JPS63157997A - Novel lymphokine related peptide - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention relates to a polypeptide related to human macrophage migration inhibitory factor, a method for producing the polypeptide, mRNA, DNA and hybrid vector encoding the polypeptide, and a method for producing the polypeptide. The present invention relates to hosts transformed with such hybrid vectors, monoclonal and polyclonal antibodies against the polypeptides, and methods for diagnosing inflammatory conditions and capsular fibrosis.

[Background of the invention]

Human macrophage migration inhibitory factor (MIF) is an antigen,
It belongs to the so-called lymphokine group, which includes biologically active soluble polypeptides secreted by lymphocytes and monocytes or macrophages when stimulated by mitogens and the like. Other examples of lymphokines are immune interferon (γ-interferon), interleukins 1 and 2.
, as well as macrophage activating factor (MAF).

These lymphokines regulate the differentiation, activation and proliferation of various cell types of the immune system.

According to known technology, human MIF consists of a group of polypeptides that inhibit the migratory ability of macrophages. Human M
IF is secreted not only by activated lymphocytes, T-cells and B-cells, but also by non-lymphoid cells, such as fibroblasts and some tumor cells. M.I.F.
is T-interferon, macrophage activating factor (
MAF) and other lymphokines.

H) MIF plays a decisive role in the early stages of inflammatory reactions (“delayed hypersensitivity reactions”). It induces the maturation of monocytes and resting tissue macrophages and differentiation into inflammatory macrophages. Therefore, human MIF and related proteins are important indicators of inflammatory conditions and are useful in the treatment of immunomodulatory and chronic inflammatory diseases.

The isolation and purification of MIF protein with a molecular weight of 8 kD from human mononuclear cells stimulated with concanavalin A is described in European patent application EP 162,812. This protein is characterized by its N-terminal amino acid sequence (I6 amino acid) and its macrophage migration-inhibiting activity, as well as its immunoreactivity with selected monoclonal antibodies. Other MIs of 14kD, 28kD and 45kD
The F protein has been described but is poorly characterized. The 14 kD MIF protein was found to have the same N-terminal amino acid sequence (amino acids 2-19) as the 8 kDMIF protein.

According to EP 162,812, human MIF and its proteins are obtained from the culture supernatant or filtrate of stimulated human cells. Because of the problems inherent in culturing suitable human cells, the limited availability of fresh human MIF-producing cells, and the tedious isolation of single proteins, this method
Limiting the availability of F.

Rapid advances in recombinant DNA technology in recent years provide a general method for producing large quantities of polypeptides independent of the primary natural source of such compounds. Identification of the mRNA or DNA encoding the desired polypeptide is essential to the success of this approach. If partial amino acid sequence information is available, chemically synthesized nucleic acid probes can be used to encode a single piece of mRNA or DNA, respectively, from a mixture of mRNAs or a DNA library from cells that produce the desired polypeptide. It will lead to separation.

To date, many examples have been known for the isolation of mRNA or DNA encoding desired polypeptides.
And although the general method has been described in principle, each new and specific problem requires adaptation of the technique to the particular case.

Once we have the genomic or complementary DNA encoding the desired polypeptide, we proceed with the preparation of appropriate expression vectors, transformation of hosts with these vectors, fermentation of the transformed host, and production of the expressed polypeptide. Isolation follows standard methods.

Again, in order to obtain stable introduction of DNA, sufficiently high expression of the desired polypeptide in the selected host organism, and acceptable yield of pure, biologically active, isolated protein. However, the methods described above must also be adapted to specific problems.

Additionally, recombinant DNA techniques produce polypeptide variants by mutating or altering the coding DNA that is introduced into a host organism, thereby reducing the potential for active ingredient naturally found in a single polypeptide structure. This makes it possible to expand the range of applications.

Capsular fibrosis (c) isolated from chronic myeloid leukemia cells
Recent publications on the ystic fibrosis antigen (CF antigen) (J, R. Dorin et al., Natur.
e 1987, 614) suggest that this CF antigen is identical to, or closely related to, the MIF-related protein MRP-8 of the present invention. However, this invention
tic fibro-sis).

At the same time, a reliable diagnostic method for capsular fibrosis is described by this invention based on the immunological determination of another MIF-related protein, MRP-14.

OBJECTS OF THE INVENTION One object of the present invention is to provide highly pure and sufficient amounts of human macrophage migration inhibitory factor (MIF)-related polypeptides and methods for producing them. recombinant DNA
The technique can solve problems in industrial polypeptide synthesis. Therefore, another object of this invention is to obtain a DNA5M1. The object of the present invention is to provide DNA encoding an F-related polypeptide, a hybrid vector, and a host transformed with the vector. Other objects are said hybrid vectors, transformed hosts, methods for the production of RNA and DNA molecules, as well as medicaments containing an effective amount of MIF-related polypeptides and methods for their production, and uses of said polypeptides. .

Monoclonal and polyclonal antibodies directed against MIF-related polypeptides, hybridoma cell lines producing such monoclonal antibodies, methods for producing the antibodies and hybridoma cell lines, and uses of these antibodies are other objects of this invention. It is. A particular objective is a reliable method for diagnosing inflammatory conditions and capsular fibrosis.

These objectives have been achieved by the present invention.

[Description of the invention]

This invention provides human macrophage migration inhibitory factor-related peptide (MRP) with an apparent molecular weight of about 8 kD or about 14 kD.
, and variants, fragments and derivatives thereof.

The invention particularly relates to the following formula (I): Z, -Leu-Thr-Glu-Leu-Glu-Ly
s-Ala-Leu-Asn-3er-11e-11e
-Asp-Val-Tyr-His-Lys-Tyr-
3er-Leu-11e-Lys-Gly-Asn-P
he-His-8la-Val-Tyr-Arg-As
p-Asp-Leu-Lys-Lys-Leu-Leu
-Glu-Thr-Glu-Cys-Pro-Gln-
Tyr-11e-Arg-Lys-Lys-Gly-A
la-Asp-Val-Trp-Phe-Lys-Gl
u-Leu-Asp-11e-8sn-Thr-Asp
-Gly-Ala-Val-Asn-Phe-Gln-
Glu-Phe-Leu-11e-Leu-Va141
e-Lys-Met-Gly-Val-Ala-Ala
-Old 5-Lys-Lys-3er-Old 5-Glu-Gl
Human macrophage migration inhibitory factor-related peptide (MRP-8) represented by u-5er-formerly 5-Lys-Glu (I) (wherein ZI is hydrogen, acyl or amino acid residue methionine) and variants thereof , fragments and derivatives; and the following formula (■): Asn-11e-Glu-Thr-11e-11e-85n-Thr-Phe-His-Gln-Tyr-Se
r-Val-Lys-Leu-Gly-■s-Pro-
Asp-Thr-Leu-Asn-Gln-Gly-G
lu-Phe-Lys-Glu-Leu-Val-Ar
g-Lys-Asp-Leu-Gin-8sn-Phe
-Leu-Lys-Lys-Glu-Asn-Lys-
Asn-Glu-Lys-Val-11e-Glu-H
is-11e-Met-Glu-5p-Leu-^5
p-Thr-8sn-^1a-Asp-Lys-Gln
-Leu-5er-Phe-Glu-Glu-Phe-
I le-,.

Met-Leu-Met-Ala-Arg-Leu-T
hr-Trp-^1a-3er-Pro-Gly-Hi
s-His4is-Lys-Pro-Gly-Leu-
Gly-Glu-Gly-Thr-Pr.

(II) Human macrophage migration inhibitory factor-related peptide [MRP- 14) and variants, fragments and derivatives thereof.

Acyl ZI or Z2 is an acyl group of a natural organic or inorganic acid, such as formic acid, an alkanecarboxylic acid such as acetic acid, propionic acid, valmitic acid or myristic acid, or phosphoric acid or sulfuric acid, preferably acetic acid.

Peptide Z2 consists of 1, 2, 3, 4 or 5 natural amino acids and is e.g. Met-1Thr-C
ys-Lys-Met-1 or Met-Thr-Cys
-Lys-Met-. Such peptide residues are N
- an acyl group in the terminal amino group, such as Zl or Z2
may be substituted by an acyl group defined as acyl, e.g. acetyl, and e.g. acetyl-T
hr-Cys-Lys-Met-.

Variants of the invention are characterized in that one or more, in particular 1, 2 or 3 single amino acids of the metal compound of formula (I) or (II) are replaced by different amino acids or by a combination. It is a polypeptide.

Such variants may be formed by naturally or chemically induced mutations at the DNA level or by substitution of amino acids by chemical synthesis.

Fragments of this invention are fragments of compounds of formula (I) or (II) comprising 20 or more consecutive amino acids. Fragments of the invention can be produced by natural or chemically induced mutations at the DNA level that change amino acid-encoding triplets into stop codons, or by chemically or enzymatically cleaving peptide bonds at the peptide level. It can be formed by

Derivatives of polypeptides of formula (I) or (ff), or variants or fragments thereof, may for example be derivatized, e.g. glycosylated, acylated, amidated or It is esterified. In glycosylated derivatives, carbohydrate residues or oligosaccharides are linked to asparagine, serine and/or threonine. Acylated derivatives are substituted with natural organic or inorganic acids, such as acetic acid, phosphoric acid or sulfuric acid, at the amino group, especially at the N-terminal amino group, or at the hydroxy group, especially the hydroxy group of tyrosine or serine. Esters are esters of natural alcohols, such as methanol or ethanol.

Derivatives of the present invention also include dimers, variants or fragments of the compound of formula (I) or of the compound of formula (II), in which the mercapto group of the cysteine residue is oxidized in the disulfide form and the molecule and mixed dimers of a compound of formula (I) or a variant or fragment thereof with a compound of formula (II) or a variant or fragment thereof, It is bonded via the oxidized mercapto group of cysteine residue.

Other derivatives include salts, especially pharmaceutically acceptable salts, such as metal salts, such as alkali metal salts and alkaline earth metal salts, such as sodium salts, potassium salts, magnesium salts,
calcium or zinc salts, or ammonia or suitable organic amines, such as lower alkyl amines, such as triethylamine, hydroxy-lower alkyl amines,
For example, it is a salt with 2-hydroxyethylamine.

Preferred is the compound MRP-8 of formula (I) in which Z is Met, ie the amino acid residue methionine. The effective molecular weight of this polypeptide
-Iar weight) is 10.8 kD, but on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGt) this polypeptide migrates as an 8 kD peptide when compared to standard marker proteins.

Further preferred is the compound MRP-14 of formula (II) in which Z2 is Thr-Cys-Lys-Met- or hydrogen. The latter compound is also called MRP-14d. The effective molecular weights of these polypeptides are 13.1 kD and 12.6 kD, respectively, but they migrate as 14 kD peptides on 5O3-PAGE when compared to standard marker proteins.

Preferred derivatives are MR of formula (I) where Zl is Met
Dimer of P-8, Z2 is Thr-Cys-Lys-M
dimer of MRP-14 of formula (II) where et-, and MRP-8 of formula (II) where Zl is Met and Z2 is Th
MR of formula (II) which is r-Cys-Lys-Met-
It is a mixed dimer with P-14, and both are bonded via the oxidized mercapto group of the cysteine residue.

The invention further relates to a method for producing human macrophage migration inhibitory factor-related peptides and variants and derivatives thereof, which method comprises preparing a solution containing the compound of interest, e.g., stimulated normal human leukocytes or genetically engineered microorganisms or permanent microorganisms. pre-purified extracts of mammalian cell lines;
It is characterized in that the cell supernatant or culture filtrate is purified by chromatographic methods and the compound is isolated and optionally fragments or derivatives prepared therefrom.

Prepurified extracts, cell supernatants and culture filtrates of stimulated normal human leukocytes containing compounds of formula (II) or derivatives thereof are prepared as described in EP 162,812. In particular, suitable additives, such as concanavalin A, are added to ensure that normal human mononuclear cotton follicles produce macrophage migration inhibitory factor (MIF) and other lymphokines.
or stimulated with phytohemagglutinin and cultured according to conventional methods. The extract, cell supernatant or culture filtrate is then prepurified by immunoaffinity chromatography on a column loaded with an antibody specific for human MIF, such as the monoclonal antibody IC5.

Extracts, cell supernatants, and culture filtrates of genetically engineered microorganisms or permanent mammalian cell lines containing human macrophage migration inhibitory factor-related peptides are obtained and prepurified as discussed below.

Chromatographic methods expected for the preparation of target compounds include ion exchange chromatography, reversed phase high performance liquid chromatography, gel filtration, affinity chromatography, chromatography on hydroxyapatite, hydrophobic interaction chromatography, etc. .

Suitable carrier materials for ion exchange chromatography can be of organic or inorganic origin, for example cross-linked agarose, dextran, polyacrylamide,
It can be based on styrene/divinylbenzene copolymer, cellulose, and the like. The carrier material carries basic functional groups, such as tertiary amino functions, quaternary ammonium groups, or acid functions, such as carboxylic acid groups or sulfate groups. Examples of preferred ion exchangers include those carrying diethylaminoethyloxypropyl-ammonioethyl functional groups, and those carrying sulfopropyl (SP) or carboxymethyl (CM) functional groups, where the functional groups are usually liquid chromatography, fast protein (
fast protein) liquid chromatography (
PPLC) or high performance liquid chromatography (HPLC)
) are added to the carrier in a suitable manner. Separation and purification by ion exchange chromatography follows established methods, e.g. increasing amounts of salt,
For example, it can be carried out in an aqueous buffer solution containing sodium chloride and having a pH of pl+5 to 9.

Suitable carrier materials for gel filtration or size exclusion chromatography include cross-linked dextran, agarose,
Including appropriately modified polyacrylamide or silica. Optionally these carriers are modified by substituents carrying hydroxy functions, for example 1-hydroxy or 1,2-dihydroxy-lower alkyl groups. Chromatographic materials range from 5,000 to 20,000
0 daltons (5 kD to 20 KD) to provide optimal separation of peptides in the molecular weight range. Such gel filtration or size exclusion chromatography is similar to the conventional liquid chromatography described above using approximately neutral aqueous buffers containing varying amounts of salts, e.g. sodium chloride.
It can be carried out in a column suitable for FPLC or ffPLc.

Reversed phase chromatography uses hydrophobic groups, e.g.
alkyl groups having 4, 8, 12 or 18 carbon atoms, preferably 4, 8, 12 or 18 carbon atoms, or respectively 1 and 8 carbon atoms;
or on a silica carrier carrying a mixture of alkyl groups having 2 and 18 carbon atoms, or phenyl groups.

Associated with this method is hydrophobic interaction chromatography, in which agarose or related materials coated with alkyl and/or phenyl groups of up to 12 carbon atoms are used. These chromatographic methods are FPLC or l(PL
It is applied using C. Solvents for the treatment of polypeptides of the invention on siliceous reverse phase materials include, for example, increasing amounts of polar water-miscible organic solvents, such as acetonitrile,
Lower alcohols such as methanol, ethanol or propatool, tetrahydrofuran, etc., preferably aqueous acids containing acetonitrile, such as aqueous trifluoroacetic acid.

Affinity chromatography can also be used to describe molecules having high affinity for the compounds of formula (I), as well as variants, fragments and derivatives thereof, such as antibodies, in particular those described below that are specific for the peptides of this invention. Suitable carrier materials carrying polyclonal and monoclonal antibodies, such as cross-linked agarose, dextran or polyacrylamide, are expected to be used to purify the peptides of the invention.

Preferred chromatographic methods are ion exchange chromatography using carriers carrying sulfopropyl groups, and reverse phase high performance liquid chromatography (HPLC).

The compounds of this invention are isolated by conventional techniques such as filtration or ultrafiltration, dialysis, dissolution and precipitation in a mixture of solvents with appropriate salts and/or buffers, evaporation of the solvent, lyophilization, etc. .

Fragments of MIF-related peptides are prepared, for example, by treatment with proteases. For example, papain, trypsin, α-chymotrypsin, thermolysin, pepsin, subtilisin, endoproteinase L from Lysobacter enthymokenes (mu pterygium frog)
ys-C, Staphylococcus aureus (Sta
h lococcus aureus) or related proteases of formula (I) or (I
T) and the resulting mixture of fragments is subjected to chromatographic methods such as gel filtration and/or reverse phase H
Separate by PLC.

Dimers of compounds of formula (I) or (II) containing Cys residues are obtained, for example, by mild oxidation with air, oxygen, iodine, dimethyl sulfoxide and HCII or HBr, or other chemical oxidizing agents.

Conjugates of compounds of formula (I) and compounds of formula (II) are prepared by similar oxidation of appropriate mixtures.

In particular, compounds of formula (I) or (II), and variants, fragments and derivatives thereof, can be prepared by recombinant DNA techniques, e.g.
Produced by culturing a transformed host expressing a peptide of formula (I) or (II) or a variant or derivative thereof under conditions that permit expression of the heterologous protein, and isolating the compound of interest. be able to. More specifically, a) human cell cDNA or genomic DNA;
isolating a DNA encoding a compound of formula (I) or (II) or a fragment thereof from a library and optionally mutating it, or chemically synthesizing such DNA; b) C) transferring the resulting hybrid vector to a recipient host; d) transforming an untransformed host, e.g., by culturing under conditions in which only the transformed host survives; e) culturing the transformed host under conditions that permit expression of the heterologous polypeptide; and f) selecting a compound of 2) or (II) or a variant, fragment or derivative thereof; and, if desired, convert the obtained compound of formula (II) or (II), or a variant or fragment thereof, into a derivative; thereby producing the target compound.

The steps involved in the preparation of these peptides by recombinant DNA techniques are discussed in more detail later.

Furthermore, compounds of formula (I) or (II), and variants and especially fragments thereof, can be prepared by chemical methods, especially M, Bo
danszky +, Pr1nciples of P
eptideSynthesis % Spring
It can be synthesized by the condensation reaction described in r-Verlag 1984.

Fragments are synthesized, for example, by solid-phase methods, in which an N-protected amino acid is coupled to a suitable resin, the protecting group is removed, a second N-protected amino acid is condensed with the amino group of the first amino acid, and The deprotection/condensation cycle with the next N-protected amino acid is repeated until the desired composition of peptide residues is completed, and finally the peptide residues are cleaved from the resin and deprotected. Suitable resins, protecting groups, condensing agents, and reaction conditions are known in the art.

The invention also provides for DNA encoding compounds of formula (I) or (old), or variants thereof, such as those having one or more, especially 1, 2, 3 or 4 nucleotide mutations. Concerning DNA and fragments of these DNAs comprising at least 15 nucleotides.
A is understood to be isolated or double-stranded.

In particular, this invention provides the following formula (■): Y, -Y -Y -Y -Y -Y -Y -Y -Y
-'l -Y -Y -Y -Y -Y -'l
-Y -Y -Y -'l -Y -Y
-Y -Y -Y -Y -Y -Y
DNA encoding MRP-8 represented by - and DNA encoding MRP-14 represented by the following formula (■): flanking l1ylA sequence; Y2 is yM y
T vt, yK or absent; Y, l are flanking DNA sequences of one or more nucleotides or absent; YA encodes alanine (A or Ala), and G
CT, GCC, GC8 or GCG; YC encodes cysteine (C or Cys) and is TGT or TGC; YD encodes aspartic acid (D or Asp) and is GAT or GAC; YE codes for glutamic acid (E or Glu) and is GAA or GAG; Y' codes for phenylalanine (F or Phe);
and TTT or TTC; YG codes for glycine (G or Gly) and G
GT, GGC, GGA or GGG; YH codes for histidine (H or old S) and CAT or C
AC; Yl encodes isoleucine (I or l1e) and is ATT, ATC or 8T^; yK encodes lysine (K or Lys) and AAA or AAG
and yL codes for leucine (L or Leu), and T
TA, TTG, CTT, CTC, CT8 or CT
G; yM encodes methionine (M or Met) and is TG; yN encodes asparagine (N or Asn) and is AAT or AAC; yP is proline (P or Pro) and C
CT, CCC, CCA or CCG; yQ codes for glutamine (Q or Gln) and is CAA or CAG; yR codes for arginine (R or Arg) and CGT, CGC, CGA, CGG, AG^ or 8GG; yS codes for serine (S or 5et), and TCT, TCC, TGA, TCG, A
GT or AGC; YT is threonine (T or Th
r), and ACT, 8CC, AC8 or ^
CG; yV codes for valine (V or Val) and is GTT, GTC, GTA or GTG;
Y′″ codes for tryptophan (W or Trp),
and TGG; YY codes for tyrosine (Y or Tyr) and T
AT or TAC; and Y” is the stop codon TAA, TAG or TGA]
, a double-stranded DNA consisting of a DNA of formula (III) or (IV) and a DNA complementary thereto (here, adenine (A) is bonded to thymine (T), and vice versa) , guanine (G) is combined with cytosine (C) and vice versa), this complementary DNA itself has one or more introns, in particular one or two introns, of the formula (II[) or (
IV) genomic DNA which interrupts the DNA of Regarding these DNA fragments consisting of.

In particular, this invention provides DNA encoding MRP-8 represented by the following formula (■): (V), and the following formula (■): MSQLERNIETIII TAA-Y.

(VI) DNA encoding MRP-14 represented by
Y, are flanking DNA residues of 12 or more nucleotides containing the promoter sequence, and Y2 is ATGAC
TTGCAAA or absent, and Y3 is one or more nucleotide flanking DNA residues,
), a double-stranded DNA consisting of the DNA of formula (V) or (VI) and a complementary DNA thereto, the complementary DNA itself,
Genomic DNA in which the DNA of formula (V) or (VI) is interrupted by one or more introns, especially one or two introns
, variants of these DNAs in which one or more, in particular 1, 2, 3 or 4 nucleotides have been mutated, or fragments of these DNAs comprising at least 15 nucleotides.

The invention also relates to DNA that hybridizes with DNA of formula (V) or (VI) or with DNA complementary to DNA of formula (V) or (VI).

An example of the DNA of the present invention having the formula (V) encoding MRP-8 is, for example, the following formula (■): (■)
It is DNA.

Other specific cDNAs derived from human mononuclear leukocyte mRNA are nucleotides 1 to 123 in YIC formula (■)]
have different meanings. Y, for example ^^GTCTGTGG
GCATC-.

ATGTCTCTTGTCAGCTGTCTTTCAG
AAGACCTGGTGGGGCAAGTTCCGTG
GGCATC-, TTGTCTCTTGTCAGCTG
TCTTTCAG -AAGA(:CTG8899TT
CTGTTTTTCAGGTGGGCAAGTTCC
GTGGGCATC-1 or nucleotide 1 of formula (■)
08-123 or 86-123, with a T inserted between nucleotides 112 and 113.

Other examples of DNA of formula (V) encoding MRP-8 are:
isolated from human placenta and between amino acids 47 and 48 [between nucleotides 141 and 142 of formula (V)]
contains an intron of 150 nucleotides and has the following formula (■
) is the genomic DNA represented by

D of this invention of formula (“II) encoding MRP-14
An example of NA is cDNA derived from human mononuclear leukocyte mRNA, represented by the following formula (■): (IX)
It is A.

Other examples of DNA of formula (VI) encoding MRP-14 are isolated from human placenta or fetal liver cells and between amino acids 50 and 51 [nucleotide 138 of formula (VI)].
and 139], the following formula (X
) is the genomic DNA represented by

In addition, the present invention also provides RNA encoding compounds of formula (I) or (II), variants thereof, e.g. RNAs in which one or more nucleotides have been mutated, and fragments of such RNAs, In particular, Y has the meaning given above, provided that D
RNA of formula (V) or (VI) in which there is RNA instead of NA and therefore uridine (II) instead of deoxythymidine (T), especially the formula (■ ) or (IX).

A DNA encoding a compound of formula (I) or (II) or a variant thereof, and a fragment or variant thereof, can be obtained, for example, by culturing a transformed host and producing the desired D
It can be produced by isolating NA or chemically synthesized by nucleotide condensation.

In particular, such DNA can be obtained by: a) isolating mRNA from human mononuclear leukocytes, selecting the mRNA of interest, for example, by hybridization using a DNA probe, and preparing isolated DNA complementary to the mRNA; Then double stranded DNA (d
s cDNA); or b) isolating genomic DNA from human cells, such as placenta or fetal liver cells, and selecting the DNA of interest using a DNA probe; and C) preparing the cDNA of step a) or step b. ) into a suitable expression vector; d) transforming a suitable host with this desired hybrid vector; e) containing a DNA encoding formula (I) or (II) or a variant or fragment thereof; It can be produced by: selecting a transformed host containing no coding DNA; and f) isolating the target DNA.

