KR970007862B1 - Genes coding for human immunoglobuline binding factor related polypeptides, vectors comprising the inserted gene, transformed hosts - Google Patents

Abstract

No summary

Description

Genes encoding polypeptides associated with human immunoglobulin E binding factors, vectors into which such genes are inserted, hosts transformed with such vectors, and methods of making the same

1 shows the construction of plasmids pCL-1 and pCL-2.

2 is a diagram comparing two inserts of plasmids pCL-1 and pCL-2.

3 shows the construction of plasmid pGEM ^™ -1 / CL 2 and transcription of this DNA insert into mRNA.

4 shows the construction of plasmids pFK-1 and pFK-2.

5 shows the construction of plasmid pPL-BF.

6 shows the construction of plasmid pJOB207R / PH05-BF.

7 shows the construction of plasmids pCAL5-R / ND and pCAL8-BF / ND.

8 shows the construction of plasmid pPLPTIS-BF.

The present invention relates to a gene encoding a polypeptide associated with human immunoglobulin E binding factor (IgE-BF), a hybrid vector, a host comprising the hybrid vector, and a method for producing the same.

Allergic diseases are still a major health problem due to their high incidence (20-30% of the population) and the lack of treatment. Treatment is typically limited to the use of antihistamines or more or less effective immunization methods. Prior art allergic disease treatment agents have certain drawbacks, especially since they cause several side effects in the treated patient. Immunization methods are limited to one or two allergens, while most patients are sensitive to many allergens. In addition, hyposensitization therapy has no therapeutic or preventive effect.

Most allergic diseases are mediated by airborne allergens (e.g. pollen, beasts' marrow, tick mites, food antigens), drugs (e.g. penicillin) or immunoglobulin E (IgE) antibodies related to venom venom. The production-regulatory mechanism of IgE has been extensively studied using laboratory animals [K. Ischizaka, Ann. Rev. Immunol, 2, 159 (1984)]. These studies have elucidated the existence of IgE isotype specific mechanisms that are non-antigen specific but which regulate the production of IgE in animal models. The main molecules of these regulatory mechanisms were named IgE-binding factor (IgE-BF) due to their affinity for IgE. IgE-BF can be classified into IgE-inhibitors (IgE-SF) and IgE- synergists (IgE-PF), and these molecules differ only in their carbohydrate content. It was less glycosylated compared to IgE-PF. The production of substantial IgE in animal models is determined by the ratio between these two types of IgE-BF.

The same cells can secrete IgE-SF or IgE-PF depending on the effect of glycosylation-inhibition or enhancers secreted by separate regulatory T lymphocyte subpopulations.

M. Sarfati et al., Immunology 53, 197, 207, 783 (1984) demonstrate that the presence of human B cell lines secreting IgE-BF provides biological activity similar to that described in rodents. Other researchers have described the production of IgE-BF by human T cells [T. F. Huff. and K. Ishizaka, Proc. Natl, Acad. Sci. (USA) 81, 1514 (1984)] and the production of IgE-BF by genetic engineering methods (European Patent Application No. 155192). The relationship between B cell-derived IgE-BF of T cell-derived IgE-BF is not yet known. As will be evident in accordance with the present invention, B cell-derived IgE-BF has a statistically lower homology than T cell-derived IgE-BF.

Purified IgE-BF is important for the diagnosis and treatment of allergic diseases and related immunomodulatory diseases. In particular, IgE-BF with IgE-inhibitory activity is useful for the treatment of allergic diseases, while IgE-BF with IgE- synergistic activity can increase resistance to infection, for example, resistance to parasitic infections.

The assay for the detection of IgE-BF from B cells is based on the rosette inhibition test in which RPMI 8866 cells expressing receptors for IgE (FcεR) (lymphocyte B cell lines) rosette with red blood cells of IgE-coated cattle. If pre-incubation of IgE-coated bovine red blood cells with IgE-BF can no longer bind to RPMI 8866 cells, reducing the population of rosettes. This assay is not quantitative and requires sophisticated techniques because of the variability in coupling IgE to bovine erythrocytes, the rosette must be observed under a microscope, the cell line must be available permanently, and the IgE-coated erythrocytes are constantly produced. The analysis is complex for reasons such as, for example, a person can only perform 20 to 40 tests per day. Lymphocytes, which cross-react with IgE-BF, use monoclonal antibodies against FcεR to perform more convenient, quantitative and easy analysis. Such monoclonal antibodies are described. Manufactured by European Patent No. 868102443 to G. Delespesse et al., The hybridoma cell lines which produce it have been deposited with the Collection Nationale de Cultures de Microorganismes, Institute Pasteur, Parks and accession number I -425 (clone 208.25 A. 4, 3/135), I-420 (clone 208.25 D. 2, 1/176), I-451 (clone 207.25 A. 4, 4/30), I-452 (clone 207.25 A. 4, 4/45) and I-486 (clone 208.25 D. 2/94). Corresponding monoclonal antibodies are named Mab-135, Mab-176, Mab-30, Mab-45 and Mab-94, respectively. They also make it possible to effectively purify IgE-BFs by affinity chromatography.

Despite the use of such monoclonal antibodies, the amino acid sequence of a single IgE-BF isolated from human natural B-cell lines has not yet been determined. For therapeutic purposes, pure single polypeptides having a defined amino acid sequence with the desired IgE-binding properties and which can be easily produced in large quantities are highly desirable.

In recent years, rapid progress in the method of DNA production and synthesis has provided general methods for achieving the above object. If the structure of the polypeptide is unknown, the success of DNA recombination technology will depend on the identification of mRNA or DNA encoding the desired polypeptide from a natural source. After identifying mRNA using appropriate assay methods, complementary DNA can be prepared. The hybrid host obtained by inserting the cDNA into the appropriate vector can be transformed into the appropriate host, the transformed host can be selected and incubated to prepare a polypeptide and finally isolated. The amino acid sequence of the polypeptide can be determined by isolating and sequencing the cDNA encoding the polypeptide of interest. The cDNA or portions thereof can be used to select mRNA or DNA genomes of natural sources that provide additional nucleotide sequences that encode the polypeptide of interest.

Therefore, since the structure of IgE-BF is unknown, the first object of the present invention is to transform egg cells of Xenopus laevis with fractionated mRNA of the B-cells and assay using the monoclonal antibody. By determining the clone containing the mRNA of interest by identifying the mRNA of the human B-cell encoding the polypeptide of interest. Another object is to prepare cDNA and hybrid vectors, transform the appropriate host and finally incubate the host to isolate it into the desired polypeptide. This polypeptide is not necessarily identical to the native polypeptide since post-translational modifications may occur after expression.

An object of the present invention is a polypeptide associated with IgE-BF of human B-cells, a hybrid vector containing a DNA sequence encoding the polypeptide as an insert, a transformed host containing the hybrid vector, encoding the polypeptide To provide a pharmaceutical formulation containing RNA and DNA letters and an effective amount of the polypeptide.

Still another object of the present invention is to provide a method for preparing the polypeptide, a hybrid vector, a transformed host, RNA and DNA molecules, a pharmaceutical agent and the use of the polypeptide.

It is also an object of the present invention to provide a method for preventing and / or treating allergic diseases by administering an effective amount of a polypeptide of the invention associated with IgE-BF.

These objects can be achieved by making DNA encoding the polypeptide of SEQ ID NO: 1 and fragments thereof.

The present invention relates to a polypeptide having a amino acid sequence of the following formula (I), fragments, mutants or derivatives thereof.

In the above formula (I), a single letter represents a naturally occurring L-amino acid. (A) alanine, (C) cysteine, (D) aspartic acid, (E) glutamic acid, (F) phenylalanine, (G) glycine, (H) histidine, (I) isoleucine, (K) lysine, (L Leucine, (M) methionine, (N) asparagine, (P) proline, (Q) glutamine, (R) arginine, (S) serine, (T) threonine, (V) valine, (W) tryptophan, ( Y) tyrosine.

Polypeptides of the formula (I), fragments, mutants and derivatives thereof are referred to herein as “polypeptides of the invention”. In the absence of IgE receptors and membrane anchoring sequences on human B-cells, they are associated with IgE-BF, such as Sarfati et al., Mentioned above.

A fragment of a polypeptide of the invention is part of a complete polypeptide of Formula (I) containing sequentially at least 10 to 320 amino acids in the sequence corresponding to Formula (I). Such fragments are, for example, polypeptides of Formula (I) wherein the first amino acid or up to about 133 amino acids are deleted from the N-terminus. This deleted N-terminus is a membrane-immobilized sequence that binds the polypeptide to the cytoplasmic membrane of B-cells. Other fragments are polypeptides of Formula (I) which lack an amino acid between the N and C-terminus, for example 110 to 130 amino acids or an amino acid at the C-terminus, for example about 250 to 321 amino acids. .

In the present invention, the amino acid sequence consisting of amino acids 106 to 127 is deleted, or 120, 121, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, Of amino acids 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159 or 160 A fragment of a polypeptide of formula (I) characterized in that it is selected from the group consisting of polypeptides starting with one amino acid and ending with one of amino acids 282 to 321, preferably with amino acids 321.

Preferred fragments of the polypeptide of Formula (I) are characterized by consisting of an amino acid sequence from amino acids 119 to amino acids 321.

Another preferred fragment of the polypeptide of Formula (I) is characterized by consisting of an amino acid sequence from amino acids 134 to amino acids 321.

Another preferred fragment of the polypeptide of Formula (I) is characterized by consisting of an amino acid sequence from amino acids 148 or 150 to amino acids 321. These two fragments correspond to naturally occurring IgE-BF because they can be found in the supernatant of RPMI 8866 cells.

It may contain methionine bound to the N-terminus, especially in the case of fragments whose fragments are obtained from expression in Escherichia coli.

Mutants of polypeptides of the invention are characterized in that one (point mutant) or more, up to about 10 amino acids are replaced by one or more other amino acids. These are the result of corresponding mutations at the DNA levels leading to different codons.

Derivatives of the polypeptides of the invention are those in which functional groups such as amino, hydroxyl, mercapto or carboxyl groups are derivatized, eg glycosylated, acylated, amidated or esterified, respectively. For glycosylated derivatives, oligosaccharides are typically linked to asparagine, serine, threonine and / or lysine. Acylated derivatives are especially acylated with naturally occurring organic or inorganic acids, such as acetic acid, phosphoric acid or sulfuric acid, and acylation is usually in particular at the N-terminal amino group or hydroxy group of each of tyrosine or serine. Esters are esters of naturally occurring alcohols, such as methanol or ethanol.

Other derivatives include salts, in particular pharmaceutically acceptable salts such as alkali and alkaline earth metal salts such as sodium salts, potassium salts, magnesium salts, calcium salts or zinc salts, or lower alkylamines such as tree Ethylamine), suitable organic amines such as hydroxy-lower alkylamines (eg 2-hydroxyethylamine) or ammonium salts with ammonia.

Polypeptides of Formula (I) have IgE-binding activity that can be demonstrated by binding to rosette inhibition tests and monoclonal antibodies specific for IgE-BF (eg, Mab-135 and Mab-176). Fragments, mutants and derivatives of the polypeptides of Formula (I) preferably have IgE-binding activity.

Polypeptides of the invention are prepared by DNA recombination techniques, including the identification of mRNA encoding them, the construction of DNA or cDNA hybrid vectors, the transformation of host cells enabling expression of the vector and the isolation of said polypeptides.

Accordingly, the present invention also provides a method of incubating a transformed host comprising (a) a hybrid vector comprising a DNA sequence encoding a polypeptide of Formula (I), or a fragment or mutant thereof, or (b) a sequence MRNA encoding the polypeptide of formula (I) or fragment or mutant thereof is translated in an appropriate translation system and optionally converts the polypeptide or sequence of fragment (I) or mutant thereof to derivative thereof It relates to a method for producing a polypeptide of Formula (I) or a mutant or derivative thereof.

The transformed host in step (a) is selected from prokaryotic or eukaryotic cells, for example higher cells, including bacteria, fungi (eg yeast) or human cell lines. Preferred cells are E. coli strains (e.g. HB 101, BZ 234, B 1472) or Saccharomyces cerevisiae (e.g. RH 971), which encode the polypeptide of the invention They are transformed with hybrid vectors containing appropriate promoters, enhancers, labels, signal sequences and the like.

Transformed host cells are incubated in known methods in the art, typically in a liquid medium containing an assimitable source of carbon, nitrogen and inorganic salts and, if appropriate, appropriate growth factors.

Various carbon sources can be used for the growth of transformed prokaryotic and eukaryotic microorganisms. Examples of preferred carbon sources are assimilable carbohydrates such as glucose, maltose, manni or lactose or acetate, which can be used on their own or in suitable mixtures. Examples of suitable nitrogen sources include amino acids, proteins (such as tryptone, peptone or gravy), yeast extracts, malt extracts and also ammonium salts (such as ammonium chloride and ammonium nitrate), which can be used on their own or in suitable mixtures. have.

Medium also contains trace elements such as K ⁺ , Ca ²⁺ , Mg ²⁺ , Fe ²⁺ , Mn ²⁺ , Zn ²⁺ , Cu ²⁺ , No ₃ ⁻ , So ₄ ^2- , HPO ₃ ^2- , _{^{H 2 PO 4 -, Cl -}} , contains Bo ₃ ^3- and M ₀ O ₄ ^2- ions. In addition, it is preferable to add a substance that gives a selectivity and prevents the growth of cells that have lost the expression vector. That is, for example, ampicillin is added to the medium when the hybrid expression vector contains the amp ^R gene. In addition, the addition of antibiotics has the effect of preventing the survival of contaminating microorganisms sensitive to antibiotics. When using nutritionally demanding, eg essential amino acid demanding yeast strains as host microorganisms, the plasmid preferably contains a gene encoding an enzyme that compensates for the defects of the host. Yeast strains are cultured in minimal medium lacking the amino acids.

Vertebrate cells are most often grown under tissue culture conditions using commercial media (eg Gibco, Flow Laboratories) supplemented with mammalian blood. Cells grown on a large scale are attached to solid supports such as roller disease, microcarriers and porous glass fibers or they are grown into free floating cells in appropriate containers.

The culture method is carried out using a method known in the art. Culture conditions, such as temperature, pH value of the medium and fermentation time, are chosen so that the polypeptide of the invention obtains the maximum titer. That is, the E. coli or yeast strain is about 4 to 30 hours under aeration conditions with shaking or stirring at a temperature of about 20 to 40 ℃ preferably about 30 ℃ and a pH of 4 to 8, preferably about 7, In the meantime, it is preferable to incubate by immersion culture, preferably until the polypeptide of the present invention reaches the highest yield.

mRNA encoding the polypeptide of the present invention in step (b) can be translated and expressed in an appropriate translation system, eg, oocytes of Xenopus rabbit. MRNA encoding the polypeptide of the present invention can be microinjected into oocytes of female frog Xenopus rabbit. Transformed oocytes are incubated for 45 hours at about 20 ° C. in a Barth solution supplemented with FCS. After incubation medium is removed, oocytes are homogenized in oocyte lysis buffer and centrifuged. As can be seen by the RIA assay using monoclonal antibodies, the supernatant contains the polypeptide of the invention. Such a method for producing a polypeptide of the present invention is mainly useful for identification purposes.

