KR20240103082A - Novel heat resistant spore forming strains and probiotics uses thereof - Google Patents

Novel heat resistant spore forming strains and probiotics uses thereof Download PDF

Info

Publication number
KR20240103082A
KR20240103082A KR1020220183920A KR20220183920A KR20240103082A KR 20240103082 A KR20240103082 A KR 20240103082A KR 1020220183920 A KR1020220183920 A KR 1020220183920A KR 20220183920 A KR20220183920 A KR 20220183920A KR 20240103082 A KR20240103082 A KR 20240103082A
Authority
KR
South Korea
Prior art keywords
bacillus licheniformis
strain
dj5b
culture
resistance
Prior art date
Application number
KR1020220183920A
Other languages
Korean (ko)
Inventor
이은우
이수정
노다인
이영선
정상윤
이명진
박종훈
Original Assignee
동의대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 동의대학교 산학협력단 filed Critical 동의대학교 산학협력단
Priority to KR1020220183920A priority Critical patent/KR20240103082A/en
Publication of KR20240103082A publication Critical patent/KR20240103082A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • C—CHEMISTRY; METALLURGY
    • C05—FERTILISERS; MANUFACTURE THEREOF
    • C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
    • C05F11/00—Other organic fertilisers
    • C05F11/08—Organic fertilisers containing added bacterial cultures, mycelia or the like
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/32—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the digestive tract
    • A23V2200/3204—Probiotics, living bacteria to be ingested for action in the digestive tract
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/10—Bacillus licheniformis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Birds (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Animal Husbandry (AREA)
  • Molecular Biology (AREA)
  • Physiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수하고, 특히 포자의 내열성이 우수한 신규한 바실러스 리체니포미스 균주, 및 이의 프로바이오틱스 용도에 관한 것이다. 본 발명의 신규한 바실러스 리체니포미스 균주는 우수한 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률과 함께 또한 우수한 내열성으로 인해 다양한 방법의 가공이 가능하므로, 프로바이오틱스 용도로서 활발하게 이용될 수 있을 것으로 기대된다.The present invention relates to a novel Bacillus licheniformis strain having excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate, and especially excellent heat resistance of spores, and its use as a probiotic. The novel Bacillus licheniformis strain of the present invention can be processed in various ways due to its excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate and also excellent heat resistance, so it can be actively used as probiotics. It is expected that

Description

신규한 내열성 포자형성 균주, 및 이의 프로바이오틱스 용도{Novel heat resistant spore forming strains and probiotics uses thereof}Novel heat resistant spore forming strains and probiotics uses thereof}

본 발명은 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수하고, 특히 포자의 내열성이 우수한 신규한 바실러스 리체니포미스 균주, 및 이의 프로바이오틱스 용도에 관한 것이다.The present invention relates to a novel Bacillus licheniformis strain having excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate, and especially excellent heat resistance of spores, and its use as a probiotic.

현대에는 과도한 스트레스 환경과 서구화된 식습관에 의해 장내 불편감을 호소하는 케이스가 급격히 증대되었고, 이에 따라 프로바이오틱스(probiotics)에 대한 관심이 높아지고 있다. 프로바이오틱스란 항생물질을 의미하는 항생제(antibiotics)와는 대립되는 어원적 의미를 가지는 것으로 장 내부의 미생물 균형에 도움을 주는 미생물 제제 또는 미생물 성분으로 정의되며, 락토바실러스균과 비피더스균 등 유산균이라고 총칭하는 균종이 대표적이다. 프로바이오틱스는 GRAS(Generally Recognized As Safe)로 분류되며, 사람과 동물에 대한 독성유전자를 보유하고 않고, 병원성물질도 생산하지 않아야 한다. 또한 축산 생산성에 대한 개선 효능이 확인된 미생물이어야 한다.In modern times, cases of intestinal discomfort have rapidly increased due to excessively stressful environments and westernized eating habits, and interest in probiotics is increasing accordingly. Probiotics have an etymological meaning that is the opposite of antibiotics, which means antibiotics, and are defined as microbial preparations or microbial ingredients that help balance the microorganisms inside the intestines. They are species of bacteria collectively called lactic acid bacteria, such as Lactobacillus and Bifidobacterium. This is a representative example. Probiotics are classified as GRAS (Generally Recognized As Safe) and must not contain toxic genes for humans and animals and must not produce pathogenic substances. Additionally, it must be a microorganism with confirmed efficacy in improving livestock productivity.

프로바이오틱스의 효능은, 강력한 부착력으로 장점막에 정착하여 장질환을 유발하는 병원균을 경쟁적으로 배설시키는 것이며, 항생제 투여에 따른 장내균총의 파괴를 신속히 회복시키는 것이다. 또한 병원성 미생물의 감염에 대한 예방과 함께 증식을 억제시키는 것이고, 장내 유익균의 발육에 최적인 환경을 구성하여 유익균 증식을 촉진하는 것이다. 프로바이오틱스는 장내 유기산의 주요 구성성분인 젖산이나 아세트산을 생산하여 장내 pH를 낮춤으로서 유해 병원균의 발육을 억제할 수 있다. 그러나 종래 주로 이용되는 락토바실러스와 엔테로코커스 등 다양한 프로바이오틱스는 생물체로서의 특성상 열에 민감하여 동결건조 제형, 또는 냉장 액상 제형으로만 제조/유통되어야 하므로, 다양한 제형 및 방법으로 가공되지 못하는 문제점이 있었다.The efficacy of probiotics is to competitively excrete pathogens that settle in the intestinal mucosa and cause intestinal diseases through their strong adhesion, and to quickly restore the destruction of the intestinal flora caused by antibiotic administration. In addition, it prevents infection and inhibits the growth of pathogenic microorganisms, and promotes the proliferation of beneficial bacteria by creating an optimal environment for the development of beneficial bacteria in the intestines. Probiotics can inhibit the growth of harmful pathogens by lowering intestinal pH by producing lactic acid or acetic acid, which are major components of intestinal organic acids. However, various probiotics, such as Lactobacillus and Enterococcus, which are mainly used in the past, are sensitive to heat due to their nature as living organisms and must be manufactured/distributed only in freeze-dried formulations or refrigerated liquid formulations, so there is a problem in that they cannot be processed into various formulations and methods.

따라서 본 발명은 상기와 같은 문제의 해결을 위해 안출된 것으로, 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수하고, 특히 포자의 내열성이 우수한 신규한 바실러스 리체니포미스 균주, 및 이의 프로바이오틱스 용도에 관한 것이다. 본 발명의 신규한 바실러스 리체니포미스 균주는 우수한 내열성으로 인해 다양한 방법의 가공이 가능하므로, 프로바이오틱스 용도로서 활발하게 이용될 수 있을 것으로 기대된다.Therefore, the present invention was devised to solve the above problems, and is a novel Bacillus licheniformis strain with excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate, and especially excellent heat resistance of spores, and its This is about the uses of probiotics. The novel Bacillus licheniformis strain of the present invention can be processed in a variety of ways due to its excellent heat resistance, so it is expected to be actively used for probiotic purposes.

본 발명이 이루고자 하는 과제는 상기한 문제점을 해결하기 위하여, 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수한 바실러스 리체니포미스 균주, 또는 이의 배양물을 제공하는 데 있다.The object of the present invention is to provide a Bacillus licheniformis strain or a culture thereof with excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate in order to solve the above problems.

상기 바실러스 리체니포미스 균주는 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다.The Bacillus licheniformis strain may be preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed Bacillus licheniformis DJ5B-6 (KCTC 15240BP).

또한 본 발명의 다른 과제는 상기 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 식품 조성물, 화장료 조성물, 비료 조성물, 또는 사료 조성물을 제공하는 데 있다.Another object of the present invention is to provide a food composition, cosmetic composition, fertilizer composition, or feed composition containing the Bacillus licheniformis strain or a culture thereof.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.DETAILED DESCRIPTION OF THE INVENTION Various embodiments described herein are described below with reference to the drawings. In the following description, various specific details, such as specific forms, compositions, and processes, are set forth in order to provide a thorough understanding of the invention. However, certain embodiments may be practiced without one or more of these specific details or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques are not described in specific detail so as not to unnecessarily obscure the invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Accordingly, the phrases “in one embodiment” or “an embodiment” expressed in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, particular features, shapes, compositions, or properties may be combined in any suitable way in one or more embodiments.