Polyadenylated mensenger RNA is isolated from human mononuclear leukocytes by known methods. Leukocytes can be derived from fresh human blood, for example from a buffy coat of leukocytes, or from established continuous cell lines of leukocytes that can be expanded in culture. Isolation methods include homogenizing stimulated leukocytes in the presence of oils and ribonuclease inhibitors such as heparin, guanidinium isothiocyanate and mercaptoethanol, optionally with salts and buffers, detergents and/or cation chelators. The mRNA is extracted with a suitable loloform-phenol mixture in the presence of ethanol, and Menger RNA is precipitated from the remaining aqueous salt-containing phase with ethanol, isopropanol, or the like. isolated mR
The NA is centrifuged in a cesium chloride gradient and then subjected to ethanol precipitation and/or chromatography, e.g. affinity chromatography, e.g.
Further purification can be achieved by chromatography on dT) cellulose or oligo(II) Sepharose. Preferably, the mR thus purified
The NA is fractionated according to size, eg, by gradient centrifugation, such as on a sucrose linear gradient, or on a suitable size fractionation column, eg, an agarose gel.

The mRNA of interest is selected by screening using DNA probes or by translation in an appropriate cell or cell-free system and screening of the resulting polypeptide.

The fractionated mRNA can be translated in cells, such as frog oocytes, or in cell-free systems, such as reticulocyte lysates or wheat germ extracts.

The resulting polypeptides are tested for macrophage migration-inhibiting activity or for natural macrophage migration-inhibiting factor (MI
The reaction with antibodies raised against F) is screened, for example, in an immunoassay, such as a radioimmunoassay, an enzyme immunoassay or an immunoassay using fluorescent markers. Such immunoassays and the preparation of monoclonal and polyclonal antibodies are well known in the art and are therefore applicable. Monoclonal antibodies against MIF and immunoassays using these are described, for example, in Corosopa patent application EP 162,812.

Selection of the desired mRNA is preferably achieved using DNA hybridization probes, thereby avoiding additional steps of translation. Such hybridization probes can be fully synthetic DNA consisting of at least 17 nucleotides, or DNA or DNA fragments of natural origin or isolated from genetically engineered microorganisms.

Synthetic DNA probes are derived from human MI isolated from natural sources.
It can be constructed based on a partial amino acid sequence of F protein, for example human MTF8kD as described in EP 162,812, or a human MTF-related protein having a molecular weight of about 14 kD. A mixture of oligonucleotides preferably consisting of 17 or more nucleotides is prepared, where each member of the mixture is one fragment defined by 6 or more consecutive triplet codons Y of formula (III) or (IV). is complementary to Such DNA probes are also included in this invention.

An example of the DNA probe of this invention is MRP-
Amino acids 14-19 of 8 corresponding formula YD yV-Y
Y-YH-YK-TA and 2〇) MRP-8 amino acid 52-57 corresponding formula Ylll-Yv-Y'''-
17-me complementary to the Y'-YK-GA DNA fragment
r oligonucleotide and MRP-1 of formula (II)
2 y T y + corresponding to amino acids 14-22 of 4
-Y'-YN-YT-Y'-YH-Y'-TA's DN
A mixture of 26-mar oligonucleotides complementary to the A fragment. In these formulas, yll, yF.

YH, Yl　, YK, yN, YQ, YT, 'Yv.

The meanings of ``Y'' and YV are as defined in formula (IV). The 26-mar oligonucleotide contains 3 nucleotides in place of the nucleotide complementary to the nucleotide of triplet Y.
inosine residues, thus complementary nucleotides -
The number of nucleotide interactions is reduced to 23.

The synthesis of such oligonucleotides is carried out according to known methods as described in detail below, preferably by stepwise condensation using solid phase phosphotriester, phosphite triester or phosphoramidite methods, e.g. the phosphotriester method. This is carried out by condensation of the dinucleotide coupling units used. These methods are based on Y, Ike
etc. (Nucleic Acids Re5earch, 1
983, Dan, 477) in protected form with two, three or four nucleotides dA.
, dC, dG and/or dT or in a suitable condensation step.
The use of Knobling units allows for adaptation to the synthesis of desired mixtures of oligonucleotides.

The DNA probe must contain a marker so that hybridization with the desired mRNA can be detected and the mRNA can be identified and separated from other mRNAs that do not encode polypeptides of the invention. For example, by radiolabeling the 5'-terminal phosphate of the oligonucleotide, e.g. zzp, a fluorescent marker, or suitably labeled avidin, e.g. avidin carrying a fluorescent marker or conjugated to an enzyme such as horseradish peroxidase. Labels containing detectable biotin are suitable.

Hybridization of marker-containing DNA probes with size-fractionated mRNA is carried out according to known methods, i.e. in buffer and salt solutions containing additives such as calcium chelators, viscosity-modifying compounds, proteins, irrelevant DNA, etc. at a convenient temperature for selective hybridization, e.g. between 25°C and 40°C for l7-mer oligonucleotides and 25-
For mer oligonucleotides, the temperature is between 30°C and 50°C, preferably about 20°C below the melting temperature of the hybrid ds DNA.

The preparation of isolated complementary DNA from a selected mRNA template is well known in the art, as is the preparation of double-stranded DNA from isolated DNA.

The mRN^ template was prepared using a mixture of deoxynucleotide triphosphates, optionally radiolabeled deoxynucleotide triphosphates (to screen the results of the reaction), and poly(A) of Menger RNA.
Incubate with a primer sequence, such as an oligo-dT residue that hybridizes to the tail, and a suitable enzyme, such as reverse transcriptase. After degradation of the template mRNA, complementary DNA (cDNA) is incubated with a mixture of deoxynucleotide triphosphates and appropriate enzymes, such as those described above, to generate double-stranded DNA.

Suitable enzymes are reverse transcriptase, E. coli DNA polymerase II, the Klenow fragment, or T4 DNA polymerase. In some cases, the isolated DNA is first extended with a tail of similar deoxynucleotides to allow the use of complementary similar deoxynucleotide primer sequences, but the formation of 1cal ds DNA is usually based on natural hairpin formation. Begins. Such ds DNA resulting from hairpin formation is further treated with S1 nuclease, which cleaves the hairpin.

As an alternative to preparing cDNA from mRNA, genomic DNA can be isolated and screened for DNA encoding the desired polypeptide.

Genomic DNA is isolated from appropriate human tissue, preferably from human placenta or human fetal liver cells, according to methods known in the art. A genomic DNA library is prepared from this by digestion with suitable restriction endonucleases, such as Alu I and Haem, and introduction into λ Sharon phage, eg λ Sharon 4A, according to established methods. A genomic DNA library replicated on a nitrocellulose membrane is prepared using a DNA probe, such as a synthetic DNA probe of 16 or more nucleotides or an mR encoding a desired polypeptide as described above.
Screened using cDNA from NA. When screening with cDNA grown in a suitable host microorganism, this cDNA is labeled by the well-known nick translation method and then preferably incubated in a solution containing salts and buffers as well as other additives mentioned above. 40
Labeling is carried out at a temperature between 80°C and 80°C, for example about 65°C.

The introduction of dc DNA prepared from mRNA or genomically derived dc DNA into an appropriate vector is well known in the art. For example, cut an appropriate vector,
A similar deoxynucleotide tail is then applied. This is achieved by incubation in the presence of the corresponding deoxynucleotide triphosphate and an enzyme, such as terminal deoxynucleotidyl transferase. In another method, ds DNA can be introduced into the vector by linker-oligodeoxynucleotides or by blunt end ligation.

Transformation of suitable hosts with the resulting hybrid vectors is well known in the art.

For example, E. coli is conditioned for transformation by incubation in medium containing calcium chloride and then treated with the hybrid vector. Transformed hosts are selected with appropriate markers, such as antibiotic resistance markers, such as tetracycline or ampicillin resistance markers.

The DNA of this invention can also be prepared by chemical synthesis. A suitable method for synthesizing DNA is S
, A. Narangs Tetrahedron 19
83, similar to 3, is presented in summary form. Known synthetic methods allow the preparation of polynucleotides of up to 40 bases in good yield, high purity and in a relatively short time.

Appropriately protected nucleotides are synthesized using the phosphodiester method (
K, L, 8 garwa 1st class, Angew, Chem
, 1972, Co., Ltd., 489), and a more efficient phosphotriester method (C,B, Reese, Tetra
hedron 1972, Dan, 3143), the phosphite triester method [Rulu etsinger et al., J.A.
Chem, Soc, 1976, 3655] or the phosphoramidite method (S, L, Beaucage and M, H, Caruthers.

Tetrahedron Letters 1981,
(Record, 1859). Simplification of the synthesis of oligonucleotides and polynucleotides is made possible by solid-phase methods, in which nucleotide chains are linked to suitable polymers. H, Rink et al. (Nucl
eic Ac1dsResearch 1984.12
．． 6369] uses trinucleotides rather than individual nucleotides, which are linked by the phosphotriester method in solid phase synthesis. In this way, polynucleotides of up to 67 bases can be prepared in a short time and with good yield. Actual double-stranded DNA is assembled enzymatically from chemically prepared overlapping oligonucleotides from both DNA strands, where said oligonucleotides are held together in the correct configuration by base pairing, and then are chemically ligated by the enzyme DNA ligase. Another possibility is to combine overlapping single oligonucleotides from two DNA strands with a DNA polymerase, e.g. DNA polymerase 1, in the presence of the four required deoxynucleotide triphosphates.
Klenow fragment of 1 polymerase or T4 DNA
Incubate with polymerase or with AMV (avian myeloblastosis virus) reverse transcriptase. This holds the two oligonucleotides in the correct configuration through base pairing, and the necessary nucleotides are supplied by the enzyme, resulting in complete double-stranded DNA (S, A,
Narang et al., Anal, Biochem.

1982.12L 356).

The invention further provides that D encoding a compound of formula (I) or (II) is operably linked to an expression control sequence.
The present invention relates to a hybrid vector comprising NA, a mutant thereof, or a fragment of its DNA, and a method for producing the same.

The vector is chosen depending on the host cell used for transformation. Examples of suitable hosts include microorganisms lacking or low in restriction or modification enzymes, such as yeasts, such as S. cerevisiae), such as S. leprosy. S. cerevisiae GRF 1B, and bacterial strains, especially E. cerevisiae.
Strains of Escherichia colt, such as E. coli X 1776, E. coli 12 strains 294,
Bacillus subtilis (Bacillus 5ubt)
ilis), Bacillus stearothermophilus (Ba
cillus stearothermo hilus)
, Pseudomonas, Haemophilus, Streptococcus and others, and even cells of higher organisms, sometimes established human or animal cell lines, such as human fetuses. Lung fibroblast L-132, human melanoma Boives cells, He1a cells, African green monkey SV-40 virus-transformed kidney cells CO3
-7, or Chinese hamster Usui (CHO) cells. The above cells of E. coli, such as E. coli HB101, E. coli 12 and E. coli W3110.
, as well as strains of Saccharomyces cerevisiae, such as Saccharomyces cerevisiae GRF 18, are preferred as hosts, as well as the human fetal lung fibroblast cell line L-
132 is also preferred.

In principle, all vectors that replicate in the selected host and express the polypeptide of interest of the invention are suitable. Examples of suitable vectors for the expression of compounds of formula (N or (II)) in E. coli strains include bacteriophages, such as derivatives of the λ bacteriophage, or plasmids, such as in particular plasmids Co1E1 and derivatives thereof, such as pMB9, psF2124, pBR
317 or pBl? 322 is mentioned. A preferred vector of this invention is derived from plasmid pBR322.

Suitable vectors contain complete replicon and marker genes (for selecting and identifying hosts transformed with the expression plasmid on the basis of phenotypic traits), and optionally signal sequences and enhancers. Appropriate marker genes confer resistance to the host, eg, to heavy metals, antibiotics, etc. Furthermore, preferred vectors of the invention contain recognition sequences for restriction endonucleases outside the replicon and marker gene regions, so that foreign DNA and, if appropriate, expression control sequences can be inserted into these sites. Plasmid pBR322, a preferred vector, and plasmids derived therefrom, such as pUc9, pUC-KOlpl (Ri148 and p
PLc24 contains an intact replicon, such as marker genes conferring resistance to tetracycline and ampicillin (tetI+ and ampR), and a number of unique recognition sites for restriction endonucleases.

Several expression control sequences can be used to control gene expression. In particular, expression control sequences of highly expressed genes of the host to be transformed are used. In the case of pB11322 as a hybrid vector and E. coli as a host microorganism, expression control sequences such as the lactose operon, tryptophan operon, arabinose operon (which in particular contains the promoter and ribosome binding site), the β-lactamase gene, the phage Corresponding sequences of the λN gene, especially those containing the pt promoter, or the phage fd-coat protein gene are preferred. Plasmid pBR322 already contains the β-lactamase gene, but other expression control sequences must be introduced into this plasmid.

Vectors suitable for replication and expression in yeast contain a yeast origin of replication and a yeast selectable genetic marker. Yeast replication origins, e.g. chromosome autonomously replicating segments (
The hybrid vector containing the ars) remains extrachromosomally within the yeast cell after transformation and is autonomously replicated.

Additionally, hybrid vectors containing sequences homologous to yeast 2μ plasmid DNA can be used. Such a hybrid vector is a 2μ protein already present in the cell.
It may be recombinantly incorporated into a plasmid or it may replicate autonomously. The 2μ sequence is particularly suitable for plasmids with high transformation frequencies and will allow high copy numbers. A preferred yeast vector of this invention is pJDB207.

Suitable marker genes for yeast are in particular those that confer antibiotic resistance to the host or, in the case of auxotrophic yeast mutants, genes that complement host deficiencies. Corresponding genes confer e.g. resistance to the antibiotic cycloheximide or provide prototrophy in auxotrophic mutants, e.g. URA3, LEU2,... or especially η'2
It's genetic.

Yeast hybrid vectors preferably further contain an origin of replication and marker genes for a bacterial host, in particular E. coli, so that the construction and cloning of hybrid vectors and their intermediates can be carried out in the bacterial host. .

Expression control sequences suitable for expression in yeast are, for example, those of highly expressed yeast genes. That is,
Promoters of the TRPI gene, ADHI or ADD II, acid phosphatase gene or isocytochrome gene, or promoters involved in glycolysis, such as enolase and glyceraldehyde-3
-Phosphate dehydrogenase (dish, 3-phosphoglycerate kinase (PGK), hexokinase, pyruvate dehydrogenase, phosphofructokinase,
Promoters for the genes for glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase can be used.

Preferred vectors of the invention contain promoters with transcriptional regulation, such as the promoters of the ADHII and GAPD) genes, which can be turned on or off by changes in growth conditions. For example, the PH05 promoter can be repressed or derepressed simply by increasing or decreasing the concentration of inorganic phosphate in the medium.

Vectors suitable for replication and expression in mammalian cells are preferably derived from viruses, such as simian virus 40 (SV40), Rous sarcoma virus (R3).
V), adenovirus 2, bovine pavilomavirus (B
PV), papovavirus BKi variant (BKV), or mouse or human cytomegalovirus (CMV).

Preferably, these vectors contain eukaryotic transcription control sequences as well as an origin of replication for propagation in E. coli and antibiotic resistance. In particular, such so-called shuttle vectors can be constructed from pBR322E, a coli plasmid and SV40 and/or CMV enhancer and promoter regions. For example, the enhancer unit of the mouse or human cytomegalovirus major intermediate-early gene, the SV40 enhancer-1 in combination with the human alpha-globin promoter and/or further inducible promoters, such as promoters from heat shock genes or metallothionein genes. can contain. Furthermore, it is also possible to use promoters or control sequences naturally associated with the gene sequence of interest. The origin of replication can be provided, for example, by constructing the vector to contain a foreign origin from SV40 or other viral sources, or by the host cell chromosomal replication machinery. The latter method is often more efficient if the vector is integrated into the host cell chromosome.

In a preferred embodiment, the invention relates to a hybrid vector capable of replication and phenotypic selection in a host strain, which vector comprises a promoter and a compound of formula (I) or (II).
or a variant or fragment thereof, and this DNA is inserted into the hybrid vector under the control of the promoter so that it is expressed in the transformed host and the polypeptide is produced. are located along with transcription initiation and termination signals and translation initiation and termination signals.

The invention also relates to a method for producing a transformed host, which method comprises transforming the host with an expression vector containing the DNA of the invention controlled by an expression control sequence (
The invention further relates to the transformed or transfected host itself.

Examples of suitable hosts include the microorganisms mentioned above, such as Saccharomyces cerevisiae.
erevisiae), Bacillus subtilis (Ba
cillus subtttis) and Elisha'
Transformation with the expression plasmids of the invention can be carried out, for example, as described in the literature, ie in the case of S. coli (E. coli). Regarding Cerevisiae, A, former nnen% J, B, Hicks
and G. R. Fink, Proc.

Natl, Acad, Sci, IIs^, 1978,
■, 1929, B, Anagno for subtilis
Stopoulos et al., J. Bacteriol.

1961, ■, 741, E, for Cori, M, Man.
del et al., J. Mo1. Biol, 1970, plate, 15
This is done as described in 9.

Thus, the E. coli transformation method involves pretreatment of cells with Ca'' to allow uptake of DNA and incubation with a hybrid vector. Transfer to a permissive selective growth medium.

Cells that do not contain the vector will not survive in such a medium. Transformation of yeast can be accomplished, for example, by (I) enzymatic removal of the yeast cell wall with glucosidase, (2) treatment of the resulting spheroplasts with the vector in the presence of polyethylene glycol and Ca'' ions, and (3)
It involves a step of cell wall regeneration by embedding the spheroplasts in agar. Preferably, regeneration agar is prepared to allow simultaneous regeneration and selection of transformed cells.

Other examples of suitable hosts include the mammalian cells mentioned above, such as CO3
-7 cells, Bowes melanoma cells, Chinese hamster ovary (CHO) cells or preferably fetal lung cells L-
It is 132. Vectors can be prepared by transfection in the presence of Relper compounds such as diethylaminoethyl dextran, diethyl sulfoxide, glycerol, polyethylene glycol, etc., or by vector D.
It is introduced into mammalian cells as a co-precipitation of NA and calcium phosphate. Other suitable methods include direct microinjection of vector DNA into the cell nucleus and electroporation, ie, introduction of the DNA by short electrical pulses that increase the permeability of the cell membrane. Subsequently, selection of transformed cells can be carried out using a selection marker covalently incorporated into the expression vector or added as a separate entity. , for example, -418 (neomycin) or hygromycin, or genes that complement a genetic defect in the host cell, such as the absence of thymidine kinase or hyboxanthine phosphoribosyltransferase.

A preferred selection system lacks dihydrofluorate reductase, which absolutely requires thymidine, glycine, and purine for growth unless a foreign DHPR gene is supplied.
(DI(PR-) cells, such as CH○ cells, are used. A vector containing the DHFR gene linked to the gene encoding the polypeptide of this invention is
After introduction into PR-cells, e.g.
(methotrexate). Such treatment further increases production of the polypeptide of interest through amplification of the DHPR gene together with substantially flanking chromosomal regions containing the gene encoding the polypeptide of interest.

Mammalian cells, such as human fetal lung cells L-132, are expressed by the formula (I
) or (II), a vector DNA containing a gene encoding the compound of (II), a plasmid DNA containing a gene encoding antibiotic resistance, e.g. resistance to G-418.
Preference is given to the selection method by treatment with co-precipitation of A and calcium phosphate. Transformed cells are selected by culturing in the presence of the corresponding antibiotic, such as G-4,18, and screening for expression of the polypeptide of interest.

Transformed host cells are cultured in a liquid medium containing assimilable carbon sources, nitrogen sources, and inorganic salts by methods known in the art.

A variety of carbon sources can be used for culturing the transformed hosts of this invention. Examples of preferred carbon sources include assimilable carbohydrates such as glucose, maltose, mannitol or lactose, or acetates, which can be used as such or in suitable mixtures. Examples of suitable nitrogen sources include amino acids, such as casamino acids, peptides and proteins, and their decomposition products, such as tryptone, peptone, or meat extracts, yeast extracts, malt extracts, and also ammonium salts, such as ammonium chloride, ammonium sulfate or Mention may be made of ammonium nitrate, which can be used as such or in suitable mixtures. Inorganic salts that can be used are, for example, the phosphates and carbonates of sodium, potassium, magnesium and calcium.

The medium may further contain e.g. growth-promoting substances, e.g. trace elements,
For example, it contains iron, zinc, manganese, etc., and preferably substances that provide selective pressure and prevent proliferation of cells that have lost the expression plasmid. That is, for example, if the expression vector contains the a m p R gene, ampicillin is added to the medium.

Such addition of antibiotics also has the effect of killing antibiotic-sensitive contaminating microorganisms. For example, if a yeast strain that is auxotrophic for essential amino acids is used as the host microorganism, the plasmid preferably contains a gene encoding an enzyme that complements the host defect. Cultivation of the yeast strain is carried out in minimal medium lacking said amino acids.

Animal cells are grown under tissue culture conditions using commercially available media optionally supplemented with growth promoting substances and/or mammalian serum. The cells grow attached to solid supports, such as microcarriers or porous glass fibers, or in free suspension in suitable culture vessels.

Cultivation is performed by methods known in the art. Culture conditions, such as temperature, pH value of the medium, and fermentation time, are selected to obtain the maximum titer of the polypeptide of the invention. That is, E.

The coli or yeast strains are preferably cultivated under aerobic conditions, by submerged culture with shaking or agitation, at a temperature of about 20-40'C, preferably 30'C, and at a pH of 4-8, preferably around pH 7. for about 4 to 30 hours, preferably until maximum yield of the polypeptide of the invention is achieved.

When the cell density reaches a sufficient value, the culture is discontinued and the polypeptide is isolated. If the polypeptide is fused to an appropriate signal peptide sequence, it will be secreted by the cells directly into the supernatant.

If this is not the case, the cells may be washed with a detergent, e.g. SD
It must be destroyed by treatment with S NP-40, Triton or deoxycholic acid, or it must be dissolved by lysozyme, a similarly acting enzyme or ultrasound. When yeast is used as the host microorganism, the cell wall can be removed by enzymatic degradation by glucosidases. Alternatively or in addition to this method, mechanical forces such as shear forces (e.g. Cells can be disrupted by repeated thawing at, for example, 30°C to 40'C, as well as ultrasound.

The cell supernatant or solution obtained after centrifugation of the mixture obtained after disrupting the cells contains proteins, nucleic acids and other cellular components and is enriched for proteins, including polypeptides of the invention, in a manner known per se. do. Thus, for example, most of the non-protein components are removed by polyethyleneimine treatment and the raw white matter containing the polypeptide of the invention is precipitated by saturation of the solution with, for example, ammonium sulfate or other salts. Alternatively, the cell supernatant or cell lysate is prepurified by chromatography.

The polypeptide produced by the genetically engineered microorganism is purified by a combination of chromatographic methods, preferably by a combination of ion exchange chromatography with basic and acidic functional groups and reversed-phase high performance liquid chromatography as described above. Ru. Purification methods include other separation methods, such as filtration or ultrafiltration using molecular weight cut-off membranes, gel filtration, affinity chromatography, hydrophobic interaction chromatography, chromatography on hydroxyapatite, chromatofocusing, and dialysis. , dissolution, and reprecipitation in a mixture of suitable salts and/or buffers and solvents.

A purification scheme in which crude cell supernatant or cell lysate is sequentially chromatographed on an ion exchange column carrying quaternary amino functional groups, on an ion exchange column carrying sulfonic acid residues, and on a reversed phase liquid chromatography column. is preferred. Other preferred methods are to perform ion exchange chromatography only on one carrier containing sulfonic acid residues and/or to include gel filtration, ie size exclusion chromatography, in the purification method.

The invention furthermore relates to compounds of formula (I) or (II) and variants, fragments and derivatives thereof, in all cases prepared by the process of the invention.

The invention particularly relates to DNA, as described in the examples.
The present invention relates to hybrid vectors, transformed cells, compounds of formulas (I) and (II), and methods for their production.

Human macrophage migration inhibitory factor-related peptides, and variants, fragments or derivatives thereof, are useful for the treatment of immunomodulatory and chronic inflammatory diseases, and for protection against infection, preferably in combination with a therapeutically effective amount of the active ingredient. It is used in the form of a pharmaceutical preparation, optionally containing it together with or in admixture with an inorganic or organic solid or liquid pharmaceutically acceptable carrier.

The pharmaceutical formulations of the invention are suitable for enteral, e.g. rectal or oral administration to warm-blooded animals, e.g. humans;
and preferably for parenteral administration, such as intranasal, intramuscular, subcutaneous or intravenous administration. Depending on the intended method of application, the pharmaceutical preparation can be in the form of a unit dosage form, for example an ampoule, a vial, a herbal medicine, a pill, a tablet, a capsule, or a nasal spray in solid or liquid form.

The amount of therapeutically effective compound to be administered depends on the condition of the bleeding animal, e.g. human, e.g. body weight, nature and severity of the disease, and membrane condition, and also on the method of administration and on the treating physician. The decision can be made based on the evaluation. Formula (I
) or (II) or a variant or fragment thereof is on the order of 0.001 to Lttg per body weight per day.

