellulose membrane and sequenced. The sequence of terminal amino acid residues confirmed that the protein was a fusion protein and that the desired fusion protein was cleaved at the site of cleavage.

But during the digestion, protein was digested. Adding larger amounts of cleavage was not achievable. protein is only 50% fused to truth and longer digestion because unreacted fusion is not accessible to truth. Hybrid protein and digestion products are in the form of insoluble aggregates after incubation with the true and cannot be separated by centrifugation.

Cleavage yields of up to 90% were achieved when fused proteins were taken instead of the contaminated fraction of the inclusion bodies and further purified. To this end, this insoluble precipitate was resuspended in 5 mL H7NTE buffer (7 mol urea, 50 mmol NaCl, 50 mmol Tris-HCl, pH 8.1, 1 mmol EDTA) after washing with H1NTE buffer (see above). The insoluble fraction was removed by centrifugation, and the soluble fraction was dialyzed against 5 liters of PBS at 4 ° C. Removal of urea by dialysis removes the fused protein in the form of insoluble aggregates. The precipitated aggregates were sonicated and, as described above, decomposed and analyzed.

EXAMPLE

Specific degradation of the renatured soluble fusion protein in the truth

Using the pEX expression system, a hybrid protein (see example) containing MS2 polymerase and a portion of human cytotoxic T-lymphocyte CD8 protein was obtained (see Figure 2). Following initial purification and dissolution of the protein contained in the inclusion bodies in H7NTE buffer, the next purification step was electrophoresis using a 12.5% SDS polyacrylamide gel. Fused protein, Coomasie Briliant Blue, and then by

91, 227-235,

Electroelution was carried out (40 mmol Tris-acetate, pH 7.9) to which additional 0.1% SDS (sodium lauryl sulfate) was added. SDS was subsequently removed by dialysis against 5 liters of TAE buffer at 22 ° C. For further dialysis, the protein was as in Hunkapiller 1983) was a single band, stained from the gel for staining (Methods in Enzymology extracted from the gel. TAE in buffer was added to storage buffer (20 mmol potassium phosphate, pH 7.5, 140 mmol NaCl, 50% glycerol) The resulting soluble fusion protein was incubated with purified truth (see Example 5) and completely cleaved at the site of cleavage of the CD8 molecule (Pro-Pro- | -Thr-Pro-Ala-, see Figure 2). ) to two polypeptides Cleavage specificity was assessed by analyzing the amino acid sequence of the shorter product from the N-terminus, and the Thr-Pro-AlaPro-Thr-Ile sequence was obtained as expected.

EXAMPLE

Specific degradation of renatured soluble fusion protein derived from culture supernatant

Fused proteins containing the lower and β-moieties of cholera toxin B (positions 1097 - 1160; J. Pohlner,

Nature 325, 458-462, 1987) and IgA-proteinase from N, gonorrhocae MSII probe, were soluble in culture medium of recombinant E. coli cells. In order to distinguish between the two portions of the protein, a synthetic site (Pro-Pro-. |. Thr-Pro-) was inserted into the intermediate region between the lower and the lower part of cholera toxin B using genetic engineering techniques. To this end, oligonucleotides Tk 006 and Tk 007 were inserted into the EcoRI and SacII cleavage sites (see Figure 3). The fusion protein was taken from 2 liters of bacterial culture fluid after 12 hours of growth at 37 ° C, precipitated with ammonium sulfate, then dialyzed against 5 liters of PBS buffer. It was cleaved at a concentration of 50 g / ml protein in PBS buffer at an enzyme / substrate ratio of 1/50 (w / w) with purified truth for 2 hours at 37 ° C. Immunoassays revealed that when the fusion protein was completely cleaved, the larger fragment by molecular weight and by reaction with antiserum corresponded to the natural lower part of cholera toxin B.

EXAMPLE

Specific degradation of the renatured soluble fusion protein on the surface of gram-negative bacteria

The expression secretory system was used to obtain the fusion proteins TKB 49 and TKB 59, which contain the lower part of the cholera toxin and the IgA-proteinase β domain, to be localized on the recombinant salmonella surface. The hybrid gene encoding the fusion protein TKB 49 contained the original true-cleavage sequence (c) (Pro-Pro-. | -La-Pro) in the intermediate region between the toxin and the β-region. In contrast, a synthetic DNA fragment from Tk 006 and Tk 007 oligonucleotides between EcoRI and SacII cleavage sites encoding the cleavage sequence (-Pro-Pro- | -Thr-Pro) was inserted into the gene encoding the protein TKB 59 (cf. 3). If the intact bacteria, on which the protein was fused on the surface, were incubated with purified truth, specific cleavage occurred at the site of cleavage. Immunoassays revealed that when fully digested, the small fragments by molecular weight and by reaction with antiserum corresponded to the natural lower part of cholera toxin B.