명세서에서 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.Unless there is a special definition in the specification, all scientific and technical terms used in the specification have the same meaning as commonly understood by a person skilled in the art in the technical field to which the present invention pertains.

명세서 전체에서, 어떤 부분이 어떤 구성요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다.Throughout the specification, when a part is said to “include” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

본 발명의 일 구현 예에 따르면, 본 발명은 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수한 신규한 바실러스 리체니포미스 균주에 관한 것이다.According to one embodiment of the present invention, the present invention relates to a novel Bacillus licheniformis strain having excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion rate.

상기 바실러스 리체니포미스(Bacillus licheniformis) 균주는 토양에서 흔히 발견되는 박테리아로, 토양을 표면에 접촉하며 생장하는 동식물에서도 발견된다. 그람 양성 중온성 박테리아로, 약 50℃까지도 생장은 가능하지만, 효소 분비의 최적 온도는 37℃이다. 가혹한 환경에 저항하기 위해 휴면 포자 형태로 존재하거나, 조건이 좋은 환경에서는 식물 상태로 존재할 수도 있다.The Bacillus licheniformis strain is a bacterium commonly found in soil, and is also found in plants and animals that grow in contact with the soil surface. As a Gram-positive mesophilic bacterium, growth is possible up to about 50℃, but the optimal temperature for enzyme secretion is 37℃. It may exist in the form of dormant spores to resist harsh environments, or it may exist in a vegetative state in favorable environments.

본 발명의 상기 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수한 신규한 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다.The novel Bacillus licheniformis strain of the present invention having excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP). and, more preferably, it may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP) in which spores are formed.

상기 본 발명의 바실러스 리체니포미스 균주의 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률 특성은 해당 균주가 프로바이오틱스로서 이용될 수 있음을 시사한다. 여기서의 내산성(acid resisting properties)이란 산성 환경에 잘 견디어 내는 성질을 의미하고, 내담즙성(bile resisting properties)이란 담즙 환경에 강해 소화기관에서 사멸되지 않고 생장을 잘 유지하는 성질을 의미하며, 내염성(salt resisting properties)이란 염분에 잘 견디어 내는 성질을 의미하며, 내열성(heat resisting properties)이란 열에 잘 견디어 내는 성질을 의미한다. 세포부착률의 경우 장 점막에 얼마나 잘 부착될 수 있는가 하는 것으로, 섭취된 프로바이오틱스의 장내 정착에 중요한 요소이다.The acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion characteristics of the Bacillus licheniformis strain of the present invention suggest that the strain can be used as a probiotic. Here, acid-resistant properties refer to the property of being able to withstand an acidic environment, bile-resisting properties refer to the property of being strong in a bile environment and maintaining growth without being killed in the digestive system, and salt-resistance. (salt resisting properties) refers to the property of being able to withstand salt well, and heat resistance (heat resisting properties) refers to the property of being able to withstand heat well. Cell adhesion rate refers to how well it can adhere to the intestinal mucosa, and is an important factor in the establishment of ingested probiotics in the intestines.

상기 포자는 진균, 점균류, 일부 세균과 원생동물 및 조류뿐만 아니라 선태류와 양치류 같은 하등 식물 등이 무성생식이나 유성생식 수단으로 생성하는 생식세포이다. 작고 가벼우며 대사활성이 낮아 환경에서의 산포에 적합한 특성을 가지는데, 대부분이 좋지 않은 환경 조건에 대해 다소간의 저항성을 가지기 때문에 악조건에서의 생존 수단으로 만들어지기도 한다. 본 발명의 바실러스 리체니포미스 DJ5B-6 균주의 경우, 포자의 내열성이 특히 우수한 것을 특징으로 한다.The spores are reproductive cells produced by fungi, slime molds, some bacteria, protozoa, and algae, as well as lower plants such as bryophytes and ferns, through asexual or sexual reproduction. They are small, light, and have low metabolic activity, making them suitable for dispersal in the environment. Most of them have some resistance to unfavorable environmental conditions, so they are sometimes made as a means of survival in adverse conditions. The Bacillus licheniformis DJ5B-6 strain of the present invention is characterized by particularly excellent heat resistance of spores.

본 발명의 다른 구현 예에 따르면, 본 발명은 상기 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수한 신규한 바실러스 리체니포미스 균주를 배양한 배양물에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a culture of the novel Bacillus licheniformis strain having excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell adhesion.

여기서의 배양물이란, 바실러스 리체니포미스 균주의 균체 파쇄물, 바실러스 리체니포미스 균주가 포함된 혼합액, 바실러스 리체니포미스 균주를 배양액 배양액, 이의 농축액, 및 이의 건조물로 이루어진 군으로부터 선택되는 1종 이상을 포함하는 것이다. 또한 상기 배양물에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.The culture herein refers to at least one selected from the group consisting of bacterial cell fragments of Bacillus licheniformis strains, a mixed solution containing Bacillus licheniformis strains, a culture medium of Bacillus licheniformis strains, a concentrate thereof, and a dried product thereof. It includes. In addition, in the definition of the culture, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). The restrictions of each part for Bacillus licheniformis DJ5B-6 overlap with those described above, and are omitted hereinafter to avoid excessive complexity of the specification.

본 발명의 또 다른 구현 예에 따르면, 본 발명은 상기의 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 식품 조성물에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a food composition containing the above Bacillus licheniformis strain, or a culture thereof.

여기서의 식품 조성물이란, 바실러스 리체니포미스 균주를 장내 환경 개선을 위한 식품 조성물로 다양하게 이용하는 것으로서, 본 발명의 조성물을 유효성분으로 포함하는 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 본 발명의 식품 조성물은 독성 및 부작용이 거의 없는 천연식품 및 이의 발효물로 구성된 것이므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있다. 본 발명의 조성물이 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 100%의 비율로 첨 가할 수 있다. 여기서, 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연탄수화물 등을 추가 성분으 로서 함유할 수 있다. 즉, 천연탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바 우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다. 그 외 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성풍미제 및 천연풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알 콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.1 내지 100 중량부의 범위에서 선택되는 것이 일반적이다.The food composition herein refers to a variety of uses of the Bacillus licheniformis strain as a food composition for improving the intestinal environment. The food composition containing the composition of the present invention as an active ingredient is used in various foods, such as beverages, gum, and tea. , can be manufactured in the form of vitamin complexes, powders, granules, tablets, capsules, cookies, rice cakes, bread, etc. The food composition of the present invention is composed of natural foods and fermented products thereof with little toxicity and side effects, so it can be safely used even when taken for a long period of time for preventive purposes. When the composition of the present invention is included in a food composition, it can be added in an amount of 0.1 to 100% of the total weight. Here, when the food composition is manufactured in the form of a beverage, there are no particular limitations other than containing the food composition in the indicated ratio, and various flavoring agents or natural carbohydrates can be contained as additional ingredients like ordinary beverages. That is, natural carbohydrates include monosaccharides such as glucose, disaccharides such as fructose, common sugars such as polysaccharides such as sucrose, dextrin, and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. can do. Examples of the flavoring agent include natural flavoring agents (thaumatin, stevia extract (e.g., levaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). In addition, the present invention The food composition includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, Stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. may be used independently or in combination, although the ratio of these additives is not that important. It is generally selected in the range of 0.1 to 100 parts by weight per part by weight.

또한 상기 식품 조성물에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6, 및 배양물에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, in the definition of the food composition, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). Restrictions on Bacillus licheniformis DJ5B-6 and each part of the culture overlap with those described above and are omitted hereinafter to avoid excessive complexity of the specification.

본 발명의 또 다른 구현 예에 따르면, 본 발명은 상기의 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 화장료 조성물에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a cosmetic composition containing the above Bacillus licheniformis strain, or a culture thereof.

