KR920004050B1 - Process for preparing hepatitis b surface antigen and process for preparing a novel dna fragment - Google Patents

Abstract

Novel DNA constructs comprising regulatory regions plus the structural coding region for hepatitis B surface antigen (HBsAg) are disclosed. The regulatory regions employed are responsive to methanol, non-catabolite repressing carbon sources and catabolite repressing carbon sources followed by carbon source starvation. The novel constructs are incorporated into a variety of linear and circular plasmids. Such plasmids are used to transform suitable hosts and ultimately used for the production and isolation of hepatitis B surface antigen in high yields.

Description

Hepatitis B surface antigen and novel DNA fragments and methods for preparing the same

1 is a restriction map of the Pichia dihydroxyacetone lyase enzyme (DAS) regulatory region.

2 is a restriction map of the first Peachia alcohol oxidase gene (AOX1) regulatory region.

3 is a restriction map of the Pchia p40 gene regulatory region.

4 is a restriction map of plasmid pAOP2.

5 provides an overview of the assembly of plasmids pBSAG5 and pBSAG5I.

6 is a restriction map of plasmid pHBS-5.

7 is a restriction map of plasmid pAOT-1.

8 is a restriction map of plasmid pYJ33.

9 illustrates the assembly of plasmid pYM39 from plasmids pSAOH5 and pTHBS3.

10 illustrates the process of assembling plasmid pYMI6 from plasmids pYM39 and pPG3.2.

Figure 11 illustrates the process of assembling the plasmid pBSAGI5I from pYMI6 and pBSAG5I.

12 illustrates the insertion of a portion of the plasmid pBSAG5I into the first alcohol oxidase (AOX1) locus of the Peachia chromosome.

Figure 13 provides an overview of the assembly of plasmid pTHBS3.

The present invention relates to the use of recombinant DNA technology to produce hepatitis B surface antigen. In one aspect, the invention relates to a method for producing hepatitis B surface antigen in yeast. In another aspect, the present invention relates to novel DNA constructs encoding hepatitis B surface antigen. In another aspect, the present invention relates to a novel organism transformed by the aforementioned DNA assembly.

Recent advances in recombinant DNA technology have made it possible to control and produce a huge variety of useful polypeptides by microorganisms. Many eukaryotic polypeptides, such as human growth hormone, leukocyte interferon, human insulin and human proinsulin, have already been produced by microorganisms. According to the ongoing technical applications already under study, it is anticipated that in the future, various other useful polypeptide products may be produced by microorganisms. One such useful polypeptide product is the hepatitis B surface antigen.

Hepatitis B (serum hepatitis) virus is transmitted between humans and manifests itself as a chronic debilitating epidemic, which gradually leads to severe liver damage, primary cancer, and even death. In most cases, complete recovery from the hepatitis B epidemic is to be expected. However, especially in many African and Asian countries, a large part of the population is chronic carriers with a dangerous potential to spread the disease nationwide.

An effective prevention of hepatitis B is the administration of hepatitis B virus waxin, which is usually a highly purified hepatitis B surface antigen. Such hepatitis B virus waxin is effective in preventing transmission to virus. Particularly high risk groups are those requiring transfusion or dialysis, and medical personnel working with such groups. In addition, such wax is effective in preventing the occurrence of new carriers, so it may be possible to completely remove the hepatitis B virus from the ground.

Since hepatitis B virus is not contagious in cell culture, it can only be obtained from infected humans or higher primates. Thus, the use of means to obtain and maintain a sufficient supply of hepatitis B virus used to produce antigens for immunity against hepatitis B has not been available.

Hepatitis B virus wax is usually prepared by isolating and purifying the hepatitis B surface antigen from the plasma of hepatitis B virus carriers. However, such purification must be performed extremely efficiently because the required antigen is present only in very low concentrations in the plasma to be purified. Thus, until now, it has been very difficult to produce hepatitis B virus waxin on an industrial scale.

In accordance with the present invention, transfection is performed by a DNA assembly consisting of methanol, a non-catabolite repressing carbon source, and a hepatitis B surface antigen coding sequence under the regulation of regulatory regions that respond to carbon source starvation. By culturing the converted yeast cells, hepatitis B surface antigen can be produced in high yield.

In the accompanying drawings, the following abbreviations were used to indicate the restriction enzymes used.

In the figure, restriction sites used for manipulation of DNA fragments but destroyed during ligation are indicated in parentheses with an abbreviation for the site of destruction.

According to the present invention, a polypeptide coding region encoding (1) a hepatitis B surface antigen or a portion thereof, and (2) a transcriptional messenger RNA can be regulated when located at the 5'-end of the polypeptide coding gene. New DNA fragments consisting of regulatory regions are provided. The combination of a regulatory region with hepatitis B surface antigen (HBsAg) gene and transcription termination fragment is hereinafter referred to as an expression cassette or expression unit. The controlled zone used to practice the invention responds to at least one condition selected from (i), (ii) and (iii) below.

(Iii) the presence of methanol in the medium in contact with the host organism containing the expression cassette; (Ii) the presence of a non-catalytically inhibiting carbon source other than methanol in the medium in contact with the host organism containing the expression cassette; (Iii) Carbon source starvation in a medium in contact with the host organism after culturing the host organism containing the expression cassette on a catabolism-inhibiting carbon and energy source.

Furthermore, according to the present invention, novel linear and cyclic plasmids containing the aforementioned expression cassettes are provided.

Furthermore, according to the present invention there is provided a pure culture in essence of the yeast strain transformed by the linear or cyclic plasmid described above.

According to another aspect of the present invention, a method for preparing hepatitis B surface antigen, which consists of culturing a yeast strain transformed with the plasmid described above under conditions under which expression of a desired protein product is obtained.

The control zone used to practice the present invention is characterized by its ability to react to media containing the following (1), (2) and (3).

(1) non-catalytically inhibiting carbon sources such as methanol, (2) such as glycerol, galactose, acetate, etc., and (3) carbon source starvation following catabolic inhibiting carbon sources such as glucose, ethanol, fructose and the like.

Exemplary conditioning areas that meet the criteria are depicted by the restriction maps shown in FIGS. 1, 2 and 3. The regulatory region depicted in FIG. 1 is derived from the dihydroxyacetone synthase (DAS) gene of Pichia pastoris. The regulatory region depicted in FIG. 2 is derived from the first alcohol oxidase (AOX1) of Pchia pastoris (pichia has two alcohol oxidase genes referred to herein as AOX1 and AOX2). The regulatory region depicted in FIG. 3 is derived from the p40 gene of Pchia pastoris. One of ordinary skill in the art will appreciate that other regulatory zones having the aforementioned properties can be separated from methyltrophic yeasts such as, for example, Pchia pastoris. Such additional control areas having control properties similar to those of the control area described above are also included within the intention of the present invention.

Hepatitis B surface antigen (HBsAg) gene has been previously isolated (see Nature 280,815 of Valenzuela's group (1979)), such as pHBS-5 (see FIG. 6 and Nature 298,347 of Valenzuela's group (1982)), Various vectors such as pHBV-T 1A (EPA 73,657 of Genentech) and pHBS-56 (ATCC Accession No. 40,047; see EPA 120,551) can be used by treatment with a suitable restriction enzyme.