EXAMPLE

Purification of active truth from recombinant, E.

coli, cell culture fluid

Recombinant E. coli C 600 cells harboring plasmid pEX 1070 (VFR Patent No. 36 22 221.6) with a modified IgA-proteinase gene release active truth into the culture fluid. Filtration of the culture fluid through the membrane allows the enzyme to be concentrated and then precipitated with ammonium sulphate (0.42 g / ml). After centrifugation, the pellet was dissolved in Bio Rex buffer (50 mmol potassium phosphate, pH 7.0, 8.6% glycerol) (1 mL buffer per liter of culture fluid), equilibrated by dialysis against 2 liters of buffer, and followed by ion exchange chromatography (BioRex 70). The sorbed IgA-proteinase was washed with buffer (500 mmol potassium phosphate, pH 7.0, 8.6% glycerol) and eluted. The fractions containing IgA proteinase were then subjected to SDS electrophoresis on a polyacrylamide gel (12.5%). After this purification step, an average protein preparation of> 90% purity was achieved. Gel filtration through Sephacryl HR 300 in BioRex buffer was followed by ion exchange chromatography (see above) to obtain the purified truth. Igase activity was assayed by incubation with IgA antibodies and analysis of the resulting products on a polyacrylamide gel.

EXAMPLE

Plasmid Construction for Interleukin 3 Expression Without Methionine N-Termin

Construction was performed using the expression carrier pPZ 07 -mglac (WO 88/09373). For this purpose, the expression carrier pPZ 07 -mglac is cleaved with NCOI and the sticky ends removed with Mung bean nuclease. This is followed by further digestion of the carrier with BamHI. The optimized amino acid sequence of the fusion protein at the DNA level is obtained using the following oligonucleotides:

IA Oligonucleotide:

5'AATTCGGAGGAAAAATTAATGAAAGCCAAACGTTTTAAAAAACATGTCGACCA TGGAG-3 '

IB Oligonucleotide:

5'GGATCCTCCATGGTCGACATGTTTTTAAAACGTTTGGCTTTCATTAATTTTCC TCCGAATT-3 '

Both oligonucleotides are mixed together in equimolar quantities with approximately 100 fold excess with the digested pPZ 07 mglac as described above. Following ligation by conventional means, competent E. coli K12 cells are transformed. DNA is isolated from cells by conventional means, digested with SalI / BamHI and ligated with a DNA fragment containing the interleukin 3 coding sequence, which does not contain a protein signal sequence (as described above).

The coding sequence for interleukin 3, the sequence with the IgA-proteinase cleavage site at the DNA level, was obtained using a known PCR method, the PCR was performed using an interleukin 3 DNA template with the following primers:

2A Beginning:

5'-AAGCTTGTCGACCCACGTCCACCAGCTCCCATGACCCAGACAACGCCC-3 '

2B Beginning:

5'-TTCGTTGGATCCCTAAAAGATCGCGAGGCTCAAAGT-3 '

The resulting fragment is further cleaved with SalI and BamHI by PCR and can be directly inserted into the DNA carrier described by ligation.

Following transformation of DNA into an appropriate recipient, such as E. coli K12 C 600, IL 3 can be synthesized in E. coli cells in the Rb 'S form and subsequently isolated. As described for G-CSF, protein denaturation and renaturation are performed and the renatured protein is cleaved by IgA proteinase. The resulting IL 3, which has no methionine at its N-terminus, can be used in therapy after other purification steps.

EXAMPLE

Construction of a plasmid for expression of interleukin 2, free of methionine at the N-terminus,

The construction can be performed on the carrier pPZ07 -mgllac (W0 in oligonucleotide example 10 using expression 88/09373) which, after inserting IA and IB as described in Sall / BamHI, is cleaved. The coding sequence for interleukin 2 with the IgA-proteinase cleavage site at the DNA level was obtained using a known PCR method, PCR was performed using interleukin 2 DNA with primers 3A and 3B which also encode the IgAproteinase recognition sequence.

3A Beginning:

5'-AAGCTTGTCGACCCACGTCCACCAGCACCTACTTCACGTTCTACAAAG-3 '

3B Beginning:

5'-TTCGTTGGATCCTCAAGTTAGTGTTGAGATGATGCTTT-3 '

The resulting fragment is further cleaved with SalI and BamHI by PCR and can be directly inserted into the DNA carrier described by ligation. Next, everything goes as described for IL 3.

