LT4008B - Novel polypeptides - Google Patents

Abstract

This invention relates to new polypeptides, that are stimulated by a lipase of the bilious salt (BSSL;3.1.1.1.). This invention also relates to DNA molecules, that co-ordinate the mentioned polypeptides, and with sub products, including the mentioned molecules of the DNA. This invention describes the methods for the production of the mentioned versions of BSSL and transgenic mammals (not humans) variations, which can produce such versions of the BSSL.

Description

The present invention relates to novel polypeptides which are variants of bile salt-stimulated lipase (BSSL; EC 3.1.1.1). It also relates to DNA molecules encoding said polypeptides and to offal containing said DNA molecules. The present invention is also directed to methods of generating said BSSL variants and transgenic non-human mammals capable of expressing these BSSL variants. The invention further relates to such transgenic animals as well as infant formulas containing milk of such transgenic animals. The present invention also relates to pharmaceutical compositions containing said polypeptides and to the use of these polypeptides and DNA molecules in the manufacture of a medicament.

Dietary lipids are an important source of energy. More than 95% of these lipids are energy-rich triacylglycerols. Some lipids, such as some fatty acids and fat-soluble vitamins, are key ingredients in the diet. Against triacylglycerols and minor constituents, i.e. the absorption of esterified fat-soluble vitamins and cholesterol and diacylphosphatidylglycerols in the stomach and intestines requires hydrolysis of the ester bond to produce a less hydrophobic, absorbable product. These reactions are catalyzed by a specific group of enzymes called lipases. In humans, the major lipases are thought to be gastric lipase, pancreatic lipase dependent on colipase (hydrolysis of tri- and diacylglycerols), pancreatic phospholipase A2 (hydrolysis of diacylphosphatidylglycerols) and carboxylic ester hydrolase (cholesterol and fatty acid esters, also hydrolysis of tri-, di- and monoacylglycerols). When newborns are breastfed, bile salt-stimulated lipase (BSSL) plays a key role in the hydrolysis of some of the above lipids. Products obtained by lipid digestion together with bile salts form micelles or monolayer vesicles (Hernell, O., Staggers, J.E. and Carey, M.C. (1990): Biochemistry 29, 2041-2056) from which aspiration occurs.

Milk from some species, such as humans, gorillas, cats, and dogs, contains bile salt-stimulated lipase (BSSL) (Hernell, O., Blackberg, L., and Lindberg, T. in: Textbook of Gastroenterology and Nutrition in Infancy ( Lebenthal, E. Ed., Pp. 209-217 (Raven Press, New York 1989; Hamosh, M., Freed, L. M., York, C. M., Sturman, J. A., and Hamosh, P. (1986): Fed. Proc. 45 , 1452) When BSSL is mixed with bile in the upper part of the small intestine, it is specifically activated by primary bile salts (Hernell, O. (1975): Eur.

J. Clin. Invest. 5, 267-272). BSSL, which accounts for about 1% of total milk protein (Blackberg, L. & Hernell, O. (1981): Eur. J. Biochem. 116, 221-225), does not degrade when transported with milk through the stomach and is prevented by inactivation of bile salts in the duodenum. pancreatic proteases such as trypsin and chymotrypsin.

Heat treatment of human milk (pasteurization at 62.5 ° C, 30 min) completely inactivating BSSL (Bjorksten, B., Burman, LG, deChateau, P., Fredrikzon, B., Gothefors, L. & Hernell, O. ( J. Med. J. 201, 276-272), reduces the fat absorption coefficient of preterm infants by about 1/3 (Williamson, S., Finucane, E., Lille, H., and Gamsu, H.R. (1978): Arch. Dis. Childhood 53, 555-563; Atkinson, SA, Bryan, MH, and Andersson, GH (1981): J. Pediatr. 99, 617-624). Thus, for BSSL, it is preferable to use fresh human milk triacylglycerol than infant formulas having similar fat composition (Hernel, O. and Blackberg, L. in: Encyclopedia of Human Biology, Dulbecco, R.ed.) Vol. 47-56 (Academic Press, San Diego 1991); Chappell, JE, Clandinin, MT, Kearney-Volpe, C., Reichman, B., and Swyer, PW (1986): J. Pediatr. 108, 439-447. .

BSSL is a nonspecific lipase (EC 3.1.1.1) because it hydrolyses not only triacylglycerol but also monoacylglycerol, cholesterol esters and fat soluble vitamin esters (Blackberg, L. and Hernell, O. (1983): FEBS Lett. 157, 337- 341). Therefore, activated BSSL has the potential to hydrolyze most human milk lipids, although triacylglycerol in human milk is used effectively by synergistically acting on gastric lipase (EC 3.1.1.3), colipase-dependent pancreatic lipase (EC 3.1.1.3) and BSSL (Bernback, S., Bla ckberg). , L., and Hernell, O. (1980): J. Clin. Invest. 85, 1221-1226).

Recent studies have shown that milk enzymes are particularly important for newborns using long-chain polyunsaturated fatty acids (Hernell et al., 1993). These fatty acids are significant precursors of eicosanoids and are important for the development of the nervous system. Newborns, especially in preterm infants, have limited ability to synthesize these fatty acids from their precursors. They are thus of paramount importance for a certain, yet uncertain, period after birth.

Recently, several laboratories have described the cDNA structures of both milk lipase and pancreatic carboxylic ester hydrolase (CEH) (EC 3.1.1.1) (Baba, T., Downs,

D., Jackson, K.W., Tang, J. and Wang, C.S. (1991): Biochemistry 30, 500-510; Hui, D. and Kissel, J.A. (1990): Febs Lett. 276, 131-134; Nilsson, J., Blackberg, L., Carlsson, P., Enerback, S., Hernell, O. and Bjursell, G. (1990): Eur J. Biochem. 192, 543-550; Reue, K., Zambaux, J., Wong, H., Lee, G., Leete, T. T., Ronk, M., Shively, J. E., Sternby, B., Borgstrom, B., Ameis, D. and Schotz, MC (1991): J. Lipid. Res. 32, 267-276) and concluded that these milk and pancreatic enzymes are products of the same gene. The cDNA sequence and the deduced amino acid sequence of the BSSL / CEH gene (SEQ ID NO: 1) are also reported in WO 91/15234 (Oklahoma Medical Research Foundation) and WO 91/18923 (Aktiebolaget Astra).

BSSL is a single chain glycoprotein. The derived protein consists of (SEQ ID NO: 3) 722 amino acid residues and is extensively glycosylated (Abouakil, N., Rogalska, E., and Lombardo, D. (1989): Biochim. Biophys. Act 1002, 225-230). The N-terminal portion of the protein is highly homologous to acetylcholinesterase and some other esterases (Nilsson et al., 1990).

The experimental serine residue of the active center overlaps with serine-194; the sequence around this serine corresponds to the matching active center sequence of serine hydrolases. The only N-glycosylation site to be tested is located seven residues to the N-terminus of the serine active center (Nilsson et al., 1990). At the C-terminus of the BSSL sequence, there are 16-fold repeats of 11 amino acid residue-long fragments rich in proline. The variation in the number of repeats seems to be largely responsible for differences in molecular size and amino acid composition between enzymes isolated from different species (Han, J.H., Stratowa, C., and Rutter, W.J. (1987): Biochemistry 26, 1617-1625; Fontaine, R., Carter, C., and Hui, D. (1991): Biochemistry 30, 7008-1014; Kyger, EM, Wiegand, RC, and Lange, LG (1989): Biochem, Biophys, Res Commun 164, 1302-1309). These repeats carry most of the carbohydrate content of 15-20% of the protein (Baba et al., 1991, Abouakil et al., 1989).

The only structural difference between BSSL and the typical esterase lies in the Cgal portion of the polypeptide, i.e. in sixteen repetitive sequences containing 11-amino acid residues and high proline. The corresponding pancreatic enzyme from cow and rat has only 3 and 4 repetitions, respectively (Han et al., 1987; Kyger et al., 1989). This probably supports the hypothesis that the C-terminal moiety, or at least a portion thereof, does not affect lipase activity, i.e. its action on the long-chain triacylglycerol in the emulsified state.

Usually, lipid uptake and concomitant nutrition disorders are caused by a decrease in pancreatic colipase-dependent lipase and / or bile salts in the gastrointestinal tract. Typical examples of such lipase deficiency include patients with bladder fibrosis, a common genetic disorder that causes lifelong failure in 80% of patients, and chronic pancreatitis, often caused by chronic alcoholism.

Currently, very high doses of untreated swine pancreatic enzyme preparations are administered orally to patients with pancreatic lipase deficiency. However, colipase-dependent pancreatic lipase is inactivated by low pH in the stomach. Huge doses of enzymes cannot completely eliminate this phenomenon. Therefore, very high doses are unsuitable for most patients and, moreover, the preparations are pure and have an unpleasant taste. Certain tablets have been prepared that pass through the acidic regions of the stomach and release the enzyme only in the relatively alkaline environment of the small intestine. However, in many patients with pancreatic disorders, the small intestine is abnormally acidic and in such cases the tablets may not release the enzyme.

In addition, as non-human preparations currently on the market are present, there is a certain risk of developing immune reactions that cause adverse effects to patients or reduce the effectiveness of treatment. Another disadvantage of current formulations is that they are unreported or have other lipolytic activity that is not related to colipase-dependent lipase. In fact, most of them exhibit very low levels of BSSL / CEH activity. This may be one of the reasons why most patients with bladder fibrosis suffer from deficiencies of fat-soluble vitamins and essential fatty acids despite additional treatment.

Therefore, it is essential to obtain products having the properties and structure of human lipase and the broad specificity of substrates that can be administered orally to patients with deficiency of one or more pancreatic lipolytic enzymes. The products obtainable by the use of the present invention satisfy this need either by themselves or in combination with preparations containing other lipases.

The recombinant BSSL variants of the invention retain catalytic activity but have fewer glycosylation sites than full-length BSSL and are therefore produced with potentially less carbohydrate heterogeneity. This reduction in complexity facilitates the purification and characterization of recombinant proteins and should therefore reduce the cost of production of polypeptides having BSSL activity.

On the other hand, reduced levels of glycosylation result in lower requirements for the recipient and higher yields for multiple host cells. In addition, the reduced number of glycosylation sites allows the production of BSSL variants utilizing lower eukaryotes and limits the potential risk of abnormal glycosylation that may elicit an immune response. The reduced level and simpler glycosylation also means that the recipients in this case are wider than in the case of proteins with very complex and heavy carbohydrates.

Obviously, the use of smaller size but equally active BSSL variants for therapeutic purposes reduces the amount of additive material. Another potential benefit of the BSSL variant, which does not have most or all O-glycosylated repeats, is related to the reduction of the risk of host immune responses. This occurs because the O-linked sugars can be very heterogeneous depending on the cell in which they are made.

Scientific literature has reported that native BSSL is bound and absorbed by the intestinal mucosa. Selected BSSL variants with lower intake will be longer active against dietary lipids, thereby improving intestinal digestion. Molecules with reduced glycosylation levels are one example of such embodiments.

As mentioned above, BSSL was hypothesized to be particularly important for long-chain polyunsaturated fatty acids (Hernell, O., Blackberg, L., Chen, Q., Sternby,

B. and Nilson, A. (1993): J. Pediatr. Gastroenterol. Nutr. (in press) which are critical for neonatal neural development and vitamin A. The BSSL variant obtained according to the present invention, which is more effective in these respects, may be selected by known methods. The truncated or truncated enzyme is likely to differ in conformation, which may alter its specificity for different lipid substrates.

The invention relates, on the one hand, to a nucleic acid molecule encoding a polypeptide which is a BSSL variant less than 722 amino acids in length, said BSSL variant having the amino acid sequence shown in SEQ ID NO: 3 as residues 536-722.

As used herein, the term "portion of an amino acid sequence" means a single amino acid as well as a sequence of several amino acids or a combination of several such sequences.

The term "BSSL variant" refers to a polypeptide having BSSL activity and having a portion of the human BSSL amino acid sequence designated SEQ ID NO: 3 in the Sequence Description.

The term "polypeptide having BSSL activity" means a polypeptide having at least a portion of the following properties:

(a) is suitable for oral administration;

(b) activated by specific bile salts;

(c) acting as a nonspecific lipase in the contents of the small intestine, i.e. capable of hydrolyzing lipids relatively independently of their chemical structure and physical state (emulsion, particulate, dissolved);

and does not necessarily have one or more of the following characteristics:

(d) capable of hydrolyzing triacylglycerols containing fatty acids of varying chain lengths and varying degrees of unsaturation;

(e) also capable of hydrolyzing diacylglycerol, monoacylglycerol, cholesterol esters, lysophosphatidylacylglycerol and retinyl, and other fat soluble vitamin esters;

(f) being able to hydrolyze not only the sn-l (3) ester linkage but also the sn-2 ester linkage in triacylglycerols;

(g) capable of interacting with not only primary but also secondary bile salts;

(h) optimal activity depends on bile salts;

(i) stable in the sense that gastric contents will not affect its catalytic activity to any significant degree;

0) resistant to pancreatic proteases such as trypsin in the presence of bile salts;

(k) capable of binding heparin and heparin derivatives such as heparin sulfate;

(l) capable of binding to the lipid-water phase boundary;

(m) stable enough to be lyophilized;

(n) Stable when mixed with food ingredients such as human milk or milk formulas.

In other respects, the invention relates to a nucleic acid molecule as described above, wherein said BSSL variant has a phenylalanine residue at the C-terminus or has a Gln-Met-Pro sequence at its C-terminus or has an amino acid sequence shown at its C-terminus. as residues 712-722 of SEQ ID NO: 3.

In this context, the term "C-terminus position" denotes the position of the last C-terminus residue and the term "C-terminus portion" denotes approximately 50 amino acid residues that form the C-terminus of the BSSL variant.

The invention further relates to a nucleic acid molecule as described above, wherein said BSSL variant has less than 16 repetition units. In this context, the term "repetition unit" denotes one of the 33 nucleotide repeat units contained in SEQ ID NO: 1 of the Sequence Description.