When the content of the polypeptide of the present invention reaches its highest, the culture can be stopped to isolate the polypeptide. When the polypeptide is fused with the appropriate signal peptide sequence, the cell secretes the polypeptide directly into the supernatant. If not, the cells must be destroyed, for example, by treatment with a detergent, for example SDS or Triton, or lysed using lysozyme or an enzyme with a similar action. When yeast is used as the host microorganism, glucosidase can be used to enzymatically remove the cell wall. Alternatively or additionally mechanical forces such as shear forces (e.g. X-press, French-press, Dyno mill), or shaking with glass beads or aluminum oxide, for example liquid nitrogen Cells can be destroyed either by freezing and thawing alternately or by using ultrasonic waves. Proteins of the cell supernatant containing the polypeptide of the present invention or mixtures obtained upon cell destruction are well known in the art, in particular by treatment with polyethyleneamine, centrifugation and precipitation with salts (e.g. ammonium sulfate or zinc salts). Purify with. Additional purification steps include, for example, ultracentrifugation, dialysis filtration, gel electrophoresis, chromatography (eg ion exchange chromatography, size exclusion chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC, rapid pressure liquid chromatography). Or other suitable gel filtration column, dialysis affinity chromatography, e.g. molecular size using affinity chromatography using antibodies, in particular monoclonal antibodies (e.g. Mab-135 and Mab-179). Separation of the mixture components and other known methods in the art.

In a preferred embodiment, the cell supernatant is filtered through a monoclonal antibody affigel, for example Mab-45-apigel, and the bound IgE-BF polypeptide is, for example, 0.1M glycine at pH 2.6. Elute with -HCl buffer, load the fraction containing the desired polypeptide onto an anion exchanger column (e.g., SynChropak AX 300), and then wash the column, for example with Tris-HCl buffer (pH 7.4), The protein is eluted, for example with sodium chloride solution (e.g. 1 M NaCl), and then the fractions containing the desired polypeptide are dialyzed and lyophilized and the dialyzed fractions are reversed phase chromatographic, for example on a SynChropak RP-4 column. The polypeptide of the present invention is isolated from the cell supernatant, for example by eluting the desired polypeptide using an acetonitrile / 0.1% TFA gradient.

This method is particularly suitable for purifying native IgE-BF from RPMI 8866 cell supernatant. The natural IgE-BF purified by this method was pure enough to be used in amino acid sequencing and consisted of two proteins and was shown to have the following N-terminal amino acid sequence.

The numbering corresponds to the numbering of formula (I). The amino acid represented by X has not been determined, but may be represented as follows in comparison with the DNA sequence of SEQ ID NO (II) or (III). X ₁₄₉ = R, X ₁₅₁ = E, X ₁₅₅ = S, X ₁₆₀ = C, X ₁₆₃ = C. As a result, the native IgE-BF consists of at least two polypeptide sequences (I) having an amino acid sequence extending from L ₁₄₈ to S ₃₂₁ and M ₁₅₀ to S ₃₂₁ , which occurs at a ratio of 40 to 60.

Finally, the IgE-binding activity of the isolated protein can be determined by methods well known in the art, such as rosette inhibition, blocking of IgE-binding to anti-IgE antibodies, affinity chromatography tests and lymphocytes from allergic individuals. Can be measured by experiments measuring inhibition of advanced in vitro IgE synthesis.

Polypeptides of the invention having the correct sequence but with inadequate three-dimensional folding are useful as intermediates in renaturation experiments.

The invention also relates to a polypeptide of each SEQ ID NO: 1 obtained according to the method of the invention, or a fragment, mutant or derivative thereof.

Preparation of Transformed Host

The invention also provides for (1) the preparation of DNA encoding the polypeptide, fragments, mutants or derivatives thereof of (I), (2) insertion of the obtained DNA into a suitable vector, and (3) hybridization obtained. Transform the appropriate host with the vector, and then (4) select the transformed host from the untransformed host, optionally isolate the hybrid vector from the transformed host and modify the encoded or non-coded region of the hybrid vector. Again performing steps (3) and (4) relates to a multistep method of preparing a transformed host capable of expressing a polypeptide of the invention.

The steps involved in the preparation of the host are described in more detail below. The invention also relates to each single step.

1. Preparation of DNA Encoding Polypeptides of the Invention

The present invention relates to DNA encoding the polypeptide of Formula (I), or a fragment, mutant or derivative thereof, and a method of making the same.

The DNA encoding the polypeptide of the invention can be obtained by (a) reverse transcription of the isolated mRNA into cDNA, (b) isolation from genomic DNA or (c) chemical synthesis.

In the present invention, DNA should be obtained from genomic DNA, or cDNA library via mRNA as long as the DNA structure is unknown. The cDNA library consists of genetic information complementary to mRNA isolated from cells.

(a) reverse transcription to isolated mRNAdml cDNA

To obtain a cDNA library, mRNA is isolated from cells expressing IgE-binding activators, in particular human B-cells and cell lines derived therefrom. This mRNA is converted to double stranded cDNA. Preferred human B-cell lines are RPMI 8866. Natural B-cells can be killed with Epstein-Barr virus to make other useful B-cell lines. Standard methods well known in the art are applied to the preparation of mRNA. Breaking the cell membrane frees the cell contents, from which mRNA is isolated. Cell membranes are preferably destroyed by physical methods, or dissolved and destroyed by homogenization by detergents such as SDS, guanidinium thiocyanate, prescribed salt conditions or preferably by mixing. mRNA is isolated by standard methods of phenol extraction, ethanol precipitation, centrifugation and chromatography, preferably a combination of several methods. Centrifugation is preferably carried out on a gradient, for example a CsCl gradient. In the case of chromatography it is particularly preferred to use oligo-dT columns.

Total mRNA can be converted directly to ds-cDNA according to methods of the art. Preferably, mRNA encoding the polypeptide of the present invention is further concentrated using some techniques such as electrophoresis, chromatography and centrifugation, preferably sucrose gradient centrifugation.

Fractions containing mRNA encoding the polypeptides of the invention can be detected by several methods, for example by in vivo or in vitro translation, and then by measuring IgE-binding activity or, if the nucleotide sequence is known, with an oligonucleotide probe. Hybridization can be detected.

In vivo detoxification systems can be prokaryotic or eukaryotic systems. Preferred in vivo detoxification systems are Xenopus laby's oocytes as described in Maniatis et al. (1). In vitro systems include, for example, wheat germination and reticulocyte lysis in rabbits, both of which are available commercially.

As a detection system for screening IgE binder properties, it is preferred to use monoclonal antibodies against the polypeptide of formula (I), in particular Mab-135 or Mab-176. Another possible system uses IgE type immunoglobulins in conventional immune assays.

Ds-cDNA can be obtained by methods well known in the art from pools of mRNA derived from fractionated or unfractionated mRNA. Preferred general methods are described in Maniatis et al. (1), Okayama and Berg et al. (2) and Heidecker et al. (3). Typically, mRNA is first converted to ss-cDNA using reverse transcriptase and then to double-cDNA using reverse transcriptase or DNA polymerase I (Klenau fragment). In the case of the present invention, it is preferable to carry out according to the method described in Maniatis et al. (1). Both methods are used to accelerate the synthesis of running ds-cDNA. The first method uses the natural loop formation of ss-cDNA. The second method is performed by tailing the ss-cDNA with a homopolymer tail, for example poly -dC or poly -dT.

MRNA fractions whose corresponding polypeptides exhibit very high activity in the detection system are transcribed into complementary cDNAs by methods well known in the art. Mix oligo -dT as mRNA and primer. Next, dNTP is added as a starting material and cDNA-mRNA hybrid molecules are synthesized by reverse transcriptase. RNA molecules are degraded by addition of NaOH. The DNA polymerase is preferably mixed with the Klenow fragment of DNA polymerase I and the mixture is incubated at a suitable temperature, preferably 12-15 ° C. Incubation of the mixture with nuclease Sl yields ds-cDNA corresponding to mRNA encoding the polypeptide of the invention.

To amplify and elucidate the structure, the hybrid vector obtained by inserting the obtained ds-cDNA into a suitable vector such as plasmid pUC-KO is propagated using a suitable host such as E. coli HB 101 and more detailed. Has been described above. Re-isolating the hybrid vectors and recovering the inserted cDNA from them can reveal the structure of the DNA encoding the polypeptide of the invention. The hybrid vectors pCL-2 and pCL-1 obtained contain inserts of the formulas (II) and (III), respectively.

The pCL-2 cDNA insert has the sequence of the following formula (II).

The coding region of the polypeptide of SEQ ID NO: I in the DNA sequence of SEQ ID NO: II is represented by the amino acid symbol. The non-coded flanking region is also part of the non-coding region of the isolated mRNA. Restriction site And Represented by.

Other cDNAs obtained from the mRNA may be nucleotides encoding amino acids 106-127 in the polypeptide of Formula (I), ie, 316 through 378 of SEQ ID NO (II), deleted or otherwise run. The coding region and a portion of the two flanking sequences have the same sequence of SEQ ID NO: III as the DNA sequence of SEQ ID NO. This cDNA insert fragment is shown in pCL-1 and has the sequence of the following formula (III).

(b) Another suitable method for obtaining DNA encoding the polypeptide of the present invention is to separate the DNA from genomic DNA of tissue or cell culture. Cells are preferably lysed with SDS and glycolytic enzyme K and repeated extraction with phenol to deproteinize the DNA. RNA is preferably degraded with RNAse. The crude DNA obtained is partially digested with suitable restriction enzymes such as Hae III and Alu I to isolate 15-20 Kb fragments which are then grown on appropriate phages or cosmids such as Charon 4A or EMBL-3 phages. For example, the desired sequence is assayed using a radiolabeled DNA probe or by other methods as described above.

(c) A third method for preparing DNA encoding the polypeptides of the present invention is chemical synthesis. Chemical synthesis of DNA is summarized in S. A. Narang 's literature (4). Known synthetic techniques can produce polynucleotides of up to 40 or 60 base pairs in a relatively short time with excellent yields and high purity. Properly protected nucleotides can be prepared by the phosphodiester method described in KL Agarwal et al. (5), the phosphoester esters of CB Reesem (6). Method or the phosphite triester method of R. Lietsinger et al. (6a). Oligonucleotides and polynucleotides can be synthesized simply by solid phase synthesis which binds the nucleotides to the appropriate polymer. Advantageously, a machine for DNA synthesis is used.

Actual double stranded DNA can be enzymatically constructed from chemically prepared short but overlapping fragments. For example, according to Khorana et al. (7), using overlapping polynucleotide sequences from both DNA backbones, they are correctly aligned in base pairing and then chemically linked with DNA ligase. Alternatively, in each case a DNA-polymerase, eg, a DNA-polymer, in the presence of four deoxynucleoside triphosphates, requiring one polynucleotide sequence and short overlapping fragments from two DNA backbones Incubating with Lase I, Klenow fragment of Polymerase I or T ₄ DNA polymerase, or reverse transcriptase. This results in two polynucleotide sequences correctly aligned in base pairing and supplemented with the nucleotides required by the enzyme, resulting in complete double stranded DNA (SA Narang et al (8)).

(d) Preparation of DNA Encoding Fragment of Polypeptide of Formula (I)

DNA of SEQ ID NO (II) or (III) or a vector containing the same is digested with appropriate restriction enzymes and / or appropriate exonucleases, and if necessary the DNA fragments obtained are supplemented with DNA fragments synthesized by chemical methods, or All fragments were synthesized by chemical methods to obtain DNA encoding the fragment of the polypeptide of SEQ ID NO.

Suitable restriction enzymes and their restriction sites are shown in SEQ ID NO: II. Bgl II and Rsa I are suitable for preparing DNA fragments encoding polypeptide sequences D ₁₁₉ to S ₃₂₁ to S ₃₂₁ of Formula (I). DNA fragments encoding polypeptide sequences A ₁₃₄ to S ₃₂₁ can be obtained by restriction to Hind III and Ras I (see SEQ ID NO: II, FIG. 4). DNA fragments can also be prepared by stepwise synthesis, first limited to, for example, Hinc II and Rsa I to prepare large DNA fragments, which are then subcloned into appropriate vectors, which are respectively Bgl II and Bam HI, or Hind. It can be prepared by continuously cutting into III (see FIGS. 3 and 4).

Restriction enzymes and / or exonucleases can be used together in whole or in part chemical synthesis to produce the desired DNA fragment consisting of Formula (II).

The invention also relates to a DNA fragment of SEQ ID NO: II DNA. These fragments can be used as coding for polypeptides having IgE-binding activity or as provo to identify such DNA from natural or synthetic sources. Preferred DNA fragments are those which encode a preferred polypeptide fragment consisting of SEQ ID NO: I. The DNA probe has at least 7, preferably about 15 nucleotides on the sequence.

2. Preparation of Hybrid Vectors

Hybrid vectors of the invention are prepared by inserting into a suitable vector DNA encoding the polypeptide of Formula (I), or a fragment, mutant or derivative thereof.

Suitable vectors are carriers for importing passenger DNA, which can be used to transform host microorganisms, including human cells, and can be replicated in a host. Such vectors are suitable plasmids, piages or cosmids. Suitable vectors have insert DNA at defined locations.

Generally, such vectors include replicons and regulatory sequences, ie promoters, which are derived from species suitable for the host cell in which they are used. Typically the vector comprises a replicon site and a sequence (marker gene) that can provide phenotypic selection in the transformed cell. Suitable marker genes, for example, confer resistance to antibiotics or heavy metals on the host, or compensate for genetic defects in the host. Also useful for such vectors are enhancers and activating sequences.

Starting vectors are suitable for use in host cells of a wide range of eukaryotic and prokaryotic organisms. The vector is selected according to the host cell to be used for transformation.

Preferred start vectors are plasmid DNA bacteriophage DNAs available in the art. Especially useful are plasmid pBR322 and derivatives thereof. Such derivatives are, for example, plasmids pUC-8, pUC-9, pMB-9, pGEM ^™ -1 and pGEM ^™ -2. Among the bacteriophage vectors, lambda phage DNA, for example, λgt-11, is preferable. Suitable phage vectors are also Charon 4A and EMBL-3 phages. Lambda cloning systems are described in Maniatis et al. (1).

Vectors carrying passenger DNA such as SEQ ID NO (II) or (III) are expressed as hybrid vectors.

The obtained DNA is inserted into the starting vector in a conventional manner.

The starting plasmids are, for example, first linearized with appropriate restriction enzymes, and then, for example, plasmid pUC-KO is linearized with Pst I and then d / G tailed in the presence of dGTP and terminal deoxynucleotidyl transferase. Double-stranded cDNA inserts are dc-tained in the presence of dCTP and terminal deoxynucleotidyl transferase. Hybrid vectors are obtained by mixing cDNA and vector. Bacteriophage, such as lambda phage, are preferred for constructing genomic libraries. Lambda cloning systems are described in Maniatis et al. (1). Suitable vector DNA is completely digested with appropriate various enzymes to separate left and right arms into major fragments by rate gradient centrifugation and gel electrophoresis. Another method is to digest the stuffer fragment with restriction enzymes that do not have recognition sites in the left and right arms. The isolated genomic DNA is digested into fragments 15 to 20 kb in length. The cancer is then linked to fragments of foreign DNA having ends that match those of the cancer.

The appropriate DNA insert is recloned from the original vector used for initial cloning into the appropriate expression vector. For this purpose, appropriate restriction enzymes (FIGS. 3 and 4) are practically mixed with exo nucleases, in particular Bal31, to obtain the desired DNA fragments. These fragments are introduced into the appropriate expression vectors using direct adhesion ends or by addition of chemically synthesized appropriate oligonucleotide bridges. For modification of the ends, for example Hind III and Bgl II can be used. This invention is not limited to these specific restriction enzymes. Chemically synthesized oligonucleotides can be mixed with appropriate restriction enzymes and linked at desired positions between the expression vector and the DNA insert.