The pharmaceutical formulations of this invention comprise conventional inorganic or organic solid or liquid pharmaceutically acceptable carriers, optionally together with other therapeutically active compounds and/or adjuvants. Preferably, solutions or suspensions of the active ingredient are used, especially isotonic aqueous solutions or suspensions, or alternatively lyophilized preparations which are dissolved in water immediately before use. The pharmaceutical formulation is sterilized and/or contains preservatives, stabilizers, wetting agents, emulsifiers, solubilizers, thickeners, osmotic salts and/or
or a buffer, and may also contain other proteins, such as human serum albumin or human serum preparations.

Pharmaceutical formulations in the form of aqueous dispersions containing MIF-related peptides or variants, fragments or derivatives thereof are preferred. In particular, the lipid component containing the aqueous content containing the MIF-related peptides of the invention, such as amphiphilic lipids such as phospholipids such as lecithin, cephalin or phosphatidic acid, and optionally neutral lipids such as cholesterol monomers, Approximately 2 layers or multiple layers
, OXl0-'' to 5. OXl0-'m and a population of as uniform size as possible is preferred.

Liposomes consisting of a mixture of synthetic phosphatidylserine and phosphatidylcholine are preferred.

The invention further provides human macrophage migration inhibitory factor-related peptides, particularly MRP-8 of formula (I) and MRP-8 of formula (II).
The present invention relates to polyclonal and monoclonal antibodies specific for MRP44 and derivatives thereof.

Polyclonal antibodies against MIF-related peptides are of mammalian origin, such as mouse, rat, rabbit, goat, sheep, horse, pig, chimpanzee or human. Mouse, rat, rabbit, goat or sheep antibodies are preferred, and rabbit antibodies are particularly preferred. These polyclonal antibodies may contain antibodies other than those directed against the compound of formula (I) and the compound of formula (II), respectively. In particular, polyclonal antibodies are
- A collection of antibodies with different affinities and selectivities for related peptides. Preferred polyclonal antibodies are specific for MRP-8 and MRP-8, respectively.
14.

Preferred monoclonal antibodies of this invention are those directed against MIF-related peptides. Monoclonal antibodies are also of mammalian origin, such as mouse, rat or human origin, and are preferably murine antibodies.

Monoclonal antibodies against MRP-8 designated 8-5C2 and 8-1007 and 14-6B2 and 1449
A monoclonal antibody against MRP-14 designated C9 and derivatives thereof are preferred. These monoclonal antibodies are 8-5C2 and 8-10D7.1, respectively.
It is secreted by the corresponding hybridoma cell lines designated 4-6B2 and 14-19C9.

Derivatives of antibodies of the invention include, for example, antibody fragments, radiolabeled antibodies, and conjugation of antibodies with, for example, enzymes, compounds with exceptional binding properties, such as avidin or biotin, fluorescent markers, chemiluminescent markers, or paramagnetic particles. It is the body.

Fragments of the antibodies of the invention are, for example, Fab, Fab' or F(ab')z fragments, which retain their specificity for the antigenic determinant, i.e. the characteristic fragments of the parent antibody directed against MTF-related proteins. It holds the bond pattern.

A radiolabeled antibody can be used, for example, with radioactive iodine (+2J
, +2J%31J), carbon ("C), sulfur (35S
), tritium (3H), etc. Antibodies labeled with radioactive iodine, for example monoclonal antibodies labeled with +2J, are preferred.

The antibody conjugates of this invention can be used, for example, with enzymes such as horseradish peroxidase, alkaline phosphatase, β-
D-galactosidase, glucose-oxidase, glucoamylase, carboanhydrase, acetylcholinesterase, lysozyme, conjugates with malate dehydrogenase or glucose-6-phosphate dehydrogenase, conjugates with avidin or biotin, and fluorescent markers such as fluorescein or conjugates with rhodamine B, chemiluminescent markers such as acridinium esters, or conjugates with solid paramagnetic particles. In such conjugates, the antibody is linked directly to the conjugate partner or by a spacer or linker group. Preferred are conjugates of monoclonal antibodies and the enzymes horseradish peroxidase or alkaline phosphatase, and conjugates of polyclonal and monoclonal antibodies with biotin.

The selectivity of antibodies for MIF-associated proteins can be detected qualitatively in an enzyme-immunoassay, in which wells of a microtiter plate are coated with pallidum and then treated with the antibody to be tested; The bound antibody is then detected using a labeled antiserum against the antibody.

For example, the selectivity of the mouse monoclonal antibodies of this invention is determined by a sandwich-type enzyme-immunoassay in which a microtiter plate is coated with a rabbit polyclonal antibody directed against a MIF-related protein and then the fluorophore itself is and then treated with the antibody to be tested, and the bound monoclonal antibody is detected with a labeled antiserum against the constant portion of the mouse antibody.

Monoclonal antibodies can be further characterized with respect to their immunoglobulin class and subclass by, for example, immunodiffusion techniques using class-specific second antibodies.
lony) method.

The antibodies of the invention and their derivatives can be obtained by methods known per se. The polyclonal antibodies of this invention and their derivatives can be obtained by immunizing a suitable mammal by two or three injections of a compound of formula (I) or (II) in the presence of an immune response enhancer. The antibody is obtained by a method in which the mammalian serum obtained is collected, the antibody is isolated and purified, and, if desired, the resulting antibody is converted into a derivative thereof.

Suitable mammals for producing polyclonal antibodies are, for example, mice, rats, rabbits, goats, sheep, pigs or horses. Preferably mice or rabbits are used. These include administering a compound of formula (I) or (II) twice, subcutaneously, intravenously or intraperitoneally, for several days, e.g. 3 to 7 days, for up to several months, e.g. 4 weeks. times,
Immunization is achieved by four or more injections.

Immune response enhancers are adjuvants that stimulate lymphocyte production, such as complete or incomplete Freund's adjuvant.

Preferably, the mammal's immune response is monitored by a suitable antibody assay, such as the enzyme immunoassay described above.

The mammal's blood is collected several days after the final boost, eg, 2-5 days. Antibodies are isolated by known methods such as precipitation, centrifugation and/or chromatography. Crude immunoglobulin fractions are obtained from serum by precipitation, such as with ammonium sulfate. These immunoglobulin fractions can be isolated by gel filtration or molecular sieve chromatography, ion exchange chromatography, chromatography on DEAE cellulose or immunoaffinity chromatography, e.g.
lococcus) protein A or preferably by chromatography on a carrier material carrying the corresponding MIF-related protein.

Antibody fragments that maintain specificity for the antigenic determinant, such as Fab, Fab' or l''(ab')2 fragments,
the antibody is digested by methods known per se, for example with enzymes such as pepsin or papain, and/or
Alternatively, it can be obtained by cleaving disulfide bonds by chemical reduction.

Antibodies labeled with radioactive iodine can be prepared by iodination methods known in the art, such as radioactive sodium or potassium iodide and a chemical oxidizing agent such as sodium hypochlorite, chloramine T, etc., or an enzymatic oxidizing agent. , for example, by labeling the antibody with lactoperoxidase or glucose oxidase and glucose.

Conjugates of antibodies of the invention can be prepared by methods known in the art, such as by combining the antibodies or fragments thereof prepared as described above with a camping agent such as glutaraldehyde, periodate, N,N' -〇-phenylene dimaleimide, N-(m-maleimidobenzoyloxy)-succinimide, N-(3-(2'-pyridyldithio)-
propionoxy)-succinimide, N-ethyl-N'-
It is produced by reacting with an enzyme in the presence of (3-dimethylaminopropyl)-carbodiimide or the like. Conjugates with avidin are produced in a similar manner. Conjugates with biotin are produced, for example, by reacting the antibody with an activated ester of biotin, such as biotin N-hydroxysuccinimide ester. Conjugates with fluorescent or chemiluminescent markers are prepared in the presence of coupling agents, such as those mentioned above, or by reaction with isothiocyanates, preferably fluorescein-isothiocyanate. Conjugates with paramagnetic particles are obtained using preactivated particles or by coupling in the presence of glutaraldehyde or perkorate.

The monoclonal antibodies of the invention and their derivatives are obtained by methods known per se, which include: a) culturing in vitro hybridoma cells containing the monoclonal antibodies and isolating the monoclonal antibodies from the culture supernatant; or b) propagating the monoclonal antibody in vivo in a suitable animal and recovering the monoclonal antibody from the body fluids of the animal; and optionally converting the obtained monoclonal antibody into a derivative thereof.

Suitable media for in vitro cultivation according to method a) are standard media, such as optionally mammalian serum, such as fetal bovine serum, or other growth-promoting supplements, such as 2-aminoethanol, insulin, transferrin, low density Dulbecco's modified Eagle's medium or RPM11 supplemented with riboprotein, oleic acid, etc., and trace elements
640 medium.

Monoclonal antibodies can be isolated by precipitating the proteins contained in the culture supernatant with ammonium sulfate or the like, followed by standard chromatographic methods such as gel filtration, ion exchange chromatography, chromatography on DEAE cellulose or immunoaffinity analysis. Achieved by chromatography.

In vitro manufacturing allows scale amplifiers for large scale production of desired antibodies. Techniques for large scale hybridoma culture are known in the art and include homogeneous suspension culture, e.g. culture in airlift reactors or continuous carrier reactors, or e.g. Including immobilized or captured culture on microbeads or on ceramic cartridges.

Large quantities of the monoclonal antibody of interest can also be obtained by propagating hybridoma cells according to method b). Cell clones are injected into syngeneic mammals and allowed to grow antibody-producing tumors. After 1 to 3 weeks, the monoclonal antibody of interest is collected from the body fluid of the mammal. For example, Ba
Hybridoma cells from 1b/c mice are injected intraperitoneally into Balb/C mice, optionally pretreated with a hydrocarbon such as blistane, and the ascites of these mice is collected 1-2 weeks later. The desired monoclonal antibodies are collected from body fluids by known methods, e.g., by precipitation of the protein with ammonium sulfate, and then subjected to standard chromatographic techniques, e.g., gel filtration, ion exchange chromatography, chromatography on DEAE cellulose, or immunoaffinity analysis. Purify by chromatography.

Monoclonal antibody fragments, radiolabeled derivatives and conjugates are prepared as described above.

Radiolabeled monoclonal antibodies can also be used in step a)
It is also prepared by adding radiolabeled nutrients to the culture medium of an in vitro culture. Such labeled nutrients include, for example, radiocarbon ("C").

The invention further provides for MIF-related peptides, particularly of the formula (I
) and MRP-14 of formula (II).

In particular, the invention relates to cell lines that are hybrids of myeloma cells and mammalian B lymphocytes immunized with compounds of formula (I) or (II). Preferably, these cell lines contain mouse myeloma cells and formula (I) or (I).
A hybridoma with B lymphocytes of a syngeneic mouse immunized with the purified compound of I).

Name 8-5G2.8-1007.14-6B2 and 14
A hybridoma cell line with -19C9 is preferred. These cell lines are mouse myeloma cell line P3
Hybrid of X 63-Ag3.653 with lung B lymphocytes of Ba1b/c mice immunized with MRP-8 and MRP-14, respectively. These are stable cell lines that secrete the correspondingly named monoclonal antibodies and are maintained as deep-frozen cultures and reactivated by thawing and optionally recloning.

The preferred hybridoma cell line was developed on September 9, 1987 by the Institut Pasteur “Co11ection Nationale” under the provisions of the Budapest Treaty.
deCultures de Microorgan
ismes, (Paris).

Cell Line Ichiban-M- 14-19C91-6B7 14-6B2I -6B8 8-1007l-6B9 8-5C21-690 The invention also provides secreted monoclonal antibodies that bind to compounds of formula (I) or (II). This method involves immunizing a suitable mammal with a compound of formula (I) or (II), fusing the antibody-producing cells of the mammal with myeloma cells, and obtaining the resulting product from this fusion. cloned hybridoma cells,
Cell clones secreting the desired antibody are then selected.

Suitable antigens for immunization of mammals in the method of this invention are the preferred compounds of formulas (I) and (II), respectively, namely MRP-8 and MRP-14 as described above. Preferred mammals for immunization are mice, especially B.
It is an a1b/c mouse. Immunization is performed, for example, as described above for the preparation of polyclonal antibodies.

Antibody producing cells, preferably lung cells, of the immunized animal, harvested 2-5 days after the final boost, are fused with myeloma cells of the appropriate cell line in the presence of a fusion promoter. Several suitable myeloma cell lines are known in the art. Hyboxanthin, which lacks the oxygen hyboxanthin guanine phospholiposyltransferase (HGPRT) or the enzyme thymidine kinase (TK),
Selective medium containing aminopterin and thymidine (TA
Myeloma cells that do not survive in T medium) are preferred. HAT
Myeloma cell lines and derived cell lines that do not survive in culture and secrete immunoglobulins or fragments thereof, such as cell line P3x63-Ag 8.653,
Or Sp2/0-Ag14 is preferred. Possible fusion promoters are, for example, Sendai virus or other varamyxoviruses, optionally in inactivated form, calcium ions, surface-active lipids such as lysolecithin,
Or polyethylene glycol. Preferably, the tile cells from the immunized animal have a 3-20 fold excess of myeloma cells and about 30% to about 60% of the molecular weight of 1000-4000.
% polyethylene glycol and about 10% to about 20% dimethyl sulfoxide.

After fusion, cells are resuspended and cultured in selective HAT medium. This will ensure that only hybridoma cells survive. These include the ability to grow and replicate in vitro derived from myeloma cells, and the lack of GPRK or TK genes essential for survival in HAH medium derived from antibody-producing lung cells of immunized mammals. This is because it has both the characteristics of loss and loss.

Suitable media for expanding hybridoma cells are standard media, such as Dulbecco's Modified Eagle's Medium, Minimal Essential Medium, RPM 11640 medium, etc., optionally supplemented with serum, such as 10-15% fetal bovine serum. It is something that exists. In some cases, feeder cells such as normal mouse peritoneal exudate cells, tile cells, bone marrow macrophages, etc. are added at the early stage of cell proliferation. To prevent hybridoma cells from being overwhelmed by normal myeloma cells, the culture medium is supplemented with selective HAT medium and, in the final step, supplemented with hyboxanthin/thymidine (HT) medium.

Hybridoma cell culture supernatants are screened for the desired monoclonal antibodies, preferably by enzyme immunoassay or radioimmunoassay. Positive hybridoma cells are cloned, for example, by limiting dilution. Cloned cell lines can be frozen according to conventional methods.

The polyclonal and monoclonal antibodies of this invention and/or their derivatives are useful for the quantitative or qualitative determination of MIF-related proteins, especially compounds of formula (I) or (II).

For example, antibodies and their derivatives, such as enzyme conjugates or radioactive derivatives, can be used in any of the known immunoassays based on binding interactions between antigenic determinants of MIF-related proteins and antibodies. Examples of such assays include radioimmunoassay (RIA), enzyme immunoassays such as enzyme-linked immunosorbent assay (ELISA), immunofluorescence, immunoprecipitation, latex agglutination, and hemagglutination. Such immunoassays are useful, for example, in quantifying or qualifying MIF-related proteins in biological fluids or tissues of patients with inflammatory conditions, patients predisposed to capsular fibrosis, or healthy individuals.

The antibodies of the invention can be used as such or in the form of radiolabeled derivatives in radioimmunoassays. Any of the known variants of RIA, such as homogeneous-phase RIA, solid-phase RIA or unbound-RIA, single RIA or double (sandinch) RIA, for direct or indirect (competitive) determination of the proteins of the invention. It can be used for. Sandwich RIA is preferred, in which a suitable carrier such as the plastic surface of polystyrene, polypropylene or polyvinyl chloride microtiter plates or test tubes, glass or plastic beads, filter paper, or dextran, cellulose acetate or nitrocellulose sheets, etc. are coated with the monoclonal or polyclonal antibodies of the invention by simple adsorption or optionally after activation with e.g. the carrier-conjugated monoclonal antibody, which recognizes another epitope of the protein of the invention), and the amount of the protein of the invention is determined by measuring the radioactivity bound to the carrier. do.

Particularly preferred is the sandwich radioimmunoassay described above, in which a monoclonal antibody of the invention is bound to beads, such as polystyrene beads, and
The coated beads are incubated in test or standard solutions containing MIF=related proteins and finally revealed with radiolabeled monoclonal antibodies that recognize different epitopes.

The antibodies of this invention can be used neat or in the form of enzyme-conjugated derivatives or biotin-conjugated derivatives in enzyme immunoassays (E
It can be used in IA). Such immunoassays include test methods using enzyme-labeled monoclonal antibody derivatives of the invention, enzyme-labeled antibodies known per se that recognize and bind to the epitope of the antibodies of the invention, or enzyme-avidin conjugates. includes. Any of the known variations to EI, e.g. EIA in homogeneous phase, solid phase EIA or free-EIA, single EI
MIF using A or double (san 1-) EIA
- Direct or indirect (competitive) measurements of related proteins can be carried out.

ELISA (enzyme-linked immunosorbent assay) is preferred, in which a carrier as described above for RIA is coated with a polyclonal or monoclonal antibody of the invention, incubated with a test solution containing MIF-associated fluorescence, and It is then incubated with a polyclonal antibody conjugated to biotin or a different monoclonal antibody, and finally, the bound antibody-biotin conjugate is revealed by an enzyme-avidin conjugate and the amount of bound protein is determined by an enzyme-substrate reaction. decide.

Furthermore, a carrier coated with a polyclonal antibody or a monoclonal antibody of the present invention is combined with a test solution.
and ELIS incubated with an enzyme-conjugated monoclonal solution (if used, a dissolved monoclonal antibody that recognizes a different epitope of the MIF-related protein than the carrier-conjugated monoclonal antibody recognizes).
A is preferred. For example, the protein in the test solution is determined by an enzyme-substrate reaction that results in a color change that can be observed visually or measured with an optical measuring device.

Additionally, a carrier coated with a polyclonal or monoclonal antibody of the invention is combined with a test solution, together with a solution of a monoclonal or polyclonal antibody of a different species than the carrier-bound antibody, and then recognizes the species-specific portion of the dissolved antibody. ELIS^ in which the enzyme is then incubated with a binding enzyme-labeled second enzyme is preferred. The amount of bound enzyme is proportional to the amount of protein in the test solution and can be determined by enzyme-substrate reactions.

The monoclonal antibodies of this invention can be used in immunofluorescence tests as such or in the form conjugated with fluorescent markers.

Such an immunofluorescence test can be carried out using a monoclonal antibody derivative of the invention, such as a derivative conjugated with fluorescein 7cein, or a fluorescent marker-labeled antibody known per se that recognizes and binds to the epitope of the monoclonal antibody of the invention. Includes methods used.

The carrier described above for RIA is coated with the cells to be tested for the presence of the proteins of this invention according to standard methods, the cells are fixed, and the proteinaceous material within the cells is allowed to interact with the applied solution. permeabilized as described above and then incubated with a polyclonal or monoclonal antibody derivative of this invention conjugated with a fluorescent marker, or incubated with a polyclonal or monoclonal antibody of this invention which then recognizes and binds to said antibody of this invention. Immunofluorescence testing by incubation with a second antibody labeled with a fluorescein marker, such as fluorescein-labeled rabbit anti-mouse immunoglobulin, is preferred. The presence of the proteins of the invention is then detected and the proteins localized by standard fluorescence microscopy or flow cytometry.

The use according to the invention of said monoclonal antibodies and their derivatives for the qualitative or quantitative determination of MIF-related proteins can also be performed using other immunoassays known per se, such as immunodot analysis, radiolabeled antibodies or radiolabeled MIF= Immunoprecipitation test using related proteins, antibodies-
These include latinsis agglutination using coated or antigen-coated latex particles, or hemagglutination using antibody-coated or antigen-coated red blood cells.

The invention also relates to a kit for the qualitative and quantitative determination of MIF-related proteins, in particular compounds of formula (I) or (IT), which kit comprises the polyclonal antibodies of the invention and/or
or monoclonal antibodies and/or derivatives thereof, and optionally other polyclonal or monoclonal antibodies and/or adjuncts.

Test kits of the invention for radioimmunoassays include, for example, suitable carriers coated or uncoated with polyclonal or monoclonal antibodies of the invention, monoclonal or polyclonal antibodies against compounds of formula (I) or (It,). optionally lyophilized or concentrated solutions of antibodies and/or radiolabeled derivatives thereof, standard solutions of the corresponding compounds of formula (I) or (II), buffers, optionally non-specific adsorption and polypeptides and detergents to prevent the formation of aggregates, pipettes, reaction vessels, conversion curves, instructions, etc.

The test kit of the invention for enzyme immunoassays may be prepared, for example, on a suitable carrier, such as a microtiter plate or a nitrocellulose sheet, with a polyclonal or monoclonal antibody against the compound of formula (I) or (II), and with an enzyme label against this protein. or an optionally lyophilized or concentrated solution of a biotin-labeled monoclonal or polyclonal antibody, a solution of an enzyme-avidin conjugate if a biotin-labeled antibody is used, an enzyme substrate in solid or dissolved form, this Standard solutions of the proteins of the invention, buffers, and optionally polypeptides and detergents, pipettes, reaction vessels, conversion curves,
Includes chromaticity table, instructions, etc.

The monoclonal antibodies and antibody derivatives of this invention are MIF
- related proteins, in particular compounds of formula (I) or (II), such as MRP-8 and ?, respectively; For the qualitative and quantitative determination of IRP-14, it is preferably used in enzyme immunoassays. MR in biological fluids, tissue sections, and cells
Reliable determination of the amounts of P-8 and MRP-14 allows for the unequivocal determination of inflammatory conditions and/or genetic predisposition to capsular fibrosis. Furthermore, the monoclonal antibodies and antibody derivatives of this invention can be obtained from natural sources or from recombinant host cells.
It can be used in the immunoaffinity chromatographic isolation and purification of F-related proteins.

MIF-related peptides MRP-8 and MRP of this invention
-14 is present in different amounts in normal granulocytes and monocytes depending on the donor. After culturing granulocytes and monocytes, MRP-8
The number of and MRP-14 positive cells increases until day 3 of culture and then declines to reach O levels from day 100 onwards. MTlP-8 and MRP-14 do not appear to be present in normal human tissues other than in intravascular monocytes, such as the liver, and MRP-14 is also present in monocytes, mesothelia, and placenta in the lungs.

However, MRP-8-positive macrophages are detected in chronic inflammatory lesions. In cutaneous sarcoidosis, endothelial cells also contain MRP-8.

MRP-14-positive macrophages are found to a large extent in rheumatoid arthritis tissues. MRP-8 and MRP-
14 is expressed by a subset of tissue macrophages in secondary chronic polyarthritis and other chronic inflammations in a different pattern than in other chronic inflammations such as gingivitis.

The invention therefore relates to a method for diagnosing chronic inflammatory conditions, the method comprising determining the amount and pattern of MRP-8 and MRP-14 expression in tissues using antibodies against MRP-8 and MRP-14 as described above. Features.

Cystic fibrosis (C
F) is an autosomal recessive disease, and its etiology is still unknown. There is a need for a simple method that allows one to quickly and reliably determine whether a subject is normal, CF heterozygous, or CF homozygous. CF tetrozygotes have no clinical impact, but transmit the disease to the next generation.

A screening program of blood samples from healthy subjects, CF heterozygotes, CF homozygotes, and patients with different inflammatory and allergic conditions and other diseases has shown that MRP-14 as a marker of cystic fibrosis has been evaluated. The usefulness is shown (table).

Margin table below Healthy donor 39 0.043 0.00
3-0.132CF homozygote 11 1.0
76 0.204-5.78CF heterozygote 7
0.611 (I, 161-1,020 Rheumatoid arthritis 13 0.618 0.093-1.
48 Asthma 2 0.595 0.3
57-0.476T-cell lymphoma 2 1.3
2 0.240-2.04 Neurodermatitis 1
1.840 - Dry blindness 6 0.0270.
014-0.036 Others” 7
-<0.030a) Sandwich ELISA of Example 42
, two independent experiments per sample (standard deviation 10%
b) Mycosis fungoides, sarcoidosis, leprosy, contact dermatitis.

C) The highest and lowest values obtained.

The average amount of MRP-14 found in healthy donors is 0.
043ag/ml and the highest value was 0.1321 pg
/ me. 0.20 for patients suffering from CF
It exhibits plasma concentrations of 4-5,78 μg/ml, with an average value of 1.076 ag/me. CF heterozygote,
That is, plasma donors who are parents of CF patients but do not themselves have clinical consequences have an average MRP of 0.611 ag/+nf 44? Shows M degree, minimum value is 0.161ag
/ml. Therefore, considering standard assay reproducibility of ±10%, we estimate whether an otherwise healthy subject is heterozygous for CF by approximately 0.15 μg/ml.
can be determined with the limits of

Patients with rheumatoid arthritis, asthma, T-cell lymphoma, and neurodermatitis also show elevated MRP-14 levels, whereas patients with several other diseases, including Qiantang, have normal ranges of MRP-14fA, have a degree.