In other respects, the invention relates to a nucleic acid molecule according to the above description encoding a polypeptide having at least 90% amino acid sequence homology to the amino acid sequence shown in SEQ ID NOs: 5, 6 or 9 as well as to a nucleic acid. a molecule encoding a polypeptide having at least 90% amino acid sequence homology to the amino acid sequence is shown in Sequence Description as SEQ ID NO: 7, except for those nucleic acid molecules encoding the polypeptides having the asparagine residue at position 187.

The invention also relates to polypeptides shown in SEQ ID NO: 5, 6, 7 or 9 as well as polypeptides encoded by a nucleic acid sequence as described above.

Further, the invention relates to a hybrid gene comprising a nucleic acid molecule as described above, to a replicable expression vector containing such a hybrid gene, and to a cell accepting such a hybrid gene. Such a cell may be a prokaryotic cell, a unicellular eukaryotic organism, or a cell derived from a multicellular organism such as a mammal.

As used herein, the term "hybrid gene" refers to a nucleic acid sequence comprising, on the one hand, a nucleic acid sequence encoding a BSSL variant as defined above and, on the other hand, a nucleic acid sequence of a gene conferring expression of a hybrid gene product. The term "gene" refers to the entire gene as well as a portion of its sequence which conditions and directs expression of the hybrid gene in the desired tissue. Typically, said portion of the sequence comprises at least one or more promoter regions, a transcription start site, 3 'and 5' non-coding regions, and structural sequences.

Preferably, the hybrid gene is constructed in vitro by inserting a nucleic acid sequence encoding a BSSL variant into a gene capable of expression, using techniques known in the art. On the other hand, the nucleic acid sequence encoding the BSSL variant can be inserted in vitro by homologous recombination.

As used herein, the term "replicable" means that the vector may replicate in the given host cell type into which it has been introduced. Directly upstream of the nucleic acid sequence encoding the BSSL variant, a sequence encoding a signal peptide whose presence provides secretion of the BSSL variant expressed in the host cell accepting the vector can be inserted. The signal sequence may be naturally associated with the nucleic acid sequence or may be of other origin.

Any vector that is convenient for DNA recombination procedures can be used as a vector, and its choice is often determined by the host cell into which the vector is to be introduced. Therefore, the vector may be autonomously replicating, i.e. able to exist as a non-chromosomal entity whose replication is independent of chromosomal replication; examples of such vectors include a plasmid, phage, cosmid, mini-chromosome or viruses. On the other hand, there may be a vector which, once introduced into the host cell, integrates into the host cell genome and replicates with the host cell.

Ί the chromosome (s) into which it was integrated. Examples of suitable vectors include bacterial expression vector and yeast expression vector. The vector of the present invention can carry any of the nucleic acid sequences of the invention as defined above.

On the other hand, the invention relates to a process for producing recombinant polypeptides which comprises: (i) inserting a nucleic acid molecule as described above into a hybrid gene capable of replication in certain recipient cells or organisms; (ii) introducing the resulting recombinant hybrid gene into a recipient cell or organism; (iii) identifying and propagating the resulting cell in or on the culture medium or expressing the organism expressing the polypeptide; and (iv) recovering the polypeptide.

Any conventional medium suitable for this purpose can be used for cell growth. A suitable vector may be any of the vectors described above, and the corresponding host cell may be any of the types described above. Any vector known in the art of DNA recombination for these purposes can be used to construct the vector and efficiently introduce it into the host cell. Depending on the cell type and vector composition, the recombinant human BSSL variant expressed in the cell may be secreted, i.e. transmitted through the cell membrane.

If the BSSL variant stays inside the recombinant recipient cells, which is not secreted by the cell, it can be recovered by standard procedures, which may include mechanical destruction of the cell, such as by ultrasound or homogenizer, or enzymatic or chemical purification.

To be secreted, a sequence encoding a signal peptide that secures the BSSL variant from the cell so that at least a large part of the BSSL produced is secreted into the culture medium and recovered is inserted before the DNA sequence encoding the BSSL variant.

The invention also relates to an expression system comprising a hybrid gene which can be expressed in a cell or host accepting said hybrid gene, whereby a recombinant polypeptide is produced by expressing a hybrid gene constructed by inserting a nucleic acid sequence as described above. a gene capable of mediating expression of said hybrid gene.

One possible method of producing the recombinant BSSL variant of the present invention is the use of transgenic non-human mammals capable of secreting the BSSL variant into their milk. The use of transgenic non-human mammals has the advantage of affording a high amount of recombinant BSSL variant at reasonable cost and of providing the recombinant BSSL variant in milk, which is a normal ingredient, eg in infant formulas, especially when the non-human mammal is a cow. therefore, extensive purification is not required when the recombinant BSSL variant is used as a nutritional supplement in dairy-based products.

In addition, when produced in higher organisms, such as non-human mammals, it undergoes regular processing of the mammalian protein molecule, such as post-translational processing and correct folding. Large quantities of the almost pure BSSL variant are also available.

Thus, an expression system based on the above description may be a mammalian expression system comprising a DNA sequence encoding a BSSL variant inserted into a gene encoding a non-human mammalian milk protein to form a hybrid gene that can be expressed upon acceptance of said hybrid. gene in the mammary gland of an adult female mammal.

The mammary gland, as an expression tissue, and genes encoding milk proteins are believed to be particularly suitable for the production of heterologous proteins in transgenic non-human mammals, since milk proteins are naturally produced in increased quantities in mammalian mammary glands. It is also easy to collect and available in large quantities. In this connection, the use of milk protein genes in the production of a recombinant BSSL variant has the advantage that the latter is produced under conditions close to the natural production conditions, in terms of expression regulation and site of production (mammary glands).

In transgenic mammals, it is preferable that the above hybrid gene contains a sequence encoding a signal peptide so that the product of the hybrid gene is correctly secreted through the mammary gland. Typically, the signal peptide could be the signal peptide of the milk protein gene of interest or the signal peptide associated with the DNA sequence encoding the BSSL variant. However, other signal sequences leading to secretion of the hybrid gene product through the mammary gland are also suitable. Of course, the individual elements of a hybrid gene must be fused so that the gene product is correctly expressed and processed. Therefore, normally, the DNA sequence encoding the selected signal peptide must be precisely linked to the N-terminal portion of the DNA sequence encoding the BSSL variant. The DNA sequence encoding the BSSL variant typically has its own termination codon, but not its message termination and polyadenylation site. The DNA sequence encoding the BSSL variant is usually followed by the iRNA processing sequence belonging to the milk protein gene.

Several factors have been found to be responsible for the true expression level of a given hybrid gene. Very important for the expression level may be the features of the promoter and other regulatory sequences as mentioned above, the mammalian genomic site into which the expression system is integrated, the site of the milk protein coding gene encoding the BSSL variant, elements leading to post-transcriptional regulation , and other similar factors. Based on knowledge of the influence of various factors on the expression level of the hybrid gene, one skilled in the art should know how to construct an expression system useful for the purpose being pursued.

The milk protein gene for consumption may be derived from the same species into which the expression system will be inserted, or it may be derived from another species. In the latter case, control elements that direct gene expression to the mammary gland have been shown to have no species limitations, which may be possible due to common ancestry (Hennighausen, L., Riuz, L. & Wall, R. (1990): Current Opinion in Biotechnology 1, 7478).

Among the various proteins commonly found in mammalian whey are examples of suitable genes encoding the milk protein or its active subset that can be used to construct an expression system, such as the Whey Acid Protein (WAP) gene, preferably when extracted. from mice, and the β-lactoglobulin gene, preferably when derived from sheep. Casein genes from a variety of sources can also be used to produce BSSL transgenic variants, such as sheep aSl-casein and rabbit β-casein. The WAP gene of mice is currently preferred because it has been found to confer high levels of expression on several foreign human proteins in the milk of various transgenic animals (Hennighausen et al., 1990).

Another sequence linked to the expression system of the invention is the so-called expression stabilizing sequence, which results in a high level of expression. There are strong indications that such a stabilizing sequence is near the start of milk protein genes.

The invention also provides a method of producing a transgenic mammal of non-human origin capable of expressing a BSSL variant, comprising (a) inserting the expression system described above into a fertilized egg or embryo of a non-human mammal and (b) a resulting fertilized egg or embryo. breeding a non-human mammal female.

The expression system can be inserted into the mammalian germ line using any suitable technique, such as that described in "Manipulating the Mouse Embryo"; Laboratory Manual, Cold Spring Harbor Laboratory Press, 1986. For example, several hundred molecules of the expression system can be directly injected into a fertilized egg, such as a fertilized single cell egg or its nucleus, or the embryo of a selected mammal and subsequently transferred to microinjection. and allow the development of the fallopian tubes.

A method of producing a transgenic non-human mammalian capable of expressing a BSSL variant may also be useful where said mammal is substantially unable to express its own BSSL. Such a method comprises (a) abrogating the mammalian ability to express BSSL without substantially expressing the mammalian BSSL, and inserting the above expression system into a mammalian germ line such that the BSSL variant is expressed in that mammal; and / or (b) modifying a mammalian BSSL gene or part thereof by an expression system as described above.

The mammalian BSSL expression ability is conveniently abolished by inducing mutations in the DNA sequence responsible for BSSL expression. This may be the introduction of a termination codon of a mutation that misses the DNA sequence reading frame or the deletion of one or more nucleotides from the DNA sequence.

The mammalian BSSL gene or portion thereof may be replaced by an expression system or DNA sequence encoding a BSSL variant as defined above using well-known principles of homologous recombination.

Another important aspect of the invention is the insertion of the DNA sequence described above into the genome of transgenic non-human mammals. Preferably, said DNA sequence is already present in the mammalian germ line and the mammalian milk protein gene. Preferably, the transgenic mammal of non-human origin can be selected from the group consisting of mice, rats, rabbits, sheep, pigs, and horns.

The invention also includes the offspring of transgenic non-human mammals as defined above and milk obtained from such transgenic non-human mammals.

The invention further relates to infant formulas containing infant milk as defined above and infant formulas comprising a BSSL variant as defined above. Infant formulas may be prepared using conventional techniques and may contain any necessary supplements such as minerals, vitamins, etc.

In another aspect, the invention relates to pharmaceutical compositions comprising a BSSL variant as defined above, and to the use of such a BSSL variant in therapy.

In yet another aspect, the invention relates to a variant of BSSL as defined above, for use in the manufacture of a medicament for the treatment of pathological conditions associated with exocrine pancreatic insufficiency; bladder fibrosis; chronic pancreatitis; fat absorption problems; malabsorption of fat-soluble vitamins; fat intake disorders for physiological reasons. The invention also relates to the use of the BSSL variant in the manufacture of a medicament for improving the absorption of dietary fat, particularly in preterm infants.

EXAMPLES

1. EUCARIOT EXPRESSION OF RECOMBINANT BSSL AND PROCARIOTS

IN CELLS

1.1. THE EXPERIMENTAL PART

1.1.1. The recombinant plasmid pS146 containing 2.3 kb human BSSL cDNA (Nilsson et al., 1990), which was cloned with pUC19, was digested with Hind III and Sal I. The BSSL cDNA was inserted into the bovine papillomavirus (BPV) expression vector pS147 (Figs. 1). This vector contains human BSSL cDNA controlled by a murine metallothionein 1 (mMT-1) enhancer and a promoter element (Pavlakis, G.N., and Hamer, D.H. (1983): Proc. Natl. Acad. Sci. USA 80, 397-401). The iRNA processing signals were taken from the rabbit β-globin gene fragment comprising part of exon II, intron II, exon III and downstream elements. This transcriptional unit was cloned with a vector containing the entire BPV genome. The BPV and BSSL transcriptional unit are transcribed in the same direction. The vector also has a pML2d, pBR322 derivative, for its replication inside E. coli (Sarver, N., Byrne, J.C., and Howell, P.M. (1982) Proc. Natl. Acad. Sci. USA 79, 7147-7151). .

The expression vector pS147 was co-transfected with a vector encoding a neomycin resistance gene regulated by the 5'-end long repetition of Harvey's sarcoma virus and 40 polyadenylation monkeys (Lusky, M., and Botchan, MR (1984): Cell 36, 391- 401).

To express BSSL in E. coli, BSSL cDNA was subcloned as an Ndel-BamHI fragment from pT7-7 (Ausubel, FM, Brent R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K). (eds) in: Current Protocols in Molecular Biology (John Wiley & Sons, New York; edition of 1992) to pGEMEX-1 plasmid (promega, Madison, WI, USA) (Studier, FW and Moffat, BA (1986): J. Mol. Biol 189, 113-130) In this cloning procedure, the coding sequence of T7 gene 10 is replaced by the BSSL gene encoding the mature protein and the start codon The final expression vector, pGEMEX / BSSL, has been verified by DNA sequencing using specific BSSL internal primers.

1.1.2. Mutagenesis

The number 1 is given to nucleotide A from the ATG initiation codon. In amino acid numbering, the first signal peptide methionine is given a -23 number, and the first amino acid residue of the mature protein, alanine, is numbered 1.

To create variant A with deletion (SEQ ID NO: 4), two PCR primers, PCR-1 and PCR-2, were synthesized (Table 1). J / mdlII, Sali and BzzraHI were designed to be cloned with different plasmids. The Bell link in the BSSL sequence was created without amino acid changes. This was done to facilitate the incorporation of synthesized DNA for other variants. The primer PCR-2 has two synthetic termination codons. The resulting PCR fragments were digested with BamHI and HindIII and cloned into pUC18 for sequencing. This plasmid is designated pS157. The exact PCR fragment was inserted into the BPV expression vector by binding to the BSSL sequence at a single Asp700 site (site 1405 in the BSSL cDNA) and a SalI site upstream of the β-globin gene fragment, yielding pS257.