The previous example described how an appropriate IgA-proteinase recognition sequence and subsequent methods could provide an N-terminal methionine-free protein having the N-terminus starting with the Ala-Pro amino acid residue sequence. Other proteins which can be obtained analogously by the methods described can be obtained without the methionine at the N-terminus, specifically using oligonucleotides encoding the IgA-proteinase recognition sequence and the region corresponding to the 5'- or 3'-end of the published sequence and can be obtained by PCR amplification. Other relevant therapeutically useful proteins, which, in their mature, naturally occurring form, begin with Ala-Pro and, therefore, may be obtained in an analogous manner to the method of the present invention are provided below.

Cathepsin L (EC 3.3.22.15), Masoh, R.W. et al., Biochem. J. 240, 373-377, 1986.

Erythropoietin, Lai P. H. et 3116-3121, 1986. al. , J. Biol. Chem. 261, Interleukin 1β, Iseto K.M. 968, 1988. et al., Blood 71, 962 - Osteonectin, Fisher L.N. 262, 9702-9708, 1987. et al., J. Biol. Chem. Collagenase Type IV, Collier. Chem., 263, 6579-6587, 1988. . I . E. et al., J. Biol. Also, this is the way to go to receive protein, which

in mature form, the amino acid residue sequence Ser, Pro begins. For example:

ai antitrypsin, Hill R.E. et al., Nature, 311, 175

177, 1984.

Atrial natriuretic factor, Kambayashi et al., FEBS Lett. 259, 341-345, 1990.

Other examples of proteins that, in their mature form, are Thr-Pro in Ngale and can be used in therapy include:

Complement factor B, Campell R.D. et al., Proc. Natl. Acad. Sci., 80, 4464-4468, 1983.

Apolipoprotein A, Eato D.L. et al., Proc. Natl. Acad. Sci., 84, 3224-3228, 1987.

Claims (9)

DEFINITION OF INVENTION A method of enzymatic digestion of a fusion protein obtained by genetic engineering consisting of any component and a specific cleavage site, characterized in that (1) the intermediate region. which fusion protein fused portions modifies by genetic engineering such that there is at least one IgA-proteinase recognition site in this intermediate region, which must contain this amino acid residue Y-Pro. X-Pro, where X can be any amino acid residue and Y is one or more amino acid residues, (2) cleaves the fusion protein obtained in step (1) with the IgAproteinase symbol. | . and (3) upon cleavage, obtains one or more desired portions of the fusion protein. 2. The method of claim 1, further comprising fusing a protein intermediate modifier by inserting nucleotide sequences encoding an IgAproteinase recognition site or portion thereof; in addition, nucleotide sequences are inserted before or / and after one or more DNA segments encoding desired portions of the fusion protein. 3. The method of any one of the preceding claims, wherein (1) the cell is transformed with recombinant DNA or / and a recombinant carrier, wherein the DNA or carrier comprises at least one gene encoding a fusion protein having at least an IgA-proteinase recognition site. a copy of the fusion protein, (2) culturing the transformed cells in a suitable medium, (3) achieving expression of the gene encoding the fusion protein in the transformed cell, (4) cleaving the fusion protein with IgA proteinase, and (5) isolating one or more target fusion proteins. part of the protein. 4. A method according to any one of the preceding claims, wherein the fusion protein containing Met-Y-Pro is produced in order to obtain recombinant proteins at the N-terminus of prokaryotic cells without methionine protein. The .X-Pro-A sequence wherein X is any amino acid residue, Y is one or more residues of any amino acid, and A is any sequence of amino acid residues that cleaves the IgA proteinase to yield a protein or polypeptide containing Χ-Pro. -A sequence of amino acid residues. 5 The G-CSF or derivative of G-CSF is not substantially contaminated with prokaryotic-derived G-CSF having methionine at its N-terminus. 5. A method according to any one of the preceding claims, wherein the β-Pro-A is human granulocyte colony stimulating factor (GCSF) or derivatives thereof. 6. A fusion protein comprising a plurality of polypeptide moieties, wherein the intermediate region comprises at least one or more genetically engineered IgA-proteinase recognition sites between the respective polypeptide moieties having the amino acid residue sequence Y-Pro. | .Χ-Pro, wherein X is a residue of any amino acid, preferably Ser, Thr or Ala, and Y may be one or more residues of any amino acid. Claim 7 and, if necessary, the usual pharmaceutical additives, excipients and / or carriers. 7. Recombinant G-CSF or recombinant G-CSF derivative derived from prokaryotes, lacking the N-terminus of methionine protein, characterized in that 8. A pharmaceutical preparation comprising a G-CSF or a G-CSF derivative according to claim 10. 9th Recombinant DNA, bes i differentiating 15th that it encodes a protein according to 6th . 10th Cell, b e s i s kir i a n t i by the fact that she is transformed DNA according to claim 9.