The amount of MRP-8 found in plasma samples of healthy donors, CF homozygotes and CF heterozygotes is usually 0.
01 μg/ml and does not indicate carcinogenic fibrosis.

The present invention therefore relates to a reliable diagnostic method for carcinogenic fibrosis, which uses antibodies against MRP-14 as described above to determine whether a person is homozygous or heterozygous for carcinogenic fibrosis. It is anticipated that the method will be characterized by measuring the amount of MRP-14 in a plasma sample of an otherwise healthy patient.

Next, the invention will be described more specifically by way of examples. However, this does not limit the scope of the invention.

The following abbreviations are used in the examples below.

8TP adenosine triphosphate bp
Base pair BSA bovine serum albumin cDNA complementary DNA cplIl power front/min (radioactive decay) d8
2'-deoxyadenosine dATP 2'-deoxyadenosine triphosphate dC2'-deoxycytidine and the following margin dCTP 2'-deoxycytidine triphosphate DEAE'; ethylaminoethyl dG 2
'-deoxyguanosine dGTP 2'-deoxyguanosine triphosphate DMEM Dulbecco's modified Eagle medium D
MSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dNTP dATP, dcTP, dGTP and dT
TP mixture dpm Dispersion 7 minutes (radioactive decay) ds DNA Double-stranded DNA dT (2'-deoxy)thymidine DTT
14-dithiothreitol dTTP Thymidine triphosphate EDTA Ethylenediaminetetraacetic acid FAB-MS Fast atom bombardment (
fastatom bombardment) mass spectrum FCS fetal bovine serum margin FPLC fast protein polypeptide polynucleotide liquid chromatography HAT
Hypoxanthine/Aminopterin/Thymidine HBS Hepes Buffered Saline Hepes
N 2-hydroxyethylpiperazine-N'-2-
Ethanesulfonic acid HPLC High performance liquid chromatography IgG
Immunoglobulin G kb kilobase kD kilodalton (molecular weight) MEM minimal essential Eagle medium MIF macrophage migration inhibitory factor mRNA
Message + -RNAMRP MIF-related peptide OD Optical density PA (,E Polyacrylamide gel electrophoresis PB
S Phosphate buffered saline PMSF Ferylmethylsulfonyl fluoride R
To N Ribonucleic acid rpm Rotation speed 7 minutes SOS To sodium dodecyl sulfate TF Tris tris (hydroxymethyl
) aminomethane ) lis(hydroxymethyl)aminomethane tRNA Transfer RNA The following buffers and media are used.

Denhart 0. 1% polyvinylpyrrolidone (PVP
-Solution 360, Sigma), 0. 1%F
icol1400 (Pharmacia) ,,
0.1% BSA.

Elution buffer 10mM Tris-H (J!, pH
7. 5, 1mM EDTA, 0. 2% SDS 0 GuSCN 4 M guanidium isothiocyanate buffer, 50 mM Tris-HC/!
, pH7. 5. 10mM ED T8. 2% Sodium N
-Lauroyl sarcosinate (sarcosyl), 14
0mM β-mercaptoethanol.

LB medium 1% Batatotributon (Difco), (
L broth) 0.5% Bacto yeast extract (Difco), 1
70mM' Na (J!, pH 7.5 with NaOH)
Adjust to.

PBS 136mM Na(J!,
2mM KG7! , 8mM NaJPOn, 1
．． 4mM KH2PO4.

RVT buffer 200mM Tris-HCn,
pH 8.3 at 42°C, 20mM MgCj2t
, 280mM KC7! , 20mM TT 0 SOC medium 2% tryptone (Gibco), 0.5% yeast extract (Gibco), 10mM NaCρ, 2,5m
MKCJ! , 10mM MgC7! z, 5m
MMgSO4, 20mM glucose.

SSC buffer 15mM sodium citrate, 150m
MNa (J! pH 7.0 with XNaOH for 8 cycles.

TBE buffer 89mM Tris (TRIZMA" base), 89mM boric acid, 1mM EDTA.

TNR buffer 10mM Tris-HCIl, pH
8. 0, 1mMEDTA, 0. I M NaC
A.

Wash buffer 10mM Tris-HC7! , pH7
．． 5, 1mM EDTA, 0. 5M NaCA
,0. 2% SDS.

The following margins are open. LLI! [J Pepti's "Vivid Human Mononuclear Cells are Stimulated and Cultivated, and the Resulting Cell Culture Supernatant is Concentrated," and European Patent Application No. 162,
812 by immunoaffinity chromatography carrying the monoclonal antibody IC5. The protein-containing fractions were made up to 1% in TFA and purified using Vyda HPLC equipment.
c 214 TP 5415 Reversed Phase HPLC Column (The
Separation Group, Hespari Power, CA, USA)
Above 1. Separate into 1 ml fractions. Place the column in water 1
%TFA 65% and 0.07% TFA in acetonitrile
and the product was equilibrated in a mixture of 0.1% TFA in water and 45% TFA in acetonitrile.
Elute with a linear gradient ending in a mixture of 55% TFA and 55% TFA at a flow rate of 1 in/min. Transfer the eluate to Kratos
Monitored by absorption at 220 nm with a Spectroflora 773 HPLC UV detector. Retention time 11.8 minutes (I), 12.6 minutes (II), 13.4 minutes (I), 14.4 minutes (IV), 15.2 minutes (V),
Seven individual fractions with 16.0 minutes (■) and 16.6 minutes (■) are collected manually according to UV absorption.

↓2. Aliquots of both fractions (I) to (■) were subjected to 5O3-PAGE (V, to Laemm) under reducing and non-reducing conditions.
l i.

Nature 1970.227.6B0) and stained with Coomassie Blue R-250 (FIG. 1). An aliquot of the HPLC fraction (I~5%) was vacuum dried, dissolved in 20 μl of dissociation buffer with or without (reduced) DTT (I%), heated for 2 min at 96 °C, and incubated for 15 min. % applied to polyacrylamide gels.

Both proteins (I) are identical to the known human MIF protein with an apparent molecular weight of 8 kD described in HP 162.812. Both fractions (II) contain an 8 kD dimer of MIF protein, which under non-reducing conditions has a molecular weight of 16.5 kD.
It appears as a double band at kD and as a strong band at 8 kD with a faint band that migrates slightly faster under reducing conditions.

Both proteins (III) appear at 14 kD under reducing and non-reducing conditions and are designated l'1RP-14.

The protein of both portions (IV) shows a double band at 13kD,
And it is called MRP-14'. Apparent molecular weight 20k
The two (V) proteins with D consist of a disulfide-linked heterodimer of the 8 kb MIF protein and MRP-14 shown under reducing conditions. Both parts of 17.5kD (
The protein VI) is another disulfide-linked heterodimer of the 8kD protein, and the two (■) proteins appearing at 23.5kD are the disulfide-linked dimer of MRP-14.

170 ml of concentrated supernatant of cultured human mononuclear cells of European Patent No. 1 Th 162,812 was extensively dialyzed against 50 mM sodium acetate (NaOAc) buffer (pH 4) and SP Trisacryl M (L
KB) Pump onto an ion exchange column (2,6X10 cm). Wash the column until the UV254nm absorption reaches baseline. Proteins bound to the column were dissolved at 0.0 M in 50 mM NaOΔc (pH 4,0).
Linear gradient of 1.0 M NaCl2 (30M)
Elute using a flow rate of 1.8 mff/min. Both 18-individual portions are collected and analyzed by 5O5-PAGE.

MRP-8, MHI'-14 and MRP-14' are 250
They are eluted together in the same fractions with a total gradient volume of ~280 WIR. The pool of MRP-containing fractions was
Concentrate by ultrafiltration on a -10 membrane (Amicon) and bring to 1% in TFA. Pure MRP~8, respectively.
Isolation of MRP-14 and MRP-14' was performed using Vydac.
Achieved on a 214 TP 510 reverse phase HPLC column (The Separations Group, USA). The column was washed with 75% 0.1% TFA in water and 0.0% TFA in acetonitrile.
．． Equilibrate in a mixture of 0.7% TFA with 25% and 0.1% TFA in water with 45% and 0.1% TFA in acetonitrile.
The protein is eluted with a linear gradient over 45 minutes ending with a mixture of 55% and 07% TFA at a flow rate of 3 m2/min. The eluate is monitored by absorbance at 235 nm. Individual peaks are collected manually according to absorbance readings. Example 1.1. MRP-8, MRP-14 and MRP-14' are identified by comparison with peptides isolated according to the present invention.

A protein (■) (Example 1) called Pantau 4431 and MRP44 (Example 1) was incubated at room temperature for 6 hours with 100μZ of 50mM N)14
Incubate with 0.5 μg of Staphylococcus aureus V 87' rotiase (Cooper Biochemicals) in HcO+. A small aliquot (2%) of the incubation mixture was transferred to a Vydac 214 TP 5415 reverse phase H
Digestion progress is monitored by analysis on a PLC column (The Separations Group). On the same column, 1+++j! from 100% 0.1% TFA in water to 100% 0.07% TFA in acetonitrile over 60 minutes! Preparative separation of peptide fragments is achieved by elution at a flow rate of /min. 3 pieces for both sides, 20.
7 minutes (A), 22.7 minutes (B) and 24.8 minutes (C)
Collect manually according to UV absorption at 220 nm at a retention time of .

[i MRP-14's slot
Fractions A, B, and C (Example 2) were evaporated in vacuo, each dissolved in 25 μ of 0.1% TFA in water, and amino acid sequence analyzed using a gas phase protein sequencer model 470 manufactured by Applied Biosystems. Put it on.

The N-terminal amino acid sequence is as follows.

Val-Lys-Leu-Gly-(A)^1a-3e
r-X+t-Glu-Lys-Met-(B)Xz+-
Xzz-11e-(C) In the above sequence, Xn represents an undetermined amino acid located at the nth position from the N-terminus.

Margin below! ! 1.6 x 1010 mononuclear human blood leukocytes from mononuclear human blood leukocytes were isolated from buffy coat and European patent application 1k1
62,812 for 2 hours. Spinner Culture Medium R
After 16 hours of incubation at 37° C. in PMT1640 medium (5% CO□), cells are harvested by centrifugation at 350×g for 15 minutes. Approximately 10- fluffy cell pellets are dissolved in 5QmR GuSCN buffer and homogenized for 90 seconds at maximum speed in a Truvaloo Omnimixer (I00mf). Next, the solution was mixed with 10
mM Tris-HCj! (p) 17.5), 10
0mM NaCj! and pre-equilibrated phenol 60- in a solution containing 1 mM EDTA.
Mix with. Add 60 ml of chloroform, mix,
Phase separation is then achieved by centrifugation at 300 rpm in a tabletop centrifuge. The aqueous phase containing some of the non-viscous mesophase is collected and 60-equilibrated phenol and chloroform are added sequentially. The mixture is centrifuged and the aqueous phase and non-viscous interphase are recovered. These steps are repeated 3 to 3 times until all interphases have virtually disappeared.
Repeat 4 times.

Nucleic acids are precipitated at -20°C by adding 2 volumes of ethanol (IOM). RNA is further purified from contaminating DNA as follows. Dissolve the nucleic acid in 6 cups of water. 1.5 mN of 0.5 MED T^ (pH 7.5),
Next, 7.5 g of dry-heated CsCl! and l of 215μZ
Add a mixture of 1 NHCl. Pour this solution into two T
0.1 MEDTA in ST41 tube (Kontron)
(pH 7,5) (final) 5.7 M C5Cj! The cushion 2- overlaps on top of the cushion. Fill the tube with water and centrifuge for 16 hours at 20°C in a TST410-tar. At the end of the run, most of the supernatant was removed and the tube was quickly inverted and drained. The glassy RNA pellet is dissolved in four volumes of elution buffer by vortexing and warming at 37°C (2 minutes). The RNA is precipitated by adding 10-g of ethanol and centrifuging for 10 minutes in an HB40-tar (Tsurpal). This R
Briefly dry NA (9,5 mlr) and Q, 4
ml elution buffer. After heating for 2 min at 6B °C and cooling on ice, 44 mg of 5M N
aCl1 is added and this solution is applied to a column containing 0.5 g of oligo-dT cellulose (type 7, Pharmacia) equilibrated with wash solution. After three successive applications of the sample, the column is washed with 15 wash buffers and the bound RNA is eluted with 4 wash buffers. Heat the eluted material at 6B°C for 2 minutes, cool and add 0.44ml of 5M NaCA. The solution is applied (3 times) to a pre-equilibrated oligo-dT cellulose column. After washing with 15 mE wash buffer, bound RNA is eluted with 4+nf elution buffer. 0.25 mf of 3 M Na0Ac (pH 5,5)
The RNA is precipitated overnight at -20° C. by adding 100 ml of ethanol. Precipitation (I10 pg)
was collected by centrifugation (15 min at I6,000 x g), dissolved in 0.4 WF of water, and 25 μl of 3
Reprecipitate by adding M Na0Ac and 1 ml ethanol. After cooling in dry ice for 10 minutes, RNA is collected by centrifugation in an Eppendorf centrifuge for 5 minutes. The pellet is air dried and dissolved in 110 μl of water.

l Polyadenylated RNA (Example 4) with a polyadenylated RNA size of \190 cm was mixed with 50% DMS of 200 μm.
O, 10mM Tris-IC6 (pH 7,5), 1
2 at 80°C in mM EDTA and 0.5% SDS.
Denature for minutes. After cooling and addition of 300 Ij1 of water, the solution was transferred to a TST41 rotor (Kontron).
100mM NaCl2, 10mM Tris in
-IC4 (pH 7,5), 1 mM EDTA and 0.
Layer on 1.5 ml of a linear gradient of 5-15 W/v% sucrose in 5% SDS. 4L OOO
After centrifugation for 4.5 hours at 25°C, 30 0
．． 4-Collect fractions and record individual UV spectra.

15μ of RNA from both sides of each individual! of 0.3 M Na
Precipitate by adding 0Ac (pH 5.5) and 1 ml of ethanol. After incubation overnight at -20°C, RNA is collected by centrifugation, lysed, and reprecipitated as described above. Finally add 20 RNA
Dissolves in m water.

Mixed oligonucleotides are synthesized based on the known partial amino acid sequence of MRP-8. Oligonucleotide mixture 1 is 5'-TAYTTRTGRTANACRTC-
3' composition, where A, T, G and C are adenosine, thymidine, guanosine and cytosine, respectively, and Y and R are pyrimidine (T, C) and purine (A, G), respectively; And N is any one of four types of deoxynucleotides.

Oligodeoxynucleotide mixture 2 is 5′-TC
YTTRAACCANACRTC-3', where the codes have the same meaning as above. These two are composed of 64 types and 32 different types of 17-n+er, respectively.
A mixture of amino acids 14-19 and 5 of MRP-8
This is a DNA strand that may be complementary to 2-57.

These oligodeoxynucleotides were synthesized by Y, Ike et al.
Nucleic Ac1d Research 1983
, ■, 477. The 5'-ends of these oligodeoxynucleotides were isolated using standard methods (
T. Maniatis.

E, F, Prltsch and J, Sambrook;
”Mo1ecular cloning+a 1abo
ratory manual"ICo1d Sprin
g Harbor Laboratory, 1982)
r −”P −dATP (5000 Ci/m
moA ) and polynucleotide kinase (Pharmacia) to make it radioactive (I ~ 2 x 1109 dp/■).

2 pi each of the size fractionated RNA of Example 5
Spotted onto a sheet of filter (Pal I-Biodyne) and heated in a vacuum oven at 80°C for 2 hours.

This filter was heated at 32°C for 3 hours with 0.9 M Na
CA, 180mM Tris-HCj! (pH8
, 0), 6mM EDTA, 0.5% SDS, and 50trg/ml of sheared isolated calf thymus DNA. After removing the prehybridization solution, one filter was incubated at 29°C for 36 hours and an additional 5 hours.
Prehybridization containing X 10' dpm of oligodeoxynucleotide mixture 1? Liquid 1.
Hybridize in 5 ml. A second filter is hybridized at 32° C. in the same solution containing 5×10 7 dpm of oligodeoxynucleotide mixture 2. At the end of hybridization, store the filter at 25°C (filter 1) or at 29°C.
℃ (filter 2), 250mj! of 0.6M
NaCjl! , 0.12M Tris-HCj! (
pH 8,0), 4mM EDTA and 0.2% SDS
and 250 m1 of 0.3 M NaC4,0,
06M Tris-HCn (pl+8.0),
Wash 4 times for 15 minutes each with 0.2mM EDTA and 0.2% SDS.

After drying the filter, place it in Illfort®.
Fast Tungstate Screen (Tlford)
Exposure to X-ray film for 3 days at -80°C using a Fast Tungstate 5cleaner.

By comparing the two filters, we can calculate the difference between 23 (
9S) is estimated to contain most of the MRP-8 mRNA.

The following composition: 5'-TAYTGRTGRAAIGTR
Oligodeoxynucleotide mixture 3 of TTIATIATNGT-3' (where ■ is inosine), a DNA strand potentially complementary to the mRNA encoding amino acids 1-9 of peptide fragment A of Example 3. 64 different 26-mers were synthesized as described in Example 6 and radioactive (I~2X109d
pm/11g).

Size fractionated RNA is prepared as described in Example 5. However, Q, collect 40 3 ml portions,
And 40μ of precipitated RNA! dissolves in water.

Two pieces of this RNA (2 pl each) were spotted on two filters and dried at 80°C. The filters are prehybridized and hybridized in the presence of 5×10 7 dpm of the above oligodeoxynucleotide mixture 3 and washed. These operations are carried out as described in Example 6, except that the hybridization temperature is 37°C. By comparing replicas on X-ray film, fractions 12 and 13 contain most of the M
It is estimated that it contains RP-14 mRNA.

Margin below 31 cDNA cloning of MRP-8 8.1. 93 mRNA of 3H encoding MRP-8 from "Tantan" fat-coated fraction 23 (see Example 6) was incubated at 42° C. for 90 min at 1
00n+M Tris-1 (Cj! (p)l 8.3 measured at 40°C), 10mM MgCj2z
, 140mM KCj2.10n+M DTT, 1
mM of each dNTP, 100 g/mf oligo dTI2-
111 (Pharmacia), 90 units of RNasin
(Genophyte), 40 units of AMV reverse transcriptase (
Genophyte) and 30 pci'! ”PdCT
Incubate in 50μ! of reaction mixture containing 3000Ci/mm.P (0.5M of 2I).
The reaction is stopped by adding EDTA (pH 7.5). RNA is degraded by incubation with 0.15 N NaOH for 1 hour at 65°C. 251 Tris-HC4 (pH 8,0) and 6μ
Neutralize the solution by adding 1 of INH (J!).SDS
After addition of 0.5%, the solution is extracted with 100 μl of phenol/chloroform (I:1) equilibrated with TNE buffer. Sephadex G- in THE buffer
The aqueous phase is passed through a 2-column containing 50 (Pharmacia). 2X 106dpm” P (I, 6g
> isolated cDNA was recovered from the flow-through fraction (0,4d),
Then, precipitate with 1 ml of ethanol. The precipitate was collected by centrifugation and added with 100mM Hepes.
(pH 6,9), 10 mM Mg (J!.

2, 5mM DTT, 70mM K(J!, 0
．． Duplexing occurs overnight at 15° C. in a 50 ml reaction mixture containing 5 mM of each dNTP and 40 units of DNA polymerase "large fragment" (Boehringer). For digestion with S1 nuclease, the reaction mixture was diluted with 30μ of water!
, and I M NaC7! , 250mM Na0Ac
(pH 4,5), 20μ of a solution containing 5mM ZnSO4 and 2,5% glycerin! , and 1 μl of INH
C7! Dilute with After adding 2 units of 81 nuclease (Pharmacia), the mixture is incubated for 30 minutes at 30°C. 5μl of 0.5MEDT8 (p
H7,5), 5 μl of I M Tris-HfJ!
The reaction is stopped by adding 20% SDS (pH 8.3) and 51d, extracted with phenol-chloroform and chromatographed on Sephadex G-50 as above. 2 ng of double-stranded cDNA is recovered and ethanol precipitated.

8.2. E. coli cDNA life example 8.1. The ds cDNA of 200 mM potassium cacodylate (pH 6,9
, 1mM CoCji! z, 1mM DTT and 0.
The reaction mixture containing 75 dCTP is extended for 200 m. After premixing for 10 minutes at 30°C, 120 units of terminal deoxynucleotidyltransferase (Pharmacia) were added and the mixture was incubated for 3
Incubate for 15 minutes at 0°C. 0 of 4Ill
, 5M EDTA (pH 7,5) and 2ul of 20%S
DS is added and the DNA is extracted, chromatographed and precipitated as described above. 40ng
(20m) of this dC-tail cDNA at 81 (I0
0 ng) of oligo-d G + . -2゜tail pUC9
DNA (Pharmacia) and TNE buffer 172 and incubated for 10 minutes at 65°C, 1 hour at 46°C, 1 hour at 37°C, and 1 hour at room temperature. Using annealed cDNA, D, Hanahan, JoMol, Biol, +
Combitene) E, coI prepared for transformation as described by J.D., 1983, D., 557.
Transform JHB101 (LM1035 strain) cells. Add 1 μl of annealed DNA to 200 pl of competent cells and place on ice for 30 minutes. Repeat this method 60 times. After 90 seconds of heating and cooling in water for 2 minutes, 0.8 ml of SO per tube.
C medium is added, which is then incubated for 60 minutes at 37°C.

After incubation, all tubes were combined and 3 tubes containing 25ttg/ml ampicillin were added.
Plate on two Manconchi agar plates (I2c+n). Incubate the plates overnight at 37°C. 2500 resulting recombinants per plate are picked onto a nylon membrane (Pall-Biodyne) and two replicas are made. Master filters were stored at 4°C on agar plates and Man3at
Process replicas for colony hybridization as described in the 3s handbook.

8.3. Full sifting example 8.2. Replica filter at 32℃ for 2 hours.
0.9 M NaCji! , 0.18M Tris-
H(J! (pH 8,0), 6mM EDTA,
0.2% SDS and 50 μ/− modified calf thymus D
Prehybridize in 100ml of 2x Denhardt's solution containing NA. Hybridization is carried out for 36 hours in the same solution 1- containing 2 x 107 dpm of oligonucleotide mixture 2 (Example 6) in a sealed plastic bag. After hybridization, filters are washed and exposed to X-ray film overnight. Positives appear on both replica filters. Six positive clones are grown and their plasmid DNA is analyzed for restriction analysis.

The longest cDNA insert from these six clones (
Approximately 500 base pairs, clone 3) was selected and the same cDNA
Rescreen the library and the second cDNA library. This second cDNA library is
To obtain a full-length cDNA clone, prepare it as follows151).

8.4. To the second cDNA - library - 9S mRNA encoding MRP-8 (fraction 23 of Example 6) 10I
11 (I■/艷) was mixed with 25% RVT buffer, 2.54% 20mM dNTP mixture, 5I11 law/m# oligo-"r'+z-+s (Pharmacia), 1 μl α
-”P -dCTP (I0μCi, 3000Ci/
mmol), 3plRNasin (60 units, Biotic), 3I AMV reverse transcriptase (66 units, Genophyt) and 2I water. This mixture was incubated at 42°C for 1.5 hours, then 2Il! of 0.5 MB [
The reaction is stopped by adding 1TA (pH 7.5). Denature the RNA and convert the cDNA to Example 8.1
．． Collect as follows.

This cDN8 was transformed into a 32J c
DNA (2,8Ig), 10thl of 1M sodium cacodylate (pH 7,0), 5Ill of 10mM
CoCA2.5 pl of 1mM DTT, and 10μcf
of 3H-dCTP (20 Ci/mmoj!, 10 bar lyophilized). After a 5 minute preincubation at 37°C, 3 μl of terminal deoxynucleotidyl transferase (8
Add 1 unit (Pharmacia) and incubate for 10 minutes. 50 pl of TNE buffer are added and the solution is extracted with 0.1 mff of phenol/chloroform mixture. Precipitate the cDNA by adding 0.2 mi of ethanol and cooling on dry ice.

After centrifugation, the pellet is washed with 70% ethanol, air dried, and dissolved in 13 ul of water.