Variant B (SEQ ID NO: 5) was constructed using oligonucleotides numbered 3, 4, 7 and 8 (Table 1). The renatured oligonucleotides encode the C-terminal amino acid sequence corresponding to the fragment from lysine 712 to phenylalanine 722 in the full-length protein. This fragment is attached to glutamine 535. The translation termination sequence is inserted after the last phenylalanine. This fragment has a Bell link at the 5 'end and a Sal link at the 3' end, so it can be inserted into pS157. The resulting plasmid was cleaved with Asp700 and SalI and the resulting 313 bp fragment was inserted into an expression vector as described above. The resulting plasmid was designated pS258.

TABLE.

Synthetic oligonucleotides used in the construction of BSSL variants. The nucleotides of the restriction sites are underlined. Broadcast termination signals are marked in bold.

Variant N the altered codon is designated PCR-3 in bold font and asterisk. Oligonucleus otidas Sequence (5 '- 3') PCR-1 CGGGATCCGAAGCCCTTCGCCACCCCCACG PCR-2 CGAAGCTTGTCGACTTACTACTGATCAGTCACTGTGGGCAGCGC CAG PCR-3 GGGAATTCTGGCCATTGCTTGGGTGAAGAGGAATATCGCGGCC TTCGGGGGGGACCCCAACCAGATCACGCTCTTCGGGGAGTCT * PCR-4 CGGGATCCCACATAGTGCAGCATGGGGTACTCCAGGCC 1 GATCAGGGGGCCCCCCCCGTGCCGCCCACGGGTGACTCCGGG 2 GCCCCCCCCGTGCCGCCCACGGGTGACTCCAAGGAAGCTCAGA 3 TGCCTGCAGTCATTAGGTTTTAGTAAGTCGACA 4 AGCTTGTCGACTTACTAAAACCTAATGACTG 5 CAGGCATCTGAGCTTCCTTGGAGTCACCCGTGGGCGGCACGGG GGGGGCCCCGGA 6th GTCACCCGTGGGCGGCACGGGGGGGGCCCCCT 7th GATCAGAAGGAAGCTCAGA 8th CAGGCATCTGAGCTTCCTTCT

Oligonucleotides 1 through 6 (Table 1) were used to construct the gene encoding variant C (SEQ ID NO; 6). The renatured DNA fragment has two repeats encoding eleven amino acids that overlap with the aligner (Nilsson et al., 1990) inserted between the sequence glutamine 535 and lysine 712 to phenylalanine 722. This fragment also has a Bell link at the 5 'end and a Sal site at the 3' end, so the same cloning strategy can be followed.

Two PCR primers (PCR-3 and PCR-4 in Table 1) were synthesized to construct variant N (variant without N-glycosylation, SEQ ID NO: 7). EcoRI and BamHI sites were generated by cloning a 360 bp PCR product with pUC19 for sequencing purposes. Potential N-linked glycosylation site, asparagine 187 replaced with glutamine. The modified sequence was separated as the Ball-HindIII fragment and cloned with SacI and HindIII digested pUC19 together with the SacI and Bali fragment containing the mMT-1 promoter and the 5 'end of the BSSL cDNA. A SacI-DralII fragment of about 1.2 kb in length was isolated from this plasmid and inserted into the expression vector mMT-1 and the BSSL cDNA sequence, respectively. The resulting plasmid was designated pS299.

1.1.3. Mammalian cell culture and transfections

The vectors were co-transfected into mouse cell line C127 (ATCC CRL 1616), according to the calcium phosphate precipitation method (Graham, F.L. and Van der Eb, A.J. (1973): Virology 52, 456-467).

C127 cells were grown in Ham's F12-Dulbecco's modified Eagle's medium (DMEM) (1: 1) supplemented with 10% fetal calf serum. Neomycin-resistant cell clones were selected using 1.5 mg x ml'l G418, and after 10-15 days, growth-resistant cell clones were isolated from parent plates and propagated for assays.

1.1.4. Bacterial strains and growing conditions

For expression experiments, the vector pGEMEX / BSSL was transformed into E. coli JM109 (DE3) and BL21 (DE3) pLysS strains. Expression tests were performed according to Studier et al. (1986). After harvesting the bacteria, cells were pelleted by centrifugation (5000 x g, 10 min at 4 ° C). For preparation of the periplasm and cytoplasm fractions, the centrifuge pellet was resuspended in 4 ml of 20 mM Tris-Cl / 20% sucrose, pH 8.0, 200 μ 200 0.1 M EDTA, and 40 μΐ lysozyme (15 mg / ml in water) for each gram of centrifuge pellet. . The suspension was kept on ice for 40 minutes. 160 μΐ of 0.5 M MgCl2 per gram of centrifugation precipitate was added, followed by centrifugation at 12000 x g for 20 minutes. The resulting supernatant contained periplasmic proteins and the cytoplasmic fraction in the centrifugation pellet. For soluble protein preparation, cells were suspended in 40 mM Tris-Cl, 0.1 mM EDTA, 0.5 mM phenylmethylsulfonyl chloride, pH 8.2, and lysed several times by freeze-thawing and sonication. The cell lysate was centrifuged (30,000 x g for 30 min at 25 ° C).

1.1.5. Nucleic acid analysis

RNA and DNA are secreted from mammalian cell-separated lines or E. coli cells (Ausubel et al., 1992). RNA and DNA are fractionated on an agarose gel and blotted with GeneScreen Plus (New England Nuclear) and hybridized according to the supplier's instructions.

1.1.6. Natural enzyme preparation

Bile salt-stimulated lipase is isolated from breast milk as previously described (Blackberg & Hernell, 1981). As shown by SDS-PAGE analysis, the purified preparation was homogeneous and exhibited a comparative activity of xmin'l and mg'l of 100 pmol fatty acids when tested on a long chain triacylglycerol substrate.

1.1.7. Enzyme sample

The enzyme sample was performed as described (Blackberg & Hernell, 1981) using triolein as a substrate in gum arabic. Incubated with 10 mM sodium cholate as activating bile salt. Concentrations of salts added to bile salts (sodium cholate and deoxycholate sodium, Sigma Chem. Co.) were as shown in Fig. 3.

1.1.8. Western blotting

In blotting experiments, the conditioned medium was concentrated by chromatography on blue sepharose (Pharmacia LKB Biotechnology) to enhance the reaction. The appropriate medium was mixed with Blue Sepharose (About 10 ml medium per ml gel). The gel was washed (10 mL for each mL of gel) with 0.5 M Tris-Cl buffer containing 0.1 M KCl, pH

7.4. Enzyme activity was washed with 1.5 M KCI in the same buffer. Concentrations of 25-30 times higher as well as 3-5 times higher purity were obtained by this method. SDSPAGE was performed on a 10% polyacrylamide gel, essentially according to Laemmli (U.K. (1970): Nature (London) 227, 680-685). After transfer onto nitrocellulose membranes and incubation with polyclonal rabbit BSSL-antiserum, goat anti-rabbit IgG conjugated to alkaline phosphatase and other reagents from Bio-Rad were used.

1.1.9. Effect on N-glycosidase F

To 10 μΐ of variant B having 2.5 μηαοί fatty acid extraction x min'l BSSL activity was added 1 μΐ of 1M β-mercaptoethanol and 0.5 μΐ of 10% (w / v) SDS. After boiling for 5 minutes, 10 μΐ of 0.1 M sodium phosphate buffer, pH 8.0, 6 μΐ of 0.1 M EDTA, 4 μΐ of 7.5% (w / v) Nonidet P40 and 5 μΐ (1U) of N-glycosidase were added. F (Boehringer Mannheim). As a control, the same amount of variant B was treated in the same way without glycosidase alone. After incubation overnight at 37 ° C, samples were subjected to SDS-PAGE analysis and blotting using polyclonal rabbit BSSL-antiserum.

1.2. RESULTS

1.2.1. Design of BSSL variants

Modifications of BSSL variants relative to full-length BSSL are summarized in Table 2 and Fig. 1. The techniques used to create these variants are described in 1.1. section. In Variant A (SEQ ID NO: 4), the termination codon is inserted after glutamine at position 535, thereby removing the last 187 amino acids from the full-length protein. The portion of variant B (SEQ ID NO: 5) encoding the last 11 C-terminal amino acids and the original translation terminated to glutamine 535. Thus, this variant does not have all the repeats. In Variant C (SEQ ID NO: 6), a fragment containing two repeats having the aligner sequence (Nilsson et al., 1990) is inserted between glutamine 535 and the sequence from lysine 712 to phenylalanine 722.

Another variant has been constructed to determine the importance of the test N-linked carbohydrate structure close to the active center serine 194. Variant N (SEQ ID NO: 7) was obtained by replacing a potential N-glycosylation site, asparagine 187, with glutamine.

TABLE

Amino acid sequences of BSSL variants compared to human BSSL.

Variants Removed remains Altered remains A (SEQ ID NO: 4) 536-722 B (SEQ ID NO: 5) 536-711 C (SEQ ID NO: 6) 536-568, 591-711 N (SEQ ID NO: 7) Asn 187 -> Gln

1.2.2. Characterization of recombinant DNA in mammalian cell lines

DNA samples were prepared from cell lines transfected with expression vectors encoding different BSSL variants. The prepared DNA was digested with BnmHI, fractionated on agarose gels and transferred onto membranes for hybridization. 32p_-labeled BSSL cDNA was used as a probe. The hybridization results confirmed the existence of recombinant genes and also that the vector copy number was approximately equal in different cell lines (Fig. (Fig.2). 2). The arrangement of the hybridized fragments reflected different lengths of the various BSSL sequences and coincided with the expected lengths. The arrangement, which was also similar to the DNA isolated from the transection test bacteria used, showed that the vector lines did not undergo any major DNA rearrangement (Fig. 2). The supernatant hybridization signals in the DNA sample representing variant A were most likely obtained by partial cleavage.

1.2.3. Full-length and mutant BSSL iRNA expression in mammalian cells

For recombinant BSSL gene expression assay, RNA was isolated from individual cell lines. Northern blot experiments and hybridization with 32p_žy _m etaj BSSL cDNA showed that recombinant mRNA is detected in all cell lines that have taken BSSL vector (Fig. 3). Hybridization was not detected in control samples taken from cell lines containing the same vector but without BSSL cDNA (Fig. (Fig.3). 3).

Different lengths of hybridized iRNAs combined with cDNA modifications. The levels of the different sample recombinant BSSL iRNA variants were practically the same except for variant A (Fig. 3). The reason for the poorer accumulation of variant A iRNA is unknown, but it was detected in two cell line populations as well as in isolated clones. Hybridization with the mouse β-actin probe confirmed that the same samples contained the same amount of RNA (Fig. (Fig.3), lower panel).

1.2.4. Production of full-length BSSL and BSSL variants in mammalian cells

Medium from single clones of C127 cells transfected with full-length BSSL and various mutant forms was collected and the activity of BSSL was investigated (Fig. (Fig.4). 4). In clones with the highest expression, the full-length molecule and variants had N, B and C activities ranging from 0.7 to 2.3 µmol fatty acid release in x min'f x medium ml'l. This corresponded to expression levels of 7-23 µg x medium ml'l and was close to the comparative activity of BSSL in natural milk. All clones analyzed with variant A exhibited activity less than 0.05 µmol fatty acid release x min ' ¹ x medium mlf. Concentration with blue sepharose and lyophilization showed that the active enzyme was indeed expressed in the clones with the highest activity, although very low level. It cannot be excluded that the low activity of variant A may be partially explained by the significantly lower specific activity.

Data from Western blotting of clones from various transfection experiments are shown. FIG. 5A. M _{r of} BSSL variants obtained as expected. However, it should be noted that the full-length BSSL variants and the B and C variants yielded double bands. Because all three had an intact single N-glycosylation linkage whereas variant N, which did not display a double band, did not have this linkage, this is a possible explanation that those double bands originated from differences in N-glycosylation. Therefore, variant B was exposed to N-glycosidase F. As shown in Figs. In Fig. 5B, only traces remained from the upper band, whereas the lower band was amplified, indicating that only a portion of the expressed variant was N-glycosylated.

One of the hallmarks of BSSL is specific activation in the presence of primary bile salts such as cholate (Hernell, 1975). Upon activation of cholate, all the different recombinant forms exhibited the same concentration dependence (Fig. 6). Peak activity in the test system used was obtained at approximately 10 mM. When cholate was replaced with deoxycholate (secondary bile salt) stimulation was not observed. Thus, the full-length recombinant as well as the different variants exhibited the same specificity for bile salt activation.

1.2.5. Expression and biochemical characterization of full-length BSSL in E.coli cells

Two E.coli strains, JM109 (DE3) and BL21 (DE3) pLysS (Studier et al., 1986), were transformed with the expression vector pGEMEX / BSSL containing the human BSSL cDNA under the control of the T7 promoter. Transformants from both strains were identified, grown and induced after exposure to IPTG for about 90 min (Studier et al., 1986). Northern blotting analysis of all iRNAs using BSSL cDNA as a 32P-labeled probe showed that expression was productively induced in both strains and that transcription was tightly controlled (Fig. (Fig.7A). 7A). The apparent size of the recombinant BSSL, approximately 2.4 kb, is consistent with the expected length. Separation of protein samples with SDS-PAGE and immunodetection with anti-BSSL antibodies showed that E.coli efficiently produced full-length BSSL (Fig. (Fig.7B). 7B). The BL21 (DE3) pLysS strain released more protein into the periplasm than JM109 (DE3) (Fig.7B).

E. coli cultures induced with IPTG had active soluble BSSL corresponding to 0.5 - 4 µg BSSL protein / culture ml. Western blotting showed that 20-60% of the reactant was in insoluble centrifugation sediment. Uninduced bacteria did not show any significant BSSL activity.

Lipase activity from cultured bacteria had the same dependence on bile salts as native milk BSSL.

2. RECOMBINANT FULL LENGTH AND ITS MUTANT FORMS

PURIFICATION AND CHARACTERIZATION OF SALT STIMULATED LIPASE

2.1 THE EXPERIMENTAL PART

2.1.1. Enzymes and enzyme variants

Recombinant full-length BSSL and BSSL variants B, C, and N were constructed and expressed as described above. In comparison to the native enzyme, variant B (SEQ ID NO: 5) did not have all 16 unique, O-glycosylated, proline-rich C-terminal repeats (amino acids 536-711), whereas the extreme C-terminal fragment (amino acids 712-722) was attached to glutamine 535. Variant C (SEQ ID NO: 6) had the same C-terminal fragment and two repeats, 11 residues in length, between glutamine 535 and lysine 712. Variant N (variant without N-glycosylation, SEQ ID NO: 7) asparagine 187, responsible for the only N-linked sugar, was replaced by a glutamine residue.