The invention also relates to a hybrid vector containing a DNA encoding a polypeptide of Formula (I), or a fragment, mutant or derivative thereof, operably linked to an expression control sequence.

Appropriate hybrid expression vectors are used for expression. The term hybrid expression vector includes specific vectors capable of expressing the DNA sequences contained in the vectors, which sequences are operably linked to other sequences capable of expressing them in the vector, namely operator, enhancer and promoter sequences. . In summary, expression vectors are characterized by the functionality defined by a particular DNA sequence capable of expressing a particular DNA sequence inserted into the vector. The present invention is intended to include all forms of hybrid expression vectors that can be prepared from expression vectors known in the art and functional equivalents containing DNA inserts encoding the polypeptides of the invention.

Multiple expression control sequences can be used to regulate gene expression. Microbial expression vectors typically contain a promoter that is used to express its own protein by a microbial host. Promoters commonly used in constructing recombinant DNA include β-lactamase and lactose promoter systems (Chang et al. (9): Goeddel et al. (10)), tryptophan (trp) promoter systems (Goeddel et al. 11)) or a bacteriophage promoter system such as the P _L promoter from lambda. Although these are most commonly used, other microbial promoters have also been found and used, details of their nucleotide sequences have been published and the skilled person can operatively link them with plasmid vectors (Siebenlist et al (12)). In principle, all vectors that clone and express the polypeptide of the invention in a selected host are suitable. Examples of suitable vectors for the expression of the polypeptides include plasmid PKK 223-3, pDR 720 and pDL-lambda, or vectors of bacteriophage lambda, such as lambda -gtll, all of which are commercially available (Pharmacia, Sweden: Promega Biofec, USA). Preferred vectors of the present invention are vectors containing expression and secretion vectors of pIN-ompA type (Gharayeb et al (13)) and the PL promoter.

Suitable vectors for replication and expression in yeast contain one or more, for example two yeast replicon initiators and one or more selectable gene markers for yeast. Yeast replicon initiators, such as chromosomal self-replicating fragments (ars ¹ ), or hybrid vectors containing 2μ ori, are retained extrachromosomes in yeast cells and spontaneously replicate after transformation. Suitable marker genes for yeast are those that confer antibiotic resistance to the host, in particular, or in the case of nutritionally demanding yeast mutants, which complement the host lesion. Corresponding genes, for example, confer resistance to the antibiotic cycloheximide or provide nutritional non-urea to nutritional yeast mutants such as the URA3, LEU2, HIS3 or in particular the TRP1 gene. In addition, yeast hybrid vectors are preferably bacterial host, in particular E. coli, so that hybrid vectors and their intermediates can be constructed and cloned in bacterial hosts. Replicon initiation and label gene for E. coli (shuttle vector). Suitable expression control sequences for expression in yeast are, for example, sequences of highly expressed yeast genes. Thus, promoters of the TRPI gene, ADHI or ADHI gene, phosphatase (PHO3 or PHO5) gene or isochitochrome gene, or promoters involved in the process, for example enolase, glyceraldehyde-3-phosphate dehydro Promoters of genease (GAPDH) or 3-phosphogli serratin kinase (PGK) can be used.

Preferred vectors contain promoters which may or may not be initiated depending on growth conditions. For example, the PHO5 promoter may be inhibited or deinhibited only by increasing or decreasing the concentration of inorganic phosphate in the medium.

Expression vectors for such cells typically comprise a versatile, strong enhancer / promoter unit located in front of the gene to be expressed. When expressing cDNA, an RNA insertion site, a polyadenylation site, and finally a transcription terminator sequence are added to the gene. When used in mammalian cells, the control over the expression vector is often provided by viral material. For example, commonly used enhancer-promoter units include Simian virus (SV 40), Rous sarcoma virus, Adeno virus 2, or cytomegalovirus in mice and human body ( cytomegalovirus). In particular, the SV40 enhancer combined with the enhancer promoter of the cytomegalovirus adjacent early gene of the mouse and the human α-globin promoter is suitable. Also useful are inducible promoters, such as those derived from heat shock or metallothionine genes. In addition, promoters or regulatory sequences conventionally linked to the gene sequence of interest can be used. The origin of replication can be provided by constructing a vector comprising exogenous-origin derived from, for example, SV40 or other viral sources (eg, Polyoma, Adeno, VSV, SPV, etc.) or by host cell chromosomal replication mechanisms. . The latter method is often more preferred when introducing a vector into a host cell chromosome.

Reseparation from the host of the vector DNA containing the cloned DNA insert is achieved, in particular, by lysis and centrifugation of the host cells, in particular by purification by CsCl density centrifugation and phenol / chloroform extraction.

The invention also relates to a hybrid vector containing a DNA sequence encoding an polypeptide or a fragment, mutant or derivative thereof of SEQ ID NO (I) as an insert.

In particular, the present invention provides a polypeptide of SEQ ID NO: 1, wherein the insert is deleted from an amino acid sequence consisting of amino acids 106-127; 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, Any of amino acids 282 to 321, starting with any one of amino acids 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159 or 160 A fragment of a polypeptide of Formula (I) selected from the group consisting of polypeptides terminated by one amino acid; A fragment of the polypeptide of Formula (I) consisting of the amino acid sequence of amino acids 119 to 321; A fragment of the polypeptide of Formula (I) consisting of the amino acid sequence of amino acids 134 to 321; A fragment of the polypeptide of Formula (I) consisting of the amino acid sequence of amino acids 148 to 321; Or a DNA sequence encoding a fragment of the polypeptide of Formula (I) comprising an amino acid sequence of amino acids 150 to 321, wherein the fragment encodes a fragment of the polypeptide of Formula (I) To a hybrid vector.

In particular, the present invention relates to a hybrid vector containing a DNA sequence of SEQ ID NO: II or III, or a fragment or derivative thereof.

Specific hybrid vectors include pCL2, pCL1, pFK-1, pFK-2, pPL-BF, pJDB 207 R / PHO5-BF, pCAL5-R / ND, pCAL8-BF / ND and pPL.PTIS-BF (see : 1 to 8 degrees).

Further hybrid vectors according to the present invention comprise DNA sequences of at least 15 nucleic acids that are 100% homologous to a portion of the insert of Formula (II).

3. Transformation of host

Strong expression vectors are then used as appropriate host cells for the expression of the polypeptide of interest of the invention. In general, prokaryotes are preferred for cloning DNA sequences and assembling vectors. The assembled vector is transferred to an appropriate host cell, wherein prokaryotic and eukaryotic cells can be used. Microbial species that may be used include E. clai, Bacillus subtilis, Bacillus sterothermophilus and other Serratia marcesans, for example Salmonell typhimurium. ) Or Serratia marcesans and various Pseudomonas species. Particularly useful are E. coli strains such as E. coli B, HB 101, BZ 234, X1776, W3110, JA 221 and K12. These are, of course, intended to be illustrative and not restrictive.

In addition to prokaryotes, eukaryotic microorganisms such as yeast may also be used. The most commonly used eukaryotic microorganisms are Zaccharomyces cerevisiae or common baker's yeast, but other species are also commonly used. For expression in Zaccaromyces, for example, plasmid YRp7 (Stinchomb et al. (14), Kingsman et al. (14a), Tschemper et al. (15)) can be used.

In addition to microorganisms, cell cultures derived from multicellular organisms may be used as hosts. Essentially, such cell cultures can be obtained from vertebrates or invertebrates, but vertebrate cell cultures are of greater interest. Examples of such useful host cell lines include Vero and Hela cells, Chinese hamster ovary (CHO) cell lines, Bowes melanoma cell lines, RPMI 8866 and Cos-7 cell lines.

Transformation of the obtained hybrid vector DNA into a recipient is accomplished by a method well known in the art, for example, the method described in the literature (1) of Minatis et al. Bacteria are transformed with hybrid vector DNA, for example by the CaCl transformation method.

Another method suitable for transforming E. coli host bacteria when using lambda phage DNA as a vector is to package the hybrid vector DNA in vitro to infect the bacterium. In vitro packaging is carried out using mainly available packaging kits (Pharmacia, Sweden; Boehringer, Mannheim). Infection is by the MgCl ₂ method described on page 275 of Maniatis (1).

Transformation of yeast includes, for example, enzymatic removal of the yeast cell wall by the use of glucosidase, treatment of the spheroplast obtained with a vector in the presence of polyethylene glycol and Ca ²⁺ ions and spherople The last step is to insert agar into the agar to regenerate the cell wall. Preferably, the regenerating agar is prepared in such a way as to regenerate transformed cells and simultaneously select them.

Transformation of vertebrate cells grown in tissue culture is accomplished by one of several methods well known in the art. DNA can be microinjected directly into the cell nucleus, E. coli protoplasts can be fused with future host cells, or co-precipitates between DNA and dicalcium phosphate can be added. The transformed cells can then be selected using a selection label covalently incorporated into the expression vector or added as a separate entity. Selective markers include genes that confer resistance to antibiotics, such as G418 and hygromycin, or genes that complement genetic lesions in host cells, such as the absence of thymidine and hypoxanthine phosphoribosyl transferase. .

4. Selection of transformed host

Transformed hosts with the characteristics of the selection unit incorporated into the vector are selected from untransformed hosts, in particular by growing bacteria under appropriate selection conditions, so that only the transformed host survives. Another screening method when using bacteriophage is spot formation on smeared E. coli host bacteria.

Screening of a host containing a hybrid vector containing a DNA sequence encoding a polypeptide of the present invention as an insert uses a radiolabeled oligonucleotide probe that encodes a fragment of such polypeptide or screens the polypeptide product of the DNA insert. Can be achieved. Hybridization is performed in particular with any oligonucleotide probe containing at least about 12 consecutive nucleotides encoding mRNA, or fragments of the polypeptides of the invention.

In particular, the selection of E. coli hosts transformed with hybrid vectors involving inserts encoding polypeptides of the invention hybridize oligonucleotide probes to replica filters derived from cDNA libraries distributed on agarose plates. Can be done. Oligonucleotides were synthesized by priming synthesis with Klenow polymerase using fragments of cDNA encoding the polypeptide of the invention cloned at 5 'terminus at ³² P-αATP with ³² P-αATP using T ₄ kinase enzyme or phage M13. It can be labeled internally.

Protein products for screening purposes are obtained by in vivo or in vitro translation, in particular using Xenopus Rabis oocytes as described in Maniatis et al. (1). The decoded protein product uses motoclonal antibodies, such as Mab-45, Mab-176 and Mab-135, or rosettes by functional test systems, such as Sarfati et al. (17). The binding of IgE to the polypeptide can be detected as performed in the inhibition test.

Recombinant phages carrying DNA sequences encoding polypeptides of the invention are identified using hybridization of radiolabeled nucleic acid sequences containing DNA fragments encoding said polypeptides. Alternatively, they are detected by immunological screening using monoclonal antibodies such as Mab-135 and Mab-176.

The modification of the encoded or non-coded region of the hybrid vector is achieved by, for example, the method 1d described above.

The present invention also relates to the use of a polypeptide of the invention having IgE binding activity for treating or preventing allergic diseases in patients allergic to all kinds of antigens, such as pollen, cat hair, mite and the like. This is especially important in the treatment of critically ill patients, including new life-threatening new organisms that are not breastfeeding. Polypeptides of the invention are typically in the form of dosage units, such as tablets, dragees, ampoules, vials or suppositories, for example, enteral, eg nasal, rectal or oral, or parenteral, eg intramuscular, subcutaneous or intravenous. May be administered. The dosage of the polypeptide depends on its particular activity, the weight and condition of the patient, the severity of the disease, the mode of administration and should be based on the judgment of the physician. Typically, about 100 μg and about 5000 μg may be administered per kilogram of breed per day.

The present invention also provides oral, rectal, nasal or parenteral administration of a polypeptide of the present invention having an effective amount of IgE-binding activity to treat an allergic disease (eg, intramuscular, subcutaneous or intraperitoneal administration). It relates to a pharmaceutical formulation which is optionally mixed with a conventional pharmaceutically acceptable carrier which is suitable for and does not adversely interact with the active ingredient.

Suitable formulations include tablets; Capsules; Vials containing solid powders; Or injectable solutions, preferably aerosols, sprays, vials, ampoules, etc., containing aqueous solutions or suspensions, which for example contain the active ingredient alone or include carriers (e.g. mannitol, lactose, glucose, albumin). And lyophilized formulations containing the same). Pharmaceutical formulations may be sterilized and optionally mixed with adjuvants such as preservatives, stabilizers, emulsifiers, solubilizers, buffers and / or salts for adjusting osmotic pressure. Sterilization is achieved by sterile filtration through a small pore size (0.45 μm or smaller diameter) filter, optionally followed by sterile drying of the formulation. Antibiotics may also be added to maintain sterility.

The pharmaceutical preparations according to the invention contain a dosage unit form, for example 1 to 2000 mg of a pharmaceutically acceptable carrier and about 1 to 100 mg, preferably about 2 to 50 mg of active ingredient per unit dose. Prepared in ampoules.

The invention also relates to a process for the preparation of a pharmaceutical preparation characterized by mixing the polypeptide of the invention with a pharmaceutically acceptable carrier.

Known methods per se, for example conventional mixing, dissolution, lyophilization and the like, are carried out to obtain pharmaceutical preparations containing from about 0.1% to 100% of the active substance, in particular from about 1% to 50%.

The use of the novel polypeptides of the present invention for treating and preventing diseases of the human body is also an object of the present invention.

Abbreviations used herein have the following meanings.

bp: base pair, BSA: bovine iron albumin, cDNA: complementary DNA cpm: minute count (radioactive decay), dA: 2'-deoxyadenosine, dATP: 2'-deoxyadenosine triphosphate, dC: 2'-deoxy Cytidine, dCTP: 2'-deoxycytidine triphosphate, dG: 2'-deoxyguanosine, dGTP: 2'-deoxyguanosine triphosphate, dT: 2'-deoxythymidine, dTTP: 2 '-Deoxythymidine triphosphate, DNA: deoxyribohexane, dNTP: dATP, dCTP, mixture of dGTP and dTTP, ds: double-strand, dTT: 1,4-dithiothreitol, EDTA: ethylenediaminetetraacetic acid Disodium salt, FCS: fetal calf serum, HAT: hypoxanthine / aminopterin / thymidine, HBSS: Hank balanced salt solution, HT: hypoxanthine / aminopterin, Hepes: N-2-hydroxyethyl Piperazine-N'-2-ethenesulfonic acid, IgE: immunoglobulin, mRNA: messenger RNA, min: min, PBS: phosphate buffered saline, Pipes: piperazine-N, N'-bis (2-ethane Phosphonic acid), PMSF: phenylmethylsulfonyl fluoride, RLA: radioimmunoassay, RNA: ribohexane, rpm: revolutions per minute, SDS: sodium dodecyl sulfate, SS: single chain, Tris: tris (hydroxymethyl) Aminomethane, tRNA: transfer RNA, μg: microgram

The following examples are intended to illustrate the invention and are not intended to limit the invention thereto.

Example

The buffer and medium used are as follows.