13 trl water, 25 μl RVT buffer, 2.54 20 mM dNTP mixture, 5 pI 0.2*/m
l Oligo d G +□-78 (Pharmacia), 3μ
! of α-32P-dCTP (I0 mCi/ml, 3
000Ci/mmol) and 3I reverse transcriptase (6
6 Unisoto, Genophyte) solution of the above cDNA in 42
Incubate for 1.5 hours at °C. 0.5 of 2I
The reaction was stopped by the addition of M EDTA (pH 7.5) and 50% TNE buffer, and the mixture was brought to 0.5%.
Extract with a phenol/chloroform mixture of 15+nff1. The aqueous phase was transferred to a Sephadex G-50 column (TNE).
2.5 m) in buffer and collect the flow-through portions containing 1.3 ttg of ds cDNA. D by adding 1 ml of ethanol and cooling on dry ice.
Precipitate NA. The resulting pellet is dissolved in 32 °C of water and extended with oligo-dC as described above for isolated cDNA. 1μ! of 0.5M
The reaction was stopped by the addition of EDTA (pH 7,5) and the sample was transferred to a TB using a 0.5 m wide slot.
Load onto a horizontal 1% agarose gel in E buffer. 5V
/cm for 1 hour, 0.35-0.
The region containing the appropriate size cDNA of 7 kb is excised and placed in two micro-collodion bags (Sartorium) and soaked in water. 0.3- of water is added and the bag is placed in an electrophoresis apparatus containing half-strength TBE buffer. The DNA is electrophoresed for 20 min at an electrode distance of 5 V/cm and recovered from the bag by vigorous pipetting. After extraction with a 0.6-ml phenol/chloroform mixture, 40 IJ1 of 3M Na08c (pH 5,5) and 1.2 ml of ethanol are added and the solution is cooled in dry ice for 10 minutes. After centrifugation (Eppendorf centrifuge, 5 min), 164 ng of ds cDNA was recovered and 18
pno's 10111M Tr+5-H(J (p)18
．． 0) and lmM EDTA.

20 pi (27 ng) of the above cDNA was added to 8 ttl.
Oligo-dCylo-2O (100 ng) was annealed with pUC9 DNA (Pharmacia) and the resulting DNA was used to generate competent E as described above (Example 8.1).

E. coli HB101 (strain LM1035) cells are transformed. The 2600 resulting recombinants per plate are picked onto nylon membranes (Pail-Biodyne) and two replicas are made. Master filters are stored on agar plates at 4°C and replicas are processed for colony hybridization as described in the Maniatis handbook.

8.5. c from the 1Ig plasmid of Kurifish 23 Eku clone 3 (Example 8.3)
The DNA insert is digested with old ndlI and EcoRI restriction endonucleases and isolated by agarose gel electrophoresis and gel eluted. pure cDNA
The insert (100 ng) is made radioactive using Amersham's Two-Twin Translation Kit (N, 5000) according to the supplier's instructions. This radioactive cDNA probe has a specific activity of 5 x 10'' dpm/μg.

The replica filter of Example 8.4 was added to 0.9 M NaC.
7! , 0.18M Tris-HCjl! (pH8
,0), 6mM EDTA, 0.2% SDS and 50
Prehybridize for 2 hours in 100ml of 2 Mediciheart solution containing 1/ml of denatured calf thymus DNA. Heat-denatured nick translation cDNA probe (60X
Hybridization is carried out overnight in the same solution 1- containing 106 dpi). After hybridization, filters were treated with 0.9 M NaC4, 0.18 M
Tris-HCff (pH 8,0), 6mMEDT
A and 0.2% SDS at 65°C, followed by 0.45M NaCl1.
0.09M Tris'H (IJ! (pl+8.0
), twice at 65°C in a solution of 200°C containing 3mM EDTA and 0.2% SDS, and 0.15M
NaCj! , 0.03M Tris-HCJ! (pH
8,0), washed twice with 200 mf of a solution containing 1 mM EDTA and 0.2% SDS. The filters are exposed to X-ray film overnight and positives appear on both replica filters.

l MRP-14 cDNA cloning 9.1. MRP-14-encoding mRNA from fractions 12 and 13 (Example 7) of each 20 m (0,125+ng/mE)
70 m RVT buffer for 60 min at 42°C.
μ! of 20n+M dNTP mixture, 1/20 μl of
Oligo-dT+z-+Il (Pharmacia), 3pl
RNasin (60 units, biological), 2
IJ1 AMV reverse transcriptase (66 Unisoto, Genophyto) and 7 μl α-32P-dCTP (I, c+c
+, incubated in a solution containing 3000 Ci/mmo71. 6 μl of 0.5 MEDTA (
The reaction is stopped by adding pH 7.5).

RNA is degraded by incubation with 3.75 pl IN NaOH for 1 hour at 65°C. The solution is neutralized by the addition of 25 pl Tris-H (J! (pH 8,0) and 6 pl INHcl. After adding SDS to 0.5%, 1
Extract the solution with 00 μl of phenol/chloroform (I: 1). Pass the aqueous phase through a 2 ml O column containing Sephadex G-50 in TNE buffer 62
×105dpm32P (I, Opg) -terminal chain c
DNA was collected from both flow-throughs (0.4 mg) and l
Precipitate by adding ml of ethanol. Collect the sediment by centrifugation.

cDNA8 was extended with oligo-dC as described for MRP-8 cDNA in Example 8, 4, followed by dNTP mixture in RVT buffer, oligo-d
G+z-+e (I' ”P dcTP and H3 t
d(7) Process at 37° C. for 60 minutes using a reverse transfer IM element. After phenol/chloroform extraction, the aqueous phase was applied to a Sephadex G-50 column (2.5 mE in THE buffer).
and collect the flow-through (0.4 m#) containing 0.53 Mg of ds cDNA. The DNA is extended by oligo-dC tilt and then applied to a horizontal 1% agarose gel in TBE buffer using a 0.5 cm wide slot. After 1 h of electrophoresis at 5 V/cm, cDNA with suitable size of 0.5-0.75 kb
The region containing A is excised and electrophoresed as described in Example 8.4. 1100n ds c
Collect the DNA and add 200μ/10mM Tri
s-H (J! (pH 8,0) and 1 mM EDT
Dissolve in A.

9.2. 20 ng (20 ng) of the dC-tailed ds cDNA from E. coli cDNA library Example 9.1.
μZ) 30til (60ng) oligo-dG+
o-zO tail pUc-KO DNA and 1 of 20III
Mix with 0x TNF buffer and incubate sequentially for 10 minutes at 6°5°C, 1 hour at 46°C, 1 hour at 37°C and 1 hour at room temperature. pUC-K
The O plasmid is a derivative of pUc9 (obtained from Pharmacia), in which Iac Z
The promoter/operator region of the gene has been removed between the Hae U restriction site just outside the promoter sequence and the old ndllT restriction site within the polylinker, creating pUC
Other sequences of the 9 plasmid remain unchanged.

Using annealed cDNA plasmid DNA, M
The RP-8 cDNA was isolated from competent E, coli 1 (B101 (LM103) as described in Example 8.2).
5) Transform the cells. Two replicas are made from six pine conch agar plates containing 2500 recombinants each. Master filters on nylon membranes are stored on agar plates at 4°C and replicas are processed for colony hybridization.

9.3. ffi death determination Hybridize at 37° C. in a solution containing oligonucleotide mixture 3 of Example 7 in a sealed plastic bag as described for prescreening in Example 8.3.

Positive colonies grew and their plasmid DNA
A is isolated for restriction analysis.

pMRP-14 with an insert of approximately 500 nucleotides
A recombinant plasmid designated as -10 was selected and the same cDNA
Rescreen the library. This clone p
The cDNA insert from plasmid 1n of MRP-14-10 was removed by digestion with old ndllI and EcoRI restriction endonucleases and transduced with radioactive 5 X 108d using a nick translation kit.
specific activity of pm/μg). This probe is used to rescreen the replica filter of Example 9.2 as described in Example 8.5. Positives appear on both replica filters.

Example 10. DNA alignment encoding MRP-8 The cDNA insert of clone 3 (Example 8.3) and a number of cDNA inserts from the positive clone of Example 8.5 were selected and analyzed using the well-known method of Sanger and Maxav
The complete nucleotide sequence is determined using the method of I and G11bert. The coding region is sequenced on both strands, using restriction sites in the sequencing strategy determined on the overlapping fragments.

This strategy is summarized in Figure 2 (Part C) and the restriction sites are shown (Part E). Clone 3 coding cDNA
Express the sequence (and the amino acid sequence it encodes) with the formula (■)
Shown below. Bar) A in FIG. 2 shows the entire sequence of this cDNA. Special features and differences between this cDNA of clone 3 and other clones are indicated by numbers and are described below.

1. Position 1: The sequence up to the end of clone 3, position 6B, is present only in clone 3 and is not found in the gene.

2, position 69: ends of clones 8 and 15; clone 3
and A in clone 15 and T in clone 15.

3.72nd position: Clone 8 from GGCAA in clone 3
and 6 bases have changed to TCTCTT in 15.

4.86th position: End of clone 7.

5, 102nd position: 17 bases AAG in clone 15
GTTCTGTTTTTCAG is inserted.

6, position 108: end of clone 14.

7, position 109: clone 2 and 110 (7) end.

Positions 8 and 113: T has been inserted in clones 7, 8.14 and 15.

Positions 9 and 115: The base is changed to T in clones 2 and 110.

10th and 124th position: Start of coding region.

Position 11, 378: AA not found in the gene is inserted into clone 2.

Position 12, 403: End of coding region.

13, 475th position: Start of poly A-til.

DNA arrangement encoding MRP-14 Two clones (Example 9.3, pMRP-14-10 and pMRP-14)
The cDNA insert of RP-14-16) is selected and the entire nucleotide sequence is determined. This method is illustrated in FIG. The coding cDNA sequences (and the amino acid sequences they encode) of these clones are the same and are given by formula (IX).

Three other clones (pMRP-14-15, 18 and 19) are analyzed for their 3'-ends. All have the formula (I
mRN
It lacks the natural 3'-end of A.

DNA encoding trp promoter and MRP-8
An expression vector for E. coli containing the insert is prepared by substantially the same method as described for the corresponding Nigrin C expression vector in European Patent Application EP 146,785.

12.1.5 Plasmid pHR4148 (EP 146,7
85) is completely digested using BamHI. The ends are dephosphorylated using 3 units of bovine intestinal alkaline phosphatase. The DNA is extracted with a phenol/chloroform mixture and then digested to completion with EcoRI.

Vector DNA is isolated by agarose gel electrophoresis and electroelution as described for cDNA in Example 8.4. Dissolve the vector DNA in water at a concentration of 0.5 μg/ml.

12.2. Yuno left summer dish 5' -AATTCATGCTGACTGAGC
-3' and 5' -TCAGTCAGCA
TG-3' was purified using standard methods (H, R4nk, etc., Nucle
irAcid Re5earch, 1984, ear,
6369). The shorter oligonucleotide of 2■ is phosphorylated using ATP and nucleotide kinase, and then ligated to the dephosphorylated larger oligodeoxynucleotide of 2ttg using DNA ligase. Following ligation, the ds DNA is digested to completion with Alul. DNA was extracted with a phenol/chloroform mixture, precipitated with ethanol and reduced to 10ΔH20? Understand.

12.3. 20 pg of clone 3 cDNA (Example 8.3) was added to Ba
Completely digested with mH1 and Pvu U, and about 4 s
The obp cDNA insert is isolated by agarose gel electrophoresis and gel elution. 3 μg of this DNA fragment was
It is partially digested with luI and the approximately 340 bp fragment is isolated as described above. 70℃ 1g of this DNA
μ! Linker-DNA solution 8I of Example 12.2 in water. The resulting DNA was completely digested with EcoRI and BamHI, and the resulting fragment of approximately 440 bp was digested with P
Isolate by EGE and electroelution.

12.4. Example 12.1 0.5 ml of the vector and 50 ng of the insert-linker DNA of Example 12.3 are ligated. DNA obtained
Competent E as above (Example 8.2) using
, to transform E. coli HB101 (strain LM1035) cells. Expected restriction enzyme pattern and insert DNA
The recombinant pMRP-8-trp shown in sequence is selected for expression of MRP-8.

12.5. E containing u pMRP-8-trp (Example 12.4),
7g of Na2HPO4, 3g of KH2 per 11
PO,,0.5g of NaCJ! , 1g of NH4CJ!
, 5 g glucose, 0.02 g CaCAz, 0
．． 25g MgSO4, 25g casamino acids, 0.1g
Medium 2 containing thiamine and 50 μm of ampicillin
Grow overnight at 37° C. in 00 mN. culture,
Dilute in the same prewarmed medium as above supplemented with 12.5 Ig/me β-indole acetic acid. After 4.5 hours, the optical density 0D65o reaches 1.3. Collect cells by centrifugation. Control cultures are prepared similarly using E. coli containing pHR1148.

12.6. - History: 1 day The bacterial pellet was mixed with 5Qml of 50mM Tris-HC1.
1! (pH 8,0), both suspended in 30 mM NaCl and 1 mg/ml egg white lysozyme. This suspension is kept in water for 1 hour. 0.1mM PM
SF is added and cells are disrupted by cycles of freezing in liquid nitrogen and thawing at 37°C. 5S340-
The cell lysate is clarified by centrifugation at 17,000 rpm for 30 minutes at 4° C. in a tar (Tsurpal).

12.7. , ,-”几 5onify
d) 50mM prepared from the bacterial pellet of Example 12.5
Hepes (pH 8,0), 30 mM NaCJ!
and cell suspension in 0.1% ethanolamine (o D6
5. = 20) Mix 22.5 m2 with 18 g of urea. The suspension is sonicated for 3 x 30 seconds at 30 minute intervals with an MSE Sonic Prep 150 using a 9.5 m probe and 24 micron intensity. Tsurupal 5S340-
The cell lysate is clarified by centrifugation at 17,000 rpm for 30 minutes at 20° C. in a microcontroller. 0.1mM
CaCj2z.

MgCNz, CoCjl! z, ZnCAz
, MnCj! 2. CLISO4 and FeSO
4 and 10mM Hepes (pH 7,5)
, 130 mM NaCl and 0.1 mM of the same salts as above, dialyzed in three changes. The dialysate was prepared in Example 12.
Clarify by centrifugation as described in 6.

■E in the above table tr promotion -〇　'.

DN encoding trp promoter and MRP-14
An expression vector for E. coli containing an A. insert,
Prepared by substantially the same method as described in Example 12.

13.1. Standard method (H, Rink, etc., Nucleic Ac1
d Re5search 1984, ■, 6369) using the following oligodeoxynucleotide: (I) 5'
-AATTCATGACTTGCAAAATGTCG
CAG-3′, (2)5′-CTGCGACATT
TTGCAAGTCATG-3', (3) 5'
-AATTCATGTCGCAG-3' and (4)
5'-CTGCGACATG-3' is synthesized. Oligodeoxynucleotides 1 and 3 are phosphorylated using ATP and polynucleotide kinase by standard methods. Phosphorylated oligodeoxynucleotide 1
and an equimolar mixture of unphosphorylated oligodeoxynucleotides and phosphorylated oligodeoxynucleotides 3
and unphosphorylated oligodeoxynucleotide 4 are prepared. Mixture 1-2 is used to construct a plasmid expressing MRP-14, and mixture 3-4 is used to construct a plasmid expressing MRP-14d in which the first four nucleotides of MRP-14 are deleted.

13.2. Plasmid pHR1148 prepared in Kuji Kaiku ■■ Cleft Example 12.1
Example 13.1
Linker mixtures 1-2, and 34 (50 pmoA) of
Connect with. Separate vector DNA from free linker by agarose gel electrophoresis and gel elution. 10p
g clone pMRP-14-10 cDNA (Example 9.3
) is digested to completion with BamHI and Pvu H, and the approximately 430 bp cDNA insert is isolated by agarose gel electrophoresis and gel elution. 25g each of this cD
The NA insert was inserted into 0.2 n vector-linker-1-2 (
MRP-14) and 0.2 μg vector-linker-3
-4 (MRP-14d). The resulting DNA is used to transform competent E. coli HBI cells (LM1035 strain) as described above. Recombinant pMR showing the expected restriction enzyme pattern and DNA sequence of the insert.
P-14-trp and pMRP-14d-trl),
Select for expression of MRP44 and MRP-14d, respectively.

pMRP-14-trp or pMRP-14d-trp
E. coli containing (Example 13.2) are grown and treated as described in Example 12.3.

Cells are treated with lysozyme or disrupted by sonication in a urea solution and the cell lysate is prepared in Example 12.6.
and processed as described in 12.7.

14.1. Plasmid pPLc24 (E, Remaut, P,
5tanssens and W, Fiers, Gene
1981, ■, 81) is digested with EcoRI and then treated with Klenow polymerase and dNTPs to blunt ends. The DNA is treated with Bam) II and the resulting vector DNA is isolated by agarose gel electrophoresis and electroelution. pMRP-8-trpDNA
(Example 12.4) is completely digested with BamHI and partially digested with HpaI. A fragment of approximately 440 bp is isolated by agarose gel electrophoresis and electroelution.

This fragment was ligated into vector DNA from pPLc24 and the resulting DNA was used to generate wild-type E.

12 was transformed into E. coli. Transformants are plated on one plate containing 40 μl of ampicillin. Standard sequence analysis of recombinants is performed to confirm the correctness of the construction.

Using DNA of the correct sequence, E. coli W3110 and ) 18101 strains (both with λcI857) (R
emaut et al. cited above).

Transformants are plated on single plates containing 40 n/- of kanamycin and ampicillin. The resulting recombinant 11MRP-8-PL is used for fermentation.

14.2. The recombinant p) IRP-8-P+- is grown overnight at 30°C in LB medium containing 40 tnr/ml ampicillin and kanamycin. The culture is diluted 1:5 with the same medium and incubated for 2.5 hours at 42°C. Cells are lysed as described in Example I2, 6 or 12.7.

pMRP44-tri) and pMRP-146-trp
and plasmid pPLc24 and used to transform E. coli 12, W3110 and HB101 as described in Example 14.1. Resulting recombinants 1) MRP-14-PL and pMRP-14d-PL are grown in LB medium as described in Example 14.2 and lysed.

611g plasmid pJDB207R/PH0-T
PA12-2 (European patent application EP 143,0
81) is completely digested with the restriction endonuclease BamHI. The resulting DNA fragments of size 6.8 kb and 2.4 kb were precipitated with ethanol and
Resuspend in 50mM Tris-HC4 (pH 8,0) in trl. Add 4.5 units of calf intestinal alkaline phosphatase (Boehringer Mannheim). The mixture is incubated for 1 hour at 37°C. 65°C
The phosphatase is inactivated by incubation for 1.5 hours at room temperature. The solution was diluted with 150mM NaCJ!
Adjust to. 150mM NaCj2 and 1mM ED
10mM Tris-HCj containing TA! (pH
7,5) equilibrated with 100μ! bed DB52
(Whatman) Applies to anion exchangers. After washing with the same buffer, the DNA was added to 400 μl of 1.5 M NaCj
! , 10mM Tris-HCj! (pH7,
5) and eluted with 1mM EDTA and precipitated with ethanol. The large 6.85 kb BamHI fragment
Separate from small fragments on a 1% agarose gel in TBE buffer. The DNA fragments were electroeluted from the gel, purified by DE52 anion exchange chromatography (see above), precipitated with ethanol, and dissolved in water.
．． Resuspend at a concentration of 1 p moρ/Δ.

Application EP, 100.561) to EcoRI and BamH
Digest with I.

The resulting three fragments are separated on a 1.2% agarose gel in THE buffer. 534bp BamHI-Eco
The RT fragment comprises the PH05 promoter. DNA
The fragment was electroeluted from the gel, purified by DE52 chromatography, ethanol precipitated, and 0.1
Resuspend to a concentration of pmoβ/lri.

16.3. 0.4 kb encoding MRP-8
DNA ゛J胛1101I plasmid f1MR
P-8-trp (Example 12.4) with BamHI and Ec
Digest with oRI. The resulting two types of DNA fragments are 1.2
% agarose gel.

A 0.4 kb fragment was isolated as above and 0.1 pmoj! in water. Resuspend at a concentration of /lrl.

16.4. 6.8 k of ordinary human skin piece ■ stray boar 0,1 p mob (0,45μg)
bBamHT vector fragment, 0.2 pmoj! (
70pg>534bp BamHI-EcoRI
PH05 promoter fragment and 0.2 p mo7! (
0.4 kbE of pMRP-8-trip (52 ng)
coRT-BamH■ fragment in 15 pl of 60mM
Tris-HCl (pH 7,5), 10mM MgG
#2. 10mM DTT, 1mM ATP and 6
00 units of 74 DNA ligase (Biolapse)
Connect the books at 15°C for 6 hours in a room. 1111 of the ligation mixture
Add an aliquot to 100 μl of calcium-treated transformation-competent E. coli HB101 cells.

12 transformed ampicillin resistant colonies 1
Grow individually in LB medium containing 00 μg/me ampicillin. Holmes et al.'s method (An
al.Biochem, 1981.114.193
) and prepare plasmid DNA according to BamH
I and old ndll[/EcoR1 digestion.

The appearance of the 780 bp BcoRI-H1ndllI fragment indicates the correct orientation of the PH05 promoter-MRP-8 DNA insert. Such a loan was isolated and designated pJDB207R/plate, MRP-8.

Plasmids for MRP-14 and MRP-146 in Saccharomyces cerevisiae were plasmid pJ
DB207R/PH05-TP^12-2 and p
MRP-14-trp and pMRP-146-tri)
prepared as described in Example 16 from the 0.4 kb BcoRI-BamHI fragment of .

E. Transformed ampicillin-resistant colonies of E. coli HB101 cells are grown individually in LB medium containing 1100 p/me ampicillin. plasmid DNA
and BamHI and old nd ]II/EcoR
Analyze by I digestion. 780bp EcoRl-Hl
ndnl[The appearance of the fragment is PH05 promoter-MRP
44 or - MIIP-146 indicates the correct orientation of the DNA insert. Isolate the loans like this, and p
JDB207R/dish-ηRP-14, and pJDB20
It is named 7R/pH05-MRP-14d.

Plasmid pJDB207R/Hiroto1'1RP-8,
pJDB207!1/dish-MIIP-14, and pJD
B207R/PH peeled liver P-14d,) 1inne
n etc. (Proe, Natl, Acad, Sci, 1JS
Saccharomyces cerevisiae GR using the transformation method described by A.
F-18 (α, ”Wataru 3-11, his 3-15, l
eu 2-3, leu 2-112, Kanl+). Transformed yeast cells are selected on yeast minimal medium lacking leucine. Single transformed yeast colonies were isolated and Saccharomyces cerevisiae G.
RF1B/pJDB207R/Machi-MI'1P-8,
GRF18/pJDB207R/Fake-MRP-14 and GRF18/pJDB207R/PH part-MRP-14
Name it d.

The transformed yeast strain Saccharomyces cerevisiae GI? F18/pJDB207R/Rikikawa Toki P-8,
GRF1B/ pJDB207R/ PH residence-Ding P-1
4, and GRP18/pJDB207R/Taka-MRP
-146 in 50% yeast minimal medium (Difco Yeast Nitrogen Base, which does not contain amino acids).
% glucose and 20μ/l L-histidine) for 25 hours at 30°C.
Shake until the concentration is -. Cells were washed with 0.9% NaCl and 0.03 g/j! 112PO4,1g
/β KCl, 10 g/β L-asparagine ((NH
t) instead of 2SO4), 2% glucose and 1 g
/x Noshiichi Difco yeast containing histidine
Nitrogen-based medium (no amino acids)
Prepare according to the recipe. Starting OD, into the medium. . 09
Vaccinate to 25. Cells are grown for 24 hours at 30°C and 0D6oo are harvested at this point.

Cells in low Pi medium for 35 d were collected by centrifugation and total 4 mβ was added to cold 66 mM sodium linsan (pH 7,
4) and resuspend in 0.1 v/v% Triton X-100 buffer. Transfer the cell suspension to a 30 m2 collection tube, add 8 g of glass beads (0.4 gm diameter), and mix the suspension at full speed on a Portex mixer (Scientific Instruments, USA). Shake for 4 minutes and then cool in a water bath. This method destroys over 90% of the cells. Cell debris and glass beads were collected at 4°C in a Tsurpar HB-40-tar.
, by centrifugation at 8000 rpm for 10 minutes. The supernatant is transferred to an Eppendorf tube, frozen in liquid nitrogen and stored at -60°C.

Dialysis (Spectraball membrane 11h3.3.5 kD) against 1 (Cl, 0.01% DTT (pl+8.5)
Cutoff, Spectrum Medical Industries).

The dialyzed solution was transferred to a DEAE trisacrylic M (LKB) ion exchange column (2,6
x 10 cm). After loading the sample, the '+lamb is washed with dialysis buffer until the UV254nm absorbance is relative to baseline levels (Ubicode, S, LKB). Protein bound to the column was purified by a linear gradient of NaCl increasing from 0.0 to 0.2 M in dialysis buffer and then in dialysis buffer/0.2 M.
NaCA (80 ml> and dialysis buffer/1.
Elute with OM NaCj2 (200 mf) at a flow rate of 1.8 ml/min (Peristal pump P-r, Pharmacia).

Both individual 9 ml aliquots (collected by Ultrolac ■, LKB) were separated on a 15% polyacrylamide slab gel.
DS-PAGE (II, Laemmli, Na
ture 1970, ■, 6B0] and pooled according to their MRP-8 content. 180
Both pools (BioRad conductivity monitor) eluting between ~380 μS are reduced to a volume of 5.5 μS by ultrafiltration (YM-10 membrane, Amicon > tS).