The hepatitis B surface antigen gene was modified by treatment with Bal 31 exonuclease to remove the viral non-coding sequence at the 5'-end of the hepatitis gene. The 3'-end of the HBsAg gene was modified by digesting with endonuclease and adding a linker to remove the viral noncoding sequence at the 3'-end of the hepatitis gene. The hepatitis B surface antigen gene has been further modified to incorporate convenient restriction sites for the manipulation of DNA fragments. The DNA fragment thus produced is an EcoR I-Stu I insert and has the following nucleotide sequence.

5'-GAATTCATGG AGAACATCAC ATCAGGATTC CTAGGACCCC

TGCTCGTGTT ACAGGCGGGG TTTTTCTTGT TGACAAGAAT

CCTCACAATA CCGCAGAGTC TAGACTCGTG GTGGACTTCT

CTCAATTTTC TAGGGGGATC TCCCGTGTGT CTTGGCCAAA

ATTCGCAGTC CCCAACCTCC AATCACTCAC CAACCTCCTG

TCCTCCAATT TGTCCTGGTT ATCGCTGGAT GTGTCTGCGG

CGTTTTATCA TATTCCTCTT CATCCTGCTG CTATGCCTCA

TCTTCTTATT GGTTCTTCTG GATTATCAAG GTATGTTGCC

CGTTTGTCCT CTAATTCCAG GATCAACAAC AACCAGTACG

GGACCATGCA AAACCTGCAC GACTCCTGCT CAAGGCAACT

CTATGTTTCC CTCATGTTGC TGTACAAAAC CTACGGATGG

AAATTGCACC TGTATTCCCA TCCCATCGTC CTGGGCTTTC

GCAAAATACC TATGGGAGTG GGCCTCAGTC CGTTTCTCTT

GGCTCAGTTT ACTAGTGCCA TTTGTTCAGT GGTTCGTAGG

GCTTTCCCCC ACTGTTTGGC TTTCAGCTAT ATGGATGATG

TGGTATTGGG GGCCAAGTCT GTACAGCATC GTGAGTCCCT

TTATACCGCT GTTACCAATT TTCTTTTGTC TCTGGGTATA

CATTTAAGGC CT-3 '

Restriction-structured gene assemblies of the invention can be supplied to an organism for proliferation, reproduction and expression in a variety of ways. For autonomous replication in yeast, autonomous replication sequence (ARS) elements are useful. Examples are PARS1 and PARS2 derived from Peachia pastoris (see co-pending US application SN 666,577 (inventor: Craig, assignee: Philips Petroleum Company)). If integrative transformation of the host is desired instead, the ARS element will not be used. Preferred methods for achieving integrated transformation are described in co-pending patent application Ser. No. 791,013 (Inventor: Craig, Assignee: Phillips Petroleum Company), the first insertable DNA fragment, selectable marker gene And a site-integrated integration vector consisting of a second insert DNA fragment.

The first and second inserted DNA fragments each correspond to at least about 200 nucleotides in length and have nucleotide sequences homologous to genomic DNA portions of a species belonging to the genus Pizzia. The various components of the integration vector are arranged in series, forming a linear fragment of DNA such that the expression cassette and the selectable marker gene are located between the 3 'end of the first insert DNA fragment and the 5' end of the second insert DNA fragment. The first and second insert DNA fragments are oriented in linear fragments arranged consecutively with respect to each other, such as orientation in the Peachia genome.

To transform a host strain, one or more selectable marker genes must be included in the DNA. This facilitates the selection and isolation of organisms incorporating the transforming DNA. Marker genes impart phenotypic traits that were not possessed by the host (e.g., when the untransformed host strain has a bond in a specific amino acid biosynthetic pathway, restores its ability to produce that particular amino acid) .

As will be appreciated by those skilled in the art, additional DNA sequences such as bacterial plasmid DNA, bacteriophage DNA, and the like may be incorporated into the vectors used to practice the present invention. Such sequences allow these vectors to be propagated and maintained in bacterial strains.

The plasmid of the present invention described above has utility in the yeast strain that can be transformed. Regulation of gene expression in yeast by the novel DNA fragments of the present invention can be accomplished by causing the transformed organism to undergo carbon source starvation. When carbon starvation occurs after culturing on various catabolic and non-catalytically inhibited carbon sources, expression of the gene product maintained under the control of the regulatory region of the present invention is induced. Another method for expressing the desired gene product in a suitable species of transformed yeast is to culture the transformed yeast in methanol. Another method of inducing the expression of the desired gene product is to culture the transformed yeast on a medium containing a non-catalytic inhibitor carbon source.

Since the regulatory regions of the present invention have been found to be induced under a variety of conditions, these regulatory regions are useful for expression in all yeast strains. Thus, yeasts that can grow on methanol or on non-catalytically suppressed carbon sources cause foreign, ie, heterologous, polypeptides to be produced directly, while yeasts that can grow on catabolically suppressed carbon sources can cause carbon starvation to occur in such cultured yeast cells. By applying the conditions of exogenous polypeptide is produced.

Examples of preferred transgenic yeast strains in the process of the present invention include Candida, Kloeckera, Saccharomyces, Schizosaccharomyces, Rhodotorula, Hansenula Members of the genus such as Hansenula, Torulopsis, Pichia, and Kluyveromyces. Yeasts derived from these genera are preferred because their handling stability, culture conditions and the like are well established and known to those skilled in the art.

Particularly preferred yeast strains for use in one embodiment of the process of the invention are those capable of growing on methanol as a carbon and energy source. Among yeasts known to grow on methanol are Candida, Kloeckera, Saccharomyces, Rhodotorula, Hansenula, Torulopsis, and blood. Includes members of the same genus as the tooth.

In addition, the control region of the present invention may be induced by culturing in a non-catalytically inhibited carbon source as well as in a carbon source starvation condition, such as glucose, acetate, glycerol, ethanol, lactose galactose, fructose, sucrose, etc. Methanol substrates and mixtures of two or more of them are also useful in practicing the present invention. The host organism is cultured on a suitable non-catalytic inhibitor, non-methanol carbon source (e.g. glycerol or galactose), or the host organism is cultured on a suitable catalytic inhibitor carbon source (e.g. ethanol, glucose and fructose). By allowing the host organism to undergo carbon source starvation, the gene product can then be expressed under the control of the regulatory region of the present invention.

Particularly preferred host yeast strains are Pichia pastoris GS115 (KFCC-10359: deposited on April 22, 1987), a variant lacking histidine production capacity. GS115 has been named as having the mutant genotype his4 due to a defect in the histidine pathway affecting the histidol dehydrogenase-coding gene. GS115 is derived from Peachia Pastoris NRRL Y-11430 and deposited in the Northern Regional Research Center of the United States Department of Agriculture in Peoria, Illinois, and has been given the accession number NRRL Y-15851. This particular host is useful because it is a nutritionally demanding variant that has a defective histidine pathway. Among other DNA sequences, transforming the host with a vector that encodes the function of the HIS4 gene allows for convenient selection of the transformed host.

Another preferred yeast strain for use in practicing the present invention is the variant strain Pichia pastoris GS190 (KFCC-10357: April 4, 1987), which has an arginine pathway that affects the argininosuccinate lyase coding gene. 22 days deposited). GS190 is derived from Peachia Pastoris NRRL Y-11430 and deposited in the Northern Regional Research Center of the United States Department of Agriculture in Peoria, Illinois, and has been given the accession number NRRL Y-18014.