Agar: LB-broth supplemented with 2% agar, elution-buffer: 10 mM Tris-HCl (pH 7.5) 1 mM EDTA, 0.2% SDS, LB-broth: 1% bacto-tryptone (Difco), 0.5% bacterium Yeast extract (Difco), 170 mM NaCl (adjusted to pH 7.5 with NaOH), Dissolution-Solution: 0.5M NaOH, 1.5N NaCL, HBSS: 8g NaCi, 400mg KCL, 48mg Na ₂ HPO ₄ , 350mg NaHCO ₃ , 60mg KH ₂ 100 mg of phenol red in 1 L of PO ₄ , H ₂ O, HBSS-FCS: 10% FCS, 0.01% NaN ₃ , HBSS (pH 7.2) supplemented with 66 mM Tris-HCl, HT-medium: 40 μl 2-mercaptoethanol, 100 μM hypoxanthine, RPMI / c-medium supplemented with 1 μM thymidine, HAT-medium: HT-medium supplemented with 10 μM aminopterin, MBS-H: 88 mM NaCl, 1 mM KCl, 0.33 mM Ca (NO ₃ ) ₂ 0.41 mM CaCl ₂ , 0.82 mM MgSO ₄ , 2.4 mM NaHCO ₃ , 10 mM Hepes (pH 7.4), Mc Conkey Agar: 50 g of premixed McGonky Agar (Becton Dickionson), oocyte lysis-buffer per liter of distilled water : 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 0.5% Triton × 100, 0.5% Sodium Deoxycol Rate, 0.1% methionine, 1 mM PMSF, PBS: 8 g NaCl, 0.2 g KCl, 1 L containing 1.44 g Na ₂ HPO ₄ 2H ₂ O, 0.2 g KH ₂ PO ₄ , RPMI 1640-Medium: purchased from Gibco, RPMI 1640 / c-medium: RPMI 1640-medium, RVT-buffer supplemented with 1% phenylsilin-streptomycin (Gibco), 1% L-glutamine (Gibco) and 15% (V / V) FCS (Gibco): 200 mM Tris-buffer (pH 8.3 at 42 ° C.), 20 mM MgCl ₂ 280 mM KCl, 20 mM DTT, SOC-Medium: 2% Bacterium Tryptone (Gibco), 0.5% Yeast Extract (Gibco), 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 5 mg MgSO ₄ , 20 mM glucose, SSC-buffer: 15 mM sodium citrate, 150 mM NaCl, TBE-buffer: 10.8 g, Tris, 5.5 g boric acid, 1 L with 4 ml 0.5% EDTA, pH 8.0, TE- Buffer: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, TNE-buffer: 10 mM Tris-HCl, 1 mM EDTA, 0.1M NaCl (adjusted to pH 7.8 with NaOH), wash-buffer: 10 mM Tris-HCl (pH 7.5) , 1 mM EDTA, 0.5 M NaCl, 0.2% SDS

Use of restriction enzymes and isolation of DNA

All restriction enzymes are used in buffer as recommended by the providers for the enzyme data sheet. Generally, three units of enzyme are used to degrade 1 μg of DNA. Incubation is continued for 2 hours at 37 ° C. EDTA and Na-acetate were added at 15 mM and 200 mM final concentrations respectively to stop the enzyme reaction. 1 volume of 1: 1 mixture of chloroform / phenol presaturated with TNE is added and the mixture is vigorously shaken to extract DNA. The organic phase and the aqueous phase are separated by centrifugation at 5000 g for 5 minutes (room temperature). The aqueous phase is transferred to a new tube and extracted with 1 volume of chloroform. After centrifugation, 2.5 volumes of ethanol are added to precipitate the DNA. Samples are incubated at −20 ° C. for at least 2 hours and then centrifuged at 10000 g for 10 minutes. The DNA pellet is washed once with 70% ethanol, dried in a vacuum dryer for 10 minutes and finally dissolved in the appropriate volume of TE buffer.

The strains used are as follows.

this. E. coli strain ^{HB 101: F -, hsdS20 (} r - β, m - B), recA13, ara14, proA2, lacY1, galK2, rspL20 (Sm '), xyl-5, mtl-1, supE44, λ - (Boyer and Rouland-Dussoix 1969: Bolivar and Backman 1979).

RPMI 8866 Cell Line: RPMI 8866 cells (ATCC No. CCL 107) are from lymphoblast B cell lines expressing receptors for IgE. This cell line P. Ralph (Sloan-Kettering Research Institute, NY, USA).

The plasmids used are as follows.

pUC-9 from Pharmacia (P-L Biochemicals Upsalla, Sweden). The pUC-9 plasmid consists of a DNA replication origin linked to the pBR322 derived ampicillinase gene and part of the E. coli lacZ gene. DNA inserts with an alignment of unique restriction enzyme recognition sites were introduced into the lacZ region of this plasma.

pUC-KO: The promoter / operator region of the lacZ gene between the Hae III restriction site and the Hind III restriction site next to the promoter is deleted, and the other sequences of pUC-9 are derivatives of the unchanged pUC-9 plasmid.

pGEM ^™ -1: purchased from Promega Biotec (Madison, USA). It is a specific transcription vector and constructed using the bacteriophage SP6 promoter-containing plasmid pSP64 (Melton, DA, et al, (16)) and the bacteriophage T7 promoter. The resulting plasmid has two opposing SP6 and T7 promoters separated by small pieces of DNA with several cloning sites.

PIN-MMM-ompA plasmid: described in Gharayeb et. Al. (13). This plasmid is a specific secretion cloning vector in E. coli. Secretion of the cloned gene product through the cytoplasmic membrane can be accomplished by fusing the appropriate signal peptide to the amino-terminus of the gene product. In these plasmids, DNA fragments encoding the signal peptide of the ompA protein, the outer membrane main protein of E. coli, were inserted into the high expression vector. Foreign DNA fragments can be cloned into any of the three reading frames in the following unique EcoRI, Hind III or BamH I sites directly following the ompA signal peptide coding sequence. PIn-III-ompA-plasmids of types 1, 2 and 3 provide different frames for decoding.

Example 1

Isolation of mRNA from RPMI 8866 Cells

RPMI 8866 cells are grown in a tissue culture flask (Falcon, 175 cm ² ) containing 15 ml FCS, 100 units / ml penicillin and 100 ml / m RPMI 1640 medium supplemented with 100 μg / ml streptomycin. Centrifuge to collect cells from 50 confluent flasks (approximately 10 ⁸ cells / flasks) and wash once with 50 ml PBS. Cell pellet (5 g) was prepared with 100 g of guanidinium thiocyanate, H ₂ O, 100 ml, 10.6 ml 1M Tris-HCl, pH 7.5, 4.2 ml 0.5M EDTA, 21.2 ml 20% N-lauryl sarcosine and 20- It is dissolved in 25 ml of a solution prepared from 2.1 ml of mercaptoethanol. The cell lysates are homogenized at full speed for 90 minutes in a pluripot. Then 2 volumes of a 1: 1 mixture of chloroform and phenol are added. The mixture is shaken vigorously for 1 minute and then centrifuged at 5000 g for 10 minutes with a Sorvall centrifuge at 10 ° C. Recover the aqueous phase and repeat extraction four more times. Two volumes of ethanol are added to the aqueous phase. The precipitate is recovered by cooling to −20 ° C. for 15 minutes and then centrifuged at 10000 rpm with a Sorval SS34 rotor at 4 ° C. for 10 minutes. The pellet is dissolved in 4 ml of TE buffer. 7.5 g of baked CsCl (Merck) and 50 μl of 0.1 N HCl are added and the solution is adjusted to 7.5 ml and charged with 2 ml of 5.7 MCsCl buffer in a 12 ml tube for centrifugation. The tube is filled with water and centrifuged for 16 hours at 29000 rpm with a TST 41 rotor (Kontron) at 20 ° C. At the end of the run, most of the supernatant is removed and the tube is quickly inverted and emptied. The glassy RNA pellet is vortexed and sometimes warmed at 37 ° C. (for 2 minutes) and dissolved in 1 ml of TE buffer and 0.2% SDS. As described on pages 461 to 462 of Document (1), RNA is precipitated with ethanol. The dried mRNA is dissolved in 1 ml of elution buffer. After heating at 68 ° C. for 2 minutes, cooling on ice, 130 μl of 5M NaCl was added and the solution was added to a 2 ml column of oligo-dT cellulose (2 ml bed volume in 5 ml syringe type 7, PL Biochemicals) equilibrated with wash buffer. Apply. After two consecutive samples are applied, the column is washed with 15 ml of wash buffer and bound mRNA is eluted with 4 ml of elution buffer. The eluted material is heated at 68 ° C. for 2 minutes and cooled on ice before 0.44 ml of 5M NaCl is added. The solution is applied twice to the re-equilibrated oligo-dT cellulose column. After washing the column with 15 ml of wash buffer, bound mRNA is eluted with 4 ml of elution buffer. The recovery of mRNA is calculated by measuring the absorbance at 260 nm (OD _{260 nm} = 1 at 40 μg / ml). mRNA (150 μg) is precipitated with ethanol. The precipitates were collected by centrifugation (15 min at 16000 g), dissolved in 0.4 ml of water, and reprecipitated with ethanol. The cDNA-pellets are air dried and dissolved in 150 μl of TE buffer supplemented with 0.1% SDS.

Example 2

Purification of mRNA Encoding IgE-Receptor and IgE-BF Related Polypeptides

130 μg (1 μg / μl) of poly A-mRNA obtained from Example 1 was heated at 70 ° C. for 5 minutes and cooled on ice to prepare 0.1 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA and 0.5% SDS. On 12 ml of sucrose with a 5-20% linear gradient in water. The gradient is centrifuged at 25 ° C. for 5 hours at 41000 rpm with a TST 41 rotor. Thirty fractions (volume: 0.4 ml / fraction) were pooled and assayed by injecting into oocytes of Xenopus rabbis as described in Example 3.

Example 3

In Vivo Detoxification of mRNA in Xenopus Rabbit Oocytes

Mature male and female Xenopus levis. Obtained from several animal suppliers, including Evans (K. Evans, 716 Northside, Ann Arbor, Mi 48105). The frogs are left in certain types of water tanks without venting at 18-22 ° C. A constant supply of bovine liver and heart fragments (twice a week) will maintain a strong clone. Oocytes must be obtained from healthy mature female Xenopus. This can easily be achieved by anesthetizing the frog for 10-30 minutes in ethyl-m-aminobenzoate 1: 1000 (w / v) solution in water. Make a small incision in the ventral side to remove the frog's ovary (1 cm). After the ovary sections are removed, the incisions can be sutured so that the frog can survive quickly. The ovary is immediately placed in modified Barth saline (MBS-H) and individual oocytes are separated by platinum teeth. Fully grown giant oocytes are injected using a micromicropipette, micrometer syringe and standard stereoscopic microscope for dissection. Construction of suitable infusion pipettes is described in Gurdon's document (18). The oocytes are wiped with paper towels and placed on the dried microscope slides and the slides placed on the microscope. The oocytes are fixed with forceps of the position maker before or during the insertion of the pipette. The pipette was plugged into oocytes and injected with a micrometer syringe with an aliquot of the mRNA solution (1 mg / ml 30-50 ml) of Example 2. Supplemented 40 groups of oocytes containing the same fraction of mRNA with 6% FCS Incubate for 45 hours in 0.5 ml of prepared Bart's solution at 20 ° C. Remove incubation medium and homogenize oocytes in 900 μl oocyte lysis buffer Centrifuge the homogenate in an Eppendorf centrifuge for 10 minutes. Was collected and tested by RIA as described in Example 7 in aliquots of 50 μl.

Example 4

Preparation of Hybridoma Cells Producing Monoclonal Antibodies to FcεR

BALB / c mice are immunized by intraperitoneal injection of 5 × 10 ⁷ RPMI 8866 live cells in PBS three times at four week intervals. Two days after the last injection, individual mouse serum samples are collected and tested for anti-FcεR activity. Splenocytes from two animals with the highest titers are collected and used for fusion the next day. Pellet spleens and pellet 1 × 10 ⁸ splenocytes washed for each fusion with 25 × 10 ⁶ NSI / 1-Ag4 / 1 mouse myeloma cells (obtained from the American type-culture collection) for 50 min at 350 × g. Make it angry. The cell pellet is resuspended in 2 ml of polyethylene glycol solution (PEG-1540, Baker) consisting of 20 g PEG dissolved in 28 ml RPMI 1640 medium (Gibco) containing 15% (v / v) dimethylsulfoxide.

8 ml of RPMI / c medium is added dropwise over 90 seconds, then an additional 5 ml is added quickly. The tubes are inverted and mixed, then left for 2.5 minutes and centrifuged for 5 minutes at 350 × g. The pellet is resuspended in 5 ml RPMI / c medium and 50 μl aliquots are dispersed in each well of 4 Costar # 359624-wellplates containing 1 × 10 ⁶ BALB / c normal spleen cells in 1 ml HAT-medium. Start from day 5 after fusion and add or replace HAT medium every few days as needed to maintain complete culture. After 14 days, the HAT is replaced with HT medium and after 28 days with RPMI / c. After 1-2 weeks of fusion, the supernatants of each well (192 cultures) are screened for anti (I) FcεR antibodies. 21 cultures producing the desired antibody are cloned in limited dilution. The cultures were diluted in RPMI / c to 10 viable cell concentrations per ml, so 50 μl aliquots of these suspensions were prepared in 96-well plates containing 100 μl HT medium and 1 × 10 ⁵ BALB / c normal spleen cells (Linbro). # 76-003-05, Flow Labs). The wells are examined under a microscope to confirm the presence of monoclonals in the grown culture. A sample of supernatant taken from this is tested for antibody activity. Positive cultures are selected and transferred to larger culture vessels. Finally, 14 monoclonal cell lines secreting antibodies of the desired specificity are obtained. Three clones used in the present invention were each 207.25. A.4.4 / 45, 208.25A.4.30135 and 208.25D. Named 2.1 / 176 and deposited with the institution [Collection Nationale de Cutures de Microoryanismes of the Institut Pasteur, Paris], accession numbers are I-452, I-425 and I-420, respectively. The monoclonal antibodies thus produced are named Mab-45, Mab-135 and Mab-176.

Example 5

Isolation and Purification of Monoclonal Antibodies

Bal b / c mice are pretreated intraperitoneally with 0.5 ml Pristane (Aldrich). Two weeks later, 5 × 10 ⁶ cloned hybridoma cells of Example 4 are injected intraperitoneally. After 8 to 10 days, the ascites solution is collected and centrifuged at 800xg and stored at -20 ° C. The thawed ascites fluid is centrifuged at 50,000xg for 60 minutes. The fat layer suspended on the surface is carefully removed and the protein concentrate is adjusted to a concentration of 10-12 mg / ml. Crude immunoglobulin is precipitated by dropwise addition of 0.9 volume equivalent of saturated sulfuric ammonium at 0 ° C., then dissolved in 20 mM Tris-HCl / 50 mM NaCl (pH 7.9) and dialyzed against the same buffer. DEAE-D52 Whatman chromatography using a buffer gradient system of 20 mM Tris-HCl / 25 to 400 mM NaCl, pH 7.9, yields an immunoglobulin G fraction.

Example 6

Preparation of ¹²⁵ I Labeled Antibody Mab-135

F. Seed. 40 μg of Mab-135 (PBS solution of Example 5) is iodized with 0.5mCi ¹²⁵ I sodium iodide and chloroamine T according to the general procedure of FC Greenwood et al. (19). The solution containing the iodinated Mab-135-protein is dialyzed for 6 h and 4 times for 1 l of PBS-buffer, respectively. The final product has a specific activity of approximately 2 × 10 ⁷ cpm / μg protein. Similarly, ¹²⁵ I labeled antibody Mab-176 is prepared.