Samples of the crude cell lysates of Examples 12.7.14.2 and 19 containing MRP-8 are processed in a similar manner.

20.2. Size: The concentrated pool from Chromatography Example 20.1 was transferred to a HPLC pump 2150, L
2 channel recorder 2210 from KB and Kra
HPLC UV detector spectroflow 7 from tos
57) IPLC system, 30mM Na0Ac and 150mM NaCj! G3000SWG fast gel filtration column (LKB
). The maximum sample volume applied is 2
rd, the flow rate is 3-7 minutes, and both fractions are automatically collected every minute (Fraction Collector Superrack, 2211, LKB). 5DS-PAGE
Both fractions eluting between 163 ml and 182 ml of elution volume were pooled and concentrated to a volume of 6 ml by ultrafiltration as described above.

Margin below 20.3. 0.8 ml of the concentrated pool of Example 20.2 is diluted with 3 ml of water and adjusted to pH 8.5 with dilute ammonia. This solution was mixed with 20mM jetanolamine-HC.
Mono-QHR51 equilibrated in l (pl(8,5)
5 column (FPLC, Fast Protein, Polypeptide, Polynucleotide Liquid Chromatography System, Pharmacia). The column was washed with 12ml of jetanolamine buffer and 0.0ml in the same buffer.
05~0.125M NaCj! Straight line NaC7! The gradient elutes at a flow rate of 1.5 m/min over 21 minutes. Both parts of the individual peaks are collected manually according to the UV280nm elution pattern.

20.4. As an alternative to sulfopropyl ion chromatography size exclusion chromatography and monoQ ion exchange chromatography (Examples 20.2 and 20.3), the concentrated pool from Example 20.1 (ca.
52-) containing 0 μm of protein in 50 mM Na0Ac
/0.01% DTT (pH 5,5) (starting buffer) and equilibrated with the same buffer.
P Tris Acrylic M (LKB) ion exchange column (2
, 5X10 cm). The column is washed with buffer until the UV254nm absorption reaches baseline levels. The protein bound to the column was dissolved in 0.0 M to 0.5 M NaCj! in the starting buffer. A linear gradient of starting buffer/0.5 M NaC7! (I
00mf) and starting buffer/1.0 M NaCjl
! (Elutes at a flow rate of 2.0-7 minutes with I00 mJ. MRP-8 is 0.25M to 0.35M NaC/!
It elutes between. The purity as determined by 5O5-PAGE is higher than 90% at this stage.

20.5. ! The protein fraction of Citrus Example 20.3 or 20.4 was added to Varian 50.
Vydac 218 using a 00 liquid chromatograph.
Further purification is performed on a TP 5415 reverse phase HPLC column (The Sailations Group, Hesbarrier, CA, USA). Column with 65% 0.1% TFA in water.
Equilibrate in a mixture of 35% and 0.07% TFA in acetonitrile. 5 minutes after injecting the sample, 12
Start a linear gradient for 0.1% TFA in water.
45% and 55% 0.07% TFA in acetonitrile
The flow rate is 1-7 minutes. The eluate is 21
Monitor by UV absorption at 5 nm.

MRP-8 has a retention time of 14.5 minutes and 15.5 minutes, respectively.
Elutes in two separate peaks at 8 minutes. As shown by 5O3-PAGE under reducing or non-reducing conditions, the early eluent is the 1,000-mer form of MRP-8 (apparent molecular weight 8 kD) and the second peak is the dimeric form of MRP-8. body disulfide bond derivative (apparent molecular weight 16kD)
Consists of.

m Hatanuki■Jl Kaiyu Somakura 21.1. M, W, Hunka
pillar, E, Hood, Methods
in Enzymology 1983, ■, 399
Gas phase protein sequencer model 470 according to the method of
(Applied Biosystems) for N-terminal amino acid sequence analysis. Anilino-thiazolinone derivatives are converted to phenylthiohydantoin (PTH) amino acids by treatment with 25% aqueous TFA at 50°C. PTH amino acids were added to a Zorbax CN HPLC column (DuPont, 200 x 4, 6 m) (R, Kne
cht et al., Anal, Biochen+, 1983.
Law, 65] as analyzed above. The following N-terminal amino acid sequence is found.

Met-Leu-Thr-Glu-Leu-Glu-L
ys-Ala-Leu-8sn-Ser-11e-11
e-Asp-Va 1-Tyr-X + 7-Lys-
Tyr-3er-Leu-11e-Lys-Gly-A
sn-Phe-Xz7-Ala-Val-Tyr-Xl
l-to sp-to 5p-Leu-Lys-Lys-Leu
-Leu-Glu-Thr-Glu-X*z-Pro-
Gln-Tyr-11e-X47-Lys-Lys-G
ly-Ala-Asp-Val-Trp-Phe-Ly
s-X+y, X27, X3+, X4□ and X4. is an undetermined amino acid. This sequence matches the sequence of formula (I) or (II) determined by cDNA analysis (Example 10).

Margin below 21.2. Tanuki "Konben" analytical reverse phase HPLC, Vydac 218 TP-B5
On -5μ (4,0×1201), EP 162,81
For human MIF 8kD of Example 2, MRP-8 of Example 20, and mixtures thereof, 65% 0.1% TFA in water
A mixture of 0.08% TFA in water and 35% in acetonitrile to 0.1% TFA in water and 45% in acetonitrile
．． 08% TFA to 55% mixture using a 30 minute linear gradient. Human MIF 8kD and MR
P-8 was not identified under these conditions and 11.2
Elute with a retention time (UV absorption at 215 nm) of minutes.

21.3 Size Chromato Goofy MRP-8
and the dimeric disulfide-linked MRP-8 derivative of Example 20 in 30mM Tris-HCj! and 150mM Na
Shimpack Diol 1 in C# (pH 7,0)
Chromatographic analysis is performed in a 50 High Performance Size Exclusion Chromatography Column (Shimazu, ?, 9X500 mm) at a flow rate of 1-7 minutes. UV absorption is measured at 215 nm. Cytochrome C (I2kD), a standard molecular weight marker
, myoglobin (I7kD), carbonic anhydrase (30kD), ovalbumin (45kD) and BS
When compared to A (66,2kD), the monomer MRP-
8 elutes after 16.4 minutes with an apparent molecular weight of 30 kD, and the dimeric MRP-8 derivative elutes after 15.1 minutes with an apparent molecular weight of 42 kD.

21.4 Mass Spectrum The molecular weight of MRP-8 was determined by the fast atom bombardment (FAB-MS) method according to M. Barber et al. (Nature 1981, la, 270).
AB-5t! 7! , determined using a hectrometer (VG Analytical, Manchester, GB) at 8 kV. Ionization is performed using a 35 kV cesium gun. Thioglycerol containing 0.1% TFA is used as matrix.

M (calculated value): 10' 823.53 M (measured value): 10' 833.6 ± 2.1 (average of 4 measurements) An aliquot of MRP~8 was treated with 1/10 amount of trypsin, chymotrypsin, or Digest with ■8 protein from Staphylococcus aureus (in 50mM NH4HCO3). V88 cut is 1.25 NHC7 in methanol
! Conversion to the methyl ester is carried out at room temperature for 1 hour. Trypsin fragment (50Mg) is 50IJ! of performic acid (part I of 30% H20□ and 29 parts of HCOOI ( ) for 2 hours at room temperature. PAB-MS of the underivatized, esterified and oxidized fragments were respectively Amino acids 1-16, 19-41, 57-7
0, and 72-77.

Example 1 from E. coli containing pMRP-14-trp
3.3 The crude cell lysate 90- was dialyzed and Example 2
DEAE) Lisacrylic M (LKB) ion exchange column (5X10 cm) as described in 0.1
Purify above. MRP-14 is a bipartite mM Tris-
HCj! ,.

0 in 0.01% DTT (pH 8,5) (dialysis buffer)
．． 12~0.15M NaCj! Elutes at a concentration of Samples of crude cell lysates containing MRP-14 from Examples 15 and 19 are processed in the same manner.

22.2. A pool of recombinant MRP-14 (6Bmffi) containing both the sulfopropyl ions from Example 22.1 was acidified to pH 5.5 with 10% acetic acid and 50 mM NaAc/0.01% D
Pump onto a SP) Lisacryl M (LKB) ion exchange column (2,5X10 cm) equilibrated with TT (pH 5,5) (starting buffer). UV254r
The column is washed with starting buffer until +m absorbance reaches baseline level. Proteins bound to the column were washed with 0.0 M to 0.5 M NaCJ! in starting buffer.
linear gradient of starting buffer/0.5 M
Na(J(80-) and starting buffer/1.0 M
NaCj! (200 m) at a flow rate of 1.7-7 min. Both portions of individual 17- are collected and analyzed by 5DS-PAGE. Recombinant MRP-14 from the pooled fractions is judged to be more than 90% pure at this stage by 5O5-PAGE.

22.3 Recombinant MRP-14 of Renm Engineering Example 22.2 was converted into 2187P-85-
Further purification is carried out on an HPLC column (0.4 x 12 cm) packed with 5μ (I8B Barations Group). Using the equipment and conditions of Example 1.1. That is, 0.1% TF in water
A65% to 45% and 0.07% TF in acetonitrile
In a 30 minute linear gradient from 35% to 55% A, MRP-14 elutes after 13.8 minutes. Dimeric disulfide-linked MRP-14 elutes after 16.2 minutes. This dimer was prepared at 1 at room temperature in 0.2% DTT.
It can be converted to monomeric MRP-14 by treatment for 5 minutes.

22.4. The purified MRP-14 of Example 22.3 is subjected to N-terminal amino acid analysis as described in Example 21.1. next N
- The terminal amino acid sequence is found.

Thr-X2-Lys-Met-3er-Gin-Le
u-Glu-Xg-X+ o-11e-Glu-Thr
-I le-11e-Asn-Thr-Phe-His
-Xzo-Tyr-Xzz-Val-Lys-Leu-
Gly-Xzy-Pro-Asp-Xso-Lue-85n- X21 X91 XIO+ Xzo + X+z +
X2? and X. indicates an undetermined amino acid. MRP-1
The predicted amino acid methionine at the N-terminus of pMR
P-14-trp is clearly cleaved by the E. coli host.

22.5. mass spectrum FAB-MS is performed as described in Example 21.4.

M (calculated value, first amino acid Thr): 13' 1
10.94M (measured value): 13' 112.8
(Summed values from 3 separate analyses) Trypsin, Chymotrypsin and FAB of ■8 Digest
MS is for amino acids 10-19, 23-52, 58-
77, and 79-93.

1) 320 rds of the crude cell lysate of Example 13.3 from E. coli containing MRP-146-trp was dialyzed as described in Example 20.1 and loaded onto a DEAE) Lysacrylic M ion exchange column ( 2.6 x 10 cm).

The column was washed with BOml of dialysis buffer, then 0.0M to 0.2M NaCJ! in dialysis buffer. Elute using a linear gradient of MRP-146 is 0.08-0.
Elutes between 19M Na (J!).

23.2. The combined volumes containing the recombinant MRP-146 from Example 23.1 were acidified to pH 5.5 and treated with SP Trisacrylic M as described in Example 22.2. Add to ion exchange column. 0.0M to 0.5M in the starting buffer described above
linear gradient of 0.5M and 1.0M Na
(MRP-14d was eluted by J! and 5O5-
According to PAGE, the purity is judged to be higher than 95%.

23.3. The purified MRP-146 of Example 23.2 is subjected to N-terminal amino acid sequence analysis as described in Example 21.1.

The following N-terminal amino acid sequence is obtained.

Glu-Phe-Lys-Glu-Leu-Val-M
The predicted amino acid methionine at the N-terminus of RP-146 is missing.

Detailed pieces of human placenta are frozen in liquid nitrogen and cut into small pieces by grinding in a mortar. Several 2 ml aliquots of this finely textured powder were added to 30 ml of 0.1 M
II! DTA, 0.1 M Tris-HCji
! (pH 7.5), 1% Sarcosyl, 0.3M β-
DNA is isolated by gentle lysis on a rotary disc in mercaptoethanol and 1100 p/mR of proteinase. To prevent lump formation, pass the powder through a fine sifter before adding to the lysis buffer. Add 28 g of C5Cj2 and 10 μg of ethidium bromide and mix in a VT50 Peckman rotor at 4900 g.
DNA is banded by equilibrium centrifugation at Orpm for 36 hours. This band is separated and the ethidium bromide is extracted with isoamyl alcohol for three times. DNA 1
000 volume of 10mM Tris-BCJ! (pi
(7,5) and 0.5 mM EDTA at 4° C. for 2 days.

24.2. 10-15 μg of human placental DNA (Example 24.1) was prepared by
Restriction endonuclease BamHI, formerly ndIII,
Complete digestion with EcoRI or Pstl (Heringer) for 2 hours at 37° C. according to manufacturer's instructions. The restriction digest was treated with 50mM Tris-acetate (pH
8,0) and 10μ per slot in separate slots on a 0.6% agarose gel in 1 mM EDTA.
g) and run in this buffer at 4° C. and 100 μm for 6 hours. After electrophoresis, the gel was washed with ethidium bromide (
5trg/ml water) for 10 minutes and photographed using a UV260nm transilluminator.

24.3. The stained gel of Southern Broth Example 24.2 is exposed to 260 nm UV radiation for 5 minutes to allow efficient transfer of high molecular weight DNA molecules. The gel was then washed with 0,4 N N
Incubate for 30 min in aOH and O, 6 M Na (J!) and 0.5 M Tris for neutralization.
-HCJ! (pH 7,5) and 1.5 M NaC
Incubate for 30 minutes in A. After placing the gel on a glass plate, it was packed in 3MM Whatman paper and
Soak in X SSC buffer (3M NaCA and 0.3M sodium silicate). "GeneScreen plus" membrane pre-wetted with 2XSSC and 5c of 3MM Whatman
m piles were placed on the gel and incubated for 2 hours at room temperature for 18 hours.
Allow flow transfer of nucleic acids to 0X SSC.

24.4. Hydration of BamHI, EcoRI, old ndlll and PstI restriction digests of total human placental DNA with MRP-8 cDNA fragments.
Fragments containing sequences homologous and partially related to the 8cDNA (clone 3 of Example 8.3) are tested.

Placental DNA fragments on “GeneScreenplus” were purified with a 32p labeled probe of MRP-8 cDNA (I,
2X 10 'cpm/pg''). This probe was derived from clone 3 (Example 8.3) and cleaved a 369 bp fragment.
Prepared by Pst I digestion and two-way translation as described in Example 8.5. The membrane with DNA fragments was incubated at 65°C with 5x SSC buffer, 5x Denhardt's solution, 0.
5-10 x 1106c for 12 hours in 1% SDS and 100 g/mf calf thymus sonication carrier DNA
Hybridize with p/ml MRP-8 cDNA probe. The membranes were incubated at 65°C in 6xSSC, 4xSSC, 2xSSC containing 0.1% SDS.

1xssc and 0. Washed one after another in IX5SC,
Dry and expose to autoradiography.

Low stringency hybridization is performed similarly, but with only washes in 6X SSC containing 0.1% SDS at 65°C.

Only DNA fragments that hybridize strongly at high and low stringency are observed. BamHI digestion yielded a hybridizing 18 kb fragment, old ndI [I gave a 22 kb fragment, EcoRI
yields a 21 kb fragment and PstI yields a 5 kb fragment. This result strongly suggests that the MRP-8 gene exists as a single copy in the human genome. To check whether the genomic DNA was truly completely digested, control Southern broth was incubated with human tissue plasminogen activation Factor cDNA probe (S, Priezner-D
egen, B, Rajput and E, Re1ch.

J. Biol, Chem, 1986, 6972
) to hybridize with. Bam1l T,E
The published banding pattern with coRI, old ndl[I and Pstl fragments is confirmed.

24.5. The human fetal liver D
Restriction endonuclease Haell [and Al
Constructed by limited digestion with uI (R, M, L
awn, E, F, Fr1tsch+ R, C, Par
ker, G, BIake and T, Maniatis+
Ce1l, 1978, ■, 1157-1174).

MRP-8c using this library as described in Example 24.4.
Screen by DNA probe. 600,0
00 independent phage plaques were placed on a nylon membrane (P
all-Biodyne) and double hybridized with 8X 106 cpm 32 DNA per membrane island according to standard methods (Maniatis, Handbook). The master plate is maintained at 4°C for several months. Six positive plaques are picked, purified, and λ DNA isolated for further analysis. Southern broso analysis of the DNA showed that all six recombinant phages contained the complete gene on the phage human DNA insert. A 5 kb long Hpa I [DNA fragment containing the complete MRP-8 coding region was extracted from phage clone 3 and wild-type pB linearized with C1a I].
Plasmid pBRMRP was subcloned into R322.
-8/3A-HpaH.

The sequence determination method for the configuration of the Boosmid BRMRP-8/3A-HaI is shown in FIG. 4, and the sequenced regions are indicated by lines and black circles indicating the direction of DNA sequencing. DNA
Sequencing is performed on bacteriophage M13 isolation templates according to the manufacturer's instructions (Amersham). MRP-8
The complete DNA sequence of the gene is read on both strands.

The MRP-8 gene contains two introns (introns 1 and 2) and three exons (exons 1-3). Intron 1 interrupts the 5' untranslated region 23 nucleotides upstream from the ATG start codon, while the other 150 bp
Intron 2 of length connects the coding region to the amino site W47
Interrupted at . Non-coding exon 1 has a length of 33 bp. Exon 2 has a length of 164 bp and encodes the MRP-8 protein from amino acids 1 to 47, while exon 3 has a length of 211 bp and encodes the MRP-8 protein from amino acids 1 to 47.
8-93 (C-terminus). The 56 bp long mRNA leader sequence is 4 bp 33 bp downstream of the CAP site.
It is interrupted by intron 1, which is 84 bp long.

The mRNA (mRNA) rail up to the poly(A) addition site has a length of clonucleotides. The poly(A) addition site is the 3' end DNA of the full-length MRP-8 cDNA (Example 10).
Deduced from array.

The complete DNA sequence encoding MRP-8 and the flanking DNA control regions are shown in formula (■). The control DNA sequences and intron-exon junctions are summarized in formula (■). At the 5' end of the gene, the major MRP-8 mRNA
A 5′-TATAA 29 bp upstream of the CAP site
The AA-3' promoter element is found. At the 3' end, a poly(A) addition signal 5'-AATAAA-3' is found 53 bρ downstream of the amber codon. Established GT/AG rules (R, Breathnac
h etc., Proc, Nat, 8cad, sci, IJsA
, 1978, Edan, 4853-4857), the intron contains a polypyrimidine stretch and a lariat (Iar.
iat) Contains a common DNA sequence for structure formation.

Bam) I % of total human placental DNA of Example 24.2
The EcoRI% HindIn and Pstl restriction digest was added to human MRP-14 cDNA (clone pM of Example 9.3).
Fragments containing sequences homologous and partially related to RP-14-10) are tested. ” GeneS
MRP-14 cDNA at low stringency and high stringency.
32p-labeled probe (I, 2X107cpm/I
hybridize with lg). This probe is a Bram/Av fragment that cleaves a 364 bp fragment from the plasmid of clone pMRP-14-10 (Example 9.3).
Prepared by aI digestion and nick translation as described in Example 9.3. Membranes with DNA fragments were incubated for 12 hours at 65°C in 6X SSC buffer, 5X Denhardt's solution, 0.1% SDS and 1100p/- of sonicated calf thymus carrier DNA.
10X106cp/mj! of? Hybridize with IRP-14 cDNA probe. The membrane was heated at 65°C to 0.
6X5SC containing 1% SDS.

4xSSC, 2xSSC, 1xSSC, and 0.2
Wash sequentially in X5SC, dry and expose for autoradiography. Low stringency hyperdigestion is performed in a similar manner.

However, 4XSSC containing 0.1% SDS at 65°C
Clean with only

At high and low stringency, only strongly hybridizing DNA fragments are observed. BamHI digestion hybridizes 11.6kb
Pstl digestion yields a 6kb fragment. Both old ndllI and EcoRI digestions yielded two types of fragments: old ndllI [5.7 kb and 3
．． a 6 kb fragment, and BcoRI yields 5.4 kb and 2.7 kb fragments. This result shows that MRP-1
This strongly suggests that the four genes exist as a single copy in the human genome.

26.2. A monogenic human lambda Sharon 4A genomic library of MRP-14's clone was used as human fetal liver D.
constructed from NA and screened with the MRP-14 cDNA probe as described in Example 24.5. 600,000 independent phage plaques are transferred to 20 nylon membranes and hybridized according to standard methods.

Five positive plaques were picked, purified, and λDN
A was isolated for further analysis. Southern blotting analysis of DNA showed that all four types of recombinant phages were phage human DNA.
It was shown to contain the complete gene on the A insert. 6 kb long Ps containing the complete MRP-14 coding region
t I DNA fragment from Phage Sharon 2
Insert into wild type pUC9 vector linearized with tI, generating plasmid pUcMRP-14/Pst6.

Part 27. Boosmid UCMRP-14Pst 6
The one-line sequencing method is shown in FIG. 5, and the sequenced regions are indicated by lines and black eyes indicating the direction of DNA sequencing. D.N.
A-sequencing is performed according to Mania's handbook by the dideoxy chain termination method on bacteriophage M13 isolation templates and on double-stranded supercoiled DNA templates. The coding region of the MRP-14 gene is interrupted by two introns: intron 1 and intron 2. Intron 1 has a length of 387 bp and interrupts the 5' untranslated region 15 bp upstream from the ATG start codon. Intron 2 has a length of approximately 2227 bp and interrupts the coding region at amino acid position 50. Non-coding exon 1 has a length of 28 bp. Exon 2 is 165
bp in length and encodes amino acids 1 to 50 of the MRP-14 protein, while exon 3 has a length of 389 bp and encodes amino acids 5l-115 (COO)l.
end).

The sequence of the gene encoding MRP-14 and the flanking DNA control region are shown in formula (X). No sequence is known between positions 1737 and 2098. Control DNA sequences and intron-exon junctions are shown in formula (X). At the 5' end of the gene, 5'-TA
TAAAT-3' promoter element RP-14 m
Found 29 bp upstream from the RNA CAP site.

Poly(A) addition signal 5'-AA at 3' end
AT88899 is the ochre codon 16
Found 4 bp downstream. Established GT/AC rules (
R, Brea thnach et al., Proc, Nat, A
cad, Sci, USA, 1978, ■, 4853
Besides a conserved splicing site that coincides with the polypyrimidine stretch and the formation of a lariat structure, the intron contains a common D
Contains the NA sequence.

The expression vector pCMVe/MRP-8 for MRP-8 in M was constructed by standard DNA manipulation and is shown in FIG. This plasmid contains the origin of replication of pBR322 for amplification in E. coli and the ampicillin resistance gene.

This plasmid is the plasmid pBRMR of Example 24.5.
4320 bp Bam from P-8/3A-HpalI
HT/EcoRI DNA fragment, which contains the MRP-8 coding region and the 5' and 3' DNA fragments.
The plasmid further contains an Acc I site (position 2246 in pBR322) from the DNA fragment and the 4320 bp long BamHI/Eco
It contains eukaryotic transcription control sequences in the form of a very strong constitutive enhancer on a 300 bp long DNA fragment located between RI and BamHI.

Major IEI gene promoter 9M+j! U(M,
B u s h a r t .

p, Tdebel, ni, JaIB1, K, 1)
OF2(, h-Haes Ier, B, F 1e
chens te in and W, 5chaffner,
This human cytomegalovirus (HCMV) from Cell, 1985, Vision 2.521-530) is derived from plasmid pBR322Acc I by standard DNA manipulations (Maniatis Handbook). Plasmid pBR322Ace I is pBR322
(J, G, 5utcliffe.

Proc, Nat, Acad, Sci, tlSA,
214 from 1978, E5, 3737-3741)
4 bp long Acc I /H4ndll I DNA
The 300 bp l(C4) fragment was isolated by cleaving pSV40-HCMV (recombinant C4) using an
It is produced by ligating to a MV enhancer-containing DNA fragment.

The 300 bp Nco I enhancer-DNA fragment is)
Covers the region upstream of the start site between nucleotides -262 and -524 in the ICMV major IEI gene promoter.

Expression vector pCMVe/MRP-14 is a standard DNA
created by the operation and shown in FIG. This plasmid is the plasmid pCMVe of Example 28 with the following exceptions:
/ Same as MRP-8. That is, this plasmid is the plasmid pUCMRP-14/P of Example 26.2.
It contains a 6000 bp Pst I DNA fragment derived from st6, which carries the MRP-14 coding region and 5' and 3' DNA control elements.

The MRP-8 gene and MRP-14 gene were
- A modification of the dextran technique (J, H, Cutchan and J, Pagano.

J, Natl, Cancer In5t, 196B.
4L 351-357; J.