Native BSSL is isolated from breast milk as described (Blackberg & Hernell, 1981).

2.1.2. Enzyme test

Lipase activity was tested as described (Blackberg & Hernell, 1981) using triolein as a substrate in gum arabic. Sodium cholate (10 mM) was used as activating bile salt. The different test modifications are given in the drawings.

2.1.3. Preparation of immunosorbent

Purified milk BSSL (3 mg) was combined with Sepharose using CNBr according to the manufacturers description. 40 ml of polyclonal antiserum obtained in rabbits prior to purified BSSL milk was passed through the column. Specific antibodies were washed with 0.1 M glycine-HCl, pH 2.5. The pH is adjusted to approximately 8 using solid Tris. After desalting and lyophilization, 6 mg of affinity purified antibodies were combined with sepharose as described above.

2.1.4. Method of purification

Conditioned growth medium containing 5-25 pig recombinant expressed BSSL or BSSL variant mixed with blue sepharose (Pharmacia, Sweden), 10 ml medium per ml gel. After stirring for 30 min, the gel was washed with 0.05 M Tris-Cl, pH 7.0, 0.05 M KCl and lipase activity was washed with 0.05 M Tris-Cl, pH 7.0, 1.5 M KCl. An activity peak was collected and dialyzed against 5 mM sodium veronal, pH 7.4, 0.05 M NaCl. The dialysate is passed through a heparin-Sepharose column. The column was washed with a NaCl gradient from 0.05 to 1.0 M in 5 mM sodium veronal buffer, pH 7.4. Fractions with lipase activity were collected and used on an immunosorbent column. After washing with 0.05 M Tris-Cl, pH 7.0, 0.15 M NaCl lipase was washed with 0.1 M glycine-HCl, pH 2.5. The pH of the fractions was immediately brought to about 8 with solid Tris.

2.1.5. Electrophoresis

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed according to Laemmli (1970). Protein stained with Commassie Brilliant Blue.

2.1.6. N-terminal sequence analysis

Amino acid sequencing was performed using Applied Biosystems Ine. 477A pulsed liquid phase sequencers and on-line phenylthiohydantoin analyzer 120A with regular cycle programs and reagents from manufacturers. Initial and repeat calculations for a known sequence standard protein (β-lactoglobulin) were 47% and 97%, respectively.

2.2. RESULTS

2.2.1. Purification of recombinant BSSL and BSSL variants

Conditioned medium chromatography on blue sepharose was primarily used for concentration. Further purification by heparin-sepharose chromatography resulted in the initial purification of most of the albumin present in the culture medium. This indicated that the recombinant BSSL molecules all retain binding to heparin. After treatment with the immunosorbent as shown by SDS-PAGE (Figure 8), all BSSL variants exhibited a purity greater than 90%. The full-length enzyme and variants B and C migrated as doublets. The M _{r of the} different variants are shown in Table 3. N-terminal sequencing elucidated a single sequence for all variants from 8 cycles: Ala-Lys-Leu-Gly-Ala-Val-Tyr-Thr-.

2.2.2. Lipase activity

The molecular weights of the different formulations are given in Table 3. The specific activity of the formulations ranged from 75 to 120 µmol free fatty acids per minute per mg protein. Thus, no significant difference was found between the activity of full-length BSSL and BSSL variants.

In order for the preparations to act on the long-chain triacylglycerol in the emulsified state, they all required the primary bile salt (sodium cholate) (Fig. 9A). Sodium deoxycholate did not stimulate any of the variants (data not shown). However, deoxycholate together with other bile salts showed two effects (Fig. (Fig.9B and C).). First, it reduced the concentration of cholate needed for stimulation, and second, it inhibited the activity of the enzyme at higher concentrations of bile salt.

TABLE

M _{r of} recombinant full length BSSL and BSSL variants

The enzyme M _r (kDa) determined by SDS-PAGE Full length 105.107 Option B 63.65 Option C 60.62 Variant N 95

2.2.3. Stability of recombinant BSSL and BSSL variants

Recombinant BSSL and BSSL variants exhibited the same pH stability as native milk BSSL (Fig. 10). In all cases, inactivation was achieved at a pH of about 2.5-3. Above pH 3, all variants were stable if protein levels were high enough. This was done with the addition of bovine serum albumin or ovalbumin (data not shown). The diluted samples were less stable at all tested pH but the threshold remained the same (data not shown). Fig. Figure 11 shows the thermostability of a recombinant enzyme compared to native milk enzyme. At 37-40 ° C the activity begins to decrease. Variants (B, C, N) were less stable than full-length recombinant enzyme and milk enzyme. However, if the protein concentration is increased by the addition of bovine serum albumin, all variants are resistant to 40 ° C (Fig-H).

Native milk BSSL and all recombinant variants are sensitive to trypsin. Time-dependent inactivation was found (Fig. 12). However, if bile salts are added to buffer j, i.e. cholate, lipase variants are protected and activity is maintained (Fig. 12).

Thus, many of the in vitro traits, i.e. no significant differences were found between different BSSL variants and native milk BSSL with respect to bile salt stimulation, heparin binding, pH and temperature stability, and protection of bile salts from protease inactivation.

3. EXPRESSION IN TRANSGENIC ANIMALS

3.1. CONSTRUCTION OF EXPRESSION VECTORS

The construction of an expression vector for the production of recombinant human BSSL variant in transgenic mammalian milk followed this strategy (Fig. 13).

Three plasmids containing different portions of the human BSSL gene (pS309, pS310, and pS311) were obtained according to Lidberg, U., Nilsson, J., Stromberg, K., Stenman, G., Sahlin, P., Enerback, S.G. and Bjursell, G. (1992: Genomics 13, 630-640). Plasmid pS309 contains an Sphl fragment spanning the BSSL gene from the 5 'untranslated region to the fourth part of the intron. Plasmid pS31O contains a SacI fragment comprising the BSSL variant gene from part one of the first intron to part six of the intron. Finally, plasmid pS311 has

A BamHI fragment comprising the BSSL gene from most of the fifth intron and the entire remaining intron / exon structure with deletions in exon 11. The deleted sequences are 231 bp, resulting in a sequence encoding a BSSL variant that has exactly 77 amino acids or seven less than full length BSSL. The nucleotide sequence of the resulting BSSL variant ("variant T") is provided in Sequence Description as SEQ ID NO: 8. The amino acid sequence of Variant T is provided in Sequence Description as SEQ ID NO: 9.

Due to the very high repeatability of the exon 11 sequence of the human BSSL gene, one would expect a relatively high rate of rearrangement when the sequence is cloned in a plasmid and propagated in a bacterium. Based on these assumptions, one desired variant of BSSL having a truncated exon 11 was identified, isolated, and sequenced.

Another plasmid, pS283, containing a portion of the human BSSL cDNA cloned in pUC19 at the HindIII and SacI sites, was used to combine genomic sequences. Plasmid pS283 was also used to obtain a suitable restriction enzyme site, KpnI, in the 5 'untranslated leader sequence of BSSL.

Plasmid pS283 was digested with Ncol and Sac1 and electrophoretically isolated a fragment of about 2.7 kb. Plasmid pS309 was digested with Ncol and BspEI and a fragment of about 2.3 kb containing the 5 'part of the BSSL gene was isolated. Plasmid pS310 was digested with BspEI and Sacl, and a fragment of about 2.7 kb, which had the middle part of the BSSL gene, was isolated. The three fragments were fused and transformed into the competent E. coli strain TG2, and the transformants were isolated by selection with ampicillin.

Plasmids were prepared from several transformants and one plasmid named pS312 (Fig. 14) having the desired construct was used in further experiments.

The following procedure was used to obtain a modified pS311 in which the BamHI site outside the termination codon was replaced by a SalI site to facilitate further cloning. Plasmid pS311 was linearized by partial digestion with BamHI. The linearized fragment was separated and a synthetic DNA linker was inserted, replacing the BamHI site with the SalI site (5'-GATCGTCGAC-3 '), thereby disrupting the BamHI site. Because there were two potential sites for integration of synthetic linkers, the resulting plasmids were analyzed by restriction enzyme digestion. The plasmid with the inserted linker at the desired site outside exon 11 was isolated and labeled with pS313.

To obtain a final expression vector construct containing human BSSL variant sequences, an existing expression vector, pS314, was constructed to produce stage-specific and tissue-specific expression in mammary gland cells during lactation. Plasmid pS314 contains a genomic fragment from the murine whey acidic protein (WAP) gene (Campbell, S.M., Rosen, J.M., Hennighausen, L.A., Strech-Jurk, U. and Sippel, A.E. (1984): Nucleic Acid Res. 12, 8685-8697). ) cloned as a NotI fragment. The genomic fragment contains about 4.5 kb forward control sequences (URS), all four mouse WAP exons and all intron sequences, and about 3 kb downstream of the last exon. The only one

The KpnI link is in the first exon 24 kb upstream of the natural WAP broadcast initiation codon. The other single restriction enzyme site is the Sal I site in exon 3.

The human BSSL variant genomic sequence is inserted between KpnI and SalI sites using this strategy. First, pS314 was digested with KpnI and SalI and the fragment containing the cleaved plasmid was electrophoretically isolated. Second, pS312 was digested with KpnI and BamHI, and a 4.7 kb fragment containing the 5 'portion of the human BSSL gene was isolated. Third, pS313 was digested with BamHI and SalI and the 3 'portion of the human BSSL gene was isolated. The three fragments were fused, transformed into competent E.coli bacteria and transformants isolated after ampicillin selection.

Plasmids were prepared from several transformants and subjected to restriction mapping and sequence analysis. One plasmid containing the desired expression vector was identified and designated as pS317 (Fig. 15).

By deleting the prokaryotic plasmid sequences, pS317 cleaved Notl. The recombinant vector element consisting of the murine WAP sequence adjacent to the genomic fragment of the human BSSL variant was then separated using agarose electrophoresis. Prior to insertion into the mouse embryo, the isolated fragment was purified by electroelution.

The recombinant gene for expression of the human BSSL variant in the milk of transgenic mice is shown in Figs. 16th

3.2. Creation of transgenic animals

The NotI fragment was isolated from plasmid pS317 according to the method described in 3.1. section. This DNA fragment contains the mouse WAP promoter fused to the genomic sequence encoding the human BSSL variant. An isolated fragment, at a concentration of 3 ng / μΐ, was injected into 350 C57Bl / 6JxCBA / 2J-f2 embryonic pronucleus from mouse donors induced by superovulation with 5 IU of pregnant foal gonadotropin. C57Bl / 6JxCBA / 2J-fi animals were obtained from Bomholtgard Breeding and Research Center LTD, Ry, Denmark. After collection of the embryos from the fallopian tubes, they are isolated from the cumulus oophorus cells by exposure to M2 hyaluronidase (Hogan, B., Constantini, F. and Lacy, E. (1986): Manipulating the mouse embryo. A Cold Spring Harbor Laboratory Press). The washed embryos were transferred to M16 medium (Hogan et al., 1986) and stored in a 5% CO2 incubator. The injection was in M2 medium microparticles, with light paraffin oil, using Narishigi hydraulic micromanipulators and a Nikon inverse microscope with Nomarski optics. After injection, 267 healthy-looking embryos were implanted into 12 alveolar C57Bl / 6JxCBA / 2J-fi recipients with 0.35 ml of 2.5% avertin administered intraperitoneally. Mice that integrated the transgene were identified by PCR analysis of DNA obtained from tail biopsy samples taken from animals three weeks after birth. Positive results were confirmed by Southern blotting.

In lactating females, 2 IU oxytocin was injected intraperitoneally and anesthetized by injection of 0.40 ml 2.5% avertin into the peritoneal cavity after 10 minutes. The milk collector was connected to the nipple by siliconized tubes and the milk was collected in 1.5 ml Eppendorf tubes by gentle massage of the mammary glands. The amount of milk ranged from 0.1 to 0.5 ml per mouse per milking, depending on the day of lactation.

3.3. Expression of BSSL Variants in Transgenic Mice

Transgenic mice were identified by analysis of DNA obtained from tail biopsy samples. These tissue samples were incubated with proteinase K and extracted with phenol / chloroform. The isolated DNA was used in polymerase chain reactions with primers that amplify specific fragments in the presence of heterologous inserted DNA containing an expression vector fragment. The animals were also analyzed by DNA hybridization to confirm the PCR data and information on the number of copies of the integrated vector elements.

In one test group, 31 mice were tested in two ways and the results showed that 1 mouse had a heterologous DNA vector element derived from pS317. The results of the PCR analysis and the hybridization tests were in agreement (Fig. 17). 10 of 65 animals tested were transgenic for pS317.

Mice identified as carriers of the vector DNA element (co-founder animals) were then paired and identified in the same manner as Fl, the progeny containing the transgene.

RNA was isolated from various pS317 transgenic females during lactation period tissue isolated using agarose formaldehyde gel electrophoresis, subjected to blotting to a membrane and hybridized with the _m 32p_žy etaj BSSL cDNA used as a probe. The results showed that expression was only in the mammary glands during lactation (Fig. 18).

Milk samples were collected from anesthetized founder animals exposed to oxytocin for lactation induction and investigated for the presence of a recombinant variant of human BSSL. Assayed by SDSPAGE followed by transfer onto nitrocellulose membranes and incubation with polyclonal antibodies raised against native human BSSL. The results obtained showed expression of recombinant human BSSL variant in milk of transgenic mice. FIG. 19 shows the presence of a recombinant human BSSL variant in the milk of transgenic mice. Isolation of milk samples from various pS317 transgenic mice by SDS-PAGE and immunoblotting showed that the recombinant BSSL variant with lower molecular weight was produced more efficiently than the full length recombinant BSSL variant derived from pS314 transgenic mouse milk. Plasmid pS314 is similar to pS317 but has full-length human BSSL cDNA instead of the genomic variant. The double band seen in all mouse milk samples is murine BSSL and thus indicates cross-reactivity of the serum. This finding is confirmed by the observation that this dual band is visible in lane 9 of FIGS. 19, which contains purified BSSL in mice.