여기서의 화장료 조성물이란, 바실러스 리체니포미스 균주를 노화 개선을 위한 조성물로 다양하게 이용하는 것으로서, 본 발명이 속하는 분야에서 자명한 기술적 접근에 따르면 장내 환경 개선에 유효한 프로바이오틱스는 노화를 억제하고 피부를 건강하게 개선하는 데 효과가 있다. 본 발명의 조성물을 유효성분으로 포함하는 화장료 조성물은 주름 방지 또는 개선, 피부 보습력 증가, 피부 장백 개선, 피부 탄력 개선, 항산화, 및 피부 미백으로 구성된 군으로부터 선택되는 하나 이상의 효과를 목적으로 이용될 수 있고, 화장수, 영양로션, 영양에센스, 마사지 크림, 미용목욕물첨가제, 바디로션, 바디밀크, 배스오일, 베이비오일, 베이비파우더, 샤워겔, 샤워크림, 선스크 린로션, 선스크린크림, 선탠크림, 스킨로션, 스킨크림, 자외선차단용 화장품, 크렌징밀크, 탈모제{화장용}, 페 이스 및 바디로션, 페이스 및 바디크림, 피부미백크림, 핸드로션, 헤어로션, 화장용크림, 쟈스민오일, 목욕비누, 물비누, 미용비누, 샴푸, 손세정제(핸드클리너), 약용비누{비의료용}, 크림비누, 페이셜워시, 헤어린 스, 화장비누, 치아미백용 겔, 치약 등의 형태로 제조될 수 있다. 이를 위해 본 발명의 조성물은 화장료 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다. 본 발명의 화장료 조성 물 내에 더 추가될 수 있는 담체, 부형제 또는 희석제로는 정제수, 오일, 왁스, 지방산, 지방산 알콜, 지방산 에스테르, 계면활성제, 흡습제(humectant), 증점제, 항산화제, 점도 안정화제, 킬레이팅제, 완충제, 저급 알콜 등이 포함되지만, 이에 제한되는 것은 아니다. 또한, 필요에 따라 미백제, 보습제, 비타민, 자외선 차단제, 향 수, 염료, 항생제, 항박테리아제, 항진균제를 포함할 수 있다. 상기 오일로서는 수소화 식물성유, 피마자유, 면 실유, 올리브유, 야자인유, 호호바유, 아보카도유가 이용될 수 있으며, 왁스로는 밀랍, 경랍, 카르나우바, 칸델 릴라, 몬탄, 세레신, 액체 파라핀, 라놀린이 이용될 수 있다. 지방산으로는 스테아르산, 리놀레산, 리놀렌산, 올레산이 이용될 수 있고, 지방산 알콜로는 세틸알콜, 옥틸도데칸올, 올레일알콜, 판텐올, 라놀린알콜, 스테아 릴 알콜, 헥사데칸올이 이용될 수 있으며 지방산 에스테르로는 이소프로필미리스테이트, 이소프로필 팔미테이트, 부틸스테아레이트가 이용될 수 있다. 계면활성제로는 당업계에 알려진 양이온 계면활성제, 음이온 계면활성제 및 비이온성 계면활성제가 사용가능하며 가능한 한 천연물 유래의 계면활성제가 바람직하다. 그 외 에도 화장품 분야에서 널리 알려진 흡습제, 증점제, 항산화제 등을 포함할 수 있으며, 이들의 종류와 양은 당업 계에 공지된 바에 따른다. The cosmetic composition herein refers to a variety of uses of the Bacillus licheniformis strain as a composition for improving aging. According to a technical approach obvious in the field to which the present invention belongs, probiotics effective in improving the intestinal environment suppress aging and keep the skin healthy. It is effective in improving. A cosmetic composition containing the composition of the present invention as an active ingredient can be used for the purpose of one or more effects selected from the group consisting of preventing or improving wrinkles, increasing skin moisturizing ability, improving skin whiteness, improving skin elasticity, antioxidant, and skin whitening. There is lotion, nutritional lotion, nutritional essence, massage cream, beauty bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sunscreen cream, suntan cream, Skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilator {cosmetic}, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil, bath soap. , liquid soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medicated soap (non-medical use), cream soap, facial wash, hair rinse, cosmetic soap, teeth whitening gel, toothpaste, etc. To this end, the composition of the present invention may further include an appropriate carrier, excipient, or diluent commonly used in the production of cosmetic compositions. Carriers, excipients or diluents that can be further added to the cosmetic composition of the present invention include purified water, oil, wax, fatty acid, fatty acid alcohol, fatty acid ester, surfactant, humectant, thickener, antioxidant, viscosity stabilizer, These include, but are not limited to, chelating agents, buffering agents, lower alcohols, etc. Additionally, if necessary, it may contain whitening agents, moisturizers, vitamins, sunscreen, perfume, dyes, antibiotics, antibacterial agents, and antifungal agents. Hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm oil, jojoba oil, and avocado oil can be used as the oil, and waxes include beeswax, spermaceti, carnauba, candelilla, montan, ceresin, liquid paraffin, and lanolin. This can be used. Stearic acid, linoleic acid, linolenic acid, and oleic acid can be used as fatty acids, and cetyl alcohol, octyldodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, and hexadecanol can be used as fatty alcohols. And as fatty acid esters, isopropyl myristate, isopropyl palmitate, and butyl stearate can be used. As surfactants, cationic surfactants, anionic surfactants, and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred whenever possible. In addition, it may contain moisture absorbents, thickeners, antioxidants, etc., which are widely known in the cosmetics field, and their types and amounts are known in the art.

또한 상기 화장료 조성물에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6, 및 배양물에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, in the definition of the cosmetic composition, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). Restrictions on Bacillus licheniformis DJ5B-6 and each part of the culture overlap with those described above and are omitted hereinafter to avoid excessive complexity of the specification.

본 발명의 또 다른 구현 예에 따르면, 본 발명은 상기의 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 사료 조성물에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a feed composition containing the above Bacillus licheniformis strain, or a culture thereof.

여기서의 사료 조성물이란, 동물의 양적, 질적 크기를 변화시키기 위해 공급하는 식용 물질을 의미한다. 여기에 함유되는 바실러스 리체니포미스 균주, 또는 이의 배양물은 농축액 또는 분말 등의 형태 변화를 포함한다. 사료는 시판되고 있는 일반사료를 모두 포함할 수 있으며, 이에 한정되지는 않으나, 미강, 옥수수, 대두박, 콩, 수수, 쌀, 보리, 밀, 귀리, 호밀, 좁쌀, 메밀, 티리티게일, 고구마, 타피오카, 밀기울, 맥강, 대두피, 옥수수겨, 맥아근, 전분박, 커피박, 잠분, 잠사, 해조분, 면실박, 채종박, 캐놀라밀, 임자박, 호마박, 아마박, 해바라기씨박, 낙화생박, 야자박, 옥수수 글루텐, 주정박, 옥수수 배아박, 고추씨박, 루핀종실, 어분, 우모분 및 육분일 수 있으며, 이러한 사료에 상기의 유산균 발효 조성물을 함유하는 것을 포함한다. 본 발명의 사료에는 일반적인 사료 첨가제, 예를 들면 소금, 골분, 인산칼슘제, 무기물 혼합제, 비타민제, 아미노산제, 항생물질, 호르몬제 등의 특수목적을 위한 사료 첨가제가 포함될 수 있다.The feed composition here refers to an edible substance supplied to change the quantitative and qualitative size of the animal. The Bacillus licheniformis strain contained herein, or its culture, includes changes in form, such as concentrate or powder. Feed may include all commercially available general feeds, but is not limited to rice bran, corn, soybean meal, beans, sorghum, rice, barley, wheat, oats, rye, millet, buckwheat, tirigale, sweet potato, Tapioca, wheat bran, wheat bran, soybean husk, corn bran, malt root, starch meal, coffee meal, bran meal, silkworm meal, seaweed meal, cottonseed meal, rapeseed meal, canola wheat, sesame seed meal, pumpkin meal, flax meal, sunflower seed meal, peanut meal. It may be gourd, coconut meal, corn gluten, ethanol gourd, corn germ meal, red pepper seed meal, lupine seed meal, fish meal, feather meal, and meat meal, and these feeds include those containing the lactic acid bacteria fermentation composition. The feed of the present invention may include general feed additives, such as salt, bone meal, calcium phosphate, mineral mixture, vitamins, amino acids, antibiotics, hormones, and other special-purpose feed additives.

또한 상기 사료 조성물에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6, 및 배양물에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, in the definition of the feed composition, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). Restrictions on Bacillus licheniformis DJ5B-6 and each part of the culture overlap with those described above and are omitted hereinafter to avoid excessive complexity of the specification.

본 발명의 또 다른 구현 예에 따르면, 본 발명은 상기의 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 비료 조성물에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a fertilizer composition containing the above Bacillus licheniformis strain, or a culture thereof.