Banerji, L. 01son and W. 5chaff.
ner, Ce11.1983, Masu, 729-740) into mammalian cells.

30.1. The plasmid DNA of Example 28 of CMVeMRP-8 was converted into C3CI! /Tidium bromide density gradient, and 10mM T
ris-H (J! and 1 mM EDTA (pH 7,5
) and then resuspended in DEAE-dextran (0,5 mg/ml, Pharmacia, molecular weight 5
X105) to a maximum concentration of 1 rig/mR plasmid DNA.

Incubate this solution for 10 minutes at room temperature.

A mock control containing no plasmid with no gene is treated similarly.

CO3-7 cells (ATCC CRL 1651.5V-4
African green monkey kidney cells transformed with 0 virus;
Y.

Gluzman, Ce1l, 1981.23.17
5-182), Bowes cells (RPMI 7272,
Human malignant melanoma, D.C., Rijken, and Co1
1en, J. Biol, Chem., 1981, Niray, 7035-7041), and L-132 cells (AT
CCCCl2, human fetal lung fibroblasts, C, Davis
et al., Fed, Proc, 1960, ■, 386), 9
Plate in MEM containing 5-10% Fe2 (Gibco) in 6-well microtiter plates or 10c+n Petri dishes (Falcon). 24 hours later,
Cell density reaches 60-80% confluency. Rinse the cell monolayer twice with DMEH. plasmid DNA
/DI! Add AE-dextran mixture (50 m per well of microtiter plate, 1.2 mff1 per 10 cm Petri dish).

Cells were incubated for 30 min at 37°C/15% CO□, then 37°C/7.5% CO depending on cell type.
Incubate at □ for 90-120 minutes.

Cells were incubated for an additional 90 s with 15 v/v% DMSO (Merck) in DMEM, rinsed twice with DMEM, and then incubated with Loom (per microtiter well) containing 5 v/v% Fe2 and 5 mM sodium butyrate (Sigma). ) or 10. (ld (per bed plate)
Incubate in MEM for 12 hours at 37°C, 15% CO□. Change the medium to MEM containing 5 v/v% Fe2. After 48-72 hours, transfected cells are checked for MRP-8 expression.

30.2. The CMVe MRP-14 Example 29 plasmid DNA was purified, mixed with DEAE-dextran, and L-13 as described above (Example 30.1).
Add to 2 cells. L-132 cells at 37°C/7.5%C
Incubate for 30 minutes at 0.05 °C and further process as described above. Transformed cells are checked for MRP-14 expression after 48-72 hours.

Below is a margin of 31 LLX, ■ A pellet containing 7 x 10' L-132 cells labeled with RP-8, which was found off the coast of January 11, is
48 hours after transfection (Example 30.1), 5
Resuspend in 00 μl of GuSCN buffer. This GuS
Homogenize the cells by passing the CN solution several times through a sterile disposable 1-pipette tip. Lysed cells were treated with phenol and treated with standard methods (Ma
niatis handbook). Centrifuge the nucleic acids and add 7.5 liters of 10mM Tris-
H(J! (pH 7,0) and ImM EDTA and added to 7.5 g of CsCβ (Merck). The C5Cj2 solution was added to TST41 (I5m
l) 2 ml in an ultracentrifuge polyaromer tube. 5.7
M C5 (Place it on the cushion of j2. Kontron T
290 Orpm in ST410-tar, 1 at 20°C
After 6 hours, the RNA molecules are pelleted. C5(j
! Remove the DNA remaining on the top of the cushion. The RNA pellet was redissolved in 2 ml elution buffer and precipitated with ethanol to 100 Il! Resuspend in 0.1% SDS and use for primer expression experiments. The concentration is determined spectrophotometrically. 30 to 166 cells
50 μg of DNA.

31.2.・M of the 8° angle type (■) of the primer
500 ng of synthetic DNA oligomer 5'-GGCTC complementary to positions 131-150 of RP-8 cDNA
GACCTCTTTCGGAAC-3' and complete MRP-
M13 isolated template 1 containing the 8 cDNA sequence (Example 10)
Radioactive primers are prepared by annealing with pg for 60 minutes at 60°C. 5 unit Kl
enow DNA polymerase (Boehringer) and 60
Four types of radiolabeled α-”P-dNTPs in μCi
The oligomers are extended by incubation for 30 minutes at room temperature in a solution containing 5OIJI. The reaction is followed for 15 minutes with a 5-bar chase mixture (0.2 mM dNTPs) and stopped by placing at 65° C. for 5 minutes. newly synthesized DN
A is cleaved with Pvu II and the reaction mixture is separated by denaturing 8M urea 8% PAGE. The extension product, a 6B nucleotide long DNA fragment, is excised and eluted from the polyacrylamide gel. The specific activity of the synthesized primer is 0.5 x 107
cpm/j1g.

31.3. 5'I7) of MRP-8 mRNA? −
Example 31.2.
Co-precipitated with ethanol with 1 x 1106 cp of synthetic primer. The nucleic acids are resuspended in 27 ml of sterile water and 3 μl of 2.5 M KCn for 300 minutes. RNA and primers
Denatured at 9°C for 3 minutes and annealed at 60°C for 1 hour. 3 concentrations of reverse transcriptase buffer (60 m
M Tris-HCj2, pH 8, 8, 30mMM
gCffz, 30mM DTT) is added and the reaction mixture is adjusted to a 3mM dNTP mixture in 90μl.

10 units of reverse transcriptase (BRL) are added and the reaction mixture is incubated for 30 minutes at 37°C and then stopped with 4111 0.5 M EDTA (pH 7.5). RNA is hydrolyzed by alkaline treatment with 50mM NaOH at 65°C for 1 hour.

The nucleic acid is neutralized and then precipitated with ethanol in the presence of carrier tRNA. Nucleic acids were dissolved in formamide sample buffer (80% formamide, 10mM NaOH, 1
mM EDTA, 0.1% xylene tool, 0
．． Resuspend in 1% bromophenol blue) and visualize the extended primers on DNA sequencing 8M urea 8% PAGE in TBE buffer.

90% of extended RNA molecules are 5'-TATAA
It co-migrates with deoxyadenosine located 30 bp downstream of the A8-3' regulatory element. The same results are obtained when poly(A) RNA isolated from human blood mononuclear cells is assayed using the same primers as above. Mock transfected cellular RNA was transferred to pCMVe/MR
When assayed under the same conditions as cells transformed with P-8, no such extended product is detected in the former.

cells using established methods (J, Briiggen et al., C
ancerImmunol, Immunother,
1983, ■, 200-205) and fixed with glutaraldehyde. Cell monolayers were rinsed twice with PBS and incubated with 0.05 V/V% glutaraldehyde in PBS for 5 min at room temperature, then PBS
Rinse twice.

The fixed cells were subjected to immunoperoxidase method (J,
Brueggen et al., 1983, supra;
etc., Cancer Immunol, Immunothe
The expression of MRP-8 is tested in the following manner using a modified method of J. R., 1983, ■, 53-38). IOV/
After blocking non-specific binding with V% normal pig (Gibco), cells are incubated with monospecific rabbit anti-MRP-8 serum (Example 34.1) for 30 minutes at 37°C. Specific antibodies bound to cells are incubated with pig anti-rabbit IgG conjugated to horseradish peroxidase (DAKO) for 30 minutes at 37°C.

Bound peroxidase was removed in 0.1M acetate buffer (p
H5,2) with 0.10 V/V% H2O2 (Merck) and 0.26 W/V% 3-amino-9-ethylcarbazole (AEC1 Sigma) at room temperature for 7 minutes.

Evaluation is performed on 500 cells by microscopic observation.

MRP-8 positive cells show a red colored precipitate.

Table 1 shows the % expression in the cells tested.

MRP-8 is expressed at a high percentage in human fetal lung cells L-132. Monkey kidney cells transformed with SV-40 CO
Expression is lower in 5-7 and human melanoma cells (Bowes). Mock treated controls and negative controls are negative.

CO5-7 monkey kidney 1% Bo es
Human malignant melanoma <1%31.5. ]
Fetal lung cells L-132 transfected with MRP-8 as described in Stamp Proft Example 30.1 were incubated with MRP-8 (D) at 0.5%.
05 W/V% trypsin and 0.02 W/V% ED
Detach it using TA (Gibco) and press it at 80 x g.
and 20mM Tris-H (J!,
120mM NaCj! , 5+nM KCJ,
1.4mM Mg(OAc)z, 3.6mMCaC
l2.6.0mM β-mercaptoethanol and 1 m
Q, 5 v/v % NP-40 or 0.5% v/v NP-40 in buffer containing M PMSF (all reagents from Biorad). IW/
Lyse cells with V% SDS for 15 minutes on ice.

The cell lysate was centrifuged at 48,000×g for 60 min, and the supernatant was subjected to 5O3-PAGE (I5w/V%;
, Laen+mli+Nature 1970.2
27.6B0-6B5).

The amount of protein loaded per slot corresponds to 5 x 105 cells. The separated proteins are electrotransferred onto nitrocellulose (Milliho P; Towbin et al.
Proc, Nat, 8cad, Sci, USΔ,
1979, 76.4350). The protein transferred to the tetrocellulose sheet was mixed with 45v/v% methanol and i0
Stain with V/V% Q in acetic acid, 1 w/v amide blank (Merck). Untreated sheets of nitrocellulose were treated with rabbit anti-MRP-8 serum (Example 34.1) for 14 hours at 4°C, followed by porcine anti-rabbit IgG conjugated to horseradish peroxidase (DAK
O). PB bound peroxidase
0, 1% ozoz and 0.3 W/V diluted in S
Visualize with % chloronaphthol (Merck) for 7 minutes. Rabbit anti-MRP-8 serum is 8kg/moj! A protein band in the cell lysate is recognized that exhibits a molecular weight of 100% and exhibits the same characteristics as recombinant MRP-8 protein expressed in E. coli or yeast (Example 21).

■↓1 MRP-14 cells transformed with Example 30.2 or -132 cells, Example 3
Identify with glutaraldehyde and test for expression of MRP-14 using the method of 1.4. Cell example 3
5.1 with monospecific rabbit anti-MRP-14 serum. Evaluation is performed on 500 cells by microscopic observation. MRP-14 positive cells show a red colored precipitate. MRP-14 is expressed in 75% of transfected human fetal lung cells L-132. Mock treated controls and negative control sera are negative.

pCMVe/MRP as described in Example 30.2
-14-transfected fetal lung cells L-1
32 is lysed as described in Example 31.5 and the cell lysate is processed by 5O3-PAGE. Separated proteins were electrophoretically transferred onto nitrocellulose and rabbit anti-MRP-14 antibody (Example 3
5.1) for 14 hours at 4°C and then conjugated to horseradish peroxidase.
(DAKO). Rabbit anti-MRP-
14 serum exhibits a molecular weight of 14 kg/mob and is expressed in E. coli or yeast (Example 22).
Recognizes a protein band in cell lysates that exhibits the same characteristics as the -14 protein.

To isolate a permanent human cell line producing recombinant MRP-8 or MRP-14, a plasmid containing the dominant selection marker Tn5 neomycin conferring resistance to G-418 is isolated from a plasmid containing the MRP-8 gene or a plasmid containing the MRP-8 gene. Calcium phosphate method (F
, L. Graham and A. J. van der Eb.
.

Virology 1973.52.456-467
; D, Picard and W, 5chaffner;
Proc, Natl, 8cad, sci, LIsA,
1983, Dan Ohm, 417-421).

Plasmid pSV2neo (P, 5outhern and P, Bery, +J, Mo1.App1.Genet,
, 1982, supra, 327-341) and pCMVe
/MRP-8 (Example 28) or pCMVe/MRP-1
4 (Example 29) and 10mM Tris in a ratio of 1=5.
-HCI! ,/1 mM EDTA (pH 7,5). An equal volume of 0.5 M CaCA containing 0.1 M Hepes (Gibco) is added and the mixture is incubated for 5 minutes at 22°C. Its capacity is 2xHBS (0,05M Hepes, 0.
28M NaCl! , 0.75n+M NazHPO
pSV of 4ttg/ml, neo and pSV of 20n/ml by adding twice 0.75mM NazHPOi).
CMVe/MRP-8 or pCMVe/MRP-14
and the mixture is placed on ice for 30 minutes. Add 10 m of this mixture to subconfluent L-132 cells (Example 30) grown in 100j11 in 96-well microtiter plates. Cells at 37℃
Incubate for 16 hours at 15% CO □, 15 v
/v% DMSO for 10 seconds, 5 v/v
Refeed MEM containing %FC3 and 5mM sodium butyrate, incubate for 6 hours at 37°C 15% COz, refeed MEM and incubate at 37°C 15% COz.
Incubate for 24 hours in Co2. Selective agent G-4
18 (Gibco) to a final concentration of 1/-.

Cells were cultured for 5 days, trypsinized, and treated with MEM 15%.
Divided into 96-well microtiter plates at a 1:5 ratio in FC3 and incubated with G-41 at 37 °C, 15% CO
Incubate with 8.

After 10 days, single cell colonies are isolated and expanded into large cell cultures according to standard methods. Example 31
and MRP-8 or MRP- as described in 32.
Cells are tested for expression of 14 and positive clones are selected.

JLL4LMRP-8 Polkroll 34.1
．． Rabbit anti-MR by immunizing rabbits with recombinant MRP-8 from E. coli (Example 12) purified by -Bi-MRP-8 persize exclusion chromatography (Example 20.2).
Generate P-8 serum. 0.5 μ of protein in complete Soloind adjuvant (Gibco) is injected followed by a booster injection of 5 μ of protein in incomplete Freund's adjuvant 20 days later. Rabbit serum titers are monitored by enzyme-linked immunosorbent assay (ELISA) in microtiter plates encoded with recombinant MRP-8 according to established methods. Western blot tests showed that exhaustive uptake by cell lysates of untransformed E. coli
After absorption), the only reactivity remaining in the antiserum is directed against MRP-8.

4 to 5 μm of purified recombinant MRP-8 (Example 20) to 1-
An MRP-8-Tiffi-Gel 10 immunofluorescent solvent column is prepared by coupling the MRP-8-Tiffi-Gel 10 to Affi-Gel 10 using the manufacturer's method (Bio-Rad, Lysotimondo, California). Immunoglobulin G (IgG) from monospecific rabbit anti-MRP-8 serum (Example 34) was
% saturation ammonium sulfate. The precipitate is dissolved in PBS and dialyzed against PBS. 15 mf of dialyzed solution containing approximately 100 mg of IgG
Pump i through the immunoaffinity column at a flow rate of 10-12 me/hr. PBSlo column
, remove non-specifically bound material by washing with 4M sodium chloride. 0.1M glycine-HCl2
(pH 2,5) to elute specifically bound rgG. Both aliquots containing antibodies were pooled and IMT
Add ris to neutralize and dialyze against PBS. Approximately 4 nw of rgc specific for MRP-8 is obtained.

Polyclonal based on M-main iMRP-14 -35.
1. Rabbit anti-MRP-14 serum is generated by immunizing rabbits with purified recombinant MRP-14 from E. coli (Example 22). Injection of 0.5N protein in complete Freund's adjuvant (Gibco) followed by a booster injection of 0.5N protein in incomplete Freund's adjuvant 20 days later. Rabbit serum titers are monitored by enzyme-linked immunosorbent assay (ELISA) in microtiter plates coated with recombinant MRP-14 according to established methods. Western blot testing shows that after exhaustive uptake by untransformed E. coli cell lysates, the only activity remaining in the serum serum is directed against MRP-14.

35.2. The recombinant MRP-1
4 = Affie Gel 10 immunoatosolvent column is prepared and used for isolation of rabbit anti-MRP-14 IgG from monospecific rabbit anti-MRP-14 serum. Approximately 3.2 ml of IgG specific for MRP-14 is obtained.

36.1. Three female Ba1b/c mice were injected intraperitoneally with 0.1 mgO recombinant MRP-8 (Example 12; purified as in Example 20.2) in complete Freund's adjuvant. ,
Then, two booster injections of 0.05 µ of MRP-8 in incomplete Freund's adjuvant are given at 14 day intervals. After 6 weeks, 0.05 nw MRP-8 in saline is injected and mice are sacrificed 4 days later.

Margin below 36.2. A well-established method for all fusion experiments (G, Koeh I)
er and C. Milstein, Nature, 1
The non-aqueous myeloma cell line P3 X 63-8g8.653 (ATCCItCRL
1580). 10° lung cells, 35
W/V% polyethylene glycol (PEG4000,
Merck) and 15% dimethyl sulfoxide (Merck)
fused with 107 myeloma cells in the presence of . The fusion mixture was transferred to 12 microliter plates (Falcon) containing mouse peritoneal exudate cells as feeder cells.
Standard HAT selection medium (20% FC3) in 00 wells
, Gibco). After 10-14 days, supernatants of the growing hybridomas were subjected to sandwich ELISA (Example 40
．． 2) to test for binding to MRP-8. Forty-eight of the 633 hybridoma supernatants tested were strongly positive in this assay. Suitable hybridomas are recloned at least twice by limiting dilution.

Below is the margin JLLL gate RP-8 ``Monochrome''
37.1. 8-10 week old Balb/c mice from Hua Li and U-Ki are pretreated intraperitoneally (i, p,) with 0.3 ml of Bristan (Aldrich). After 2-3 weeks, 5-10 × 10 cloned hybridoma cells and 0.2 m pristane were injected i.
, p, inject. After 8 to 10 weeks, ascites was collected and 800
Centrifuge at Xg and store at -80°C.

Alternatively, hybridomas are grown in vitro on a large scale using Hybridoma Medium (Gibco).

The supernatant was centrifuged at 800×g, and 0.45 strands of Nalgene (N
algene) and stored at -80°C.

Crude immunoglobulin was precipitated by dropwise addition of 0.9 volumes of saturated ammonium sulfate at 0°C, then 20 m
M Tris-H, 50mM NaC7! (pH
7,9). The IgG fraction is obtained using Bio-Rad's Affi-Gel Protein A MAPS kit.

The eluted IgG fraction was precipitated again with ammonium sulfate and dissolved in PBS at a concentration of 10/-.
Then dialyze against the same buffer.

37.2. Hybridomas 8-5C2 and 8-10D7 selected by Toyosai
Sandwich-type ELISA using rabbit anti-MRP-8 and anti-MRP-14 (Examples 40 and 42), MRP-8
and Western plot for MRP-14 (Example 3
1.5 and 32.2), and MRP-8 and MRP
-14 in single cell assays (Examples 31.4 and 32.1). Monoclonal antibody 8-
5C2 and 8-10D7 are M of EP 162,812
IF 8kD, and E.

Recombinant M expressed in coli (Example 12), yeast (Example 19) and transfected fetal lung cells L~132
selectively recognizes RP-8, but natural or recombinant? Does not cross-react with IRP-14 or other proteins. The epitope recognized is 5DS-stable.

Subclassing of monoclonal antibodies was determined using standard methods (J, B
Ruggen et al., Cancer Immunol, Im
Munothor, 1983, ■, 200) and both 8-5C2 and 8-10D7 were found to be Igc+.

Ba1b/c mice in complete Freund's adjuvant
．． 1 mg of E. coli derived recombinant MRP-14 (Example 13;
(purified according to Example 22) followed by two booster injections of 0.05 ml of MRP-14 in incomplete Freund's adjuvant, 14 days apart.

Six weeks later, 0.05 μ of MRP-14 in saline is injected. After 4 days, lung cells of immunized mice were collected and mouse myeloma cells P3 X 63-Ag8.
653 (ATCC CRL 1580),
The resulting hybridoma cells are then screened as described in Example 36. Of the 420 hybridoma supernatants tested, 27 were positive in the sandwich type Elisa of Example 42. Suitable hybridomas are recloned at least twice by limiting dilution.

The selected hybridoma cells of Example 38 were combined with Example 37.1.
In vivo propagation or in vitro culture as described in . The precipitated IgG fraction was transferred to Affi-Gel-Protein A M.
Purified using the APS kit, re-precipitated with ammonium sulfate, dissolved in PBS to a concentration of 10 μ/-,
Dialyze against BS and store at -80°C.

Selected hybridomas 14-6B2 and 14-19
Example 3: Antibodies produced by C9 for their specificity
Sandwich-type ELIS as described in 7.2
A, Tested in Western blot and single cell assays. Monoclonal antibodies 14-6B2 and 14
-19C9 selectively recognizes native MRP-14, FIRP-14', recombinant MRP-14 and MRP-14d, but does not cross-react with FIRP-8 or other proteins.

Monoclonal antibodies 14-6 B 2 and 14-19C
The subclass of 9 was determined to be IgGt.

(22B) 40. Polyclonal rabbit anti-MRP-8 antibody (Example 34) or monoclonal antibody 8-5C2 (Example 3) by FFJ-immunoasei (ELISA)
7) and 0.1■ biotin-X-NH3 (Calbiochem), and 0.1■- of biotin-X-NH3 (Calbiochem). IM Hepes buffer (pH 8
, 0) for 4 h at 4°C as described by Lerner et al.
Exp, Med.

The reaction is carried out according to a modification of the method of 1980, 1085). Biotinylated antibodies are dialyzed against PBS at 4°C and stored at -80°C.

Microtiter plate (NUNCFl) 0.05M
Affinity-purified rabbit anti-MRP-8 antibody (5 pg) in carbonate buffer (pH 9,6) at side 34.2
/ml) at 50 μl/well and 4
Incubate overnight at ℃. Coated plates can be stored for two weeks. 0.2 non-specific sites
After blocking for 1 hour at 37°C with PBS containing 1% gelatin and 1% BSA (Celva), 50I
ll/well dilution series of MRP-8 (Example 20.2
．． Test samples of dilution series from 0.1 to 50 ng/mj and 50 μg/well [0.2% gelatin, 1% B
SA and 0.05% Tween 20 (Bio-Rad) in PBS] and incubated overnight at 4°C. After rinsing with PBS containing 0.05% Tween 20, in PBS medium side, 1 part biotinylated Ubit anti-MRP-8 (Igg/ml), 0.2% gelatin and 0.05% Tween. 20 is incubated for 1 hour at 37°C and then treated with streptavidin-peroxidase (BRL) for 30 minutes at 37°C. After rinsing with PBS and 0.05% Tween 20, 0.064 v/v% of 8202 (Merck) and 2.2′-Azinobis-(3 -ethylbenzthiazoline sulfonic acid) [^BTS, 0.54 mg/ml (W
/ v), Herlinker Mannheim] to develop color of the bound peroxidase. 3 at 37°C
After 0 min, 4 min using an 8-channel photometer (Flora).
Measure optical density at 15 nm.

This assay tests MRP-8 in cell lysates of human monocytes.
Fetal lung cells L-132 transfected with (Example 3
1) detect 50 pg 7 ml or more of MRP-8 in plasma samples of human patients and normal controls;

Biotinylated mouse monoclonal antibody 8-5C2 (lx/-) can be used in place of biotinylated rabbit anti-MRP-8.

The assay method is similar to Example 40.2, except that the microtiter plate is first injected with monoclonal antibody 8-1.
After blocking non-specific sites, test samples and MRP-8
of standard solution and then biotinylated antibody 8”5
React with C2 (Ittg/ml>).Other operations are as described above.

Biotinylated BIT anti-MRP-8 can be used instead of biotinylated monoclonal antibody 8-5C2.

The assay method is as described in Example 40.2.

8-10D7 (or 8-5C2) (I0
■/-) on a microtiter plate. After blocking non-specific sites, test sample and MRP
A standard solution containing MRP-8 is added and then reacted with rabbit anti-MRP-8.

1 g of the conjugated rabbit antibody (species-specific goat anti-Rapid)
- Detection by peroxidase conjugate (to DIANOV) and further processing as in Example 40.2.

In a similar assay, polyclonal rabbit anti-MRP-8 was used to coat, then treated with the test sample and then monoclonal antibodies 8-5C2 or 8-10D? Process with. The bound mouse antibody was conjugated with a species-specific goat anti-mouse Ig-peroxidase conjugate (D
IANOVA).

■↓1. Sandwich ELIS for MRP-8
A kit for the sandwich ELIS of Example 40.2 includes:

1) Microtiter plate (NUNCFI) 2) 0.
Affinity-purified rabbit anti-MRP-8 polyclonal antibody (5■/-; Example 34.2 in 05M carbonate buffer (pH 9,6)
) 10d3) Recombinant MRP-8 standard solution (I■/d) in PBS containing 0.05% Tween 20 1.0 ml 4 a) PBS (pH 7,4), 0.2% gelatin, 1% BSA , biotinylated rabbit-anti-MRP-8 in 0.05% Tween 20 (Ittg/rd; Example 40.1)
10+d or 4b) Biotinylated monoclonal antibody 8 5 C2 (Ittg/ml) in PBS (pH 7,4), 0.2% gelatin, 1% BSA, 0.05% Tween 20 (Ittg/ml) LOm1
5) PBS (pH 7,4), 2% gelatin, 1% B
SA, Streptavidin-peroxidase (BRL) in 0.05% Tween 20 1:2000 10m
16) PBS, 0.05% Tween 20 200
7) PBS (pH 7.4), 0.2% gelatin, 1% BSAS 0.05% Tween 20
200yn18) ABTS (0.54mg'/in 0.05M citrate buffer (pH 4.0)
ml) and 0.064% H2O2 40ml 9) Conversion curve 10) Instructions.