Example 7

Radiation Immunoassay for the Detection of IgE-BF in Cell Supernatants and Serum

Wells of polyvinyl chloride microtiter plates are incubated overnight at 20 ° C. with 150 μl of 0.01 M carbonate buffer at pH 9 containing 5 μg / ml of Mab-176 from Example 5. The plate was then washed once with PBS and reacted with 200 μl Hank Balanced Salt Solution (HBSS-FCS) containing 10% fetal calf serum at room temperature and then washed 10 times with PBS again to give test sample 100 Incubate with μl for 8 hours at room temperature. The blanks are determined using HBSS-FCS. Plates were washed 10 times with PBS and incubated overnight at room temperature with 100 μl of ¹²⁵ I-Mab-135 (Example 6, 2-4 × 10 ⁵ cpm in HBSS-FCS), then washed 10 times with PBS and gamma Count in the counter.

Example 8

Synthesis of ss-cDNA from mRNA

12 μl (0.5 mg / ml) of the mRNA solution of Example 2 showing the maximum binding capacity to ¹²⁵ I-Mab-135 detected in the RIA of Example 7 was mixed with 25 μl RVT buffer, 2.5 μl dNTP mixture (20 mM dATP, dTTP, respectively). And dGTP), 1 mg / ml oligo-dT _12-18 (PL-Biochemicals 5 μl, 1 μl α- ³² P-dCTP (10 μCi, 3000 Ci / mmol), 3 μl RNasin ^™ (60 units, Promega Biotec, Madison, USA) ) And 3 μl reverse transcriptase (66 units, Promega Biotec) Add radioactive dCTP to the reaction mixture for better recovery and yield measurement of cDNA after the synthesis step The mixture is incubated at 42 ° C. for 1.5 hours. The reaction was stopped by adding 0.5 μl of 0.5 M EDTA-2 μl, and 25 μl of 0.15 M NaOH was added and incubated for 1 hour at 45 ° C. 25 μl of 1 M Tris-HCl (pH 8.0) and 1 M HCl 6 μl is added to neutralize the solution 2 μl of 20% SDS is added and the solution is added to the same volume of phenol-chloroform mixture (equilibrated with TNE-buffer). And chloroform) 0.15 ml .. The aqueous phase is applied with a Pasteur pipette to a Sephadex G-50 column equilibrated with TNE-buffer to separate freshly synthesized cDNA from unmixed nucleotides and digested mRNA. Fractions are collected and the radioactivity of each fraction is roughly determined by a Geiger counter.The three fractions with radioactivity are collected: 1.9 μg of ss-cDNA is recovered and described on pages 461 to 462 of (1). Ethanol-precipitate ss-cDNA is dissolved in 20 μl of water.

Example 9

ds-cDNA-synthesis and Sl-degradation

The obtained SS-cDNA was prepared using 100 mM Hepes, 10 mM MgCl ₂ , 2.5 mM DTT, 70 KCl, 0.5 mM dNTP (dATP, dCTP, dTTP, dGTP) and 20 units of DNA polymerase I macrofragment, Klenau enzyme (pH 6.9). Incubate at 15 ° C. for 3 hours in 100 μl final volume of Boehringer Mannheim). Then add another 20 units of the same enzyme and continue incubating at 15 ° C. for 10 hours. EDTA is added to 20 mM to terminate the reaction. The mixture is extracted with phenol-chloroform and precipitated with ethanol as described on pages 461 to 462 and pages 458 to 459 of Document (1). The resulting ds-cDNA is treated for 30 minutes at 30 ° C. in 100 μl of an incubation mixture containing 250 mM NaCl, 50 mM sodium acetate, pH 4.5, 1 mM ZnSO ₄ , SI Nuclease (Boehringer Mannheim). EDTA was added to 25 mM to stop the reaction. 1 M Tris-HCl, pH 8.0, is added to 100 mM and SPS up to 1% and then passed through a Sephadex G-200 column in a 2-mil Pasteur pipette, extracted with phenol / chloroform and equilibrated with TNE buffer. Radioactivity is measured to determine the fractions containing ds-cDNA, which are collected, precipitated with ethanol and dissolved in 15 μl of water. 3.2 μg of ds-cDNA is obtained.

Example 10

3'-oligo (dG) -tailing of the pUC-KO plasmid

20 μg of the pUC-KO plasmid is cut into 50 units of Boehringer Mannheim (PstI) in 200 μl of pH 8.0 at 50 mM Tris-HCl, 100 mM MgCl ₂ and 50 mM NaCl. EDTA is added to 20 mM and the reaction mixture is extracted with the same volume of chloroform / panel (1: 1). Cleaved plasmid-DNA was precipitated by adding 2.5 volumes of ethanol and recovered by centrifugation at 10000 g for 10 minutes. Discard the supernatant and dissolve the pellet in 50 μl of water. The probe was 5 at 37 ° C. in 150 μl of a solution containing 80 units of 200 mM potassium cacodylate, 1 mM CoCl, 2 mM DDT, 10 μM dGTP and terminal deoxynucleotidyl transferase (Pharmacta PL Biochemicals, Upsalla Sweden) at pH 6.9. Incubate for minutes. EDTA was added to 10 mM to stop the reaction and the mixture was extracted once with phenol / chloroform (1: 1). DNA is precipitated with ethanol and recovered by centrifugation at 10000 g. DNA pellets are dissolved in 200 μl of TE buffer and loaded onto 0.8% horizontal agarose gel in TBE buffer using a slot 3 cm wide. After electrophoresis at 1V / cm for 16 hours, the DNA is recovered from the bag by electroeluting at 5V / cm for 20 minutes and pipetting vigorously. DNA is extracted with phenol-chloroform and ethanol-precipitated as described in Example 1. After centrifugation, DNA is dissolved in TE buffer and stored at -20 ° C.

Example 11

Preparation of a plasmid containing ds-cDNA encoding a polypeptide related to IgE-receptor and transformation of E. coli HB 101 using the same

A solution containing 800 ng of ds-cDNA from Example 9 containing 200 mM potassium carodilate, pH 6.9, 1 mM CoCl ₂ , 2 mM DTT, 100 pmol ³ H-dCTP and 12 units of terminal deoxynucleotidyl transferase (PK Biochemicals) 40 Incubate at 37 ° C. for 5 minutes. EDTA was added to 10 mM to stop the reaction. The mixture is extracted with phenol / chloroform and the DNA is precipitated with ethanol. The dc-tailed ds-cDNA is dissolved in water and stored at -20 ° C. A mixture of 50 mg of dC-tailed ds-cDNA in 200 μl of TNE buffer and 150 mg of dG-tailed pUC-KO of Example 10 was incubated at 65 ° C. for 5 minutes and 55 ° C. for 60 minutes and then in a water bath 3 to 5 Cool slowly to 30 ° C. over time. To a 200 μl of a suitable E. coli HB 101 prepared for transformation by treatment with calcium chloride as described on page 250 of document (1) is added a 2 μl aliquot of the annealing mixture. The mixture is kept on ice for 30 minutes and then heated to 42 ° C. for 2 minutes, diluted with 1 ml of SOC-medium and incubated at 37 ° C. for 1 hour. The contents of 10 tubes are collected and centrifuged at 2000xg for 5 minutes to collect the cells. Each cell pellet is resuspended in 1 ml of SOC-medium and distributed on 10 cm agar plates containing LB-medium and 50 μg / ml ampicillin. Plates are incubated at 37 ° C. for 16 hours. About 5000 transformed clones are obtained, which are characterized as having ampicillin resistance.

Example 12

Identification by Hybrid-Selection Decoding of Clones Containing ds-cDNA Encoding Human IgE-Receptor and IgE-Binding Factor Related-Polypeptides

Individual clones of Example 11 were grown in saturation in 2 ml of Lb-broth containing 100 μg / ml of ampicillin. 96 cultures were collected and the plasmid-DNA was isolated using an alkali dissolution method (Maniatis, T, et al., P. 90 (1). 100 μg of the one-calorie denatured plasmid-DNA was collected from Seed's literature). Covalently bind to 50 mg of activated ATP-cellulose prepared according to the method of 20).

PolyA-mRNA (60 μg) from RPMI 8866 cells (Example 1) were dissolved in 300 μl of 15 mM EDTA, 600 mM NaCl, 0.2% SDS and 59% formamide at pH 6.4 and cellulose-bound at 37 ° C. with gentle stirring. Hybridize to plasmid-DNA for 16 hours. Cellulose is washed 10 times in 50% formamide, 45 mM NaCl, 4.5 mM Natrium Citrate, 20 mM Pipes at pH 6.4 and 1 mM EDTA. Hybridization mRNA is eluted from cellulose by incubating twice at 65 ° C. in 20 μg of 100 μl 90% formamide, 0.2% SDS, 10 mM Pipes at pH 6.4, 5 mM EDTA, between 20 μg / ml calf tRna. Eluted mRNA is precipitated twice with entanol. Precipitated poly-RNAs obtained from each pool were dissolved in 6 μl of water and used for injection into Xenopus laby's oocytes and analyzed as described in Example 3. The translated protein is screened by RIA as described in Example 7. Only one of 10 pools with 10 clones, each with 96 clones, is positive. These 96 clones are screened in the same manner in combination with 12 new pools with 8 clones. Finally, after deciphering mRNA in frog oocytes, a single colony is identified in which the protein shows a positive signal in RIA. This clone is grown in LB-liquid medium containing 100 μg / ml of ampicillin. The plasmid-DNA is isolated from this clone. 1 μg of plasmid DNA was digested with Pstl, a restriction enzyme that cleaves both boundaries between the vector DNA and the ds-cDNA insert, and was sequenced using the dideoxy chain terminal sequencing method of Sanger et al. (21). Determine. Sequencing is performed using the reagents contained in the sequencing kit (Amersham, N 4501 and N 4502) as described in detail in Amersham handbook “M 13 cloning and sequenClng.” The length of the ds-cDNA insert is 417 bp. And its sequence is shown in SEQ ID NO: II of bp No. 878 to bp 1395. The ds-DNA encoding the C-terminus of the IgE-receptor and IgE-binding factor is a human IgE-receptor or IgE-binding factor. It is used as a DNA probe in hybridization and screening to produce longer cDNA clones with all encoding information for the polypeptide involved.

Example 13

Cloning of cDNA with Completely Encoded Sequences for Human IgE-Receptors

As described in Example 1, polyA-mRNA is isolated from RPMI 8866 cells. The first step of cDNA synthesis is performed according to Examples 2-8. The experimental process is then changed to produce full length ds-cDNA. Dissolve ss-cDNA in 32 μl of water. ss-cDNA is extended with oligo-dc tail in a reaction mixture containing 32 μl ss-cDNA (2.8 μg), 10 μl 1 M potassium cacodylate at pH 7.0, ₅ μl 10 mM CoCl _{2, 5} μl 1 mM DTT and 1 nmol dCTP. After preincubation at 37 ° C. for 5 minutes, 3 μl of terminal deoxynucleotidyl transferase (81 units, PL Biochemicals) is added and incubated for 10 minutes. 50 μl of TNE buffer is added and ss-cDNA is extracted with chloroform / phenol and precipitated with ethanol. The pellet was washed with 70% ethanol and air dried, then 15 μl H ₂ O, 25 μl RVT buffer, _2.5 μl dNTP mixture (20 mM dATP, dTTP and dGTP) and 0.2 mg / ml oligo dG _12-18 (PL Biochemicals) Dissolve in 5 μl. Add 3 μl of reverse transcriptase (66 units, Promega biotec) and incubate the mixture at 42 ° C. for 90 minutes. 2 μl of 0.5 M EDTA at pH 7.5 and 50 μl of TNE buffer are added to stop the reaction and the mixture is described as 0.15 ml of phenol-chloroform (1: 1). The aqueous phase is applied on a Sephadex G50 column (2.5 ml in TNE buffer) to collect a pass fraction (0.4 ml) containing 1.1 μl of ds-cDNA. ds-cDNA is ethanol precipitated. The resulting pellet is dissolved in 32 μl of water and the ds-cDNA is extended with a radiolabeled oligo-dc tail as described in Example 11. The reaction is stopped by adding 1 μl of 0.5 M EDTA, pH 7.5, and the sample is loaded onto a 1% horizontal agarose gel in TBE buffer using a slot of 0.5 cm in width. 1 μg of bacteriophage lambda DNA (digested into EcoRI and Hind III) was loaded into parallel slots to serve as size markers. After electrophoresis at 2.5 V / cm for 2 hours, the gel is immersed in TBE buffer containing 0.5 μg / ml of atdium bromide to stain the ds-DNA. The region containing ds-cDNA of approximately 1.4 to 2 kilobase size is cut and placed in two micro-colloidal bags (Sar-torius) pre-soaked in water. 0.3 ml of water is added and the bag is placed on a horizontal electrophoresis device (Bio-Rad) containing semi-concentrated TBE buffer. The ds-cDNA is electroeluted at 5 V / cm for 20 minutes and pipetted vigorously to recover the ds-cDNA from the bag. ds-cDNA is extracted with phenol-chloroform and precipitated with ethanol. After centrifugation, ds-cDNA is dissolved in 100 μl of TNE buffer to give 100 ng of ds-cDNA (measured from radioactivity).

Example 14

Annealing of dG-tailed pUC-KO with poly (dG) tail to ds-cDNA with poly (dC) tail and using the obtained hybrid. E. coli transformation

40 μl of ds-cDNA (40 ng of size-fractionated material of Example 13) was mixed with 16 μl (200 ng) of oligo-dG _10-20 tailed pUC-KO plasmid-DNA obtained from Example 10 and 194 μl of TNE buffer 65 Incubation is continued for 10 minutes at < RTI ID = 0.0 > Annealed DNA is used to transform competent E. coli HB 101 cells (strain LM 1035) prepared for transformation as described in Example 11. An aliquot of 2 μl of the anneal mixture is added to a parallel tube containing 200 μl of competent cells. The tube is left on ice for 30 minutes. Heat shock is applied at 42 ° C. for 90 seconds and then cooled on ice for 2 minutes, 0.8 ml of SOC medium per tube is added and incubated at 37 ° C. for 60 minutes. After incubation, the contents from 10 tubes are collected. The cells are collected by centrifugation at 2000 g for 5 minutes and plated onto a Macconki agar plate (15 cm in diameter) containing 100 μg / ml of ampicillin. Plates are incubated overnight at 37 ° C. About 1000 ampicillin resistant colonies are obtained per plate. They are transferred onto nylon membranes (Pall-Biodyne, Glen Cove, New York-USA) and the nylon membranes are loaded onto McConkie agar plates with colonies facing up. After incubation at 37 ° C. for 5 hours, two replicas are made on a nylon membrane. Base membranes are stored on agar plates at 4 ° C. For clony hybridization, replicas were saturated with 0.5M Tris-HCl, 1.5M NaCl at pH 8.0 for 5 minutes on 3MM paper (Whatman Ltd., Maidstone, USA) saturated with 0.5M NaOH, 1.5M NaCl. Treatment is carried out by placing it continuously on the paper for 10 minutes. Between each incubation the filter is blotted onto Whatman 3MM dry filters. The replica filter is baked at 80 ° C. in a vacuum oven and immediately used for DNA hybridization.