Stable lines of transgenic animals were developed.

Similarly, other transgenic animals, such as rabbits, cows or sheep, capable of expressing a human variant of BSSL may be generated.

DEPOSITS

The following plasmids were deposited under the Budapest Treaty at the Museum DSM (Deutsche Sammlung von Mikroorganismen und Zellkulturen):

Plasmas Deposit No. Date of deposit pS309 DSM 7101 pS310 DSM 7102 pS311 DSM 7103 June 12, 1992 pS317 DSM 7104 pS147 DSM 7495 pS257 DSM 7496 February 26, 1993 pS299 DSM 7497 pS258 DSM 7501 pS259 DSM 7502 March 3, 1993

BRIEF DESCRIPTION OF THE FIGURES

Figure 1

A. Schematic representation of a BPV-based vector used for expression of various BSSL variants.

B. Schematic of various BSSL variants studied. FL denotes full length BSSL. The active center is represented by a sphere, the link for a potential N-linked carbohydrate is marked by a triangle. The area with duplicates is a shaded area, and the conservative Cgal is marked with a solid area.

Figure 2

Southern blotting analysis of DNA isolated from cell lines expressing BSSL variants. DNA isolated from cell lines expressing full-length BSSL (FL), variant A (A), variant B (B), variant C (C), variant N (N) was tested. 5 µg of respectively prepared DNA isolated from the cell (left) and 1 ng of purified vector DNA isolated from bacteria (right) digested with BamHI. DNA samples were isolated by agarose gel electrophoresis, transferred onto GeneScreen Plus membrane and hybridized with 32p.žy _m etaj human BSSL cDNA.

Figure 3

Northern blotting analysis of RNA isolated from cell lines expressing recombinant BSSL variants. 10 µg of RNA isolated from cell lines producing full-length BSSL (FL), variant A (A), variant B (B), variant C (C), variant N (N) were tested. RNA from a 027 cell line containing the BPV vector identical to the vector from Fig. 1, except that it encodes a protein unrelated to BSSL used as a negative control (-) (top). Filters hybridized with ³² _m p_žy etaj _a BSSL cDNA. The filters were then re-hybridized with the murine β-actin cDNA probe, using β-actin iRNA signals (bottom) as an internal control for the amount of RNA loaded into each lane.

Figure 4

Expression of BSSL activity in 027 cells transfected with full-length and mutant forms of human BSSL. 027 cells were transfected with different BSSL costumes: full-length BSSL (FL), variant N (N), variant C (C), variant B (B), variant A (A). After the initial growth period, individual clones were selected and allowed to grow until fusion. The number of selected clones (n) is indicated in the figure. Lipase activity was determined in conditioned medium. Values are expressed in ml of free fatty acids liberated x mol'l x conditioned medium ml'l.

Figure 5

A. Western blotting of full-length and mutant recombinant BSSL. Lipase activity expressed as pmol x minl of fatty acids liberated on gel: full length 0.2 (lane 1), variant N 0.16 (lane 2), variant C 0.6 (lane 3), variant B 0.8 ( Lane 4), native BSSL 0.1 (lane 5). The antiserum used was obtained in rabbits against BSSL isolated from breast milk. The positions of the molecular weight markers (SDSPAGE pre-stained, Low Range, BioRad) are shown at left.

B. Western blotting of variant B exposed to N-glycosidase. Variant B is cleaved with N-glycosidase F as described in the experimental section. Lane 1 is unaffected and Lane B is affected by Option B.

Figure 6

Dependence of full-length and mutant BSSL on bile salts. Lipase activity was determined by varying the concentrations of sodium cholate (solid line) or sodium deoxycholate (dotted line) in conditioned medium using full-length recombinant BSSL (*), variant A (□), variant B (Δ), variant C (), variant N ( O) and purified human milk BSSL (O). In the case of Variant A, the conditioned medium is concentrated on blue sepharose as described in the experimental section. The amount of the corresponding enzyme was chosen to give the same level of peak activity, except for variant A, which had only one tenth of the highest activity. Control experiments showed that the growth medium had no effect on the activity level or the dependence of native BSSL on bile salts (data not shown).

Figure 7

A. Northern blotting of various E.coli strains produced by BSSL. Bacteria were induced by IPTG as described in the experimental section. The test conditions were the same as in Fig. In Description 2. Lane 1, uninduced BL21 (DE3) pLysS strain; Lane 2, induced BL21 (DE3) pLysS strain; Lane 3, uninduced JM109 (DE3) strain; Lane 4, induced strain JM109 (DE3);

B. Western blotting of 8-18% SDS-PAGE using antibodies against purified milk BSSL showing expression of recombinant BSSL in different E.coli strains using pGEMEX. Bacteria induced IPTG and cytoplasmic and periplasmic proteins were isolated from lysates as described in the experimental section. The amounts of bacterial protein applied to lanes 2-5 (periplasmic preparations) and 7-10 lanes (cytoplasmic preparations) correspond to the same volume of culture, so that the dye stains are proportional to the level of production. Lane 1, Pharmacia molecular weight marker; Lanes 2 and 8, induced strain JM109 (DE3); Lanes 3 and 7, uninduced JM109 (DE3) strain; Lanes 4 and 10, induced BL21 (DE3) pLysS strain; Lanes 5 and 9, uninduced BL21 (DE3) pLysS strain; Lane 6, 25 ng BSSL of purified natural milk.

Figure 8

SDS-PAGE of purified recombinant BSSL and BSSL variants. Full-length BSSL (FL) and BSSL variants N, B, and C were purified as described. 3 pg each was used except for variant B where 1.5 pg was used. Purified natural milk BSSL (NAT) used 5 pg. The positions of the molecular weight markers are marked on the left.

Figure 9

Influence of sodium deoxycholate on activation of recombinant BSSL and BSSL variants by sodium cholate. The lipase activity of recombinant full-length BSSL (O), recombinant BSSL variants B (O), C () and N (Δ) purified preparations and purified milk BSSL (□) at different concentrations of sodium cholate was investigated, with and without (left panel). 5 mM (center panel) or 10 mM (right panel) deoxycholate.

Figure 10

Stability of recombinant BSSL and BSSL variants at different pH. Native BSSL, recombinant full length BSSL and BSSL variants were incubated at 37 ° C in different buffers with pH 2-8. All buffers contained 1 mg / ml bovine serum albumin. After 30 min, uniform size samples were taken and tested for lipase activity. See Figure 9 for an explanation of the symbols.

Figure 11

Heat resistance of recombinant BSSL and BSSL variants. Purified recombinant full-length BSSL, BSSL variants, and native milk BSSL were incubated at the indicated temperatures in 50 mM Tris-Cl buffer, pH 7.5. One group of samples contained 1 mg / ml bovine serum albumin. Samples were taken after 30 min and tested for lipase activity. Activity is expressed as a percentage of the activity of each sample at 0 min. See Figure 9 for an explanation of the symbols.

Figure 12

Influence of bile salts on inactivation of recombinant BSSL and BSSL variants by trypsin. Purified recombinant full length BSSL, BSSL variants and native milk BSSL (15 pi containing 1-4 pg) were added to 60 pi 1.0 M Tris-Cl, pH 7.4 with 10 pg trypsin (TPCK-tripsin, Boehringer- Mannheim) at 25 ° C, without (dashed line) and with (solid line) 10 mM sodium cholate. After the indicated time, equal size samples were taken and tested for lipase activity. Values are expressed as percentages of the values obtained in control incubations without trypsin. See Figure 9 for an explanation of the symbols.

Figure 13

Method of production of plasmid pS317. See section 3.1 for details.

Figure 14

Construction scheme of plasmid pS312.

Figure 15

Construction scheme of plasmid pS317.

Figure 16

Schematic depicting the physical position of the human BSSL variant genomic construct in the exon WAP gene as described in section 3.1.

Figure 17

A. Layout of PCR primers used to identify transgenic animals. The 5'-primer is located at the WAP sequence starting at position 148 bp upstream of the WAP and BSSL variant junction point. The 3'-primer is located at the first intron of the BSSL variant terminating 400 bp below the junction point.

B. Sequences of PCR primers used.

C. Typical PCR analysis of potential animal founders on an agarose gel. M: Molecular weight markers. Lane 1: Control PCR product obtained from plasmid pS317. Lane 2-13: PCR reactions performed with DNA preparations from potential animal founders.

Figure 18

Northern blotting of RNA isolated from various tissues of female pS317 transgenic mouse. Tissues were isolated on the fourth day of lactation. 10 µg of total RNA from each tissue was assayed except on agar-formaldehyde and transferred onto membranes and hybridized with 32p. labeled human BSSL cDNA. The tracks contain Mg: mammary glands; Li: liver; Ki: renal; Sp: spleen; He: heart; Lu: lung; Sg: salivary glands; Br: brain. The size of the RNA expressed in nucleotides is marked on the left.

Figure 19

Western blotting of milk from pS317 transgenic mice and full-length cDNA vector pS314 transgenic mice and control animals. Samples were isolated by SDSPAGE and transferred to Immobilon filters and immunoblotted using atherosclerosis obtained against native human BSSL. Lane 1: molecular weight markers; Lanes 2.3 and 4: 2 μΐ milk from pS317 founder # 91 three Fl daughters (Fl 30, 31, and 33); Lane 5: 2 μΐ milk from pS314 founder # 90; Lanes 6.7 and 8: 2 μΐ milk from three non-BSSL transgenic animals; Lane 9: purified BSSL in mice; Track 10: Purified human native BSSL.

SEQUENCE DESCRIPTION (1) GENERAL INFORMATION (1) APPLICANTS:

(A) NAME: AB ASTRA (B) STREET: Kvarnbergagatan 16 (C) CITY: Sodertalje (E) COUNTRY: Sweden (F) ZIP Code (ZIP): S-151 85 (G) PHONE: + 46-8-55 32 60 00 (H) TELEPHONE: + 46-8-55 32 88 20 (I) TELEX: 19237 astr (ii) INVENTION NAME: New Polypeptides (iii) SEQUENCE: 9 (iv) COMPUTER-SCANABLE FORM:

(A) MEDIA TYPE: Hard Disk (B) COMPUTER: Compatible with IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patentln Release # 1.0, Version # 1.25 (EPO) (2) SEQ ID No: 1Information:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2428 base pairs (B) TYPE: nucleic acid (C) BINDING (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: cDNA derived from iRNA (iii) HYPOTHETICAL: no (iii) ANTIPRASMIC: no (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: CDS (B) POSITION: 82 .. 2319 (D) OTHER INFORMATION: / Product = "Bile Salt Stimulated Lipase" (ix) FEATURE:

(A) NAME / KEY: Exon (B) POSITION: 985 .. 1173 (ix) FEATURE:

(A) NAME / KEY: Exon (B) POSITION: 1174 .. 1377 (ix) FEATURE:

(A) NAME / KEY: Exon (B) POSITION: 1378. . 1575 (ix) FEATURE:

(A) NAME / KEY: Exon (B) POSITION: 1576 .. 2415 (ix) FEATURE:

(A) NAME / KEY: Mature peptide (B) POSITION: 151 .. 2316 (ix) FEATURE:

(A) NAME / KEY: polyA signal (B) POSITION: 2397 .. 2402 (ix) FEATURE:

(A) NAME / KEY: Repetition Area (B) POSITION: 1756 .. 2283 (ix) FEATURE:

(A) NAME / KEY: 5'UTR (B) POSITION: 1 .. 81 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1756 .. 1788 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1789 .. 1821 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1822 .. 1854 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1855 .. 1887 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1888 .. 1920 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1921 .. 1953 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1954 .. 1986 (ix) FEATURE:

(A524) NAME / KEY: Repetition Unit (B) POSITION: 1987 .. 2019 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2020 .. 2052 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2053 .. 2085 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2086 .. 2118 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2119 .. 2151 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2152 .. 2184 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2185 .. 2217 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2218. . 2250 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2251 .. 2283 (xi) SEQUENCE DISPLAY: SEQ ID NO: 1:

ACCTTCTGTA TCAGTTAAGT GTCAAGATGG AAGGAACAGC AGTCTCAAGA TAATGCAAAG 60

agtttattca tccagaggct g ATG Met -23 CTC Leu ACC Thr ATG GGG CGC Arg CTG Leu CAA Gln CTG Leu -15 GTT Or 111 Met -20 Gly GTG TTG GGC CTC ACC TGC TGC TGG GCA GTG GCG AGT GCC GCG AAG CTG 159 Or Leu Gly Leu Thr Cys Cys Trp Ala Or Ala Ser Ala Ala Lys Leu -10 -5 1 GGC GCC GTG TAC ACA GAA GGT GGG TTC GTG GAA GGC GTC AAT AAG AAG 207 Gly Ala Vai Tyr Thr Glu Gly Gly Phe Or Glu Gly Or Asn Lys Lys 5 10th 15th CTC GGC CTC CTG GGT GAC TCT GTG GAC ATC TTC AAG GGC ATC CCC TTC 255 Leu Gly Leu Leu Gly Asp Ser Or Asp Ile Phe Lys Gly Ile Pro Phe 20 25 30th 35 GCA GCT CCC ACC AAG GCC CTG GAA AAT CCT CAG CCA CAT CCT GGC TGG 303 Ala Ala Pro Thr Lys Ala Leu Glu Asn Pro Gln Pro His Pro Gly Trp 40 45 50 CAA GGG ACC CTG AAG GCC AAG AAC TTC AAG AAG AGA TGC CTG CAG GCC 351 Gln Gly Thr Leu Lys Ala Lys Asn Phe Lys Lys Arg Cys Leu Gln Ala 55 60 65 ACC ATC ACC CAG GAC AGC ACC TAC GGG GAT GAA GAC TGC CTG TAC CTC 399 Thr Ile Thr Gln Asp Ser Thr Tyr Gly Asp Glu Asp Cys Leu Tyr Leu 70 75 80 AAC ATT TGG GTG CCC CAG GGC AGG AAG CAA GTC TCC CGG GAC CTG CCC 447 Asn Ile Trp Is Pro Gln Gly Arg Lys Gln Or Ser Arg Asp Leu Pro 85 90 95 GTT ATG ATC TGG ATC TAT GGA GGC GCC TTC CTC ATG GGG TCC GGC CAT 495 Is Met Ile Trp Ile Tyr Gly Gly Ala Phe Leu Met Gly Ser Gly His 100. · 105 110 115 GGG GCC AAC TTC CTC AAC AAC TAC CTG TAT GAC GGC GAG GAG ATC GCC 543 Gly Ala Asn Phe Leu Asn Asn Tyr Leu Tyr Asp Gly Glu Glu Ile Ala 120 125 130 ACA CGC GGA AAC GTC ATC GTG GTC ACC TTC AAC TAC CGT GTC GGC CCC 591 Thr Arg Gly Asn Vai Ile Or Or Thr Phe. Asn Tyr Arg Or Gly Pro 135 140 145 CTT GGG TTC CTC AGC ACT GGG GAC GCC AAT CTG CCA GGT AAC TAT GGC 639 Leu Gly Phe Leu Ser Thr Gly Asp Ala Asn Leu Pro Gly Asn Tyr Gly 150 155 160 CTT CGG GAT CAG CAC ATG GCC ATT GCT TGG GTG AAG AGG AAT ATC GCG 687 Leu Arg Asp Gln His Met Ala Ile Ala Trp Or Lys Arg Asn Ile Ala 165 170 175

GCC Ala 180 TTC Phe GGG GGG GAC CCC AAC AAC ATC ACG CTC TTC GGG GAG TCT GCT 735 Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 GGA GGT GCC AGC GTC TCT CTG CAG ACC CTC TCC CCC TAC AAC AAG GGC 783 Gly Gly Ala Ser Or Ser Leu Gln Thr Leu Ser Pro Tyr Asn Lys Gly 200 205 210 CTC ATC CGG CGA GCC ATC AGC CAG AGC GGC GTG GCC CTG AGT CCC TGG 831 Leu Ile Arg Arg Ala Ile Ser Gln Ser Gly Or Ala Leu Ser Pro Trp 215 220 225 GTC ATC CAG AAA AAC CCA CTC TTC TGG GCC AAA AAG GTG GCT GAG AAG 879 Or Ile Gln Lys Asn Pro Leu Phe Trp Ala Lys Lys Or Ala Glu Lys 230 235 240 GTG GGT TGC CCT GTG GGT GAT GCC GCC AGG ATG GCC CAG TGT CTG AAG 927 Or Gly Cys Pro Or Gly Asp Ala Ala Arg Met Ala Gln Cys Leu Lys 245 250 255 GTT ACT GAT CCC CGA GCC CTG ACG CTG GCC TAT AAG GTG CCG CTG GCA 975 Or Thr Asp Pro Arg Ala Leu Thr Leu Ala Tyr Lys Or Pro Leu Ala 260 265 270 275 GGC CTG GAG TAC CCC ATG CTG CAC TAT GTG GGC TTC GTC CCT GTC ATT 1023 Gly Leu Glu Tyr Pro Met Leu His Tyr Or Gly Phe Or Pro Or Ile 280 285 290 GAT GGA GAC TTC ATC CCC GCT GAC CCG ATC AAC CTG TAC GCC AAC GCC 1071 Asp Gly Asp Phe Ile Pro Ala Asp Pro Ile Asn Leu Tyr Ala Asn Ala 295 300 305 GCC GAC ATC GAC TAT ATA GCA GGC ACC AAC AAC ATG GAC GGC CAC ATC 1119 Ala Asp Ile Asp Tyr Ile Ala Gly Thr Asn Asn Met Asp Gly His Ile 310 315 320 TTC GCC AGC ATC GAC ATG CCT GCC ATC AAC AAG GGC AAC AAG AAA GTC 1167 Phe Ala Ser Ile Asp Met Pro Ala Ile Asn Lys Gly Asn Lys Lys Or 325 330 335 ACG GAG GAG GAC TTC TAC AAG CTG GTC AGT GAG TTC ACA ATC ACC AAG 1215 Thr Glu Glu Asp Phe Tyr Lys Leu Or Ser Glu Phe Thr Ile Thr Lys 340 345 350 355 GGG CTC AGA GGC GCC AAG ACG ACC TTT GAT GTC TAC ACC GAG TCC TGG 1263 Gly Leu Arg Gly Ala Lys Thr Thr Phe Asp Or Tyr Thr Glu Ser Trp 360 365 370 GCC CAG GAC CCA TCC CAG GAG AAT AAG AAG AAG ACT GTG GTG GAC TTT 1311 Ala Gln Asp Pro Ser Gln Glu Asn Lys Lys Lys Thr Or Or Asp Phe 375 380 385 GAG ACC GAT GTC CTC TTC CTG GTG CCC ACC GAG ATT GCC CTA GCC CAG 1359 Glu Thr Asp Or Leu Phe Leu Or Pro Thr Glu Ile Ala Leu Ala Gln 390 395 400 CAC AGA GCC AAT GCC AAG AGT GCC AAG ACC TAC GCC TAC CTG TTT TCC 1407 His Arg Ala Asn Ala Lys Ser Ala Lys Thr Tyr Ala Tyr Leu Phe Ser 405 410 415 CAT CCC TCT CGG ATG ccc GTC TAC CCC AAA TGG GTG GGG GCC GAC CAT 1455 His Pro Ser Arg Met Pro Or Tyr Pro Lys Trp Or Gly Ala Asp His 420 425 430 435 GCA GAT GAC ATT CAG TAC GTT TTC GGG AAG CCC TTC GCC ACC CCC ACG 1503 Ala Asp Asp Ile Gln Tyr Or Phe Gly Lys Pro Phe Ala Thr Pro Thr

440,445,450

GGC TAC CGG CCC CAA GAC AGG ACA GTC TCT AAG GCC ATG ATC GCC TAC 1551 Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr TGG ACC AAC TTT GCC AAA ACA GGG GAC CCC AAC ATG GGC GAC TCG GCT 1599 Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala GTG CCC ACA CAC TGG GAA CCC TAC ACT ACG GAA AAC AGC GGC TAC CTG 1647 Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu GAG ATC ACC AAG AAG ATG GGC AGC AGC TCC ATG AAG CGG AGC CTG AGA 1695 Glu 500 Ile Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 ACC AAC TTC CTG CGC TAC TGG ACC CTC ACC TAT CTG GCG CTG CCC ACA 1743 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr GTG ACC GAC CAG GAG GCC ACC CCT GTG CCC CCC ACA GGG GAC TCC GAG 1791 Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu GCC ACT CCC GTG CCC CCC ACG GGT GAC TCC GAG ACC GCC CCC GTG CCG 1839 Ala Thr Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Glu Thr Ala 560 Pro Or Pro CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC 1887 Pro Thr 565 Gly Asp Ser Gly Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG 1935 Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC 1983 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro 605 Or Pro Pro Thr Gly 610 Asp TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC 2031 Ser Gly Ala Pro 615 Pro Or Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro GTG CCG CCC ACG GGT GAC TCC GGC GCC CCC CCC GTG CCG CCC ACG GGT 2079 Or Pro Pro 630 Thr Gly Asp Ser Gly 635 Ala Pro Pro Or Pro 640 Pro Thr Gly GAC GCC GGG CCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGC GCC CCC 2127 Asp Ala 645 Gly Pro Pro Pro Or 650 Pro Pro Thr Gly Asp 655 Ser Gly Ala Pro CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG ACC CCC ACG 2175 Pro 660 Or Pro Pro Thr Gly 665 Asp Ser Gly Ala Pro 670 Pro Or Thr Pro Thr 675 GGT GAC TCC GAG ACC GCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC 2223 Gly Asp Ser Glu Thr 680 Ala Pro Or Pro Pro 685 Thr Gly Asp Ser Gly 690 Ala CCC CCT GTG CCC CCC ACG GGT GAC TCT GAG GCT GCC CCT GTG CCC CCC 2271 Pro Pro Or Pro 695 Pro Thr Gly Asp Ser 700 Glu Ala Ala Pro Or 705 Pro Pro ACA GAT GAC TCC AAG GAA GCT CAG ATG CCT GCA GTC ATT AGG TTT TAGCGTCCCA

2326

Thr Asp Asp Ser Lys Glu Ala Gln Met Pro Ala Vai Ile Arg Phe 710 715 720

TGAGCCTTGG TATCAAGAGG CCACAAGAGT GGGACCCCAG GGGCTCCCCT CCCATCTTGA

GCTCTTCCTG AATAAAGCCT CATACCCCTA AAAAAAAAAA AA

2386

2428 (2) SWQ ID NO: 2 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 745 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (») SEQ ID NO: 2:

Met -23 Leu Thr Met -20 Gly Arg Leu Gln Leu -15 Or Or Leu Gly Leu -10 Thr Cys Cys Trp Ala -5 Or Ala Ser Ala Ala 1 Lys Leu Gly Ala 5 Or Tyr Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile Thr 70 Gln Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu Ile 130 Ala Thr Arg Gly Asn 135 Or Ile Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly • Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser I'm losing Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Vai 32 Gly 245 Cys Pro Or Gly Asp Ala Ala Arg Met Ala Gln Cys Leu Lys Or Thr Asp Pro Arg Ala

250

255

260

265

Leu Thr Leu Ala. Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 lle Asp Gly Asp Phe 295 lle Pro Ala Asp Pro 300 lle Asn Leu Tyr Ala 305 Asn Ala Ala Asp lle 310 Asp Tyr lle Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His lle Phe Ala 325 Ser Hey Asp Met Pro 330 Ala lle Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr lle Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu lle Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp lle Gln 440 Tyr Or Phe Gly Lys 445 Pro Phe Ala Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met lle 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu Glu 500 lle Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu Ala Thr Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Glu Thr Ala 560 Pro Or Pro Pro Thr 565 Gly Asp Ser Gly Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro 605 Or Pro Pro Thr Gly 610 Asp Ser 33 Gly Ala Pro 615 Pro Or

Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro Or Pro Pro 630 Thr Gly Asp Ser Gly 635 Ala Pro Pro Or Pro 640 Pro Thr Gly Asp Ala 645 Gly Pro Pro Pro Or 650 Pro Pro Thr Gly Asp 655 Ser Gly Ala Pro Pro 660 Or Pro Pro Thr Gly 665 Asp Ser Gly Ala Pro 670 Pro Or Thr Pro Thr 675 Gly Asp Ser Glu Thr 680 Ala Pro Or Pro Pro 685 Thr Gly Asp Ser Gly 690 Ala Pro Pro Or Pro 695 Pro Thr Gly Asp Ser 700 Glu Ala Ala Pro Or 705 Pro Pro Thr Asp Asp 710 Ser Lys Glu Ala Gln 715 Met Pro Ala Or Ile 720 Arg Phe

(2) SEQ ID NO: 3 INFORMATION:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 722 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (iii) HYPOTHETICAL: no (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (xi) SEQUENCE REPORTING: SEQ ID NO: 3:

Ala 1 Lys Le'u Gly Ala 5 Or Tyr Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile Thr 70 Gln .Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Lfeu Tyr Leu Asn Ile. 85 .Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu Ile 130 Ala Thr Arg Gly Asn 135 Or Ile 34 Or Or Thr 140 Phe Asn Tyr Arg

Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser Leu Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 Ile Asp Gly Asp Phe 295 Ile Pro Ala Asp Pro 300 Ile Asn Leu Tyr Ala 305 Asn Ala Ala Asp Ile 310 Asp Tyr Ile Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His Ile Phe Ala 325 Ser Ile Asp Met Pro 330 Ala Ile Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr Ile Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp Ile Gln 440 Tyr Or Phe Gly Lys 445 Pro Phe Ala Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala Or Pro 485 Thr His Trp Glu ' Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu Glu 500 Ile Thr Lys Lys Met ⁵ Gly 505 Ser Ser Ser Met 510 Lys Arg

Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu Ala Thr Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Glu Thr Ala 560 Pro Or Pro Pro Thr 565 Gly Asp Ser Gly Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro 605 Or Pro Pro Thr Gly 610 Asp Ser Gly Ala Pro 615 Pro Or Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro Or Pro Pro 630 Thr Gly Asp Ser Gly 635 Ala Pro Pro Or Pro 640 Pro Thr Gly Asp Ala 645 Gly Pro Pro Pro Or 650 Pro Pro Thr Gly Asp 655 Ser Gly Ala Pro Pro 660 Or Pro Pro Thr Gly 665 Asp Ser Gly Ala Pro 670 Pro Or Thr Pro Thr 675 Gly Asp Ser Glu Thr 680 Ala Pro Or Pro Pro 685 Thr Gly Asp Ser Gly 690 Ala Pro Pro Or Pro 695 Pro Thr Gly Asp Ser 700 Glu Ala Ala Pro Or 705 Pro Pro Thr Asp Asp 710 Ser Lys Glu Ala Gln 715 Met Pro Ala Or lle 720

Arg Phe (2) SEQ ID NO: 4 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 535 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii). MOLECULAR TYPE: Protein (iii) HYPOTHETICAL: No (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: Peptide (B) PAD: 1 .. 535 (D) OTHER INFORMATION: / tag = Variant_A (xi) SEQUENCE REFERENCE: SEQ ID NO: 4:

Ala Lys Leu Gly Ala Vai Tyr Thr Glu Gly Gly Phe Vai Glu Gly Vai 1 5 36 io 15

Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile Thr 70 Gln Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu Ile 130 Ala Thr Arg Gly Asn 135 Or Ile Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser Leu Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 Ile- Asp Gly Asp Phe 295 Ile Pro Ala Asp Pro 300 Ile Asn Leu Tyr Ala 305 Asn .. Area ' Ala Asp Ile 310 Asp Tyr Ile Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His Ile Phe Ala 325 Ser Ile Asp Met Pro 330 Ala Ile Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr Ile Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln JJlu Asn Lys 380 Lys Lys Thr Or

Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln His Arg Ala Asn Ala Lys Ser Ala Lys Thr Tyr Ala Tyr 405 410 415 Leu Phe Ser His Pro Ser Arg Met Pro Or Tyr Pro Lys Trp Or Gly 420 425 430 Ala Asp His Ala Asp Asp Ile Gln Tyr Or Phe Gly Lys Pro Phe Ala 435 440 445 Thr Pro Thr Gly Tyr Arg Pro Gln Asp Arg Thr Or Ser Lys Ala Met 450 455 460 Ile Ala Tyr Trp Thr Asn Phe Ala Lys Thr Gly Asp Pro Asn Met Gly 465 470 475 480 Asp Ser Ala Or Pro Thr His Trp Glu Pro Tyr Thr Thr Glu Asn Ser 485 490 495 Gly Tyr Leu Glu Ile Thr Lys Lys Met Gly Ser Ser Ser Met Lys Arg 500 505 510 Ser Leu Arg Thr Asn Phe Leu Arg Tyr Trp Thr Leu Thr Tyr Leu Ala 515 520 525 Leu Pro Thr Or Thr Asp Gln

530 535 (2) SEQ ID NO: 5 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 546 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (iii) HYPOTHETICAL: no (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: Peptide (B) POSITION: 1..546 (D) OTHER INFORMATION: / Tag = Variant_B (xi) SEQ ID NO: 5

Ala 1 Lys Leu Gly Ala 5 Or Tyr -Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala. Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile Thr 70 Gln Asp Ser 38 Thr Tyr 75 Gly Asp Glu Asp Cys 80

Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu Ile 130 Ala Thr Arg Gly Asn 135 Or Ile Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser Leu Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 Ile Asp Gly Asp Phe 295 Ile Pro Ala Asp Pro 300 Ile Asn Leu Tyr Ala 305 Asn Ala Ala Asp Ile 310 Asp Tyr Ile Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His Ile Phe Ala 325 Ser Ile Asp Met Pro 330 Ala Ile Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr Ile Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp Ile Gln 440 t $ S · Or Phe Gly Lys 445 Pro Phe Ala

Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu Glu 500 Ile Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr Or Thr Asp Gln 535 Lys Glu Ala Gln Met 540 Pro Ala Or Ile

Arg Phe 545 (2) SEQ ID NO: 6 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 568 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (iii) HYPOTHETICAL ·, not (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: Peptide (B) POSITION: 1 .. 568 (D) OTHER INFORMATION: / tag = Variant_C (xi) SEQ ID NO: 6

Ala 1 Lys Leu Gly Ala 5 Or Tyr Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu .Lys 55 Ala Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile .Thr 70 Gln Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 ' Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 ^As 3o Asn Tyr Leu Tyr 125 Asp Gly Glu

Glu lle 130 Ala Thr Arg Gly Asn 135 Or lle Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 lle Ala Trp Or Lys 175 Arg Asn lle Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Asn lle Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser Leu Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu lle Arg Arg 215 Ala lle Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or lle Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 lle Asp Gly Asp Phe 295 lle Pro Ala Asp Pro 300 lle Asn Leu Tyr Ala 305 Asn Ala Ala Asp lle 310 Asp Tyr lle Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His lle Phe Ala 325 Ser lle Asp Met Pro 330 Ala lle Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr lle Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu lle Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp lle Gln 440 Tyr Or Phe Gly Lys 445 Pro Phe Ala Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met lle 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys' Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala Or Pro Thr His Trp GiU Pro Tyr Thr Thr Glu Asn Ser

485,490,495

Gly Tyr Leu Glu 500 Ile Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr Or Thr Asp Gln 535 Gly Ala Pro Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Gly Ala Pro Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Lys Glu Ala 560 Gln Met Pro Ala Or 565 Ile Arg Phe

(2) SEQ ID NO: 7 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 722 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (iii) HYPOTHETICAL: no (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: Peptide (B) POSITION: 1 .. 722 (D) OTHER INFORMATION: / Tag = Variant_N (xi) SEQUENCE REPRESENTATION: SEQID NO: 7

Ala 1 Lys Leu Gly Ala 5 Or Tyr Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala Lys Asn Phe 60 Lys Lys Arg cys Leu 65 Gln Ala Thr Ile Thr 70 Gln Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met • Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu Ile 130 Ala Thr Arg Gly Asn 135 Or Ile Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly 42 Asp 155 Ala Asn Leu Pro Gly 160

Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala 180 Phe Gly Gly Asp Pro 185 Asn Gln Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 Gly Gly Ala Ser Or 200 Ser Leu Gln Thr Leu 205 Ser Pro Tyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 Ile Asp Gly Asp Phe 295 Ile Pro Ala Asp Pro 300 Ile Asn Leu Tyr Ala 305 Asn Ala Ala Asp Ile 310 Asp Tyr Ile Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His Ile Phe Ala 325 Ser Ile Asp Met Pro 330 Ala Ile Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr Ile Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp Ile Gln 440 Tyr Or Phe Gly Lys 445 Pro Phe Ala Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu Glu ' 500 Ile Thr Lys Lys Met'Gly 505 Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyf ^ Trp Thr Leu Thr 525 Tyr Leu Ala

Leu Pro 530 Thr Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu Ala Thr Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Glu Thr Ala 560 Pro Or Pro Pro Thr 565 Gly Asp Ser Gly Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro 605 Or Pro Pro Thr Gly 610 Asp Ser Gly Ala Pro 615 Pro Or Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro Or Pro Pro 630 Thr Gly Asp Ser Gly 635 Ala Pro Pro Or Pro 640 Pro Thr Gly Asp Ala 645 Gly Pro Pro Pro Or 650 Pro Pro Thr Gly Asp 655 Ser Gly Ala Pro Pro 660 Or Pro Pro Thr Gly 665 Asp Ser Gly Ala Pro 670 Pro Or Thr Pro Thr 675 Gly Asp Ser Glu Thr 680 Ala Pro Or Pro Pro 685 Thr Gly Asp Ser Gly 690 Ala Pro Pro Or Pro 695 Pro Thr Gly Asp Ser 700 Glu Ala Ala Pro Or 705 Pro Pro Thr Asp Asp 710 Ser Lys Glu Ala Gln 715 Met Pro Ala Or Ile 720

Arg Phe (2) SEQ ID NO: 8 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2184 base pairs (B) TYPE: nucleic acid (C) BINDING: double (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (iii) HYPOTHETICAL: no (iii) ANTIPRASMIC: no ( (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: Mammary gland (ix) FEATURE:

(A) NAME / KEY: CDS (B) POSITION: 82 .. 2088 (D) OTHER INFORMATION: / Tag = Variant_T (ix) FEATURE:

(A) NAME / KEY: Mature peptide (B) POSITION: 151 .. 2085 (ix) FEATURE: 44 (A) NAME / KEY: Repetition Area (B) POSITION: 1756 .. 2052 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1756 .. 1788 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1789 .. 1821 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1822 .. 1854 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1855 .. 1887 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1888 .. 1920 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1921 .. 1953 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1954 .. 1986 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 1987 .. 2019 (ix) FEATURE:

(A) NAME / KEY: Repetition Unit (B) POSITION: 2020 .. 2052 (xi) SEQUENCE DISPLAY: SEQ ID NO: 8

ACCTTCTGTA TCAGTTAAGT GTCAAGATGG AAGGAACAGC AGTCTCAAGA TAATGCAAAG 60

AGTTTATTCA TCCAGAGGCT G ATG Met CTC ACC ATG GGG CGC CTG CAA CTG Leu Gln Leu -15 GTT Or 111 Leu Thr Met -20 Gly Arg -23 GTG TTG GGC CTC ACC TGC TGC TGG GCA GTG GCG AGT GCC GCG AAG CTG 159 Or Leu Gly Leu Thr Cys Cys Trp Ala Or Ala Ser Ala Ala Lys Leu -10 -5 1 GGC GCC GTG TAC ACA GAA GGT GGG TTC GTG GAA GGC GTC AAT AAG AAG 207 Gly Ala Or Tyr Thr Glu Gly Gly Genuine Or Glu Gly Or Asn Lys Lys 5 10th 15th CTC GGC CTC CTG GGT GAC TCT GTG GAC ATC TTC AAG GGC ATC CCC TTC 255 Leu Gly Leu Leu Gly Asp Ser Or Asp Ile Phe Lys Gly Ile Pro Phe 20th 25th 30th 35 GCA GCT CCC ACC AAG GCC CTG GAA AAT CCT CAG CCA CAT CCT GGC TGG 303 Ala Ala Pro Thr Lys Ala Leu Glu Asn Pro Gln Pro His Pro Gly Trp 40 45 50 CAA GGG ACC CTG AAG GCC AAG AAC TTC AAG AAG AGA TGC CTG CAG GCC 351 Gln Gly Thr Leu Lys Ala Lys Asn Phe Lys Lys Arg Cys Leu Gln Ala 55 60 45 65

ACC Thr ATC Ile ACC Thr ⁷⁰ CAG GAC AGC ACC TAC Tyr 75 GGG GAT GAA GAC TGC CTG TAC CTC Leu 399 Gln Asp Ser Thr Gly Asp Glu Asp Cys 80 Leu Tyr AAC ATT TGG GTG CCC CAG GGC AGG AAG CAA GTC TCC CGG GAC CTG CCC 447 Asn Ile Trp Or Pro Gln Gly Arg Lys Gln Or Ser Arg Asp Leu Pro 85 90 95 GTT ATG ATC TGG ATC TAT GGA GGC GCC TTC CTC ATG GGG TCC GGC CAT 495 Or Met Ile Trp Ile Tyr Gly Gly Ala Phe Leu Met Gly Ser Gly His 100 105 110 115 GGG GCC AAC TTC CTC AAC AAC TAC CTG TAT GAC GGC GAG GAG ATC GCC 543 Gly Ala Asn Phe Leu Asn Asn Tyr Leu Tyr Asp Gly Glu Glu Ile Ala 120 125 130 ACA CGC GGA AAC GTC ATC GTG GTC ACC TTC AAC TAC CGT GTC GGC CCC 591 Thr Arg Gly Asn Or Ile Or Or Thr Phe Asn Tyr Arg Or Gly Pro 135 140 145 CTT GGG TTC CTC AGC ACT GGG GAC GCC AAT CTG CCA GGT AAC TAT GGC 639 Leu Gly Phe Leu Ser Thr Gly Asp Ala Asn Leu Pro Gly Asn Tyr Gly 150 155 160 CTT CGG GAT CAG CAC ATG GCC ATT GCT TGG GTG AAG AGG AAT ATC GCG 687 Leu Arg Asp Gln His Met Ala Ile Ala Trp Or Lys Arg Asn Ile Ala 165 170 175 GCC TTC GGG GGG GAC CCC AAC AAC ATC ACG CTC TTC GGG GAG TCT GCT 735 \ .la Phe Gly Gly Asp Pro Asn Asn Ile Thr Leu Phe Gly Glu Ser Ala .80 185 190 195 5GA GGT GCC AGC GTC TCT CTG CAG ACC CTC TCC CCC TAC AAC AAG GGC 783 5ly Gly Ala Ser Or Ser Leu Gln Thr Leu Ser Pro Tyr Asn Lys Gly 200 205 210 : tc ATC CGG CGA GCC ATC AGC CAG AGC GGC GTG GCC CTG AGT CCC TGG 831 Yeah Ile Arg Arg Ala Ile Ser Gln Ser Gly Or Ala Leu Ser Pro Trp 215 220 225 ; tc ATC CAG AAA AAC CCA CTC TTC TGG GCC AAA AAG GTG GCT GAG AAG 879 That's it Ile Gln Lys Asn Pro Leu Phe Trp Ala Lys Lys Or Ala Glu Lys 230 235 240 ; tg GGT TGC CCT GTG GGT GAT GCC GCC AGG ATG GCC CAG TGT CTG AAG 927 'ai Gly Cys Pro Or Gly Asp Ala Ala Arg Met Ala Gln Cys Leu Lys 245 250 255 : etc ACT GAT CCC CGA GCC CTG ACG CTG GCC TAT AAG GTG CCG CTG GCA 975 ^r al Thr Asp Pro Arg Ala Leu Thr Leu Ala Tyr Lys Or Pro Leu Ala : 60 265 27 0 275 1GC CTG GAG TAC CCC ATG CTG CAC TAT GTG GGC TTC GTC CCT GTC ATT 1023 Yeah Leu Glu Tyr Pro Met Leu His Tyr Or Gly Phe Or Pro Or Ile 280 285 290 : AT GGA GAC TTC ATC CCC GCT GAC CCG ATC AAC CTG TAC GCC AAC GCC 1071 .sp Gly Asp Phe Ile Pro Ala Asp Pro Ile Asn Leu Tyr Ala Asn Ala 295 300 305 ! CC GAC ATC GAC TAT ATA GCA GGC ACC AAC AAC ATG GAC GGC CAC ATC 1119 .la Asp Ile Asp Tyr Ile Ala Gly Thr Asn Asn Met Asp Gly His Ile 310 315 , · 320 TC GCC AGC ATC GAC ATG CCT GCC ATC AAC AAG GGC AAC AAG AAA GTC 1167 'he Ala Ser Ile Asp Met Pro Ala Ile Asn Lys Gly Asn Lys Lys Or 325 330 46th 335