Another preferred host yeast strain is the dual nutritional strain PPF1, in which Pichia pastoris PPF1 (deposited KFCC-10364: April 22, 1987), which has a defect in the histidine and arginine pathways, is a histidinol dehydrogenase. There are defects in histidine pathways that affect the cooting genes and arginine pathways that affect the argininosuccinate lyase coating genes. PPF1 was deposited with the Northern Regional Research Center of the US Department of Agriculture in Peoria, Illinois, and was given the accession number NRRL Y-18017.

Escherichia coli is also a suitable host for the plasmids of the present invention. Those skilled in the art will appreciate that many E. coli strains are suitable hosts. Summarizing several strains used in the work of the present invention are as follows.

The experimental procedure for transforming Pchia pastoris has been described previously and will now be presented in more detail than below (Example I).

Peachia pastoris digests cell walls with enzymes to obtain spheroplasts; The spheroplasts can be transformed by mixing with the transforming DNA, incubating in the presence of calcium ions and polyethylene glycol, and then regenerating them in selective growth medium lacking histidine.

The transforming DNA includes the HIS4 gene lacking in the host strain, in which case only the transformed strain survives the selected growth medium used.

Those skilled in the art will appreciate the numerous methods that can be used to extract heterologous proteins from single cell recombinant hosts. Any technique known to those skilled in the art for destroying cells and concentrating and / or extracting proteins from the destroyed cells is suitable for recovering HBsAg produced according to the present invention.

II" 분석 키트(아보트 연구소)를 사용하여 22nm 입자 분석을 하였다. 가용성 분류물 및 불용성 분류물에 대하여 웨스턴 블로팅 과정을 이용함으로써 단량체 분석을 하였는데, 이때 사용된 것은 방사능 125 I-표지 단백질 A와 단량체 형태의 HBsAg에 대항하여 생긴 항혈청이었다.Transformed cells were cultured under appropriate conditions for expression as described above. The cells were then destroyed and subjected to HBsAg analysis for soluble and insoluble fractions. Commercially available "AUSRIA for soluble classifications"

22 nm particle analysis was performed using the II "Assay Kit (Abbott Laboratories). Monomer analysis was performed for the soluble and insoluble fractions using Western blotting, using radioactivity 125 I-labeled Protein A. And antiserum against HBsAg in monomeric form.

The invention will now be described in more detail in accordance with the following non-limiting examples.

EXAMPLE

Throughout the examples, abbreviations have been used that have the following meanings.

SDS sodium dodecyl sulfate

EDTA ethylenediamine tetraacetic acid

TEMED N, N, N ', N'-tetramethylenediamine

DTT Dithiothreitol

BSA bovine serum albumin

EtBr Ethidium Bromide

PMSF Phenylmethylsulfonyl Fluoride

Ci Curie

60,000 zymolyase from Miles Lab

The buffer and the solution used in the following examples have the following composition.

121.1 g of Tris base in 800 mL of ₁ M Tris buffer H ₂ O; Concentrated (35%) water

The pH is adjusted to the desired value by addition of aqueous HCl;

Cool the solution to room temperature, adjust the final pH and

Dilute to 1 liter of blood.

1.0 mM EDTA in TE buffer 0.01M pH 7.4 Tris buffer

PBS (phosphate-buffered salt) 10 mM sodium phosphate (pH 7.0) 0.15 M NaCl

SDS Gel Fill 62.5 mM Tris-HCl, pH 6.8

(loading) buffer

2% SDS

10% Glycerol

100 mM Dithiothreitol

0.001% bromophenol blue

YPD Medium 1% Bakto-Yeast Extract

2% Bakto-Peptone

2% dextrose

6.75 g yeast nitrogen base lacking SD medium amino acid

(DIFCO)

2% dextrose

(In 1 L of water)

SED 1M Sorbitol

25mM EDTA

50mM DTT

9.1 g of SCE buffer sorbitol

Sodium citrate 1.47 g

EDTA 0.168 g

50 mL H ₂ O

(Adjust pH to 5.8 using HCl)

CaS 1M Sorbitol

10 mM CaCl ₂

(Filtration sterilization)

PEG solution 20% polyethylene glycol-3350

10 mM CaCl ₂

10 mM Tris-HCl (pH 7.4)

(Filtration sterilization)

SOS 1M Sorbitol

0.3 × YPD badge

10 mM CaCl ₂

Basal salt composition (for culture in fermenter of transformed peachia)

Unless otherwise noted, the solutions were used at a basic (1 ×) concentration. Throughout the examples, when different concentration levels are used, the solution is shown as a multiple of the base (1 ×) rhodocity.

Example I

Peachia Pastoris Transformation Process

[A. Cell culture]

1. Inoculate colonies of Pchia Pastoris GS115 (NRRL Y-15851) into 10 mL of YPD medium and shake the cultures at 30 ° C. for 12-20 hours.

2. After about 12-20 hours, the cells are diluted to an OD ₆₀₀ of about 0.01-0.1 and maintained in logarithmic growth mode for about 6-8 hours in YPD medium at 30 ° C.

3. After about 6-8 hours, inoculate 100 mL of YPD and 0.5 mL (or equivalent) of spawn with an OD ₆₀₀ of about 0.1. Shake at 30 ° C. for 12-20 hours.

4. Harvest the cultures by centrifugation at 1500 g for 5 minutes when the OD ₆₀₀ is about 0.2-0.3.

[B. Production of Spheroplasts]

1. Wash the cells once in 10 mL of sterile water. (All centrifugation in steps 1-5 is carried out at 1500 g for 5 minutes.)

2. Wash cells once in 10 mL freshly prepared SED.

3. Wash cells twice in 10 mL of sterile 1M sorbitol.

4. Resuspend the cells in 10 mL of SCE buffer.

5. Add 5-10 μL of 40,000 / mL Zymolyse 60,000 (Miles Laboratories) and incubate the cells at 30 ° C. for about 30-60 minutes.

Since the production of spheroplast is an important step in the transformation process, the production of spheroplast should be controlled as follows. Before or immediately after the addition of the zymolyase, and several times during the incubation period, 100 μL of the cells are added to 900 μL of 5% SDS and 900 μL of 1M sorbitol. The cells are suspended in the SDS but not in the sorbitol (usually between 30 and 60 minutes of incubation).

6. Wash spheroplast in 10 mL of sterile 1 M sorbitol by centrifugation at 1000 g for 5-10 minutes. (The centrifugation time and speed can vary. Centrifugation should be sufficient for the spheroplasts to pellet, but not enough to rupture them by that force.)

7. Wash cells once in 10 mL of sterile CaS.

8. Resuspend the cells in 0.6 mL CaS total.

[C. Transformation]

1. Place a DNA sample (volume of 20 μL or less) into a 12 x 75 mm sterile polypropylene tube. (DNA should be in water or TE buffer. It is reasonable to add about 1 μL of sonicated E. coli DNA at 5 mg / mL in each sample to obtain the maximum transformation frequency with a small amount of DNA.)