Example 15

Filter hybridization

Plasmid 10 encoding a portion of the IgE-receptor obtained from the positive clone of Example 12 was digested with Pst I restriction endo nuclease to prepare cDNA inserts. The cDNA insert (450bp) was isolated from pUC-KO vector DNA (2900bp) by electrophoresis through 1.5% agarose gel in TBE buffer and then electroeluted as described in Example 13 and precipitated with ethanol to recover it. . Radiolabel the pure cDNA insert (200 ng) according to the instructions given by the supplier using a nick decode system supplied from Amersham (N.5000). Radiolabeled cDNA probes have a specific activity of 5 × 10 ⁸ dpm / μg. Radiolabeled mRNA is incubated at 95 ° C. for 10 minutes and immediately denatured by cooling on ice. The replica filter of Example 14 was encapsulated in 0.9M NaCl, 0.18M Tris-HCl, 6 mM EDTA, 0.02% Ficoll 400, 0.02% polyvinylpyrrolidone, 0.02% BSA, 0.2% in a sealed plastic bag. Prehybridized with 100 ml of solution containing SDS and 50 μg / ml of denatured calf thymus DNA for 2 hours. Hybridization overnight in a sealed plastic bag containing 5 ml of the same solution supplemented with heat-modified radiolabeled cDNA inserts. After hybridization, the filter is washed in 2 × SSC / 0.2% SDS and then washed three times with 200 ml of 0.2 × SSC / 0.2% SDS at 65 ° C. The filter is dried and exposed to Kodak X-ray film (XAR-5) overnight. The filter is labeled with radioactive ink so that the filter can be arranged on an automatic radiograph. Two wild clones are found and their DNA hybridized to radiolabeled DNA fragments encoding IgE-receptors. These are named pCL-1 and pCL-2.

Example 16

Isolation and Analysis of pCL1- and pCL2-DNA

pCL1 alc pCL2 clones are grown and then their plasmid DNA is isolated using an alkali lysis method (Maniatis. T., et al. m, (1) p. 90). DNA is digested with a Pst I enzyme that cleaves cDNA at the border between the vector DNA and the DNA insert. Electrophoresis separates the fragments and electroelutes to separate the complete insert as described in Example 13. The cDNA inserts of these two plasmids are fully sequenced using Sanger et al. (21) described in detail in the Amersham handbook. Restriction analysis and sequencing are summarized in FIG. 2 and in formula (II).

Example 17

Transfer to a Plasmid Suitable for Transcription of cDNA Associated with IgE-Receptors

10 μg of pCL-2 plasmid DNA is digested with restriction enzymes Pst I and Hinc II (Boehringer Mannheim). 1.5 Kb cDNA insert and 2.9 kb plasmid vector DNA are separated on a 1% agarose gel in TBE buffer using a slot 3 cm wide. After electrophoresis for 16 h at 1 V / cm, DNA is recovered by electroeluting as described in Example 13. In parallel, plasmid pGEM ^™ -1 was digested with Pst I and Hinc III, extracted once with phenol / chloroform and precipitated with ethanol. 10 ng of 1.5 Kb cDNA insert and 10 ng of pGEM ^™ -1 cleaved with Pst I were ligated at 15 ° C. for 4 h in a volume of 10 μl. The reaction mixture contains 10 units of 10 mM Mgcl ₂ , 2 mM DTT, 0.1 mM ATP and T ₄ Ligase (Boehringer Mannheim) in addition to 10 mM Tris-HCl at pH 7.5. 5 μl of the mixture is used to transform competent E. coli HB101 (strain LM 1035) as described on page 250 of document (1). About 100 ampicillin resistant colonies are obtained. 24 colonies are grown and plasmid DNA is isolated from the culture. Approximately 1 μg of plasmid from each culture is digested with Hind III and the length of the digested DNA fragment is analyzed on a 1% agarose gel using lambda DNA (PharmaCla, Sweden) digested with Hind III as the size marker. . Plasmid DNA of many colonies is digested to obtain DNA fragments of 1.0 Kb and 3.3 Kb length. These plasmids are named pGEM ^™ -1 / CL2 (cf. Third). They have the amino terminus of the IgE-receptor adjacent to the T ₇ polymerase promoter on the pGEM ^™ -1 vector DNA.

Example 18

Transcription of cDNA Associated with IgE-Receptors

10 μg of the plasmid pGEM ^™ -1 / CL2 of Example 17 was digested with the enzyme Rsa I (Boehringer, Mannheim). 5 μl of 0.5 M EDTA is added and the mixture is extracted once with phenol / chloroform (1: 1, V: V) and once with chloroform. The DNA is precipitated with ethanol, concentrated and dissolved in 20 μt of TE buffer. pH 7.5 dml 40 mM Tris-HCl, 6 mM MgCl ₂ , 2 mM spermidine, 10 mM Nacl, 10 mM DTT, 1 unit / μl RNasin, 0.5 mM dNTP and 100 μl solution containing 20 units of riboprobe T ₇ RNA polymerase (Promega Biotec) Add 4 μl of DNA solution. The mixture is incubated at 37 ° C. for 1 hour. After RNA synthesis reaction, 2 units of RQI ™ DNAse (Promega Biotec) were added and incubated at 37 ° C. for 1 hour. The mixture is extracted once with phenol / chloroform and once with chloroform and precipitated with ethanol to recover the newly synthesized RNA. The RNA pellet is washed with 70% ethanol and finally dissolved in 20 μl of water.

Example 19

Translation of Plasmid-Induced IgE-Receptor mRNA and Detection of IgE-Receptor Proteins in Frog Oocytes

The mRNA obtained in Example 18 is used to inject directly into the oocytes of the frog as described in Example 3. The synthesis of IgE-receptor proteins is tested by RIA as described in Example 7. The poly-mRNA of Example 1 is used as a control sample. The results are shown in the following table.

Example 20

Assembly of Plasmids pFK-1 and pFK-2 for Expression in E. coli of Polypeptides Having IgE-Binding Factor Activity

Plasmids that produce and secrete polypeptides associated with IgE binding factors in E. coli are constructed to delete the amino terminal region of Ala ₁₁₈ or Glu ₁₃₃ at position Met ₁ including the membrane fixture. 10 μg of pCL-2 plasmid-DNA is digested with restriction enzymes Hinc II and Rsa I. Fragments 1.6, 1.25, 0.72, 0.46 and 0.23 KB are obtained and separated by electrophoresis through 1% agarose gel in TBE buffer. As described in Example 13, 1.25 Kb DNA fraction is recovered. In parallel, 10 μg of plasmid pGEM _™ -1 is linearized with 20 units of Hinc II (Boehringer) in 10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl ₂ and 5 mM DTT at 50 μl pH 7.6. After 2 hours at 37 ° C., the reaction mixture is supplemented with 50 μl of 1M Tris-HCl at pH 8.5, 10 μl of H ₂ O and 20 units of alkaline phosphatase (Boehringer) obtained from the intestine of the calf and incubated at 37 ° C. for 30 minutes. The mixture is extracted three times with phenol-chloroform and then electrophoresed through a 1% agarose gel in TBE buffer. As described in Example 13, electrophoresis to recover plasmid DNA from the gel. 10 ng of 1.25 Kb cDNA fragment and 10 ng of pGEM ^™ -1 cleaved with Hinc II were ligated at 15 ° C. in a volume of 10 μl for 10 h. The reaction mixture contains 10 units of 10 mM MgCl ₂ , 2 mM DTT, 0.5 mM ATP and T ₄ -Boehringer in addition to 10 mM Tris-HCl at pH 7.5. 5 μl of the mixture is used to transform competent E. coli HB 101 cells, as described on page 250 of document (1). The bacteria are reached on agar plates supplemented with 100 μl / ml ampicillin. Obtain about 50 ampicillin resistant colonies. Twenty-four clones are propagated to separate plasmid DNA from each culture. Approximately 1 μg of plasmid DNA from each culture is digested with Hind II and analyzed for the length of the digested DNA fragment using Hind III digested lambda DNA (PharmaCla, Sweden) as size marker. The digested plasmid DNA of some clones provides DNA fragments of 0.5 kb and 3.6 kb and several other fragments of 0.7 kb and 3.4 kb corresponding to two possible orientations of fragment insertion. These plasmids were named pCAL-3 and pCAL-4, respectively (Figure 4). pCAL-3 grows one clone and one pCAL-4 clone to isolate the plasmid DNA using an alkali lysis method, as described on page 90 of Document (1). 10 μg of pCAL-4 plasmid DNA is digested with Hind III and 10 μg of pCAL-3 plasmid DNA is digested with BgIII and BamH I restriction enzymes. Electrophoresis separates fragments and electroelutes as described in Example 13 to recover 0.8 kb Bgl II to BamH I and 0.75 kb Hind III to Hind III fragments. In parallel, 10 μg of pIN-III-ompA-2 plasmid DNA (Gharayeb et al. (5)) and 10 μg of pIN-III-ompA-3 plasmid DNA are digested with Hind III and BamH I, respectively. These two plasmids are well known secretion cloning vectors in E. coli that allow cloning of foreign DNA fragments into two reading frames fused to sequences encoding the signal peptides of the ompA protein. The linearized plasmid is then treated with alkaline phosphatase obtained from the intestine of the calf and the linear DNA is purified on a 0.8% agarose gel as described above. 10 ng of pIN-III-ompA-2 digested with Hind III and 10 ng of Hind III to Hind III fragment (mixture 1) of 0.8 kb, and pIN-III- digested with BamH I with 0.7 ng of Bgl II to BamH I 10 ng Two binding mixtures containing ompA-3 (mixture 2) are fixed in a volume of 20 μl. The reaction mixture contains 10 units of 10 mM MgCl ₂ , 2 mM DTT, 0.1 mM ATD, and T ₄ ligase (Boehringer mannbein) in addition to 10 mM Tris-HCl at pH 7.5. After 12 hours at 15 ° C., 5 μl of the mixture is used to transform competent E. coli HB 101 cells as described on page 250 of document (1). 50 to 100 ampicillin resistant clones are obtained from mixture (1) and mixture (2). Twelve colonies from each mixture are grown and plasmid DNA is isolated from the culture. Approximately 1 μg of plasmid DNA from each culture is digested with Pst I and EcoR I (for mixture 1) and BamH I and EcoR I (for mixture 2). The length of the DNA fragments is analyzed on 1% agarose gel using Hind III digested lambda DNA (PharmaCla, Sweden) as size marker. Some plasmids derived from the mixture (1) yield 0.75 Kb fragments. These plasmids were named pFK-2. These contain DNA encoding amino acids Ala ₁₃₄ to Ser ₃₂₁ of the IgE-receptor fused to the ompA signal sequence. Similarly, some plasmids derived from mixture (2) also produce 0.8 kb fragments. These plasmids were named pFK-1. These contain DNA encoding amino acids Asp ₁₁₉ to Ser ₃₂₁ fused to the ompA signal sequence.

Example 21

Detection of polypeptides associated with IgE-binding factors in E. coli with plasmids pFK-1 and pFK-2

For control, competent E. coli BZ 234 and E. coli B1472 are transfected using 10 plasmids pFK-1, pFK-2 and 10 plasmids pIN-III- ompA-2. Competent cells are prepared and transfected as described on page 250 of document (1). At least 100 ampicillin resistant colonies are obtained from each of the transfected cells. One colony was transferred to 2 ml LB-broth supplemented with 100 μg / ml ampicillin and grown overnight at 37 ° C. Transfer 1 ml of culture to LB-broth supplemented with 100 μg / ml of ampicillin. Cells are grown while shaking vigorously at 37 ° C. (250 rpm). After 4, 7, 10 and 24 hours, 10 ml aliquots are removed. Aliquots are processed immediately. Cells are collected by centrifugation at 1000 g for 10 minutes at room temperature. Discard the supernatant and suspend the cells in 0.1 M xmfltm-HCl at 2.5 ml 20% sucrose, pH 8.0.

The mixture is left at room temperature for 20 minutes and centrifuged again to collect the cells. Discard the supernatant and suspend the cells in 1.5 ml of ice-cold water. The mixture is incubated on ice for 20 minutes and centrifuged at 4 ° C., 12000 g for 10 minutes. 5 μl of the supernatant is added to 100 μl of HBSS-FCS and these samples are analyzed as described in Example 7. PIN-III-ompA-2 is used as a control. the results are as follow.

The value is cpm per well measured by RIA as described in Example 7. The radiation input per well is 325000 cpm.

Example 22

Preparation of an Immunoaffinity Gel for Purifying IgE Binding Factor Protein

Affi-Gel ^R 10 material (Bio-Rad) is washed with cold distilled water and a coupling buffer of pH 8.0 (0.1 M NaHCO ₃ solution) according to the manufacturer's instructions. 50% gel suspension in 2 ml of coupling buffer is introduced into a plastic tube and mixed with a solution of the same volume containing Mab-135 or Mab-176 and the mixture is spun at room temperature for 4 hours. The gel is washed again with coupling buffer. To block the free active site, the gel is treated with 0.1 ml of 1 M ethanolamine-HCl at pH 8.0 at room temperature, washed with PBS containing 10 mM sodium azide and maintained at 4 ° C.

Example 23

Fermentation of Transformed Cells and IgE Binding Protein Isolation from Bacterial Culture

One colony of E. coli BZ 234 containing plasmid pFK-1 obtained from Example 20 was transferred to 10 ml LB-broth supplemented with ampicillin (100 μg / ml) and propagated with vigorous shaking at 37 ° C. overnight. Aliquots of 1 ml of culture are transferred to six flasks containing 800 ml of LB-broth, each supplemented with ampicillin (100 μg / ml). The cells are grown for 8 hours with vigorous shaking at 37 ° C. (250 rpm) and centrifuged at 1000 g for 10 minutes at room temperature to collect the cells. The supernatant is discarded and the cells are suspended in 300 ml of a solution containing 20% sucrose, 30 mM Tris-HCl and 1 mM EDTA at pH 8.0. The suspension is left at room temperature for 20 minutes and then centrifuged again to collect the cells. The supernatant is discarded and the cells are suspended in 200 ml of ice-cold water. The suspension is incubated for 20 minutes on ice and centrifuged at 10000 × g for 15 minutes at 4 ° C. with a rotor of a Sorbal centrifuge. The supernatant is carefully collected (about 180 ml) and supplemented with sodium azide (0,1 mg / ml) and filtered through a Nalgene ^R sterile filter unit (0.2 micron: Nalge Company, Rochester, NY, USA). The filtrate is loaded at a flow rate of 50 ml / hour on 2 ml of a column of Mab-135 or Mab-176 coupling Affi-Gel ^R 10 obtained as described in Example 22. The gel is washed successively with 20 volumes of PBS, 5 volumes of PBS and 0.9% NaCl 5 supplemented with 0.5% NaCl and 0.05% Tween 20. Absorbance is measured at 280 nm to screen protein content in the wash solution to completely remove unbound protein. The column is then eluted with 1 ml aliquots of a solution containing 0.1 M glycine-HCl, 0.1 M HCl, pH 2.6, respectively. The solution containing the protein is pooled and neutralized with 1M Tris.

Purified polypeptides of the present invention are treated with ISCO electrophoretic concentrator model 1750 (Isco Inco and Spectrapor ^R membrane (Spectrum Medical Industries) which blocks 3.5KD) to give a concentrate. The solution is 25 mM ammonium at pH 8.3. Dialysis against acetate and concentration to 0.2 ml volume Purified protein is analyzed as follows: Fractions are incubated with Laemmli buffer and then individual proteins using 12% SDS-PAGE. Were separated and silver stained according to the BioRad procedure, proteins with a molecular weight of about 25 KD were detected, these were electrophoresed for 4 hours with a delivery buffer at 0.12 ampere and transferred to nitrocellulose membranes.The membranes were tri-buffered saline containing 10% FCS. The strips are cut and reacted with Mab-135 and Mab-176 at 10 μg / ml respectively, after incubation for 6 hours, the strips are then washed. Reaction with high horseradish peroxidase chlorine anti-mouse IgE overnight The strips are washed and developed with 4-chloro-1-naprolol (peroxidase substrate) according to the BioRad procedure, respectively Mab-135 and Mab -176 monoclonal antibody reacts with 25KD protein fragment.