여기서의 비료 조성물이란, 식물의 양적, 질적 크기를 변화시키기 위해 공급하는 보조제를 의미한다. 여기에 함유되는 바실러스 리체니포미스 균주, 또는 이의 배양물은 농축액 또는 분말 등의 형태 변화를 포함한다. 비료 조성물은 생분해성 고분자(biodegradable polymer), 석고, 석회, 규산질, 벤토나이트, 및 제올라이트로 구성된 그룹으로부터 선택되는 어느 하나 이상을 추가로 포함할 수 있고, 상기의 생분해성 고분자는 셀룰로오스(cellulose) 유도체, 부식(humus) 침출액, 아미노산 발효부산액(condensed molasses solubles), 및 아크릴(acryl)계 고분자로 구성된 그룹으로부터 선택되는 어느 하나 이상인 것일 수 있다. 또한 상기 비료 조성물은 양분 효과를 나타내도록 하기 위해서 화학　비료나 유기부산물　비료, 기타 부식산(휴믹, 펄빅 및 기타), 아미노산, 해조추출물 또는 그 혼합물을 추가로 혼합하여 사용될 수 있다. 상기 화학　비료로는 규산질　비료, 규회석　비료, 광재 규산질, 패화석　비료, 소석회, 석회석, 석회 고토, 부산 소석회, 부산 석회, 석고　비료, 석회질　비료, 규조토, 구아노 및 혈분 등을 사용한다. 이 중 중요한 몇 가지에 관하여 구체적으로 설명하면, 석회질　비료는 토양 pH 개선 및 칼슘 성분이 많이 필요로 하는 전작 작물에 필요하고 규산질　비료는 pH 개선 및 규산 성분을 많이 필요로 하는 수도작 작물에 필요하다. 패화석　비료는 남해안 굴껍질을 소성 및 분쇄 가공한　비료로서 칼슘 성분뿐만 아니라 미량성분을 다량 함유하고 있어 토양개량뿐만 아니라 작물의 16대 영양소 중 공기와 물에서 오는 탄소, 수소, 산소를 제외한 13대 영양소 (N, P, K, Ca, Mg, S, B, Fe, Mn, Mo, Zn, Cu, Cl)를 대부분 공급할 수 있어 유기농 작물의 영양소 공급에 아주 우수한 효과를 발휘한다. 패화석　비료의　비료　양분으로 부족한 일반 농작물은 화학비료를 첨가하여 작물에 필요한 양분을 충분히 공급하면 된다. 상기 유기부산물　비료로는 쌀겨, 패각류, 당밀, 왕겨, 축분 중에서 선택된 1종 또는 2종 이상의 혼합물을 사용할 수 있다. 구체적으로, 유기질　비료는 진공발효 건조기로 건조, 파쇄 혼합하여 사용할 수 있고, 왕겨는 생왕겨를 팽연하여 사용할 수 있다. 이러한 유기질　비료는 식물의 지지력을 강화하며 특히 육묘 기간이 오래 지속되는 경우 N, P, K 등 영양소의 공급원이 될 수 있다. 또한 상기 비료 조성물은 목적하는 식물의 생장 조건에 맞춰서 pH를 조절하기 위한 pH조절제를 추가로 포함할 수 있다. 상기 pH조절제는 혼합물의 pH를 중성 조건으로 되돌려서 최종 제조되는 토양　조성물의 pH를 중성에 가깝도록 하여 악취 발생, 악취 발생을 억제하기 위해 첨가된다. 식생의 요구 조건에 따라 차이가 있겠지만, 기본적으로 약산성에서 약알칼리성의 토양이면 입체 녹화시 유리한 바, pH조절제는 혼합물의 pH 5.5 내지 8.0으로 기준을 충족할 수 있도록 하는 역할을 수행한다.The fertilizer composition herein refers to an auxiliary agent supplied to change the quantitative and qualitative size of plants. The Bacillus licheniformis strain contained herein, or its culture, includes changes in form, such as concentrate or powder. The fertilizer composition may further include one or more selected from the group consisting of biodegradable polymer, gypsum, lime, siliceous, bentonite, and zeolite, wherein the biodegradable polymer is a cellulose derivative, It may be one or more selected from the group consisting of humus leachate, amino acid fermentation by-products (condensed molasses solubles), and acryl-based polymers. In addition, the fertilizer composition may be used by additionally mixing chemical fertilizers, organic by-product fertilizers, other humic acids (humic, fulvic, and others), amino acids, seaweed extracts, or mixtures thereof to achieve a nutrient effect. The above chemical fertilizers include siliceous fertilizer, wollastonite fertilizer, slag siliceous, fossil rock fertilizer, slaked lime, limestone, lime kaolin, Busan slaked lime, Busan lime, gypsum fertilizer, calcareous fertilizer, diatomaceous earth, guano and blood meal. To explain some of the important ones in detail, calcareous fertilizers are needed for precrop crops that need to improve soil pH and require a lot of calcium, and siliceous fertilizers are needed for precrop crops that need to improve pH and need a lot of silicic acid components. Paehwaseok fertilizer is a fertilizer made by burning and grinding oyster shells from the southern coast. It contains not only calcium but also a large amount of trace elements, so it not only improves the soil but also contains 13 of the 16 major nutrients for crops, excluding carbon, hydrogen, and oxygen that come from air and water. It can supply most of (N, P, K, Ca, Mg, S, B, Fe, Mn, Mo, Zn, Cu, Cl) and is very effective in supplying nutrients to organic crops. For general crops that are deficient in nutrients from fossil fertilizers, add chemical fertilizers to provide sufficient nutrients for the crops. As the organic by-product fertilizer, one type or a mixture of two or more types selected from rice bran, shellfish, molasses, rice husk, and livestock manure can be used. Specifically, organic fertilizers can be used by drying, crushing and mixing in a vacuum fermentation dryer, and rice husk can be used by expanding raw rice husk. These organic fertilizers strengthen the plant's bearing capacity and can be a source of nutrients such as N, P, and K, especially when the seedling period lasts a long time. In addition, the fertilizer composition may further include a pH adjuster to adjust pH to suit the growth conditions of the desired plant. The pH adjuster is added to return the pH of the mixture to neutral conditions and bring the pH of the final manufactured soil composition close to neutral to suppress the generation of bad odors. There may be differences depending on the requirements of the vegetation, but basically, if the soil is slightly acidic to slightly alkaline, it is advantageous for three-dimensional greening, and the pH regulator plays a role in ensuring that the pH of the mixture meets the standard of 5.5 to 8.0.

또한 상기 비료 조성물에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6, 및 배양물에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, in the definition of the fertilizer composition, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). Restrictions on Bacillus licheniformis DJ5B-6 and each part of the culture overlap with those described above and are omitted hereinafter to avoid excessive complexity of the specification.

본 발명의 또 다른 구현 예에 따르면, 본 발명은 상기의 바실러스 리체니포미스 균주, 또는 이의 배양물을 포함하는 프로바이오틱스 제제에 관한 것이다.According to another embodiment of the present invention, the present invention relates to a probiotic preparation containing the above Bacillus licheniformis strain, or a culture thereof.

여기서의 프로바이오틱스 제제란, 유익한 유산균 증식, 유해균 억제, 또는 원활한 배변활동 촉진에 효과가 있는 기능성 원료를 의미한다. 식품 조성물, 화장료 조성물, 사료 조성물, 또는 비료 조성물에 포함되어 이용될 수 있다. Probiotic preparations herein refer to functional raw materials that are effective in proliferating beneficial lactic acid bacteria, inhibiting harmful bacteria, or promoting smooth bowel movements. It can be used in food compositions, cosmetic compositions, feed compositions, or fertilizer compositions.

또한 상기 프로바이오틱스 제제에 대한 정의에 있어서, 바실러스 리체니포미스 균주는 이에 제한되는 것은 아니나, 바람직하게는 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있고, 더욱 바람직하게는 포자(spore)가 형성된 바실러스 리체니포미스 DJ5B-6(KCTC 15240BP)일 수 있다. 바실러스 리체니포미스 DJ5B-6, 배양물, 식품 조성물, 화장료 조성물, 사료 조성물, 또는 비료 조성물에 대한 각 부분의 제한사항은 상기 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, in the definition of the probiotic preparation, the Bacillus licheniformis strain is not limited thereto, but is preferably Bacillus licheniformis DJ5B-6 (KCTC 15240BP), and more preferably spore-formed It may be Bacillus licheniformis DJ5B-6 (KCTC 15240BP). Restrictions on each part of Bacillus licheniformis DJ5B-6, culture, food composition, cosmetic composition, feed composition, or fertilizer composition overlap with those described above and are hereinafter omitted to avoid excessive complexity of the specification.

이하 본 발명을 실시예에 입각하여 구체적으로 설명한다.Hereinafter, the present invention will be described in detail based on examples.