The test kit for the sandwich ELISA of Example 40.3 contains the elements described above, but differs in the following respects.

2) Monoclonal antibody 8-10D7 (I0ttg/ml) 10ml 4a) Biotinylated monoclonal antibody 8 5C2 (Ig/ml 10+d or 4b) Biotinylated polyclonal rabbit anti-MRP-8 antibody (II!g/ml)'
10 - The test kit for the sandwich ELISA of Example 40.4 contains the same elements as above, with the following differences:

2a) Monoclonal antibody 8-10D 7 or 8 5C2 (I0g/+++Fri 10ml
or 2b) Affinity purified polyclonal rabbit anti-MRP-8 antibody (5 pg/me) 10
+d4a) Polyclonal rabbit anti-MRP-8 antibody (Itnr/ml 1
0ml and below margin 5a) Goat anti-rabbit RG-peroxidase conjugate 1: 5000 LM or 4b) Monoclonal anti-El-5C2 (I■/ml) 10ml and 5b) Goat anti-mouse Ig-peroxidase conjugate 1: 5000 10d polyclonal rabbit anti-MRP-14 antibody (Example 35
), or monoclonal antibody 14-6B2 or 14
-19C9 (Example 39) is biotinylated as described in Example 40.1.

MRP- as described in Example 40.2 or 40.4.
A sandwich-type ELrSA for the detection of 14 is performed.

However, polyclonal antibody anti-? Polyclonal antibody anti-MRP-14 was used instead of IRP-8, and monoclonal antibody 14-6B2 or 1.4-1'9 was used instead of monoclonal antibody 8-10D7 or 8-5C2.
Use C9. A standard solution is prepared from MRP-14 from Example 22 (0.1-1100 n/ml).

For measurement of MRP-14 in plasma, plasma samples collected with heparin were immediately made to 1 mM phenylmethanesulfonyl fluoride (PMSF, full strength) and -
Store at 80°C. For analysis, sample at 1:5 ~
Dilute 1:10,000 and test in the sandwich assay described above.

Polyclonal anti-MRP-14 antibody and biotinylated anti-MRP-14 or biotinylated monoclonal antibody 1
The test kit for the sandwich ELISA of Example 42 using 4-6B2 includes:

■) Microtiter plate (NUNCFI) 2) 0.
Affinity-purified rabbit anti-MRP-14 polyclonal antibody (5 μg/-1 example 3) in 05M carbonate buffer (pH 9,6)
5.2) 10d or less margin 3) Recombinant MRP-14 standard solution in PBS containing 0.05% Tween 20 (I/mR>
1.0mR4a) PBS (pH7,4)
Biotinylated rabbit-anti-MRP-14 (Ipg
/ mj) 10 ml or 4 b) Biotinylated monoclonal antibody 14 6 B 2 (IN/++d!>
10mR5) PBS (pl(7,4), 2%
Streptavidin-peroxidase (BRL) in gelatin, 1% BSA, 0.05% Tween 20 1:2000 10m
R6) PBS, 0.05% Tween 20 200
me7) ABT in PBS (pH 7,4), 0.2% gelatin, 1% BSA, 0.05% Tween 20200mε 8) 0.05M citrate buffer (pH 4,0)
S (0,54■/-) and 0.064% H2O240
艷9) Conversion curve 10) Instructions.

Biotinylated polyclonal or monoclonal antibodies, and streptavidin-peroxidase conjugates (
4 and 5), polyclonal or monoclonal antibodies themselves, and species-specific anti-1g serum-peroxidase conjugates (as in Example 41) can be used.

! WLL4. MRP-8 in Example 20.5 or MRP-14 in Example 22.3 for MU's 20ON
Dissolve in 3 ml of 5N human serum albumin. The resulting solution is passed through a bacteriological filter and the filtered solution is divided into 10 vials under sterile conditions. Preferably, these vials are stored in a cool place, for example at -20°C.

[Brief explanation of the drawing]

and non-reducing condition F('F3)? 'Rosal 5DS-PAGE polyacrylic acid gel is shown. Lanes 1 and 2 dual molecular weight markers; Lane 3: Example 1.1. Total protein eluted from the IC5 affinity column; lanes 4 to 10:1
fPLC fraction 1~■. Figure 2 shows MRP of formula (■) isolated from clone 3.
-8 cDNA is schematically shown. Part A shows the code region. The circled number is the cD of clone 3.
Figure 10 shows the base positions that differ between cDNAs isolated from NA and other clones, and other specific features discussed in Example 10. Lane B shows the location of restriction sites used for sequencing. Part C summarizes the sequencing strategy and shows the start (vertical lines) and end (arrowheads) of the sequence at the restriction site, the distinct end of the sequence (dots), and the end of the DNA for each clone (cross mark). shows. The numbers indicate the numbers of different clones, and the letters indicate the sequencing method (S: Sang
er method, MG: Maxam G11bert method). Figure 3 schematically shows the cDNA of MRP-14 of formula (IX), showing the coding region (lane A), the location of the restriction sites used for sequencing (lane B), and the cloned liver P
-14-10, clone MRP-14-16 and clone MRP~14-15.18 and 19 (lane C) are shown (Example 11). FIG. 4 schematically shows the genomic DNA of formula (■) (MRP-3). The lower lane shows the positions of the restriction sites used for sequencing, the positions of exons 1.2 and 3 (boxes) and the coding sequence between the triplet ATB and TAG (black N).
shows. The upper lane summarizes the sequencing method and shows the beginning of the sequence at the restriction site and the end of the readable sequence or the end of the sequence at the restriction site. The sequencing method was according to Sanger and Coulson. Figure 5 shows the genomic DN of formula (X) (MRP-14)
A is schematically shown. Locations of restriction sites are shown for exons 1.2 and 3 (boxes) and for the coding sequence between triplet ATG and TAA (black box). Sequencing methods can be determined from the arrows. The sequence was read from the restriction site (beginning of the arrow) to the next restriction site or end of readable sequence. The Sanger and Coulson sequencing method was used. Figure 6 shows the restriction map of plasmid pCMVe/MRP-8 along with the relative positions of the origin of replication Or+, the ampicillin resistance gene Amp'', the human CMV enhancer and the three exons of the gene encoding MRP-8. Figure 7 shows the restriction map of plasmid I) CMVe/MRP-14, including the replication origin Ori, the ampicillin resistance gene (Amp''), and the human CMV enhancer 1MRP.
-14 promoter region and the relative positions of the three exons of MRP-14 are shown. Figure 8 shows 39 normal healthy donors (A) and a total of 18 patients with capsular fibrosis (CF) (white circles are homozygotes, black circles are heterozygotes) (B) 2 shows the plasma concentration of MRP-14. The concentration of MRP-14 is shown on a logarithmic scale in ng/mR. Plasma samples collected with heparin were adjusted to 1 mM phenylmethanesulfonyl fluoride and tested in duplicate by the sandwich ELISA of Example 42 using the polyclonal antibody to MRP-14 of Example 35. 2EEii: IA IA) jA1B2TI51 Procedural amendment writing method) January 6, 1988 Director General of the Patent Office Kunio Ogawa 1, Indication of the case 1988 Patent Application No. 24816B 2, New title of the invention Lymphokine-related peptide 3, relationship with the corrector case Patent applicant name Civer-Geigy Akchengesellschaft 4,
Agent address: 5-8-10 Toranomon-chome, Minato-ku, Tokyo 105
Date of the amendment order: December 22, 1985 (shipping date) 7;〉, 6. "Brief explanation of drawings" column 7 of the specification subject to the amendment, page 239, line 20 of the specification of the contents of the amendment. Correct the sentence ``Figure 1(A).(B)'' to ``Figure 1A and 1B.''

Claims (1)

[Scope of Claims] 1. Human macrophage migration inhibitory factor-related peptide (MRP) having an apparent molecular weight of about 8 kD or about 14 kD, or a variant, fragment or derivative thereof. 2. The human according to claim 1, represented by the following formula (I): [There is an amino acid sequence] (I) (wherein Z_1 is hydrogen, acyl, or the amino acid residue methionine) Macrophage migration inhibitory factor-related peptide or variant thereof,
Fragment or derivative. 3. The following formula (II): [There is an amino acid sequence] (II) (wherein Z_2 is hydrogen, acyl, or an optionally acylated peptide residue consisting of 1 to 5 amino acids. , ), or a variant thereof, according to claim 1,
Fragment or derivative. 4. Human macrophage migration inhibitory factor-related peptide MRP-8 of formula (I) according to claim 2, wherein Z_1 is hydrogen, acetyl, or the amino acid residue methionine (Met). 5. The human macrophage migration inhibitory factor-related peptide MRP-8 of formula (I) according to claim 2, wherein Z_1 is Met. 6, Z_2 is hydrogen, acetyl, Met-, Thr-Cy
s-Lys-Met-, Met-Thr-Cys-Ly
s-Met- or acetyl-Thr-Cys-Lys-
Formula (II) according to claim 3, which is Met-
human macrophage migration inhibitory factor-related peptide MRP
-14. 7, Z_2 is hydrogen or Thr-Cys-Lys-Me
The human macrophage migration inhibitory factor-related peptide MRP-1 of formula (II) according to claim 3, which is t-
4. 8. MR of formula (I) according to claim 2, wherein 1, 2 or 3 single amino acids of the compound of formula (I) are replaced by different amino acids or bonds
Mutant of P-8. A fragment of MRP-8 of formula (I) according to claim 2, comprising 9, 20 or more consecutive amino acids. 10. Formula (I) according to claim 2, wherein the amino and/or hydroxy functional groups are glycosylated
A derivative of MRP-8. 11, the formula ( I
) dimer of MRP-8. 12. MRP of formula (II) according to claim 3, wherein 1, 2 or 3 single amino acids of the compound of formula (II) are replaced by different amino acids or bonds.
-14 mutant. A fragment of MRP-14 of formula (II) according to claim 3, comprising 13, 20 or more consecutive amino acids. 14. Derivatives of MRP-14 of formula (II) according to claim 3, wherein the amino and/or hydroxy functional groups are glycosylated. The formula ( II) MRP-14 dimer. 16. The mercapto group of the cysteine residue is in an oxidized form and forms an intermolecular S-S bridge, Z_1 is Me
MRP-8 and Z_2 of formula (I) where t is Thr-C
MRP-14 of formula (II) which is ys-Lys-Met-
The dimer according to claim 1. 17. A method for producing a human macrophage migration inhibitory factor-related peptide having an apparent molecular weight of about 8 kD or about 14 kD, or a variant, fragment or derivative thereof, which comprises purifying a solution containing the compound of interest by chromatography, and A method characterized in that the compound is isolated and optionally fragments or derivatives are prepared therefrom. 18. Claims in which the solution containing the target compound is a prepurified extract, cell supernatant or culture filtrate of stimulated normal human lymphocytes or of genetically engineered microorganisms or permanent mammalian cell lines. The method according to paragraph 17. 19. The chromatographic purification method is selected from ion exchange chromatography, reversed phase high performance liquid chromatography, gel filtration, affinity chromatography, chromatography on hydroxyapatite, hydrophobic interaction chromatography, or a combination thereof. , the method according to claim 17. 20. A transformed host expressing the peptide of formula (I) or (II), or a variant or derivative thereof, is cultured in a solution containing the target compound under conditions that allow expression of the heterologous polypeptide. 18. The method according to claim 17, obtained by: 21. Next step: a) DNA encoding the compound of formula (I) or (II) or a fragment thereof is transformed into cDNA or genomic DNA of human cells.
A) isolated from the A library and optionally mutated it, or chemically synthesized such DNA; b) introducing the DNA into a suitable expression vector; c) converting the resulting hybrid vector. d) selecting transformed hosts from untransformed hosts by culturing under conditions in which only transformed hosts survive; e) conditions permitting expression of the heterologous polypeptide; culturing the transformed host; and f) isolating the compound of formula (I) or (II) or a variant, fragment or derivative thereof; and optionally culturing the transformed host of formula (I) or (II); 21. A method according to claim 20, comprising: derivatizing the compound or a variant or fragment thereof. 22. A DNA encoding a compound of formula (I) or (II) or a variant or fragment thereof and comprising at least 15 nucleotides. 23. The following formula (III): ▲There are mathematical formulas, chemical formulas, tables, etc.▼ (III) [In the formula, Y_1 is the flanking DNA residue of 12 or more nucleotides containing the promoter sequence; Y_2 is Y^M -Y^T-Y^C-Y^X or absent; Y_3 is one or more nucleotide flanking DNA residues or absent; Y^A is alanine (A or Ala ) and is GCT, GCC, GCA or GCG; Y^C encodes cysteine (C or Cys) and is TGT or TGC; Y^D encodes aspartic acid (D or Asp) death,
and GAT or GAC; Y^E encodes glutamic acid (E or Glu) and is GAA or GAG; Y^F encodes phenylalanine (F or Phe) and is TTT or TTC; Y ^G codes for glycine (G or Gly) and is GGΥ, GGC, GGA or GGG; Y^H codes for histidine (H or His) and is CAT or CAC; Y^I is isoleucine (I or Ile) and is ATT, ATC or ATA; Y^K codes for lysine (K or Lys) and A
AA or AAG; Y^L encodes leucine (L or Leu) and is TTA, TTG, CTT, CTC, CTA or CTG; Y^M encodes methionine (M or Met), and ATG; Y^N encodes asparagine (N or Asn) and is AAT or AAC; Y^P encodes proline (P or Pro) and is CCT, CCC, CCA or CCG; Y^Q codes for glutamine (Q or Gln) and is CAA or CAG; Y^R codes for arginine (R or Arg) and is CGT, CGC, CGA, CGG, AGA or AGG
and Y^S codes for serine (S or Ser), and T
CT, TCC, TCA, ΥCG, AGT or AGC; Y^T codes for threonine (T or Thr) and is ACT, ACC, ACA or ACG; Y^V encodes valine (V or Val) Code and G
TT, GTC, GTA or GTG; Y^W codes for tryptophan (W or Trp);
and TGG; Y^Y encodes tyrosine (Y or Tyr) and is TAT or TAC; and Y^* is the stop codon TAA, TAG or TGA.
] The DNA according to claim 22 encoding MRP-8 represented by the formula (III), a double-stranded DNA consisting of a DNA of formula (III) and a DNA complementary thereto, and the complementary DNA itself , genomic DNA in which the DNA of formula (III) is interrupted by one or two introns, and these D in which one, two, three or four nucleotides are mutated.
Variants of NA or fragments of these DNAs comprising at least 15 nucleotides. 24. The following formula (IV): ▲There are mathematical formulas, chemical formulas, tables, etc.▼ (IV) [In the formula, Y_1 is a flanking DNA sequence of 12 or more nucleotides containing the promoter; Y_2 is Y^M-Y ^T-Y^C-Y^K or absent; Y_3 is a flanking DNA sequence of one or more nucleotides or absent; Y^A encodes alanine (A or Ala) and is GCT, GCC, GCA or GCG; Y^C encodes cysteine (C or Cys) and is TGT or TGC; Y^D encodes aspartic acid (D or Asp);
and GAT or GAC; Y^E encodes glutamic acid (E or Glu) and is GAA or GAG; Y^F encodes phenylalanine (F or Phe) and is TTT or TTC; Y ^G codes for glycine (G or Gly) and is GGT, GGC, GGA or GGG; Y^H codes for histidine (H or His) and is CAT or CAC; Y^I is isoleucine (I or Ile) and is ATT, ATC or ATA; Y^K codes for lysine (K or Lys) and A
AA or AAG; Y^L encodes leucine (L or Leu) and is TTA, TTG, CTT, CTC, CTA or CTG; Y^M encodes methionine (M or Met), and ATG; Y^N encodes asparagine (N or Asn) and is AAT or AAC; Y^P encodes proline (P or Pro) and is CCT, CCC, CCA or CCG; Y^Q codes for glutamine (Q or Gln) and is CAA or CAG; Y^R codes for arginine (R or Arg) and is CGT, CGC, CGA, CGG, AGA or AGG
and Y^S codes for serine (S or Ser), and T
CT, TCC, TCA, TCG, AGT or AGC; Y^T codes for threonine (T or Thr) and is ACT, ACC, ACA or ACG; Y^V encodes valine (V or Val) Code and G
TT, GTC, GTA or GTG; Y^W codes for tryptophan (W or Trp);
and TGG; Y^Y encodes tyrosine (Y or Tyr) and is TAT or TAC; and Y^* is the stop codon TAA, TAG or TGA]. The DNA according to claim 22, a double-stranded DNA consisting of a DNA of formula (IV) and a DNA complementary thereto, the complementary DNA itself, one DNA of formula (IV) or genomic DNA with an interruption of two introns, or these DNAs with mutations of 1, 2, 3 or 4 nucleotides.
Variants of A or fragments of these DNAs comprising at least 15 nucleotides. 25, the following formula (V): [There is a gene sequence] (V) (where Y_1 is a flanking DNA residue of 12 or more nucleotides containing the promoter sequence, and Y_3 is a flanking DNA residue of 1 or more nucleotides) a double-stranded DNA consisting of a DNA of formula (V) and a complementary DNA thereto; Complementary DNA itself, genomic DNA in which the DNA of formula (V) is interrupted by one or two introns, these DNAs in which one, two, three or four nucleotides are mutated;
and fragments of these DNAs comprising at least 15 nucleotides. 26, the following formula (VI): [There is a gene sequence] (VI) (where Y_1 is the flanking DNA residue of 12 or more nucleotides containing the promoter sequence, and Y_2
is ATGACTTGCAAA or does not exist;
and Y_3 is a flanking DN of 1 or more nucleotides
A residue), a double-stranded DNA consisting of a DNA of formula (VI) and a complementary DNA thereof, the complementary DNA itself, DN of formula (VI)
Genome D in which A is interrupted by one or two introns
NA, variants of these DNAs in which 1, 2, 3 or 4 nucleotides are mutated, or fragments of these DNAs comprising at least 15 nucleotides. 27. The DNA according to claim 25, which is represented by the following formula (VII): [There is a gene sequence] (VII). 28, D according to claim 25 of formula (VIII)
N.A. 29. The DNA according to claim 26, which is represented by the following formula (IX): [There is a gene sequence] (IX). 30, DN according to claim 26 of formula (X)
A. 31, with DNA of formula (V) or (VI), or with formula (V
) or (VI), which hybridizes with DNA complementary to the DNA of claim 22.
N.A. 32, DN encoding a compound of formula (I) or (II)
A. A method for producing variants thereof and fragments of these DNAs, comprising culturing a transformed host and isolating the desired DNA from it or synthesizing it by condensation of nucleotides. How to become. 33. Next step: a) Isolate mRNA from human mononuclear leukocytes and target mR
Select an isolated DNA complementary to the mRNA.
from which double-stranded DNA (ds cDNA
) or b) isolating genomic DNA from human cells and selecting the DNA of interest using a DNA probe; and c) preparing the ds cDNA of step a) or the ds D of step b).
introducing the NA into a suitable expression vector; d) transforming a suitable host microorganism with the obtained hybrid vector; e) introducing the D encoding the compound of formula (I) or (II);
selecting transformed hosts containing NA or a variant or fragment thereof from hosts that do not contain coding DNA;
and f) isolating the DNA of interest; 33. The method of claim 32, comprising: 34, operably linked to an expression control sequence, the formula ( I
) or (II), a variant thereof, or a hybrid vector comprising a fragment of these DNAs. 35, the hybrid vector according to claim 34, which is derived from plasmid pBR322. 36. The hybrid vector according to claim 34, which contains the trp promoter. 37. The hybrid vector according to claim 34, which contains the promoter P_L of phage λ. 38, yeast chromosome autonomously replicating segment (ars) and ￥
Claim 3 containing the PH05\ promoter
Hybrid vector according to item 4. 39, Vector pJDB207R/￥PH05￥-MR
P-8, pJDB207R/PH05-MRP-14,
or pJDB207R/￥PH05￥-MRP-14d
The hybrid vector according to claim 38. 40. Claim 3 containing the enhancer unit of the human cytomegalovirus major intermediate-early gene
Hybrid vector according to item 4. 41, vector pCMVe/MRP-8, or pCMV
The hybrid vector according to claim 40, which is e/MRP-14. 42, any one of claims 34 to 41
A host cell transformed with the hybrid vector described in section. 43. Escherichia coli
43. The host cell according to claim 42, which is a host cell (Ecoli). 44, E. E. coli HB101/LM10
44. The host cell according to claim 43, which is strain No. 35, K12 or W3110. 45. Saccharomyces cerevisiae
43. The host cell according to claim 42, wherein the host cell is S. o-myces cerevisiae. 46, S. S. serevisiae
The host cell according to claim 45, which is the GRF18 strain. 47, Claim 4 which is fetal lung cells L-132
The host cell according to item 2. 48, pCMVe/MRP-8 or pCMVe/MRP
48. The host cell of claim 47, which is a fetal lung cell L-132 stably transformed with -14 and pSV_2neo. 49. A medicament containing a therapeutically effective amount of a human macrophage migration inhibitory factor-related peptide, or a variant, fragment or derivative thereof. 50. Polyclonal and monoclonal antibodies specific for human macrophage migration inhibitory factor-related peptides and derivatives thereof. 51. The polyclonal antibody according to claim 50, which is specific for MRP-8 and its derivatives. 52. The polyclonal antibody according to claim 50, which is specific for MRP-14 and its derivatives. 53. The monoclonal antibody according to claim 50, which is specific for MRP-8 and its derivatives. 54. The monoclonal antibody according to claim 50, which is specific for MRP-14 and its derivatives. 55, 8-5C2, 810D7, 14-6B2 and 14
- Monoclonal antibodies and derivatives thereof according to claim 50 having the name 19C9. 56, Claim 50 which is a conjugate with biotin
Polyclonal antibodies and monoclonal antibodies described in Section 1. 57. A method for producing polyclonal antibodies and derivatives thereof according to claim 50, comprising two or more injections of a compound of formula (I) or (II) in the presence of an immune response enhancer. A method comprising immunizing a mammal, collecting the serum of the immunized mammal, isolating and purifying the antibodies, and optionally converting the resulting antibodies into derivatives thereof. 58. A method for producing monoclonal antibodies and derivatives thereof according to claim 50, which comprises a) culturing hybridoma cells secreting the monoclonal antibodies in vitro, and isolating the monoclonal antibodies from the culture supernatant. or b) propagating the monoclonal antibody in a suitable mammal in vivo and recovering the monoclonal antibody from the body fluids of the mammal, and optionally converting the monoclonal antibody obtained into a derivative thereof. 59. A hybridoma cell line characterized by secreting a monoclonal antibody specific for human macrophage migration inhibitory factor-related peptide. 60, 8-5C2, 8-10D7, 14-6B2 and 1
59. The hybridoma cell line of claim 59 having the designation 4-19C9. 61. A method for producing a hybridoma cell line according to claim 59, which comprises immunizing a suitable mammal with a compound of formula (I) or (II), and transforming the antibody-producing cells of the mammal into myeloma cells. A method characterized by: fusing with a cell, cloning the hybrid cell obtained in this fusion, and selecting a cell clone that secretes the antibody of interest. 62. Use of the polyclonal and monoclonal antibodies and their derivatives according to claim 50 for the qualitative and quantitative determination of human macrophage migration inhibitory factor-related peptides. 63, an immunoassay for human macrophage migration inhibitory factor-related peptides, comprising coating a solid carrier with the polyclonal or monoclonal antibody according to claim 50 and incubating it with a solution containing the peptide to be measured; It is then incubated with a solution containing a polyclonal antibody or a different monoclonal antibody or a derivative thereof according to claim 50, and the amount of said second antibody bound to the carrier is determined by an enzyme-substrate reaction. A method characterized by: 64, a test kit for immunoassay of human macrophage migration inhibitory factor-related peptide, comprising the polyclonal and/or monoclonal antibodies and/or derivatives thereof according to claim 50, and optionally other monoclonal antibodies. or a kit containing polyclonal antibodies and/or accessories. 65. A method for diagnosing a chronic inflammatory condition, comprising using the polyclonal or monoclonal antibody or a derivative thereof according to claim 50 to detect M in a tissue.
A method characterized in that the amount and pattern of expression of RP-8 and MRP-14 are determined. 66, cystic fibrosis
), using a polyclonal or monoclonal antibody specific for MRP-14 or a derivative thereof according to claim 52 or claim 54, A method comprising: determining the amount of MRP-14 in a serum sample of an otherwise healthy subject who is expected to be heterozygous.