Example 24

Expression of a polypeptide having IgE-binding factor activity in E. coli under the control of promoter P _L of f.

24. 1

Construction of Expression Plasmids

As intermediate vector plasmid pHRi148 (European Patent Application EP146785) is used. 10 μg of the pHRi148 plasmid DNA was digested with NcoI and then blunted by treatment with Klenow polymerase and dNTP (50 μM). DNA is further digested with BamH I and treated with alkaline phosphatase. Agarose gel electrophoresis to separate 4.3 Kb vector DNA. In parallel, 10 μg of pCAL3 plasmid (Example 20) was digested with Bdl II and then treated with Klenow polymerase and dNTP (50 μM). DNA is further cleaved with BamH I and agarose gel electrophoresis to separate the 0.78 Kb insert DNA fragment. 10 ng of the purified vector and 3 ng of the purified insert DNA are combined to transform competent E. coli HB 101 cells using this mixture. Clones with correct recombinant plasmids are selected based on restriction enzyme analysis (Figure 5).

10 μg of the correct plasmid DNA is digested with BamH I and EcoR I. Agarose gel electrophoresis to separate 0.79 Kb insert DNA. In parallel, pPLc24 plasmid DNA [Remaut. E. et al., (1981), GENE , 81-93] 10 μg was digested with EcoR I and BamH I, then treated with alkaline phosphatase and subjected to agarose gel electrophoresis to purify the 2.9 Kb vector DNA. 10 ng of 2.9 Kb vector DNA and 3 ng of 0.79 Kb inserted DNA were linked and used to transform competent E. coli K12 cells. Standard restriction assays are performed to select the correct plasmid (pPL-BF Figure 5). This plasmid contains the DNA sequence of SEQ ID NO: II encoding the amino acids 119 to 321 of the polypeptide of SEQ ID NO: under the heat-induced P _L promoter. Methionine added during the intermediate cloning step at plasmid pHRi148 precedes amino acid 119.

E. with λCl857 using plasmid pPL-BF. E. coli strains W3110 and HB101 are transformed (Remaut et at., Supra). Transformants are grown on LB-plates containing kanamycin and 40 μg / mg of ampicillin and incubated at 30 ° C. for 24 hours. The resulting recombinant colonies are used to ferment.

24. 2

Fermentation

The recombinant E. coli strain obtained in Example 24. 1 was grown overnight at 30 ° C. in LB-broth containing 40 μg / ml of ampicillin and kanamycin. The culture is incubated for 4 hours at 42 ° C. with 1: 5 dilution with the same medium. Centrifuge to collect the cells.

24. 3

Purification of Polypeptides Having IgE-Binding Activity

Example 24. 22.5 ml of a cell suspension (OD ₆₅₀ = 20) in 50 mM Hepes at pH 8.0, 30 mM NaCl and 0.1% ethanolamine, prepared from the bacterial pellet of 2, are mixed with 18 g of urea. The suspension is sonicated for 3 x 30 seconds at 30 second intervals with a MSE Soniprep ^R 150 using a 9.5 mm probe and 24 micron amplitude. The lysate is clarified by centrifugation at 17000 rpm for 30 minutes at 20 "" with a Sorval SS34 rotor. The supernatant is dialyzed against 3 variants of 10 mM Hepes and 130 mM NaCl at pH 7.5 at 4 ° C. The dialysate is clarified by centrifugation at 17000 rpm at 4 ° C. with an SS34 rotor (Sorvall) to supplement the supernatant with sodium azide (0.1 mg / ml). Polypeptides having IgE-binding activity are further purified and assayed as described in Examples 22 and 23 above.

Example 25

Expression of Polypeptides with IgE-Binding Factor Activity in Yeast Saccharomyces cerevisiae

25. 1

Construction of Expression Plasmid pJDB 297R / PH0.5-BF (FIG. 6)

To prepare vector DNA, 10 μg of plasmid DNA pJDB 207R / PH0.5-TPA (12-2) (European Patent Application EP143081) is completely digested with BamH I. The digested DNA is treated with alkaline phosphatase. Large 6.85 Kb BamH I fragments are separated from the small fragments on a 1% agarose gel in TBE buffer and electrophoresed 6.85 Kb DNA fragments are recovered from the gel. DNA fragments encoding inducible PH0.5 promoter and PH0.5 signal sequence are derived from plasmid pJDB207 / PH0.5-TPA 18 (European Patent Application No. 143081). 50 μg of this plasmid was completely digested with BamH I and Hind III to separate 2.3 Kb fragments. 5 μg of the fragment is further digested with Bal I to separate the 0.58 Kb fragment. 20 ng of the above-described vector DNA, 4 mg of 0.58K fragment, 8 ng of 0.8 Kb Bgl II / BamH I cONA fragment derived from pCAL3 (Example 20) and hexane sequence 5 ′ pCCAATGCA-3 ′ / 3′GCTTACGTCTAGp-5 ′ 0.1 ng of chemically synthesized ds DNA linker is mixed and linked at 20 ° C. for 24 hours at 15 ° C. The linked DNA is used to transform competent E. coli HB101 cells. Ampicillin-resistant colonies Approximately 200 plasmid DNAs are analyzed by restriction enzyme digestion. Several colonies were found with all three insert DNA fragments in the desired orientation (plasmid pJDB207R / PH0.5-BF, FIG. 6). The exact construct of the construct at the junction between the PH0.5 signal sequence, chemical synthetic linker DNA and IgE-BF cDNA is demonstrated by sequencing.

25. 2

Transformation and Fermentation of Yeast

The plasmid pJDB207R / PH0.5-BF was subjected to the Saccharomyces cerevisiae strain using the transformation protocol described in Hinen et al. (Pro. Natl. Acad. SCl. USA 1978, 75, 1979). Transform with GRF18. Transformed yeast cells are selected on leucine deficient yeast minimal medium plates. Single transformed yeast colonies are isolated and referred to as Zaccaromyces cerevisiae GRF18 [pJDB207R / PH0.5-BF]. Transformed yeast cells were grown for 25 hours with shaking at 30 ° C in 5 ml of yeast minimal medium (Difco Yeast Nitrogen Base without amino acid) to which 2% glucose, 20 mg / l L-histidine and 10 g'l of L-asparagine were added. The density is × 10 ⁷ cells / ml. The cells were washed in 0.9% NaCl, then 0.03g / 1 KH ₂ PO ₄ , 1g / l KCl, (NH ₄ ) ₂ depending on the combination of Difco Yeast Nitogen Base medium (without amino acid). Inoculate 100 ml of low Pi minimal medium containing 10 g / l L-asparagine, 2% and 1 g / 1 L-hispidine instead of SO ₄ . The medium is inoculated with an OD ₆₀₀ of 0.25 at the start. Cells are grown at 30 ° C. for 48 hours and harvested at an OD ₆₀₀ of about 10.

35 ml of low Pi medium are collected by centrifugation and resuspended in 4 ml of a total volume of 0.1% (V / V) Triton X-l00 ^R and cooled 66 mM sodium phosphate buffer at pH 7.4. The cell suspension is transferred to a 30 ml Corex Dive. 8 g of glass beads (0.4 mm in diameter) are added and the suspension is shaken on a vortex mixer (Vortex Mixer, SClentific Instruments Inc., USA) at full speed for 4 minutes and then cooled in an ice bath. This process destroys more than 90% of the cells. Cell debris and glass beads are precipitated by centrifugation for 10 minutes at 8000 rpm with a Sorval HB 4 rotor. Using affinity chromatography as described in Examples 22 and 23, polypeptides having IgE-binding factor activity are purified from the supernatant.

Example 26

Assembly of Polypeptide Expression Plasmids pCAL5-R / ND and pCAL8-BF / ND for Cultured Mammalian Cells Having IgE-Binding Activity

The construction of the plasmids pCAL5-R / ND and pCAL8-BF / ND is described (see Figure 7). This plasmid allows the production of membrane-bound IgE receptors or secreted IgE-binding factors in cultured mammalian cells. In addition, these plasmids are designed for the selection of gene amplifications in host cells, thereby producing high yields of the desired polypeptides.

26. 1

Construction of Plasmid pCAL5

Plasmid pSV2911 neo [Asselbergs, F.A.M. et al., (1986) J. Mol. Biol, 189, 401-411] to prepare bet DNA. This was digested with restriction enzymes Hind III and Sal I to yield fragments of 3.9 and 1.8 Kb. The mixture is treated with alkaline phosphatase and electrophoresed through a 1% agarose gel before the 3.9 Kb fragment is separated.

In parallel, two DNA inserts are prepared that encode 3'-half of IgE receptor and rabbit beta-globin gene, respectively. On the one hand, 10 μg of plasmid pCAL3 (Example 20, FIG. 4) is partially digested with Hind III and completely digested with BamH I. Agarose gel electrophoresis and gel eluting separate the 1.26 Kb cDNA insert. On the one hand, plasmid pUβ [Weber, F. and Schaffner, w. (1985) Nature 315, 75-77] 10 μg are completely degraded with BamH I and Sal I. Separate 1.2 Kb DNA fragments. This fragment contains the poly (A) signal of the large intron and rabbit beta-globin genes.

10 ng of the vector DNA and 10 ng of each inserted DNA are combined. Competent E. using the generated DNA. E. coli HB 101 is transfected. Two insert the DNA inserts into the vector DNA and then select the reconstituted plasmid (pCAL 5, FIG. 7) exhibiting the restriction pattern as expected.

26. 2

Construction of Plasmid pCAL5-R / ND

10 ng of pCAL5 plasmid DNA is digested with Sal I. DNA molecules showing full length are cut only once and purified by agarose gel electrophoresis. In parallel, 10 μg of pND2 plasmid DNA (Asselbergs et at., Supra) is cut completely with Xho I and Sal I.

This plasmid contains two selectable markers, neomycin (neo) and polyhydrofolate reductase (dhfr), which allow the selection and import of foreign DNA, respectively, on the genome of a mammalian host. The cleaved pND2 DNA is treated with alkaline phosphatase, and then 10 ng of Sal I-cut pCAL5 and Sal I / Xho I-cut pND2 are joined by mixing 10 ng of plasmid DNA. The resulting DNA is used to transform competent E. coli HB101 cells. Transformed cells are distributed on agar plates containing LB-broth and 50 μg / ml kanamycin. Recombinant plasmids (pCAL5-R / ND, FIG. 7) that represent predicted DNA restriction patterns for expressing IgE-receptors in mammalian hosts are selected. This plasmid contains neo- and dhfr-selective labels at the bottom of the IgE-receptor cDNA. The direction of transcription is the same for all three genes.

26. 3

Construction of Plasmid pCAL8-BF / ND

Plasmid pCAL-BF / ND is a derivative of the plasmid pCAL5-R / ND described above, and the DNA sequence encoding amino acids 1 to 147 of the polypeptide of SEQ ID NO (I) is a signal of the influenza hemagglutinin of birds. It was replaced with a new DNA sequence encoding the sequence. This change enables the secretion of an IgE-binding factor consisting of amino acids 321 to 321 of the polypeptide of Formula (I). For this purpose, the sequence: 5'-pAGCTTACCATGGCTACCCAGATCTTGGTGTTCGCTCTGGTGGCCGTCATTCCTACAAACGCGCATGGTACCGATGGGTCTAGAACCACAAGCCAGCAGGCC Chemically synthesize DNA fragments. 0.2 ng of this DNA is linked to 10 ng of vector DNA and 2 ng of 0.7 Kb Dde I / Xba I cDNA insert. pCAL5 plasmid DNA is (a) completely digested with Xba I and Hind II and (b) dephosphorylated with alkaline phosphatase (c) 5.9K vector DNA is purified via agarose gel to obtain a vector. 0.7 Kb cDNA insert fragment is derived from pCAL3 (Example 20). 30 μg of pCAL3 plasmid DNA was digested with Hind III and Xba I and agarose gel purified to separate the 0.8 Kb cDNA insert. 3 μg of 0.8 Kb fragment was digested with Dde I to yield 0.1 and 0.7 Kb DNA fragments. Finally, agarose gel electrophoresis and purification to separate 0.7 Kb DNA fragments. Competent E. using linked DNA. E. coli HB101 cells are transformed. The DNA insert is introduced into the vector DNA and the recombinant plasmid (pCAL8: FIG. 7) that produces the predicted restriction fragment as expected is selected.

Example 27

Selection of Transgenic Mammalian Cell Lines Expressing Polypeptides Having IgE-Binding Activity

Methods for transfecting DNA into mammalian cells, screening for transformed cells and screening for gene amplification are described in US Pat. No. 4,399,216 (1983); Kaufman, RJ and Sharp, p. A. (1982). J. Mol. Biol. , 601-621, and are well known to those skilled in the art. Use as a host [cell line DUKX-Bl ^- dihydro folate reductase negative mutant (dhfr) of a Chinese hamster ovary cell line; Chasin. LA and Urlaub, G., (1980) Proc. Nai. Acad. SCl. USA 77, 4216-4220. Cells are maintained in MEM medium (Gibco, Paislay, Scotland) supplemented with 5% dialysis FCS and 0.1 mg / ml gentamycini (Gibco). Sub-adherent CHO cells are transfected with 10 μg of pCAL5-R / ND or pCAL8-BF / ND plasmid DNA using the Ca-phosphate coprecipitation method. Transfected cells are grown in alpha-MEM medium supplemented with 5% FCS, gentamycin and 0.5 mg / ml G4l8 (Gibco).

After two weeks, a single colony of G418-resistant cells develops. 48 colonies are each transferred to wells of 24-well microtiter plates and grown to coalesce in the sorting medium described above. Then, a certain amount of medium is removed and tested for the presence of IgE-binding activity with the RIA described in Example 7. About 50% of the colonies are positive, producing about 0.1-10 ng of recombinant polypeptide per ml. Transformed colonies derived from plasmid pCAL8-BF / ND are typically higher yield producers than those obtained by plasmid pCAL5-R / ND. Five highest yield colonies are genetically amplified using methotrexate (see Kaufman and Sharp, supra). After several amplifications, a cell line is obtained which yields 1 μg / ml of recombinant polypeptide. The highest yield cell line CHO-BF / ND is grown in large cultures. About 3 × 10 ⁶ cells are seeded per tissue culture flask (Falcon, 175 cm ² ) containing 50 ml of selection medium. After the cell layers adhere, the medium is removed and replaced with 50 ml of alpha-MEM medium supplemented with 1% FCS and 0.1 mg / ml gentamycin. Collect the medium twice a week for several weeks. Then, centrifuge at 5000xg for 10 minutes and store at -20 ° C. Finally, recombinant polypeptides with IgE-binding activity are purified from the mixed supernatants by affinity chromatography as described in Examples 22 and 23 above.

Purification and Sequencing of Native IgE-BF from RPMI 8866 Cells

IgE-BF-containing fractions of RDMI 8866 cell supernatants (EP 86810244.3) can be purified according to Examples B-D below to obtain IgE-BF that is pure enough to sequence the amino terminus.