본 발명의 신규한 바실러스 리체니포미스 균주, 바람직하게는 바실러스 리체니포미스 DJ5B-6 균주는 내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수하고, 특히 포자의 내열성이 우수하므로, 프로바이오틱스 용도로서 활발하게 이용될 수 있을 것으로 기대된다.The novel Bacillus licheniformis strain of the present invention, preferably the Bacillus licheniformis DJ5B-6 strain, is excellent in acid resistance, bile resistance, salt resistance, heat resistance, or cell attachment rate, and is especially excellent in the heat resistance of spores, so it can be used as a probiotic It is expected that it can be actively used for various purposes.

도 1은 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 계통을 phylogenetic tree로 나타낸 것이다.
도 2는 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 포자 염색 결과를 나타낸 것이다.
도 3은 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 내열성 시험 결과를 나타낸 것이다.
도 4는 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 세포부착률 시험 결과를 나타낸 것이다.
도 5는 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 용혈성 시험 결과를 나타낸 것이다.
도 6은 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 독성 유전자 존재 여부 확인 결과를 나타낸 것이다.
도 7은 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 DPPH 라디칼 소거능 시험 결과를 나타낸 것이다.
도 8은 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 ABTS 라디칼 소거능 시험 결과를 나타낸 것이다.
도 9는 본 발명의 일 실시예에서 본 발명의 신규한 바실러스 리체니포미스 균주의 프리바이오틱스 이용성 조사 결과를 나타낸 것이다.Figure 1 shows the phylogenetic tree of the novel Bacillus licheniformis strain of the present invention in one embodiment of the present invention.
Figure 2 shows the results of spore staining of the novel Bacillus licheniformis strain of the present invention in one example of the present invention.
Figure 3 shows the heat resistance test results of the novel Bacillus licheniformis strain of the present invention in an example of the present invention.
Figure 4 shows the results of a cell adhesion rate test of the novel Bacillus licheniformis strain of the present invention in one embodiment of the present invention.
Figure 5 shows the results of a hemolytic test of the novel Bacillus licheniformis strain of the present invention in an example of the present invention.
Figure 6 shows the results of confirming the presence of a virulence gene in the novel Bacillus licheniformis strain of the present invention in one embodiment of the present invention.
Figure 7 shows the results of a DPPH radical scavenging ability test of the novel Bacillus licheniformis strain of the present invention in an example of the present invention.
Figure 8 shows the results of the ABTS radical scavenging ability test of the novel Bacillus licheniformis strain of the present invention in one embodiment of the present invention.
Figure 9 shows the results of a prebiotic availability survey of the novel Bacillus licheniformis strain of the present invention in one embodiment of the present invention.

이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be explained in detail by the following examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited by the following examples.

[실시예][Example]

실시예 1. 미생물 분리Example 1. Isolation of microorganisms

대한민국 다양한 지역의 된장과 청국장에서 미생물을 분리하였다. 각 시료 25g을 225㎖의 phosphate buffered saline(PBS)에 현탁 후 stomacher로 균질화하여 단계 희석하였다. 각각의 현탁액은 MRS 평판배지에 100㎕ 도말하여 37℃에서 24시간 배양하였고, 배지 상에 형성된 집락의 형태학적 특징에 따라 순수분리하여 총 32종의 후보 균주를 분리하였다. 분리한 균주를 대상으로 산 생성 여부를 확인하여 총 11종의 균주를 1차 선별하였고, 이후 내산성 및 내담즙성, 내염성, 내열성, 용혈성, 독성 유전자 유무, 세포독성, 세포부착률을 조사하여 최종 균주 바실러스 리체니포미스(Bacillus licheniformis) DJ5B-6(KCTC 15240BP)을 선정하였다. 분리된 균주는 25% glycerol을 이용하여 -80℃ 초저온 냉동고에 보관하며 본 연구를 위해 사용하였다.Microorganisms were isolated from soybean paste and cheonggukjang from various regions of Korea. 25 g of each sample was suspended in 225 ml of phosphate buffered saline (PBS), homogenized with a stomacher, and serially diluted. 100㎕ of each suspension was spread on MRS plate medium and cultured at 37°C for 24 hours, and a total of 32 candidate strains were isolated by pure separation according to the morphological characteristics of the colonies formed on the medium. A total of 11 strains were initially screened by checking whether the isolated strains produced acid, and then acid resistance, bile resistance, salt resistance, heat resistance, hemolysis, presence or absence of virulence genes, cytotoxicity, and cell adhesion rate were examined to determine the final strain. The strain Bacillus licheniformis DJ5B-6 (KCTC 15240BP) was selected. The isolated strain was stored in an ultra-low temperature freezer at -80°C using 25% glycerol and used for this study.

실시예 2. 분리 균주 동정Example 2. Identification of isolated strains

실시예 2-1. 계통수 조사Example 2-1. Phylogenetic tree survey

최종 선정된 균주 바실러스 리체니포미스 DJ5B-6의 genomic DNA를 추출하여 universal primer 27F와 1492R을 이용하여 PCR을 수행하였고, 증폭된 16S rRNA 염기서열을 분석하였다. 16S rRNA 염기서열 결과는 NCBI의 BLAST를 이용하여 상동성 비교를 수행하였고, 염기서열이 유사한 20 균주를 대상으로 MEGA 6 프로그램의 neighbor-joining 방법을 이용하여 phylogenetic tree를 작성하였다. 상기 결과를 도 1에 나타내었다. 작성된 phylogenetic tree에 따르면, DJ5B-6은 바실러스 에어리우스(Bacillus aerius), 바실러스 헤인시(Bacillus haynesii)와 유사하며, 바실러스 리체니포미스(Bacillus licheniformis)와 가장 유사하였다.Genomic DNA of the final selected strain, Bacillus licheniformis DJ5B-6, was extracted, PCR was performed using universal primers 27F and 1492R, and the amplified 16S rRNA base sequence was analyzed. The 16S rRNA base sequence results were compared for homology using NCBI's BLAST, and a phylogenetic tree was created using the neighbor-joining method of the MEGA 6 program for 20 strains with similar base sequences. The results are shown in Figure 1. According to the created phylogenetic tree, DJ5B-6 was similar to Bacillus aerius and Bacillus haynesii, and was most similar to Bacillus licheniformis.

실시예 2-2. 생화학적 검사Example 2-2. biochemical test

API kit를 사용하여 Biochemical test, Assimilation test, Fermentation test를 수행하였다. 분리한 균주 바실러스 리체니포미스 DJ5B-6을 현탁하여 기질이 들어있는 cupules에 접종하여 배양하였고, 발색시약을 첨가하여 물질의 대사 유무를 색의 변화로 판정하였다. 또한, 특정 탄수화물이 유일한 탄소원으로 들어있는 cupules에 균주를 배양하여 당 이용성을 탁도 변화로 판정하였고, 당으로부터 생산된 산에 의해 변화된 pH를 측정하여 발효 여부를 판단하였다. 상기 API kit를 이용한 분리 균주의 생화학적 동정 결과를 하기 표 1에 나타내었다.Biochemical test, assimilation test, and fermentation test were performed using the API kit. The isolated strain Bacillus licheniformis DJ5B-6 was suspended and inoculated into cupules containing the substrate and cultured. A coloring reagent was added to determine whether the substance was metabolized by a change in color. In addition, the strain was cultured in cupules containing a specific carbohydrate as the sole carbon source, and sugar availability was determined by changes in turbidity, and fermentation was determined by measuring the pH changed by acid produced from sugar. The results of biochemical identification of the isolated strains using the API kit are shown in Table 1 below.