2. Add 100 μL of spheroplast into each DNA sample and incubate at room temperature for about 20 minutes.

3. Add 1 mL PEG solution into each sample and incubate at room temperature for about 15 minutes.

4. Centrifuge the cells at 1000 g for 5-10 minutes and decanter the PEG solution.

5. Resuspend the sample in 150 μL of SOS and incubate for 30 minutes at room temperature.

6. Add 850 μL of sterile 1M sorbitol and plate a sample of the sample. (See below).

[D. Regeneration of Spheroplast]

1. Prescription for Regenerative Agar Badges

a. Agar-KCl: Bakto-Agar 9g, KCl 13.4g, H ₂ 0 240mL, autoclaving.

b. 10X Glucose: 20 g of Textose, H ₂ 0 100 mL autoclaved.

c. 10X SC: 6.75 g of yeast nitrogen base lacking amino acids, H ₂ 0 100 mL, autoclaving. (Before or after autoclaving, add the required amino acid or nucleic acid to a concentration of 200 μg / mL.)

d. 30 mL of 10 × glucose and 30 mL of 10 × SC are added into 300 mL of dissolved agar-KCl solution. 0.6 mL of biotin at 0.2 mg / mL and other required amino acids or nucleic acids are added at a concentration of 20 μg / mL. The dissolved regenerated agar is maintained at 55-60 ° C.

2. Plating of Transformed Samples: Pour a bottom agar layer of 10 mL of regenerated agar per plate at least 30 minutes before the transformed sample is ready. While the transformed sample is in SOS, 10 mL aliquots of regenerated agar are dispensed into tube stones in a 45-50 ° C. bath. A large amount of each sample is added to 10 mL aliquots of the dissolved regenerated agar maintained at 45-50 ° C. and each is poured onto a plate containing a solid 10 mL bottom agar layer of regenerated agar.

3. Determination of the quality of the spheroplast formulation: Take a sample of 10 μL and dilute 100 times by adding it to 990 μL of 1M sorbitol. Remove 10 μL from the 100-fold dilution and dilute 100-fold again by adding to the second 990 μL aliquot of 1 M sorbitol. 100 μL aliquots of the two dilutions are spread over YPD agar medium to determine the concentration of intact intact cells remaining in the formulation. 100 μL of each dilution is added to 10 mL of regenerated agar supplemented with 40 μg / mL histidine to determine the total reproducible spheroplast. Good values for the transformation experiments are when the total reproducible spheroplast is 1-3 × 10 ⁷ / mL and intact cells are 1 × 10 ³ / mL.

4. Incubate the plate for 3-5 days at 30 ° C.

Example II

[assembly of pAOP2 family vectors]

1. Plasmid pPG2.5 (pBR322-based plasmid containing about 2.5 Kbp EcoR I-Sa1I fragment from plasmid pPG4.0; this plasmid has a first alcohol oxidase gene (AOX1) and a regulatory region, 1987. 4. E. Coli LF 392-pPG4.0 dated 22, KFCC-0303, available from the Northern Regional Research Center of the United States Department of Agriculture in Peoria, Illinois, as NRRL B-15868 in this Coli host). Digestion with BamH I.

2. The linearized plasmid was digested with BAL31.

3. The resulting DNA was treated with Klenow fragments to enhance blunt ends and linked to EcoRI linkers.

4. The ligation product was transformed into E. coli strain MM 294.

5. Transformants were screened by clony hybridization technique using synthetic oligonucleotides of the following sequence:

5'TTATTCGAAACGGGAATTCC

The oligonucleotide contains an AOX1 promoter sequence up to but not including the codon of the ATG initiation codon. Wherein said sequence is fused to the sequence of an EcoRI linker.

6. The arrangement of positive clones was determined by the Membrane-Zilbert technique. All three positive clones had the following sequence.

5 '... TTATTCGAAACGAGGAATTCC ... 3'

All of them carried the "A" of ATG (underlined in the sequence). It was determined that A was probably not harmful, so all subsequent clones are derivatives of these positive clones. These clones were given the laboratory names pAOP1, pAOP2 and pAOP3, respectively.

7. The other two clones were identified by screening test of BAL31 / linker-linked product. They have the following sequence.

5 '... TAATTATTCGGAATTCC ... 3'

pAOX 1 ECoRI

These clones were given the names pAOP5 and pAOP6.

As a variation of this process, pPG2.5 was cut with AsuII instead of BamH I, the linearized fragments were treated with Klenow fragments (no BAL 31 treatment as performed above) and linked to EcoRI linkers. The resulting plasmid contains the AOX1 promoter sequence and no ATG initiation codon. The resulting plasmid was named pAOP4 and its sequence is as follows.

5 '... TAATTATGGAATTC ... 3'

pAOX1 EcoRI

The AOX1 promoter (pAOX1) responds to carbon catabolism inhibition by severe interruption of enzyme synthesis. The AO promoter also reacts to carbon starvation. Incubation on methanol further induces the AOXl promoter. Moreover, the regulation of AOX1 promoter fragments used in the present invention in a manner analogous to the intrachromosomal AOX1 promoter has been described by a wide variety of studies (eg, Ellis, Brew, Cowz, Waters, Haffold and Jingaras). Biology, 1985, 5, p. 1111-1121). Each lon, prepared and isolated as described in this example, reacts to foreign substance inhibition, carbon starvation and methanol induction, as is the AOX1 promoter itself.

[Statement of AO terminator]

Stu I-HindIII fragments used as AO terminators contain sequences that provide a template for polyadenylation of AOX1 mRNA copies. These sequences include the following.

TATAGTATAGGATTTTTTTTGTC-polyadenylation

When the stu I-HindIII fragment is located 3 'to the polypeptide coding region on the plasmid, termination of RNA is facilitated. The AOX1 termination sequence is isolated and can be recovered from pPG3.2, the pBR322-based plasmid containing the AOX1 termination sequence. This plasma E. coli LE 392-pPG3.2 (KCTC 8247P: deposited on April 30, 1987) transformed into E. coli host was NRRL at the Northern Rijonal Research Center of the United States Department of Agriculture in Peoria, Illinois. Deposited under the deposit number B-15999.

Example III

The sequence of steps used for the plasmid preparation, which is the subject of this example, is summarized in FIG.

[Assembly of pBSAG5 and pBSAG5I]

1. Assembly of PCFL2

At the 3'-terminus the vector pAOP2 containing the AOX1 promoter without TG of ATG was cut with HinoII. Such promoter-containing DNA fragments were isolated and linked to pBR322 previously cut with HindIII and filled with Klenow fragments. This reaction resulted in the vector pCFL2.

2. Assembly of pBSAOP2

PBR322-Bg1II, pBR322 where PvuII site was replaced by Bg1II site, was digested with EcoRI and Cla I. This linearized plasmid and 5'AOX1-containing Cla I / EcoRI fragment from pCFL2 were bound by ligation. The resulting vector is named pBSAOP2.

3. Assembly of pBSAG22

the plasmid pHBS-5 containing HBsAg gene inserted into the EcoRI locus in pBR322 is described in Nature 298.347-350 (1982) of Valenzuela; Fig. 6] was cut with Cla I. About 60 base pairs were removed in both directions using Bal31 exonuclease. The remaining DNA fragments were digested with BamHI and loaded with Klenow fragments. After ligation, pools of about 200 transformants were cut with Nco I. Linear plasmids were isolated and relinked.