ACG GAG GAG Glu GAC TTC TAC Tyr 345 AAG Lys CTG Leu GTC Or AGT GAG TTC ACA ATC ACC AAG 1215 Thr 340 Glu Asp Phe Ser Glu 350 Phe Thr Ile Thr Lys 355 GGG CTC AGA GGC GCC AAG ACG ACC TTT GAT GTC TAC ACC GAG TCC TGG 1263 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp Vai 365 Tyr Thr Glu Ser 370 Trp GCC CAG GAC CCA TCC CAG GAG AAT AAG AAG AAG ACT GTG GTG GAC TTT 1311 Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe GAG ACC GAT GTC CTC TTC CTG GTG CCC ACC GAG ATT GCC CTA GCC CAG 1359 Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln CAC AGA GCC AAT GCC AAG AGT GCC AAG ACC TAC GCC TAC CTG TTT TCC 1407 His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser CAT CCC TCT CGG ATG CCC GTC TAC CCC AAA TGG GTG GGG GCC GAC CAT 1455 His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 GCA GAT GAC ATT CAG TAC GTT TTC GGG AAG CCC TTC GCC ACC CCC ACG 1503 Ala Asp Asp Ile Gln 440 Tyr Or Phe Gly Lys Pro 445 Phe Ala Thr Pro 450 Thr GGC TAC CGG CCC CAA GAC AGG ACA GTC TCT AAG GCC ATG ATC GCC TAC 1551 Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr TGG ACC AAC TTT GCC AAA ACA GGG GAC CCC AAC ATG GGC GAC TCG GCT 1599 Trp Thr Asn 47 0 Phe · Ala Lys Thr Gly 475 Asp Pro Asn Met Gly 480 Asp Ser Ala GTG CCC ACA CAC TGG GAA CCC TAC ACT ACG GAA AAC AGC GGC TAC CTG 1647 Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu GAG ATC ACC AAG AAG ATG GGC AGC AGC TCC ATG AAG CGG AGC CTG AGA 1695 Glu 500 Ile Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 ACC AAC TTC CTG CGC TAC TGG ACC CTC ACC TAT CTG GCG CTG CCC ACA 1743 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr Tyr 525 Leu Ala Leu Pro 530 Thr GTG ACC GAC CAG GAG GCC ACC CCT GTG CCC CCC ACA GGG GAC TCC GAG 1791 Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu GCC ACT CCC GTG CCC CCC ACG GGT GAC TCC GAG ACC GCC CCC GTG CCG 1839 Ala Thr Pro 550 Or Pro Pro Thr Gly 555 Asp Ser Glu Thr Ala 560 Pro Or Pro CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC 1887 Pro Thr 565 Gly Asp Ser Gly Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG 1935 Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC 1983 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro Vai 60547 Pro Pro Thr Gly 610 Asp

TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCT Ser Gly Ala Pro 615 Pro Or Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro GTG CCC CCC ACA GAT GAC TCC AAG GAA GCT CAG ATG CCT GCA GTC ATT Or Pro Pro 630 Thr Asp Asp Ser Lys 635 Glu Ala Gln Met Pro 640 Ala Or Ile

AGG TTT TAGCGTCCCA TGAGCCTTGG TATCAAGAGG CCACAAGAGT GGGACCCCAG Arg Phe

645

GGGCTCCCCT CCCATCTTGA GCTCTTCCTG AATAAAGCCT CATACCCCT (2) SEQ ID NO: 9 INFO:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 668 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (xi) SEQ ID NO: 9:

2031

2079

2135

2184

Met -23 Leu Thr Met -20 Gly Arg Leu Gln Leu -15 Or Or Leu Gly Leu -10 Thr Cys Cys Trp Ala -5 Or Ala Ser Ala Ala 1 Lys Leu Gly Ala 5 Or Tyr Thr Glu Gly 10th Gly Phe Or Glu Gly 15th Or Asn Lys Lys Leu 20th Gly Leu Leu Gly Asp 25th Ser Or Asp Ile Phe 30th Lys Gly Ile Pro Phe 35 Ala Ala Pro Thr Lys 40 Ala Leu Glu Asn Pro 45 Gln Pro His Pro Gly 50 Trp Gln Gly Thr Leu 55 Lys Ala Lys Asn Phe 60 Lys Lys Arg Cys Leu 65 Gln Ala Thr Ile Thr 70 Gln Asp Ser Thr Tyr 75 Gly Asp Glu Asp Cys 80 Leu Tyr Leu Asn Ile 85 Trp Or Pro Gln Gly 90 Arg Lys Gln Or Ser 95 Arg Asp Leu Pro Or 100 Met Ile Trp Ile Tyr 105 Gly Gly Ala Phe Leu 110 Met Gly Ser Gly His 115 Gly Ala Asn Phe Leu 120 Asn Asn Tyr Leu Tyr 125 Asp Gly Glu Glu I down 130 Ala Thr Arg Gly Asn 135 Or Ile Or Or Thr 140 Phe Asn Tyr Arg Or 145 Gly Pro Leu Gly Phe 150 Leu Ser Thr Gly Asp 155 Ala Asn Leu Pro Gly 160 Asn Tyr Gly Leu Arg 165 Asp Gln His Met Ala 170 Ile Ala Trp Or Lys 175 Arg Asn Ile Ala Ala Ϊ80 Phe Gly Gly Asp Pro 185 Asn Asn Ile Thr Leu 190 Phe Gly Glu Ser Ala 195 ' 4? ^ly Gly Ala Ser Or 200 Ser

Leu Gln Thr Leu 205 Ser Pro iyr Asn Lys 210 Gly Leu Ile Arg Arg 215 Ala Ile Ser Gln Ser 220 Gly Or Ala Leu Ser 225 Pro Trp Or Ile Gln 230 Lys Asn Pro Leu Phe 235 Trp Ala Lys Lys Or 240 Ala Glu Lys Or Gly 245 Cys Pro Or Gly Asp 250 Ala Ala Arg Met Ala 255 Gln Cys Leu Lys Or 260 Thr Asp Pro Arg Ala 265 Leu Thr Leu Ala Tyr 270 Lys Or Pro Leu Ala 275 Gly Leu Glu Tyr Pro 280 Met Leu His Tyr Or 285 Gly Phe Or Pro Or 290 Ile Asp Gly Asp Phe 295 Ile Pro Ala Asp Pro 300 Ile Asn Leu Tyr Ala 305 Asn Ala Ala Asp Ile 310 Asp Tyr Ile Ala Gly 315 Thr Asn Asn Met Asp 320 Gly His Ile Phe Ala 325 Ser Ile Asp Met Pro 330 Ala Ile Asn Lys Gly 335 Asn Lys Lys Or Thr 340 Glu Glu Asp Phe Tyr 345 Lys Leu Or Ser Glu 350 Phe Thr Ile Thr Lys 355 Gly Leu Arg Gly Ala 360 Lys Thr Thr Phe Asp 365 Or Tyr Thr Glu Ser 370 Trp Ala Gln Asp Pro 375 Ser Gln Glu Asn Lys 380 Lys Lys Thr Or Or 385 Asp Phe Glu Thr Asp 390 Or Leu Phe Leu Or 395 Pro Thr Glu Ile Ala 400 Leu Ala Gln His Arg 405 Ala Asn Ala Lys Ser 410 Ala Lys Thr Tyr Ala 415 Tyr Leu Phe Ser His 420 Pro Ser Arg Met Pro 425 Or Tyr Pro Lys Trp 430 Or Gly Ala Asp His 435 Ala Asp Asp Ile Gln 440 Tyr Or Phe Gly Lys 445 Pro Phe Ala Thr Pro 450 Thr Gly Tyr Arg Pro 455 Gln Asp Arg Thr Or 460 Ser Lys Ala Met Ile 465 Ala Tyr Trp Thr Asn 470 Phe Ala Lys Thr Gly 475 Asp Pr'o Asn Met Gly 480 Asp Ser Ala Or Pro 485 Thr His Trp Glu Pro 490 Tyr Thr Thr Glu Asn 495 Ser Gly Tyr Leu Glu 500 Ile Thr Lys Lys Met 505 Gly Ser Ser Ser Met 510 Lys Arg Ser Leu Arg 515 Thr Asn Phe Leu Arg 520 Tyr Trp Thr Leu Thr 525 Tyr Leu Ala Leu Pro 530 Thr Or Thr Asp Gln 535 Glu Ala Thr Pro Or 540 Pro Pro Thr Gly Asp 545 Ser Glu Ala Thr Pro 550 Or Pro Pro

Thr Gly Asp Ser Glu Thr Ala Pro Vai Pro ^% ro Thr Gly Asp Ser Gly

555,560,565

Ala 570 Pro Pro Or Pro Pro 575 Thr Gly Asp Ser Gly 580 Ala Pro Pro Or Pro 585 Pro Thr Gly Asp Ser 590 Gly Ala Pro Pro Or 595 Pro Pro Thr Gly Asp 600 Ser Gly Ala Pro Pro 605 Or Pro Pro Thr Gly 610 Asp Ser Gly Ala Pro 615 Pro Or Pro Pro Thr 620 Gly Asp Ser Gly Ala 625 Pro Pro Or Pro Pro 630 Thr Asp Asp

Ser Lys Glu Ala Gln Met Pro Ala Vai lle Arg Phe 635 640 645

Claims (42)

DEFINITION A nucleic acid molecule encoding a polypeptide which is a variant of bile salt-stimulated lipase (BSSL) of less than 722 amino acids, and said variant of BSSL is an amino acid sequence of residues 536-722 of SEQ ID NO. 2. The nucleic acid molecule of claim 1, wherein said BSSL variant encodes a phenylalanine residue at its C-terminus. 3. A nucleic acid molecule according to claim 1 or 2, wherein said variant BSSL encoded by it has a Gln-Met-Pro sequence at its C-terminus. 4. A nucleic acid molecule according to any one of claims 1 to 3, characterized in that said BSSL variant encoded at its C-terminus has an amino acid sequence represented by residues 712-722 of SEQ ID NO. 5. The nucleic acid molecule of any one of claims 1-4, wherein said BSSL variant encodes less than 16 repetition units. 6. The nucleic acid molecule of claim 1, wherein it encodes a polypeptide having at least 90% amino acid sequence homology to the amino acid sequence shown in SEQ ID NO: 5,6 or 9. 7. The nucleic acid molecule of claim 6, wherein it encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 5,6 or 9. A nucleic acid molecule encoding a polypeptide having at least 90% amino acid sequence homology to the amino acid sequence set forth in SEQ ID NO: 7, except for those nucleic acid molecules encoding the polypeptides having the asparagine residue of position 187. 9. The nucleic acid molecule of claim 8, wherein it encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO: 7. A polypeptide shown as SEQ ID NOs 5, 6, 7, or 9 in the Sequence Description. A polypeptide encoded by a nucleic acid sequence according to any one of claims 1-9. 12. The polypeptide of claim 10 or 11, wherein the polypeptide is in pure form. A hybrid gene comprising a nucleic acid molecule according to any one of claims 1-9. A replicable expression vector comprising a hybrid gene according to claim 13. 15. The vector of claim 14, wherein said vector is based on bovine papillomavirus vectors pS258, pS259 or pS299. A cell carrying a hybrid gene according to claim 13. 17. The cell of claim 16, wherein the cell is derived from murine cell line 027 or E. coli. 18. A method of producing a recombinant polypeptide comprising (i) inserting a nucleic acid molecule according to any one of claims 1 to 9 into a hybrid gene capable of replication in a specific host cell or organism; (ii) introducing the resulting recombinant hybrid gene into a host cell or host organism; (iii) identifying and culturing the resulting cell in or on the culture medium; or identifying and multiplying the resulting organism by expression of the polypeptide (iv) and isolating the polypeptide. 19. The method of claim 18, wherein the hybrid gene comprises bovine papillomavirus vectors pS258, pS259 or pS299. 20. An expression system characterized in that it contains a hybrid gene that can express in a host cell or host organism that has received said hybrid gene, thereby producing a recombinant polypeptide when the hybrid gene is expressed and the said hybrid gene is derived by inserting a nucleic acid. according to any of 1-9, to a gene capable of mediating expression of said hybrid gene. 21. A method of generating transgenic non-human mammals capable of expressing a BSSL variant, comprising (a) introducing an expression system according to claim 20 into a fertilized egg or a non-human mammalian embryo cell to incorporate an expression vector into a mammalian germ line, and (b) breeds a mature mammal of non-human origin from the resulting introduced fertilized egg or embryo. A method of generating transgenic non-human mammals capable of expressing a BSSL variant and unable to express their own BSSL, which (a) destroys the ability of the mammal to express its own BSSL without expressing the mammalian BSSL, and introduces an expression system according to claim 20 into the mammal. a germ line such that the BSSL variant is expressed in a mammal; and / or (b) the mammalian BSSL gene or part thereof is replaced by an expression system according to claim 20. 23. A transgenic mammal of non-human origin, which comprises accepting into its genome the DNA sequence of any one of claims 1-9. 24. The transgenic non-human mammal of claim 23, wherein the DNA sequence is present in the mammalian germ line. 25. The transgenic non-human mammal of claim 23 or 24, wherein the DNA sequence is present in a mammalian milk protein gene. 26. The transgenic non-human mammal of any one of claims 23-25, wherein it is a member of the group consisting of mice, rats, rabbits, sheep, pigs and cattle. 27. Progeny characterized in that it is a transgenic non-human mammal according to any one of claims 23 to 26. Milk characterized in that it is derived from transgenic non-human mammals according to any one of claims 23 to 27. 29. An infant formula comprising milk according to claim 28. 30. An infant formula comprising the polypeptide of any one of claims ΙΟΙ2. 31. A method of preparing an infant formula comprising adding a polypeptide according to any one of claims 10 to 12 to an infant formula. A polypeptide according to any one of claims 10 to 12 for use as an additive in the formulation of an infant formula. 33. A pharmaceutical composition comprising a polypeptide according to any one of claims 10 to 12. A polypeptide according to any one of claims 10 to 12 for use in therapy. Use of a polypeptide according to any one of claims 10 to 12 in the manufacture of a medicament for the treatment of pathologies associated with exocrine pancreatic insufficiency. 36. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for the treatment of bladder fibrosis. 37. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for the treatment of chronic pancreatitis. 38. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for the treatment of a fat absorption disorder. 39. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for the treatment of a fat soluble vitamin intake disorder. 40. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for treating a fat soluble vitamin intake disorder for physiological reasons. 41. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for improving dietary lipid uptake. 42. The use of claim 35, wherein the polypeptide of claims 10-12 is for use in the manufacture of a medicament for use in preterm neonates and for improving dietary lipid uptake.