API system을 이용한 바실러스 리체니포미스 DJ5B-6의 동정 결과Bacillus licheniformis using the API system Identification results of DJ5B-6 No.No. TestTest Time (hr)Time (hr) No.No. TestTest Time
(hr)Time
(hr) 2424 2424 1One GlycerolGlycerol ++ 2626 SalicinSalicin ++ 22 ErythritolErythritol -- 2727 D-cellobioseD-cellobiose ++ 33 D-arabinoseD-arabinose -- 2828 D-maltoseD-maltose ++ 44 L-arabinoseL-arabinose ++ 2929 D-lactoseD-lactose -- 55 D-riboseD-ribose ++ 3030 D-melibioseD-melibiose -- 66 D-xyloseD-xylose ++ 3131 D-sucroseD-sucrose ++ 77 L-xyloseL-xylose -- 3232 D-trehaloseD-trehalose ++ 88 D-adonitolD-adonitol -- 3333 InulinInulin ++ 99 Methyl-βD-xylopyranosideMethyl-βD-xylopyranoside -- 3434 D-melezitoseD-melezitose -- 1010 D-galactoseD-galactose -- 3535 D-raffinoseD-raffinose -- 1111 D-glucoseD-glucose ++ 3636 StarchStarch -- 1212 D-fructoseD-fructose ++ 3737 GlycogenGlycogen ++ 1313 D-mannoseD-mannose ++ 3838 XylitolXylitol -- 1414 L-sorboseL-sorbose -- 3939 GentiobioseGentiobiose ++ 1515 L-rhamnoseL-rhamnose -- 4040 D-turanoseD-turanose -- 1616 DulcitolDulcitol -- 4141 D-lyxoseD-lyxose -- 1717 InositolInositol ++ 4242 D-tagatoseD-tagatose ++ 1818 D-mannitolD-mannitol ++ 4343 D-fucoseD-fucose -- 1919 D-sorbitolD-sorbitol ++ 4444 L-fucoseL-fucose -- 2020 Methyl-αD-mannopyranosideMethyl-αD-mannopyranoside -- 4545 D-arabitolD-arabitol -- 2121 Methyl-αD-glucopyranosideMethyl-αD-glucopyranoside ++ 4646 L-arabitolL-arabitol -- 2222 N-acetyl-glucosamineN-acetyl-glucosamine -- 4747 Potassium gluconatePotassium gluconate ++ 2323 AmygdalinAmygdalin ++ 4848 Potassium 2-ketogluconatePotassium 2-ketogluconate -- 2424 ArbutinArbutin ++ 4949 Potassium 5-ketogluconatePotassium 5-ketogluconate -- 2525 Esculin ferric citrateEsculin ferric citrate ++

실시예 3. 프로바이오틱스 활성 측정Example 3. Measurement of probiotic activity

실시예 3-1. 포자 형성Example 3-1. spore formation

프로바이오틱스(Probiotics) 소재인 바실러스 리체니포미스 DJ5B-6의 포자형성을 유도하기 위하여 sporulation medium을 이용하였다. Bacto nutrient broth: 8g/L, KCl: 1g/L, MgSO4·7H2O: 0.25g/L, MnCl2·4H2O: 0.002g/L, CaCl2: 0.5mM, FeSO4: 0.001mM을 포함하며 pH는 7인 sporulation medium에 접종 후 37℃, 150rpm의 incubator에서 5일간 배양하였다. 배양된 균체는 7,000rpm에서 15분간 원심분리 후 ice-cold water를 이용하여 5번의 세척 과정을 거쳐 수거하였다. 포자(Spore)를 형성하지 못한 균체를 제거하기 위하여 sonicator를 이용하여 duty-cycle 40%, output control 4에서 5분간 처리하였다. 추가적으로 2번의 세척 과정을 거친 후 65℃에서 45분간 열처리하여 남아있는 영양 세포(vegetative cell)를 제거하였다. 포자형성 유도된 프로바이오틱스 소재의 포자형성 유무는 포자 염색법을 이용하였다. A sporulation medium was used to induce spore formation of Bacillus licheniformis DJ5B-6, a probiotic material. Bacto nutrient broth: 8g/L, KCl: 1g/L, MgSO 4 ·7H 2 O: 0.25g/L, MnCl 2 ·4H 2 O: 0.002g/L, CaCl 2 : 0.5mM, FeSO 4 : 0.001mM After inoculation into sporulation medium with a pH of 7, the cells were cultured in an incubator at 37°C and 150 rpm for 5 days. The cultured cells were collected after centrifugation at 7,000 rpm for 15 minutes and washing five times with ice-cold water. To remove bacteria that failed to form spores, the cells were treated for 5 minutes at a duty-cycle of 40% and output control 4 using a sonicator. After two additional washing processes, the remaining vegetative cells were removed by heat treatment at 65°C for 45 minutes. The presence or absence of spore formation in probiotic materials induced by spore formation was determined using a spore staining method.

현미경을 이용하여 포자 염색된 균주를 관찰한 결과 파란색으로 염색된 포자를 확인할 수 있었고, 대조군으로 사용한 영양 세포는 분홍색을 나타냄을 확인하였다. 상기 결과를 도 2에 나타내었다.As a result of observing the spore-stained strain using a microscope, spores were confirmed to be stained blue, and vegetative cells used as a control were confirmed to be pink. The results are shown in Figure 2.

실시예 3-2. 내산성 및 내담즙성Example 3-2. Acid and bile resistance

내산성 및 내담즙성 분석은 acid(pH 2~7, 2 g/L NaCl)와 intestinal juice(pH 7.8, 0.1~0.3% oxgall)을 처리하였을 때 생존율을 MRS agar 상에서 평판 배양 후 남아있는 균 수를 측정하여 대조구의 균 수와 비교하여 계산하였다.Acid resistance and bile resistance analysis was performed by measuring the survival rate when treated with acid (pH 2~7, 2 g/L NaCl) and intestinal juice (pH 7.8, 0.1~0.3% oxgall) and the number of bacteria remaining after plating on MRS agar. It was measured and calculated by comparing it with the number of bacteria in the control group.

측정 결과, 바실러스 리체니포미스 DJ5B-6 영양 세포는 acid(pH 2), intestinal juice(oxgall 0.3%)에서 각각 0%, 13.14±0.14%의 생존율을 보였다. 포자는 영양 세포보다 더 높은 생존율(73.86±1.54%, 86.27±0.56%)을 보였다. 그 결과를 하기 표 2에 나타내었다.As a result of the measurement, Bacillus licheniformis DJ5B-6 vegetative cells showed survival rates of 0% and 13.14±0.14% in acid (pH 2) and intestinal juice (oxgall 0.3%), respectively. Spores showed a higher survival rate (73.86±1.54%, 86.27±0.56%) than vegetative cells. The results are shown in Table 2 below.

바실러스 리체니포미스 DJ5B-6의 내산성 결과Acid resistance results of Bacillus licheniformis DJ5B-6 pHpH 생존율 (%)Survival rate (%) 영양 세포vegetative cells 포자spore 77 100 100 100100 66 99.81±2.1199.81±2.11 97.15±0.6497.15±0.64 55 99.30±1.8099.30±1.80 96.31±0.5296.31±0.52 44 92.01±2.6392.01±2.63 88.61±0.9488.61±0.94 33 26.27±5.2126.27±5.21 83.31±0.3483.31±0.34 22 00 73.86±1.5573.86±1.55

실시예 3-3. 내염성 및 내열성Example 3-3. Salt and heat resistance

내염성 분석은 배지 상에 염분(NaCl, 0~6%)을 첨가하였을 때의 성장도를 비교하여 +의 개수로 나타내었다. 내열성 분석은 고온의 환경에 노출시켰을 때의 생존율을 MRS agar 상에서 평판 배양 후 남아있는 균 수를 측정하여 대조구의 균 수와 비교하여 계산하였다.The salt tolerance analysis compared the growth rate when salt (NaCl, 0~6%) was added to the medium and was expressed as the number of +. In the heat resistance analysis, the survival rate when exposed to a high temperature environment was calculated by measuring the number of bacteria remaining after plate culture on MRS agar and comparing it with the number of bacteria in the control group.

측정 결과, 바실러스 리체니포미스 DJ5B-6은 0, 2, 4, 6% 모든 농도의 염분에서 높은 성장도를 보였다. 고온 환경에서의 내열성 결과, 영양 세포는 온도가 상승함에 따라 생존율이 감소하였으나, 포자는 온도 상승에 따른 생존율이 유의적인 차이가 나타나지 않았다. 그 결과를 하기 표 3과 도 3에 나타내었다.As a result of the measurement, Bacillus licheniformis DJ5B-6 showed high growth at all salinity concentrations of 0, 2, 4, and 6%. As a result of heat resistance in a high temperature environment, the survival rate of vegetative cells decreased as the temperature increased, but there was no significant difference in the survival rate of spores as the temperature increased. The results are shown in Table 3 and Figure 3 below.