After transformation of E. coli, about 10% (named pBSAGl) of all plasmids had the newly created Nco I site. pBSAG1 was digested with Nco I, filled with Klenow fragments and digested with BamHI. This plasmid fragment was previously linked to pBSAOP2 digested with EcoRI, filled with Klenow fragments and digested with BamHI. The resulting vector was named pBSAG22.

4. Assembly of pBSAG4, pBSAG5, pBSAG5I

A 1.6 kbp Sal I-HindIII fragment of plasmid pAOT-1 [pPG3.2 (available as NRRL-B-l5999 in E. coli host) with 3′-AOX1 transcription termination fragment was subjected to Sal I-HindIII cleavage PBR322 ΔEcoRI PBR322-based plasmids induced by ligation were cut with XbaI and PstI. Terminator-containing fragments were linked to pBSAG22, previously cut with XbaI and PstI, to obtain pXP-1. pBSAG22 was digested with DraI followed by StuI linker and finally digested further with StuI and EcoRI. The HBsAg structural gene was isolated and linked to pXP-1 previously cut with StuI and EcoRI to obtain pBSAG4.

HBsAg containing the ClaI fragment from pBSAG4 was linked to the unique ClaI site of pYJ33 (see Figure 8) to obtain pBSAG5 and pBSAG5I. A restriction map of plasmid pBSAG5I is shown in FIG. Plasmids pBSAG5 and pBSAG5I differ only in the orientation of the ClaI fragments containing the 5'-AOX1 / HBsAg / 3'-AOXl expression cassette. For pBSAG5, the 5'-AOX1 fragment is adjacent to the Pchia HIS 4 gene, while the 3'-AOXl fragment is adjacent to the autonomic element PARS2. The plasmid pBSAG5, transformed into E. coli host, has been deposited with the Northern Rijonal Research Center of USDA. The E. coli strain MC1061-pBSAG5 (KCTC 8250P: deposited May 21, 1987) was given an accession number of NRRL B-l8028.

Example IV

[Assembly of Pichia Pastoris HBsAg Expression Host GS115 (pBSAGI5I)]

The preparation of a Pchia pastoris host in which the first alcohol oxidase gene (AOXl) is replaced by the hepatitis B surface antigen (HBsAg) gene in the Peachia chromosome is described in this example.

Plasmid pBSAGI5I was assembled as summarized in FIGS. 9-11 to produce P. pastoris HBsAg expression-Aox1-mutant hosts. The first step in this assembly is digesting the Aox1 promoter-LacZ gene expression vector pSAOH5 and the Aox1 promoter-HBsAg expression vector pTHBS3 (prepared as described below and outlined in Figure 16) with restriction endonuclease HindIII. It was to let. To prepare PTHBS3, plasmid pAOT-1 (see FIG. 7) was cut with Stu1, linked with EcoRI linker and digested with PstI. Digestion was performed with EcoRI-PstI containing 3′-AOX1 fragment. EcoRI-PstI fragments containing 3′-AOX1 fragments were isolated. The vector pAOP3 containing the 5'-AOXl sequence was cut with EcoRI and SstI, and the resulting 5'-AOX1 fragment was previously cut with EcoRI and SstI. Shuttle vector pSEY101 (in Douglas group (1984) Proc. Natl. Acad, Sic. USA. 81, 3983-3987. The concatenation of the pAOP3 fragment and the pSEY101 fragment resulted in the plasmid pTA020. The plasmid pTA020 contains the URA3 gene and the ampicillin gene (for selection in S. cerevisiae and bacteria, respectively), a 2μ ring and a 5'-AOX1 sequence for replication in S. cerevisiae.

Plasmid pTA020 was partially cut using PstI. The linearized vector was isolated and cut with EcoRI. The vector pTHBS1 was made by linking the largest fragment (containing the 2μ ring sequence, the URA3 gene and the 5'AOX1 fragment) to the 3'-AOX1 fragment obtained from pAOT-1.

HBsAg-containing EcoRI fragments from pHBS-5 were isolated by digesting with EcoRI and then linked with pTHBS1 previously digested with EcoRI and treated with bacterial alkaline phosphatase. The resulting vector (pTHBS2) has the HB sAg gene inserted between the 3'- and 5'-AOX1 sequences.

Plasmid pYJ30 (available as B-15890 in E. coli host) was cut with EcoRI, filled with Klenow fragments and cut with PstI.

P. Pastoris HIS4 / PARS1-containing fragments were isolated and linked to PstI-SstI fragments from vector pTHBS2 (containing the HBsAg gene flanked by AOX1 sequences). This connection yields the vector pTHBS3.

The 1.4kbp fragment obtained by digesting pTHBS3 with HindIII (which contains the HBsAg gene, AOX1 termination sequence and a portion of the AOX1 promoter sequence) was recovered, and a 7.7kbp fragment (pichia HIS4 gene, mostly from pSAOH5). AOX1 promoter sequence and sequence from pBR322). 9.1 kbp of recombinant plasmid pYM39 containing the restored AOX1 promoter sequence was isolated.

In the second assembly step, plasmid pPG3.2 (available as NRRL D-15999 in E. coli host) was digested with PvuII and a 1.5 kbp fragment containing the sequence just 3 'of the AOX1 gene was transferred to a single NruI of pYM39. Inserted in place. The 10.6 kbp recombinant plasmid pYMI6 was isolated, which contained a PvuII fragment in which the 3'AOX1 proximal sequence was directed toward the HIS4 gene portion of the vector. Plasmid pYM16 has all the components necessary to delete the AOX1 gene from the Peacha host and express HBsAg under AOXl promoter control but does not have the trimmed HBsAg gene fragment of pBSAG5.

Therefore, the final assembly step was to recombine the desired HBsAg gene into the AOX1 gene deletion vector. For this purpose, pYMI6 and pBSAG5I (the same plasmid as pBSAG5 except that the ClaI fragment with the HBsAg expression cassette was reversely oriented) were digested with restriction enzymes PstI and SphI. Insert 6.3 kbp fragments from pBSAG5I (containing the trimmed HBsAg gene expression cassette and Peach HIS4 gene) into 4.6 kbp fragments from pYMI6 (containing the 3'AOX1 sequence and most of pBR322), 10.9 The final plasmid pBSAGI5I of kbp was obtained. Plasmid pBSAGI5I was deposited in E. coli MC 1061-pBSAGI5I (KFCC-10356: Apr. 22, 1987) placed in an E. coli host and deposited at the Northern Regional Center of the US Department of Agriculture, Peoria, Illinois, and NRRL B. I received a deposit number of -18021.

To transform P. pastoris his4 mutant strain GS115 (NRRL Y-15851), pBSAGI5I was first digested with restriction enzyme Bgl II to obtain a linear vector of 7.2 kbp, at one end of the vector 5 'of the AOX1 gene. The sequence contained 0.85 kbp from the other end and the other end contained 1.1 kbp from the 3 ′ of the AOX1 gene (FIG. 12). By making a selection for histidine basal organotrophy, about 2 μg of pBSAGI5I digested with BglII was transformed into GS115.

The AOX1 gene was deleted due to transformation where pBSAGI5I was inserted as a linear molecule at the AOX1 chromosome locus. Therefore, His ⁺ -transformation strains with the desired linear insertion were identified as growing very slowly for methane (P. Pastoris has a second "weak" alcohol oxidase gene AOX2, 1 produces enough alcohol oxidase to grow methanol at a slow rate in strains lacking the alcohol oxidase gene).