Example A

Enzyme-bound-immuno-adsorption-assay (ELISA) of IgE-BF

Fractions are assayed for IgE-BF as follows. PVC microtiter plate wells are coated overnight in a wet chamber with Mab-176 (5 μg / ml in PBS; 100 μg per well) at room temperature. After washing the plate twice with PBS, the nonspecific binding site is blocked with PBS containing 0.2% gelatin (150 μl / well, 1 hour at 37 ° C.). Wash the plate again with PBS twice. Fractions from chromatographic experiments are added to the wells by diluting to 1/50 in PBS (100 μl / well) and incubated overnight in a humid chamber at room temperature. Plates are washed four times with PBS. Biotin-covalently bound Mab-135 (Example 19, EP 86810244.3) (0.5 μg / ml: 100 ml / well in PBS containing 0.2% gelatin) was added and incubated in a wet chamber at 37 ° C. for 4 hours to bind IgE. -Detect BF. After 4 washes of PBS, the plates are incubated for 2 hours at 37 ° C. with 100 μl of the combination of avidin and alkaline phosphatase (SigmaCat. No. A 2527 0.5 μg / ml) in PBS containing 0.2% gelatin. After further washing with PBS, sodium p-nitrophenyl phosphate in buffer to hold the plate (100 mg MgCl ₂ x6H ₂ O in 800 ml water, 200 mg NaN ₃ and 97 ml diethanolamine, pH adjusted to 9.8 with 37% HCl) Run at 1 mg / ml. After 20 to 40 minutes at 37 ° C., the yellow reaction becomes optimal. The reaction is then stopped with 50 μl of NaOH (1M) per well. Absorbance is measured at 405 nm using a model 2550EIA reader (Bio-Rad).

Example B

Purification of IgE-BF from Human B-Cell Supernatant by Immunoaffinity Chromatography

10 L of culture supernatant from RPMI 8866 cells is filtered through a 20 ml column of Mab-45-apigel (Example 10 of EP 86810244.3) at a flow rate of 120 ml / h. The gel is washed with PBS. To completely remove unbound proteins, absorbance is measured online at 280 nm using a Uvicord ^R spectrophotometer to monitor the protein content in the effluent. The column is eluted with 50 ml of 0.1 M glycine-HCl at pH 2.6. Fractions are collected in a tube containing the same amount of 1M Tris-HCl and 0.5% Tween 20 at pH 8.0. Fractions containing IgE-BF are collected and dialyzed against 10 mM Tris-HCl at pH 7.4.

Example C

Purification of IgE-BF by Ion Exchange Chromatography

The purified IgE-BF of Example B is loaded onto a SynChropak AX 300 anion exchanger column (Synchrom Inc., Linden, IN). The column is washed with 10 mM Tris-HCl at pH 7.4 and the protein is eluted for 100 minutes at a flow rate of 1 ml / min using a 0-1 M NaCl gradient. The eluate is monitored by UV absorbance measurement at 254 nm. Fractions are collected in 1% octylpyranoglucoside (Sigma) and assayed for IgE-BF as described in Example A.

Example D

Further purification of IgE-BF by reversed phase chromatography

50 ml of IgE-BF of Example C is dialyzed once against 0.5 L PBS and twice against 0.5 L PBS containing 0.1% octylpyranoglucoside. After lyophilization, IgE-BF is dissolved in 1.5 ml of water and dialyzed twice against 0.5 L PBS containing 0.1% octylpyranoglucoside. Reversed phase chromatography on a Sincropack RP-4 (Synchrom) column in 0.1% TFA (Pierce) and 5% acetonitrile (Merck). Elution was performed for 30 minutes at a flow rate of 0.5 ml / min using a 5-60% acetonitrile gradient in 0.1% TFA to obtain an IgE-BF eluate. The eluate is monitored by measuring UV absorbance at 254 nm. 1 ml fraction rate was collected in 0.05% SDS and assayed for ground IgE-BF as described in Example A. The purity of IgE-BF is controlled by SDS-PAGE followed by silver staining (Example 22 of EP 86810244.3).

Example E

Amino Acid Sequence Analysis of IgE-BF

Purified IgE-BF of Example D was prepared using MW Hunkapillar and LE Hood, Methods in Enzymology, using positive protein sequencer model 470 (Applied Biosystems). , 399. 1983] to N-terminal amino acid sequence analysis. Amino-thiozolinone derivatives were treated with 25% aqueous TFA at 50 ° C. to analyze PTH amino acids on phenylthio hydantoin (PTH) amino acids on a Zorus CN ^R -HPLC column (Dupont, 200 × 4.6 mm). . The following N-terminal amino acid sequence was found for 40% of the substance.

X ₁₄₉ , X ₁₅₅ , X ₁₅₀ and X ₁₅₃ represent undetermined amino acids. This sequence follows the sequence of the IgE-receptor determined by cDNA analysis and is initiated at amino acid 148 of this receptor.

For 60% of the substances, the following N-terminal amino acid sequence was identified.

X ₁₅₁ , X ₁₅₀ , and X ₁₆₃ represent undetermined amino acids. This sequence follows the sequence of the IgE-receptor determined by cDNA analysis and is initiated at amino acid 150 of this receptor.

Example 28

High Expression in E. coli of Polypeptides Having IgE-Binding Factor Activity

28. 1

Construction of Expression Plasmids

10 ng of purified 2.9 Kb vector DNA (plasmid pPLc 24 digested with EcoR I and BamH I) of Example 24.1 was added to 10 mM Tris-HCl, 10 mM MgCl ₂ , 2 mM DDT, 0.1 mM ATP and T ₄ DNA ligase at pH 7.5 ( Boehringer, Mannheim) 0.1 ng oligonucleotide 5'-pAATTTGGAGGAAAAAATTAATG (Pharmacia, No. 27-4878-01) in 20 μl solution containing 100 units of solution and oligonucleotide 5'-pGATCCATAATTTTTTCCTCCA (Pharmacia, No. 27-4898-01) 0.1 mix with ng. After 16 hours at 4 ° C., the mixtures were prepared using Comp. E. coli Kl2 cells are transformed. Individual colonies are grown to isolate plasmid DNA. Standard restriction analysis is performed to select the correct plasmid (pPL. PTIS, see FIG. 8) which is not cleaved by EcoR I but only by BaMH I. DNA sequencing confirms the correct insertion of oligonucleotides. The newly inserted DNA fragment encodes a removable translation initiation site (PTIS, Pharmacia).

pPL. 10 μg of PTIS plasmid DNA is digested with BamH I, then treated with alkaline phosphatase and subjected to agarose gel electrophoresis to purify the 2.9 Kb linear vector DNA. 10 ng of this vector DNA is linked with 3 ng of 0.8 Kb BglH to BamH I fragment derived from plasmid pCAL-3 (Example 20) and then used to transform competent E. coli Kl2 cells. Plasmid DNA was isolated from individual colonies and pPL with 0.8 Kb inserts in the correct orientation by standard restriction analysis. PTIS-BF plasmids are selected (Figure 8).

Plasmid pPL. PTIS-BF is used to transform E. coli strains W3110 and HB101 with λ1857 (Remaut et at., Supra). Transformants are plated on LB-plate medium containing 40 μg / ml of kanamycin and ampicillin and incubated at 30 ° C. for 24 hours. The resulting recombinant colonies are used for fermentation.

28. 2

Fermentation

Recombinant obtained in Example 28. 1. E. coli strains are grown as described in Example 24. 2. After 3 hours of induction at 42 ° C., the cultures are cooled for 30 minutes in an ice / water bath and then collected by centrifugation.

28. 3

Purification of Polypeptides Having IgE-Binding Activity

Cell pellets obtained from 1 L of heat-induced culture are resuspended in 20 ml of 50 mM Tris-HCl, 1 mM EDTA at 4 ° C. The cell suspension is sonicated at 1 minute intervals for 4 x 30 seconds with continuous cooling on ice (MSE Soniprep ^R 150, 9.5 mm probe, 24 micron amplitude). The suspension is then centrifuged for 10 minutes (Sorvall Centrifuge HB-4 rotor, 9000 rpm, 4 ° C). The pellet is resuspended in 20 ml of 50 mM Tris-HCl, 1 mM EDTA, at pH 7.5 and sonicated for 30 seconds as described above. The suspension is centrifuged as described above and washed twice more.

Figure 1 shows the construction of plasmids pCL-1 and pCL-2 containing ds-cDNA from mRNA isolated from RPMI 8866B-cells as an insert. Insertion cDNA encodes polypeptides associated with IgE-receptors and IgE-binding factors.

Figure 2 compares two inserts of plasmids pCL-1 and pCL-2, the same coding region in two inserts, the same non-coding region in two inserts, the coding region in pCL-2 only and in two inserts. Restriction sites are shown as well as different non-coding regions.

3 shows the construction of plasmid pGEM ^™ -1 / CL2 and the transcription of DNA inserts into mRNA from pCL-2 and pGEM ^™ -1.

4 shows plasmid pFK-1 having an insert encoding amino acid sequences Asp 119 to Ser 321 of SEQ ID NO (I) and pFK-2 encoding amino acid sequences of amino acids Ala 134 to Ser 321, starting from plasmid pCL-2. Figure showing the construction of.

5 shows the construction of plasmid pBL-BF for expressing IgE-BF in E. coli W3110 and HB101. The amino acids 119 to 321 are expressed under the P _L promoter of phage λ.

FIG. 6 depicts the construction of plasmid pJDB207R / PH0.5-BF for expressing IgE-BF in Saccharomyces cerevisiae. The amino acids 119 to 321 are expressed under the PH0.5 promoter.

Figure 7 depicts the construction of plasmids pCLA5-R / ND and pCAL8-BF / ND for expressing membrane-deficient IgE-receptors or secreted IgE-BF, respectively, in cultured mammalian cells (Chinese hamster ovary cells). It is also.

8 shows the construction of plasmid pPL.PTIS-BF for transforming and expressing IgE-BF in E. coli.

Sign and Symbol Description

Restriction enzymes: A = Hae II, B = BamH I, C = Hinc II, E = EcoR I, G = Bal III, H = Hind III, N = Nco I, P = Pst I, R = Rsa I

: Sequences encoding polypeptides associated with IgE-receptors and / or IgE-BF

: specific coding sequence for pCL-2 (FIG. 2)

: Different non-coding sequences in pCL-1 and pCL-2

: non-coding sequences identical in pCL-1 and pCL-2

(Second degree)

mRNA

Microbial deposit

E. coli HB 101 / pCL-2 containing the plasmid pCL-2 was published on June 30, 1986 by the institution Deutsche Sammlung f of Göttingen Griesba Hstrasse 8, Federal Republic of Germany. r Mikroorganismen was deposited with the accession number DSM 3807 and also with the Korean spawn association on January 26, 1988 with the accession number KFCC-10503.

Reference

Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory (1982)

2.Okayama and Berg, Molecular and Cellular Biology 161-170 (1982)

Heidecker and Messing, Nucleic Acids Research , 4891-4906 (1983)

4. SA Narang et al., Anal. Biochem. , 365 (1982)

5. KL Agarwal et at., Angew. Chem. , 489 (1972)

6. CB Reese, Tetrahedron , 3143 (1972)

6a. RL Letsinger et al., J. Am. Chem. Soc. , 3655 (1976)

7. Khorana et al., J. Biol. Chem. , 565 (1976)

SA Narang, Tetrahedron , 3 (1983)

Chang et at., Nature, 275: 615 (1978)

10.Goedell et at., Nature, 281: 544 (1979)

Goedell et al., Nucleic Acid Res., 8: 4057 (1980).

12.Siebenlist et al., Cell 20: 269 (1980).

13.J. Gharayeb et al., The EMBO Journal, Vol. 3, 2437-2442 (1984)

14. Stinchomb et at., Nature, 282: 39 (1979)

14a. Kingsman et al., Gene, 7: 141 (1979)

15.Tschemper et al., Gene, 10, 157 (1980)

16. Melton, D. A. et al. (1984) Nucleic Acids Research 12, 7035-7056

17. M. Sarfati et al., Immunology, 1984, , 197-205

18. J.B. Gurdon, The control of gene expression in animal development, Clarenton Press, Oxford. 1974

19. FC Greenwood et al., Biochem. J. , 114 (1963)

20. B. Seed, Nucleic Acids Res. 10, 1799-1810 (1982)

21. F. Sanger et al., Proc. Nat. Acad. Sci. USA , 5463-5467

Claims (19)

(1) starting from a polypeptide of Formula (I) or a fragment of a polypeptide of Formula (I) lacking amino acid sequences 106-127 or one of amino acids 119-160 To prepare DNA encoding a fragment of the polypeptide of SEQ ID NO. (I) terminated with one of amino acids 282 to 321, (2) inserting the obtained NDA into an appropriate vector, and (3) The appropriate host is transformed with the obtained hybrid vector, (4) the transformed host is selected from the untransformed host, optionally the hybrid vector is separated from the transformed host, and the coding or non-coding region of the hybrid vector is removed. And modified to perform steps (3) and (4) again to express the polypeptide or fragment thereof having the amino acid sequence of the above-described formula (I). Transfection process to produce a conversion in the host. DNA encoding the polypeptide of claim 1. The DNA of claim 2 having the following sequence formula (II). The DNA of claim 2 having the following sequence formula (III). The DNA of claim 2 encoding a polypeptide having amino acid sequences D ₁₁₉ to S ₃₂₁ of Formula (I). The DNA of claim 2 encoding a polypeptide having amino acid sequences A ₁₃₄ to S ₃₂₁ of Formula (I). The DNA of claim 2 encoding a polypeptide having amino acid sequences L ₁₄₈ to S ₃₂₁ of Formula (I). The DNA of claim 2 encoding a polypeptide having amino acid sequences M ₁₅₀ to S ₃₂₁ of Formula (I). A polypeptide of SEQ ID NO: 1, or a fragment of a polypeptide of SEQ ID NO: 106, wherein the amino acid sequence of Nos. 106 to 127 is deleted, or one of amino acids of Nos. 119 to 160. A hybrid vector pCL-2 containing as DNA insert a DNA sequence encoding a fragment of the polypeptide of Formula (I) starting with and terminating with one of amino acids 282 to 321; 10. The hybrid vector pCL-2 according to claim 9, which contains, as an insert, a DNA sequence encoding a fragment of the polypeptide of SEQ ID NO: l, wherein amino acid sequences 106-127 are deleted. 10. The DNA sequence of claim 9 encoding a fragment of the polypeptide of SEQ ID NO: selected from the group consisting of a polypeptide starting from one amino acid of amino acids 120 to 160 and terminated with amino acid 321. Hybrid vector pCL-2 containing as insert. 10. A polypeptide of formula (I) according to claim 9 selected from the group consisting of a polypeptide starting from one amino acid of amino acids 120 to 160 and ending with one amino acid of amino acids 282 to 321; Hybrid vector pCL-2 containing a DNA sequence encoding a fragment of DNA as an insert. The hybrid vector pCL-2 according to claim 9, which contains, as an insert, a DNA sequence encoding a fragment of the polypeptide of SEQ ID NO: I consisting of amino acid sequences of amino acids 119 to 321. The hybrid vector pCL-2 according to claim 9, which contains, as an insert, a DNA sequence encoding a fragment of a polypeptide of SEQ ID NO: I consisting of amino acid sequences of amino acids 134-321. The hybrid vector pCL-2 according to claim 9, which contains, as an insert, a DNA sequence encoding a fragment of a polypeptide of SEQ ID NO: I consisting of amino acid sequences of amino acids 148-321. The hybrid vector pCL-2 according to claim 9, which contains, as an insert, a DNA sequence encoding a fragment of a polypeptide of SEQ ID NO: I consisting of amino acid sequences of amino acids 150-321. 10. The hybrid vector pCL-2 according to claim 9, which contains a DNA sequence of SEQ ID NO (II) or (III). Escherichia coli host transformed with the hybrid vector pCL-2 according to any one of claims 9 to 17. 19. The Escherichia coli HB101, Escherichia coli BZ234. Escherichia coli host selected from Escherichia coli B1472 and W3110.