바실러스 리체니포미스 DJ5B-6의 내염성Salt tolerance of Bacillus licheniformis DJ5B-6 0%0% 2%2% 4%4% 6%6% 바실러스 리체니포미스 DJ5B-6Bacillus licheniformis DJ5B-6 ++++++ ++++++ ++++ ++++ +++; >1.0, ++; 0.99>O.D.>0.5, +; 0.50>O.D.>0.10, -; no tolerance+++; >1.0, ++; 0.99>O.D.>0.5, +; 0.50>O.D.>0.10, -; no tolerance

실시예 3-4. 세포부착률Example 3-4. Cell adhesion rate

세포부착률은 monolayer 형성된 HT-29 세포주에 균주를 접종하고, 2시간 동안 배양한 후 HT-29 세포에 부착되지 않은 균은 제거하고 부착된 균을 trypsin-EDTA 처리하여 MRS agar에서 배양 후 균 수를 측정하여 나타내었다.Cell attachment rate was calculated by inoculating the strain into the HT-29 cell line formed as a monolayer, culturing for 2 hours, removing bacteria that did not attach to the HT-29 cells, treating the attached bacteria with trypsin-EDTA, and culturing them on MRS agar. was measured and shown.

상기 HT-29 세포주를 이용한 세포부착률 조사 결과, 바실러스 리체니포미스 DJ5B-6은 53.03±0.09%의 부착률을 보였다. 비교를 위해 프로바이오틱스로 가장 많이 연구된 균주인 락토바실러스 람노서스 GG(Lactobacillus rhamnosus GG; LGG)를 함께 조사하였고, LGG의 세포부착률은 23.15±0.03%로 나타났다. 그 결과를 도 4에 나타내었다.As a result of examining the cell adhesion rate using the HT-29 cell line, Bacillus licheniformis DJ5B-6 showed an adhesion rate of 53.03 ± 0.09%. For comparison, Lactobacillus rhamnosus GG (LGG), the most studied strain as a probiotic, was also investigated, and the cell attachment rate of LGG was found to be 23.15 ± 0.03%. The results are shown in Figure 4.

실시예 3-5. 용혈성Example 3-5. hemolytic

용혈성 검사는 blood agar plate에 획선 접종 후 37℃에서 24시간 배양하여 집락의 색과 주위로 형성되는 환의 형태를 분석하였다. 집락 주변에 녹색 환의 생성은 α-hemolysis, 황색 투명 환은 β-hemolysis 그리고 주변에 환이 생성되지 않을 경우, 용혈성이 없다고 판단하였다.The hemolytic test was performed by inoculating a blood agar plate with a stroke and culturing it at 37°C for 24 hours to analyze the color of the colonies and the shape of the ring formed around them. The formation of a green ring around the colony was judged to be α-hemolysis, the yellow transparent ring was considered to be β-hemolysis, and if no ring was formed around the colony, it was judged to be non-hemolytic.

시험 결과, 바실러스 리체니포미스 DJ5B-6은 주변에 어떠한 환도 생성되지 않았다. 따라서, 용혈성이 없다고 판단되었다. 반면, 양성대조군으로 사용한 바실러스 세레우스(Bacillus cereus) 2종은 투명 환이 생성됨을 확인할 수 있었다. 그 결과를 도 5에 나타내었다.As a result of the test, Bacillus licheniformis DJ5B-6 did not produce any rings around it. Therefore, it was determined that there was no hemolysis. On the other hand, it was confirmed that the two species of Bacillus cereus used as positive controls produced transparent rings. The results are shown in Figure 5.

실시예 3-6. 독성 유전자 검출Example 3-6. Virulence gene detection

바실러스 세레우스 기반 독성 유전자 검사는 polymerase chain reaction (PCR)을 이용하여 분석하였다. 하기 표 4에 표시한 7개의 독성 유전자를 대상으로 PCR을 수행하여 증폭 여부에 따라 독성 유전자 존재를 판단하였다.Bacillus cereus-based virulence genetic testing was analyzed using polymerase chain reaction (PCR). PCR was performed on the seven virulence genes shown in Table 4 below, and the presence of virulence genes was determined depending on whether or not they were amplified.

바실러스 세레우스 기반 독성 유전자Bacillus cereus-based virulence genes GeneGene ProductProduct 서열번호sequence number PrimerPrimer Sequence (5'η3')Sequence (5'η3') Size
(bp)Size
(bp) hblhbl hemolysinhemolysin 서열번호 1SEQ ID NO: 1 hblD-FhblD-F GGAGCGGTCGTTATTGTTGTGGAGGCGGTCGTTATTGTTGT ~620~620 서열번호 2SEQ ID NO: 2 hblA-RhblA-R GCCGTATCTCCATTGTTCGTGCCGTATCTCCATTGTTCGT nheBnheB non-hemolytic enterotoxinnon-hemolytic enterotoxin 서열번호 3SEQ ID NO: 3 nhe-Fnhe-F CTATCAGCACTTATGGCAGCTATCAGCACTTATGGCAG ~770~770 서열번호 4SEQ ID NO: 4 nhe-Rnhe-R ACTCCTAGCGGTGTTCCACTCCTAGCGGTGTTCC bceTbceT B. cereus enterotoxin TB. cereus enterotoxin T 서열번호 5SEQ ID NO: 5 bce-Fbce-F TTACATTACCAGGACGTGCTTTTACATTACCAGGACGTGCTT ~430~430 서열번호 6SEQ ID NO: 6 bce-Rbce-R TGTTTGTGATTGTAATTCAGGTGTTTGTGATTGTAATTCAGG entFMentFM enterotoxin FMenterotoxin FM 서열번호 7SEQ ID NO: 7 ent-Fent-F ATGAAAAAAGTAATTTGCAGGATGAAAAAAGTAATTTGCAGG ~1270~1270 서열번호 8SEQ ID NO: 8 ent-Rent-R TTAGTATGCTTTTGTGTAACCTTAGTATGCTTTTGTGTAACC cytKcytK cytotoxin Kcytotoxin K 서열번호 9SEQ ID NO: 9 cyt-Fcyt-F ACAGATATCGGKCAAAATGCACAGATATCGGKCAAAATGC ~810~810 서열번호 10SEQ ID NO: 10 cyt-Rcyt-R TCCAACCCAGTTWSCAGTTCTCCAACCCAGTTWSCAGTTC sphsph sphingomyelinasesphingomyelinase 서열번호 11SEQ ID NO: 11 sph-Fsph-F CGTGCCGATTTAATTGGGGCCGTGCCGATTTAATTGGGGGC ~560~560 서열번호 12SEQ ID NO: 12 sph-Rsph-R CAATGTTTTAAACATGGATGCGCAATGTTTTAAACATGGATGCG piplcpiplc phospholipasephospholipase 서열번호 13SEQ ID NO: 13 pip-Fpip-F CGCTATCAATGGACCATGGCGCTATCAATGGACCATGG ~570~570 서열번호 14SEQ ID NO: 14 pip-Rpip-R GGACTATTCCATGCTGTACCGGACTATTCCATGCTGTACC

시험 결과, 바실러스 리체니포미스 DJ5B-6에서는 양성대조군을 제외한 어떠한 밴드도 관찰되지 않았다. 따라서, 바실러스 세레우스 기반 독성 유전자는 없다고 판단하였다. 그 결과를 도 6에 나타내었다.As a result of the test, no bands were observed in Bacillus licheniformis DJ5B-6 except for the positive control group. Therefore, it was determined that there were no Bacillus cereus-based virulence genes. The results are shown in Figure 6.

실시예 3-7. 항생제 저항성Example 3-7. antibiotic resistance

항생제 내성은 6가지 항생제 반코마이신(vancomycin), 젠타마이신(gentamicin), 스트렙토마이신(streptomycin), 에리스로마이신(erythromycin), 클린다마이신(clindamycin), 또는 테트라사이클린(tetracycline)에 대한 최소 억제 농도(MIC)를 측정하였다. 단계 희석한 항생제와 분리 균을 37℃에서 24시간 배양하였고, 균이 자라지 않는 최소 농도를 MIC로 판정하였다.Antibiotic resistance measures the minimum inhibitory concentration (MIC) for six antibiotics: vancomycin, gentamicin, streptomycin, erythromycin, clindamycin, or tetracycline. did. The serially diluted antibiotics and isolated bacteria were cultured at 37°C for 24 hours, and the minimum concentration at which bacteria did not grow was determined as the MIC.

시험 결과, 포자와 영양 세포 모두 유럽 식약처(EFSA) cut-off value를 만족하였다. 그 결과를 하기 표 5에 나타내었다.As a result of the test, both spores and vegetative cells satisfied the European Food and Drug Administration (EFSA) cut-off value. The results are shown in Table 5 below.