The first step in the identification of His ⁺ transformants that could not grow well on methanol was to recover His ⁺ cells buried in the selected agar. This recovery step was carried out by transferring the agar into a 50 mL tube containing 20 ml of sterile water and grinding the agar at low speed for 30 seconds using a Brinkman equalizer. The mixture was filtered through gauze and agar debris was separated from the cells by rinsing the agar using 30 mL of sterile water. The yeast cells were then diluted to an optical concentration of 0.1 at A ₆₀₀ , a Branson sonicator was set to 4 and sonicated for 10 seconds to break up the separate yeast cell mass and diluted 100-fold using sterile water. Subsamples were applied at 10 μL and 100 μL onto agar plates containing 0.67% yeast nitrogen (Difco) and 0.1% glucose without amino acids. After incubation at 30 ° C. for 3 days, colonies on the plate were screened for growth on methanol. The method used here was carried out on a series of agar plates containing 0.67% yeast nitrogen lacking amino acids, 1) free of carbon sources, 2) 0.5% methanol, or 3) 2% glycos as carbon sources. It was copy plated colonies. Of the colonies grown on 2% glucose, 32% did not grow well on methanol.

To confirm that the pBSAGI5I sequences were inserted as shown in FIG. 12, the whole DNA was extracted from any of the P. pastoris strains defective in methanol availability, digested with restriction endonucleases, and Southern Hybridization with a 32p-labeled probe was made by the blot method. In a set of Southern blots, DNAs from Aox1 ^- strain, GS115 (pBSAGI5I) and Aox1 ⁺ straining GS115 were digested with HindIII and consisted of labeled pPG 4.0 (AOX1 gene and sequences from pBR322). Plasmid and hybridized with NRRL B-15868 from the Northern Regional Research Center in Peoria, Illinois, in E. coli host. A 2.3 kbp fragment encoding AOX1 was observed in the lane containing GS115 DNA. However, in the lane containing GS115 (pBSAGI5I) DNA, 2.3kbp fragments were absent and new fragments appeared. These results demonstrated that the AOX1 gene was deleted from GS115 (pBSAGI5I).

Example V

[Cultivation of Peach Yeast Transformed by HBsAg-Encoding Vector]

1. Incubation of GS115 (pBSAG5) in Fermentor

10% inoculum was incubated overnight in yeast nitrogen (YNB) + 2% glucose in shake flask (30 ° C.). This inoculum was added to sterile basal salt in fermenter (pH adjusted to 4). The dilution rate of 0.05 to 0.1h ^-l was added to glucose feed. HBsAg production was induced by changing the feed carbon source to methanol or a 50% glucose-50% methanol mixture when the cell concentration reached a steady state and the glucose level of the fermenter approached less than 100 ppm.

2. Culture of GSlI5 (pBSAGI5I) (Aox1-) in Fermentor

Optimal expression of soluble HBsAg Ausria activity (soluble protein: 3-4%) is achieved by batch culturing this Aox1 ^- organism on glycerol and then on methanol-containing feed. Inoculum can be cultured on YNB + glycerol. Basic salts, glycerol (1% and 4% glycerol used) and biotin can be autoclaved in fermenters. After cooling, the pH should be adjusted to 3.5 to 6, and trace salts (2.5 mL / L) must be added prior to inoculation. 100% methanol may be initiated before or after glycerol is depleted. Methanol levels around 2% do not interfere with HBsAg accumulation, and this period can last as long as 200 hours. However, 5% methanol in the fermenter will stop the accumulation of HBsAg particles.

Cultivation up to higher cell concentrations was performed by increasing the concentration of the feed salt. Incubating on methanol is particularly important to increase the amount of zinc to increase cell concentration. Higher levels of extractable ausria activity were achieved when the culture was not limited to zinc and the extractable protein was also high, resulting in a net decrease in the ausria activity as a percentage of soluble protein.

2이 얻어질때면 언제든지, 동일한 배지를 사용하여 배양물을 2배 희석하였다. 100OD₆₀₀샘플들을 주기적으로 분리해내고 2000Xg로 7분간 원심분리시켰다. 생성된 세포 펠릿은-70℃에서 1-2주간 동결 보관될 수 있다.3. Shake flask culture of GS115 (pBSAG5) and GS115 (pBSAGI5I) cell cultures One transformed colony was drawn and streaked onto SD plates. One cell line was inoculated into 50 mL of YNB culture containing 5% glucose (1 × YNB, 5 μg / ml of biotin) in a 250 mL shake flask and overnight at 30 ° C. at 250 revolutions per minute in an air shaker. Shaken. The OD ₆₀₀ read in the morning was 2-3. Cells of 100 OD ₆₀₀ units (about 10 ⁹ cells) were removed from the shake flask and centrifuged for 7 min at 200Xg, room temperature in an IEC centrifuge. Cell pellets were resuspended (OD ₆₀₀ = 0.2) in 500 mL of YNV culture containing 2% glycerol (in a 2-liter shake flask). The OD ₆₀₀ of the culture in the group, air agitation to reach the 2-3 OD ₆₀₀ was incubated in the 30 ℃, 250rpm. In the case of Aox1 ^- host, 500OD ₆₀₀ was isolated from the culture. The cell suspension was centrifuged at 2000 × g for 7 minutes in IEC. Cell pellets were resuspended in 500 mL YNB culture containing 0.5% methanol (OD ₆₀₀ = 0.1). For Aoxl ⁺ hosts, cells of 170 OD ₆₀₀ were isolated from the culture, centrifuged under the same conditions, and resuspended in 500 mL of YNB broth containing 0.5% methanol (OD ₆₀₀ = 0.3). The two cultures were shaken at 30 ° C. and 250 rpm in a 2-liter shake flask. OD ₆₀₀

Whenever 2 was obtained, the cultures were diluted 2-fold using the same medium. 100 OD ₆₀₀ samples were periodically separated and centrifuged at 2000 × g for 7 minutes. The resulting cell pellet can be cryopreserved at −70 ° C. for 1-2 weeks.

Example VI

[Analysis of HBsAg: 22nm Particles and HBsAg Monomer]

1. Determination of Extracts and Protein Formulations

All subsequent work was performed at 0.4 ° C. Frozen cell pellets were thawed and washed twice with 2 mL of ice cold solubilization buffer. Cells (100 OD ₆₀₀ units) were transferred into disposable glass tubes (13 × 100 mm). 0.35 mL of solubilization buffer and 0.5 g of acid-washed glass beads (diameter: 0.45 mm) were added to the cell pellet. This suspension was shaken four times every minute with the maximum setting on the vortex mixer and allowed to stand on ice for one minute interval between each stirring period. The intact cell slurry was separated and the glass beads washed with 0.35 mL of solubilizing solvent. Wash buffer was combined with the cell slurry and transferred into an Eppendorf tube. The extract was centrifuged for 15 minutes in an Eppendorf centrifuge. Supernatant (soluble fraction; 0.7 mL) was separated from the pellet. To extract HBsAg protein from the pellet, 2 × concentrated SDS-gel fill buffer was added to the pellet and the mixture was stirred on a vortex mixer and boiled for 15 minutes. After the mixture was centrifuged for 15 minutes, the supernatant (insoluble fraction) was separated from the cell debris. Protein content analysis was performed on subsamples from soluble and insoluble fractions using the TCA precipitation and Lowry method. BSA was used as a protein concentration standard. Insoluble and soluble fractions both had protein concentrations of 3-15 mg / mL.

2. Another Process for Preparing Extracts

The report describes conditions for extracting monomeric heterologous protein HBsAg or protein complex 22nm particles (derived from a culture of Pchia pastoris transformed with a vector containing the sequence encoding the HBsAg protein). have.

Cultures of P. pastoris were incubated at a cell concentration of 10-100 OD ₆₀₀ units per milliliter. Aliquots of 100 OD ₆₀₀ units were transferred into 13 × 100 mm borosilicate culture tubes and washed twice with 20 volumes of solubilization buffer.

After pelleting the cells, 0.5 g of acid-washing glass beads (0.5 mm) was added to these pelleted cells (IEC clinical centrifuge) followed by 0.35 mL of solubilization buffer. Solubilization buffer contained 0.5M NaC1 and 0.1% Triton X-100 (weight / volume) (control), or 3M potassium iodide or potassium thiocyanate in the presence or absence of 0.1% Triton X-100. . All solutions were buffered to pH 7.5 with 10 mM sodium phosphate. The mixture was stirred four times at maximum speed using a vortex mixer, with an interval of 1 minute between stirrings each time. During the interval, the mixture was cooled on ice for at least 1 minute. After lysis was complete, the solution of the destroyed cells was removed, the glass beads washed with 0.35 mL of solubilization buffer, the two solutions combined, and 15 minutes at 13,000 × g. Centrifuged. The supernatants were separated and analyzed for immunoreactive HBsAg particles (Ausria assay) and total trichloroacetic acid precipitation protein (Lowry). The results for the five experiments are shown in Table I below.

TABLE I

None of the conditions containing potassium iodide or potassium thiocyanate provide higher HBsAg particle values compared to those using sodium chloride (column A), but potassium iodide or potassium thiocyanide does not release the total protein. By inhibition (column B), it is clear that the specific activity of the particles is increased 2-5 fold (column).

3. 22 nm particle analysis (AUSRIA ^TM II kit)

Soluble fractions were diluted 1000-10,000 fold using Ausria dilution buffer and 25-100 μL aliquots were analyzed as follows.

[First culture]

1. To make a standard curve, a dilution series containing 200 μL of the final volume each and 0.1 ng to 4 ng of control was pipetted into the bottom of each well of the reaction tray (with four negative controls).

For the sample to be analyzed, 200 μL of each diluted soluble fraction was pipetted to the bottom of a separate well in the reaction tray.

2. Carefully add one bead into each well containing sample fractions or controls. Alternatively, the beads may be dispensed before adding the control or sample.

3. A cover seal was applied to the reaction tray and then gently tapped to remove any air bubbles covered and trapped.

4. The reaction was incubated at 45 ° C. for 2 hours.

5. The cover seal was removed and discarded. The liquid was aspirated off and each bead was washed twice with 4-6 ml of distilled or deionized water.

[Second culture]

6. 200 μL of ¹²⁵ I-anti-HBs were pipetted into each well containing beads.

7. A new cover seal was applied and the reaction tray was gently tapped to remove any air bubbles covered and trapped.

8. The reaction trays were incubated at 45 ° C. for 1 hour.

9. The cover seal was removed and discarded.

10. The beads were immediately transferred into appropriately identified counting tubes.

Read Hoist Scintillation Counter:

11. Count speed was measured for 1 minute.

12. Samples were counted within 24 hours after the last wash.

Using standard curves made as described in step 1, the levels of 22 nm particles were calculated.

4. Monomer Analysis (Western Analysis)

H ₂ O was added to a volume corresponding to 25 μg of protein (soluble or insoluble fraction) (usually 2-5 μL) to a final volume of 10 μL. 10 μL of 2 × concentrated gel fill buffer (1 × buffer 100 mM DTT) was added and the sample was boiled for 15 minutes. The boiled sample was placed on a 12% SDS acrylamide gel (Laemmli). After gel electrophoresis, the protein was purified by nitrocellulose paper [Provin. Natl. Acad. Sci. USA 76, 4350-4354 (1979). HBsAg was detected using HBsAg antiserum (generated against form-induced HBsAg) and ¹²⁵ I-labeled protein A. Nitrocellulose paper was exposed to Kodak XAR-film overnight at -70 ° C. Monomers were quantified by counting the radioactivity bands from the nitrocellulose paper in gamma-count continuation. Recombinant HBsAg (100-500 ng / lane) produced by S. cerevisiae was used as standard.

EXAMPLE VIl

[HBsAg expression level in Pchia pastoris]

Production of HBSAg by several transformed P. pastoris strains was determined by the assay document described in Example VI using the solubilization report described in Part 1 of Example VI. The results are summarized in Table II.

TABLE II

^a Protein analysis: measured by the Bradford method

^b HBsAg per liter of medium: OD ₆₀₀ = 5 × 10 ⁷ cells / mL = 0.14 mg dry weight / mL = 0.06 mg protein / mL

The results presented above demonstrate that large amounts of HBsAg can be produced in Pchia pastoris when under the control of the first alcohol oxidase gene (AOX1) regulatory region derived from Pchia pastoris.

Claims (20)

(1) a DNA fragment consisting of the following (a) and (b), ie, located at the 5 'end of the (a) polypeptide coding region, can regulate transcription of messenger RNA, and (i) contains a DNA fragment The presence of methanol in the medium in contact with the host organism, (ii) the presence of a non-catalytic inhibitor carbon source other than methanol in the medium in contact with the host organism containing the DNA cross section, and (iii) the DNA fragment A control region in which the host organism is incubated at a catabolism-inhibiting carbon and energy source and reacted to at least one condition selected from carbon source starvation in the medium in contact with the host organism, and (b) hepatitis B surface antigen or its DNA fragments consisting of polypeptide coding regions encoding portions, or (2) bacterial plasmid DNA, selective yeast marker genes, and yeast autonomous replication sequences, as well as such DNA fragments. The yeast strain transformed due to the plasmid consisting of the incubated culture in an influence medium consisting of methanol, a non-catalytic non-inhibiting carbon source, or a mixture thereof, or one or more catabolically inhibiting carbon and energy source, and the carbon and If the energy source is a catabolism-inhibiting carbon and energy source, the method of producing a hepatitis B surface antigen, characterized in that the conditions of the carbon source starvation is added to the product of the culture step. 2. The method of claim 1, wherein said DNA fragment is as shown in the restriction map of FIG. 3. The DNA fragment of claim 1 or 2 has a DNA 3 'sequence attached to the DNA fragment below the polypeptide coding region that is capable of controlling transcription termination and polyadenylation of messenger RNA encoded by the polypeptide coding region. Characterized by the above. The method of claim 1 or 2, wherein the DNA fragment is attached to at least one DNA sequence derived from bacterial plasmid DNA, bacteriophage DNA, yeast plasmid DNA, yeast chromosomal DNA or two or more thereof. . 5. The method of claim 4, wherein said yeast chromosomal DNA consists of autonomously replicating DNA sequences and marker genes. The method of claim 5, wherein the autonomous replication sequence is PARS1 or PARS2. 3. The DNA fragment according to claim 1 or 2, wherein the DNA fragment has a contiguous sequence DNA consisting of a first inserted DNA fragment, a selectable marker gene and a second inserted DNA fragment; Wherein said first and second inserted DNA fragments each have a nucleotide sequence of at least about 200 nucleotides in length and homologous to the genomic DNA portion of a species belonging to the genus Pchia; The DNA fragment and the marker gene are located between the 3 'end of the first insert DNA fragment and the 5' end of the second insert DNA fragment; Wherein said first and second insert DNA fragments are oriented with respect to each other as oriented in the genome of a pichia. 3. The method of claim 1 or 2, wherein the polypeptide coding region consists essentially of about 700 base pair fragments, or subunits thereof, or variants or functional equivalents thereof. 5'-GAATTCATGG AGAACATCAC ATCAGGATTC CTAGGACCCC TGCTCGTGDT ACAGGCGGGG TTTTTCTTGT TGACAAGAAT CCTCACAATA CCGCAGAGDC TATACTCGTG GTGGACTTCT CTCAATTTTC TAGGGGGATC TCCCGTGTGT CTTGGCCAAA ATTCGCAGTC CCCAACCTCC AATCACTCAC CAACCTCCTG TCCTCCAATT TGTCCTGGTT ATGGCTGGAT GTGTCTGCGG CGTTTTATCA TATTCCTCTT CATCCTGCTG CTATGCCTCA TCTTCTTATT GGTTCTTCTG GATTATCAAG GTATGTTGCC CGTTTGTCCT CTAATTCCAG GATCAACAAC AACCAGTACG GGACCATGCA AAACCTGCAC GACTCCTGCT CAAGGCAACT CTATGTTTCC CTCATGTTGC TGTACAAAAC CTACGGATGG AAATTGCACC TGTATTCCCA TCCCATCGTC CTGGGCTTTC GCAAAATACC TATGGGAGTG GGCCTCAGTC CGTTTCTCTT GGCTCAGTTT ACTAGTGCCA TTTGTTCAGT GGTTCGTAGG GCTTTCCCCC ACTGTTTGGC TTTCAGCTAT ATGGATGATG TGGTATTGGG GGCCAAGTCT GTACAGCATC GTGAGTCCCT TTATACCGCT GTTACCAATT TTCTTTTGTC TCTGGGTATA CATTTAAGGC CT-3 ' The method of claim 1 or 2, characterized in that the hepatitis B surface antigen is isolated and purified. (a) located at the 5 'end of the polypeptide coding region can regulate transcription of messenger RNA, and (i) the presence of methanol in the medium in contact with the host organism containing this DNA fragment; (ii) the presence of a non-catalytically inhibiting carbon source other than methanol in the medium in contact with the host organism containing this DNA fragment and (iii) placing the host organism containing this DNA fragment on a catalyzed inhibitory carbon and energy source. (B) attaching a regulatory region that reacts to one or more conditions selected from carbon source starvation in the medium in contact with the host organism to (b) a polypeptide coding region encoding hepatitis B surface antigen or a portion thereof. Method for producing a novel DNA fragment characterized in that. 11. A method according to claim 10, wherein the control area is as shown in the restriction map of FIG. 12. The method according to claim 10 or 11, characterized in that a DNA 3 'sequence capable of controlling transcription termination and polyadenylation of messenger RNA encoded by the polypeptide coding region is attached to DNA below the polypeptide coding region. Way. (a) located at the 5 'end of the polypeptide coding can regulate transcription of messenger RNA, (i) the presence of methanol in the medium in contact with the host organism containing the DNA fragment, (ii) containing the DNA fragment The presence of a non-catalytically inhibiting carbon source other than methanol in medium in contact with a host organism and (iii) contacting the host organism containing the DNA fragments with the host organism after culturing on the catalysed carbon and energy source. A DNA fragment comprising a regulatory region that reacts to at least one condition selected from carbon source starvation in a medium, and (b) a polypeptide coding region encoding hepatitis B surface antigen or a portion thereof. 14. A DNA fragment as claimed in claim 13 wherein said regulatory zone is as shown in the restriction map of FIG. 15. The DNA cross-section of claim 13 or 14, wherein the DNA cross-section is attached to a DNA 3 ′ sequence below the polypeptide coding region capable of controlling transcription termination and polyadenylation of messenger RNA encoded by the polypeptide coding region. Characterized by a DNA fragment. 15. The DNA fragment according to claim 13 or 14, wherein the DNA fragment is attached with one or more DNA sequences derived from bacterial plasmid DNA, bacteriophage DNA, yeast plasmid DNA, yeast chromosomal DNA, or two or more thereof. snippet. 17. The DNA fragment of claim 16, wherein said yeast chromosomal DNA consists of an autonomously replicating DNA sequence and a marker gene. 18. The DNA fragment of claim 17 wherein the autonomous replication sequence is PARS1 or PARS2. 15. The DNA fragment according to claim 13 or 14, wherein the DNA fragment has a contiguous sequence DNA consisting of a first inserted DNA fragment, a selectable marker gene, and a second inserted DNA fragment; Wherein the first and second inserted DNA fragments each have a length of at least about 200 nucleotides and the genome of the species belonging to the genus Pichia, respectively. Has a nucleotide sequence homologous to a DNA portion; The DNA fragment and the marker gene are located between the 3 'end of the first insert DNA fragment and the 5' end of the second insert DNA fragment; Wherein said first and second insert DNA fragments are oriented with respect to each other as oriented in the genome of Peachia. 15. The DNA fragment of claim 13 or 14, wherein said polypeptide coding region consists of about 700 base pair fragments shown below, or subunits thereof, variants or functional equivalents thereof. 5'-GAATTCATGG AGAACATCAC ATCAGGATTC CTAGGACCCC TGCTCGTGDT ACAGGCGGGG TTTTTCTTGT TGACAAGAAT CCTCACAATA CCGCAGAGDC TATACTCGTG GTGGACTTCT CTCAATTTTC TAGGGGGATC TCCCGTGTGT CTTGGCCAAA ATTCGCAGTC CCCAACCTCC AATCACTCAC CAACCTCCTG TCCTCCAATT TGTCCTGGTT ATCGCTGGAT GTGTCTGCGG CGTTTTATCA TATTCCTCTT CATCCTGCTG CTATGCCTCA TCTTCTTATT GGTTCTTCTG GATTATCAAG GTATGTTGGC CGTTTGTCCT CTAATTCCAG GATCAACAAC AACCAGTACG GGACCATGCA AAACCTGCAC GACTCCTGCT CAAGGCAACT CTATGTTTCC CTCATGTTGC TGTACAAAAC CTACGGATGG AAATTGCACC TGTATTCCCA TCCCATCGTC CTGGGCTTTC GCAAAATACC TATGGGAGTG GGCCTCAGTC CGTTTCTCTT GGCTCAGTTT ACTAGTGCCA TTTGTTCAGT GGTTCGTAGG GCTTTCCCCC ACTGTTTGGC TTTCAGCTAT ATGGATGATG TGGTATTGGG GGCCAAGTCT GTACAGCATC GTGAGTCCCT TTATACCGCT GTTACCAATT TTCTTTTGTC TCTGGGTATA CATTTAAGGC CT-3 '

Images