바실러스 리체니포미스 DJ5B-6의 항생제 저항성Bacillus licheniformis Antibiotic resistance in DJ5B-6 항생제Antibiotic Minimum inhibitory concentrations(mg/L)Minimum inhibitory concentrations (mg/L) 바실러스 리체니포미스 DJ5B-6
영양 세포Bacillus licheniformis DJ5B-6
vegetative cells 바실러스 리체니포미스 DJ5B-6
포자Bacillus licheniformis DJ5B-6
spore EFSA cut-off valueEFSA cut-off value 반코마이신Vancomycin 22 1One 44 젠타마이신Gentamicin 1One 1One 44 스트렙토마이신streptomycin 88 88 88 에리스로마이신Erythromycin 1One 1One 44 클린다마이신Clindamycin 44 44 44 테트라사이클린tetracycline 22 22 88 EFSA, The European Food Safety AuthorityEFSA, The European Food Safety Authority

실시예 3-8. 효소 활성 검사Example 3-8. Enzyme activity test

분리 균주의 효소 활성 검사는 API ZYM kit를 사용하여 측정하였다. PBS에 현탁한 분리 균주를 cupules에 접종하여 37℃에서 4시간 배양하였고, 변화된 색으로 효소 활성 여부를 판단하였다.The enzyme activity of the isolated strain was measured using the API ZYM kit. The isolated strain suspended in PBS was inoculated into cupules and incubated at 37°C for 4 hours, and enzyme activity was judged based on the color change.

시험 결과, 바실러스 리체니포미스 DJ5B-6은 Alkaline phosphatase, esterase, esterase lipase, leucine arylamidase, acid phosphatase, Naphthol-AS-BI-phosphohydrolase, α-glucosidase, 및 β-glucosidase에 활성을 가지는 것으로 나타났다. 그 결과를 하기 표 6에 나타내었다.As a result of the test, Bacillus licheniformis DJ5B-6 was found to have activity on alkaline phosphatase, esterase, esterase lipase, leucine arylamidase, acid phosphatase, Naphthol-AS-BI-phosphohydrolase, α-glucosidase, and β-glucosidase. The results are shown in Table 6 below.

바실러스 리체니포미스 DJ5B-6의 효소 활성Enzyme activity of Bacillus licheniformis DJ5B-6 No.No. 시험 항목Test Items 결과result No.No. 시험 항목Test Items 결과result 1One ControlControl -- 1111 Acid phosphataseAcid phosphatase ++ 22 Alkaline phosphataseAlkaline phosphatase ++ 1212 Naphthol-AS-BI-phosphohydrolaseNaphthol-AS-BI-phosphohydrolase ++ 33 Esterase(C4)Esterase(C4) ++ 1313 α-galactosidaseα-galactosidase -- 44 Esterase Lipase(C8)Esterase Lipase(C8) ++ 1414 β-galactosidaseβ-galactosidase -- 55 Lipase(C14)Lipase(C14) -- 1515 β-glucuronidaseβ-glucuronidase -- 66 Leucine arylamidaseLeucine arylamidase ++ 1616 α-glucosidaseα-glucosidase ++ 77 Valine arylamidaseValine arylamidase -- 1717 β-glucosidaseβ-glucosidase ++ 88 CystinearylamidaseCystinearylamidase -- 1818 N-acetyl-β-glucosaminidaseN-acetyl-β-glucosaminidase -- 99 TrypsinTrypsin -- 1919 α-mannosidaseα-mannosidase -- 1010 α-chymotrypsinα-chymotrypsin -- 2020 α-fucosidaseα-fucosidase --

실시예 3-9. 항산화 활성Example 3-9. antioxidant activity

DPPH(2,2-diphenyl-1-picrylhydrazyl) 라디칼 소거능과 ABTS(2 2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) 라디칼 소거능을 측정하여 분리 균주의 항산화 활성을 확인하였다. 분리 균주의 배양 상등액을 DPPH 용액과 혼합하여 37℃에서 30분 반응시킨 후 흡광도 측정을 통해 DPPH 라디칼 소거능을 확인하였다. ABTS 라디칼 소거능은 분리 균주의 배양 상등액과 ABTS solution을 혼합하여 상온에서 6분간 반응 후 흡광도를 측정하여 확인하였다.The antioxidant activity of the isolated strain was confirmed by measuring the DPPH (2,2-diphenyl-1-picrylhydrazyl) radical scavenging ability and the ABTS (2 2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) radical scavenging ability. After mixing the culture supernatant with the DPPH solution and reacting at 37°C for 30 minutes, the DPPH radical scavenging ability was confirmed by measuring the absorbance. The ABTS radical scavenging ability was confirmed by mixing the culture supernatant of the isolated strain with the ABTS solution and reacting at room temperature for 6 minutes. It was confirmed by measuring.

시험 결과, 바실러스 리체니포미스 DJ5B-6의 DPPH 라디칼 소거능과 ABTS 라디칼 소거능은 각각 63.91±1.43%, 89.92±0.06%로 나타났다. 양성 대조구로는 항산화제로 잘 알려진 ascorbic acid를 사용하였다. Ascorbic acid의 DPPH 라디칼 소거능과 ABTS 라디칼 소거능은 각각 90.70±0.35%, 86.95±2.90%로 나타났다. 양성 대조구와 비교하였을 때 바실러스 리체니포미스 DJ5B-6의 DPPH 라디칼 소거능은 대조구에 비해 낮았으나, ABTS 라디칼 소거능의 경우 대조구보다 높았다. 상기 결과를 도 7과 도 8에 나타내었다.As a result of the test, the DPPH radical scavenging ability and ABTS radical scavenging ability of Bacillus licheniformis DJ5B-6 were found to be 63.91 ± 1.43% and 89.92 ± 0.06%, respectively. Ascorbic acid, a well-known antioxidant, was used as a positive control. The DPPH radical scavenging ability and ABTS radical scavenging ability of ascorbic acid were found to be 90.70±0.35% and 86.95±2.90%, respectively. When compared to the positive control, the DPPH radical scavenging activity of Bacillus licheniformis DJ5B-6 was lower than the control, but the ABTS radical scavenging activity was higher than the control. The results are shown in Figures 7 and 8.

실시예 3-10. 프리바이오틱스 이용성 조사Example 3-10. Prebiotic usability survey

프리바이오틱스로 잘 알려진 5가지 성분(gluco-oligosaccharides, fructo-oligosaccharides, β-glucan, chitosan, inulin)을 유일한 탄소원으로 하여 분리 균주의 이용성을 조사하였다. 양성대조군은 glucose를 1% 첨가하였고, 37°C에서 24시간 배양하여 흡광도를 측정하여 프리바이오틱스 이용성을 나타내었다. 상기 결과를 도 9에 나타내었다. 시험 결과, 양성대조군을 제외하고 바실러스 리체니포미스 DJ5B-6이 가장 잘 이용한 성분은 inulin이었다.The usability of the isolated strain was investigated using five components well known as prebiotics (gluco-oligosaccharides, fructo-oligosaccharides, β-glucan, chitosan, and inulin) as the sole carbon source. In the positive control group, 1% glucose was added, cultured at 37°C for 24 hours, and absorbance was measured to indicate prebiotic availability. The results are shown in Figure 9. As a result of the test, excluding the positive control group, the ingredient most used by Bacillus licheniformis DJ5B-6 was inulin.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

한국생명공학연구원 생물자원센터(KCTC)Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC15204BPKCTC15204BP 2022121320221213

서열목록 전자파일 첨부Sequence list electronic file attached

Claims (15)

내산성, 내담즙성, 내염성, 내열성, 또는 세포부착률이 우수한 바실러스 리체니포미스 DJ5B-6(Bacillus　licheniformis, DJ5B-6; 기탁번호 KCTC 15240BP) 균주.
Bacillus licheniformis DJ5B-6 (Accession number KCTC 15240BP) strain with excellent acid resistance, bile resistance, salt resistance, heat resistance, or cell attachment rate.
 제 1항에 있어서,
상기 균주는 용혈성, 및 바실러스 세레우스 기반 독성 유전자가 없는 것인, 균주.
According to clause 1,
The strain is hemolytic and lacks Bacillus cereus-based virulence genes.
 제 1항에 있어서,
상기 균주는 포자(spore)를 형성하는 것인, 균주.
According to clause 1,
The strain is a strain that forms spores.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물.
A culture of the Bacillus licheniformis DJ5B-6 strain of claim 1.
 제 4항에 있어서,
상기 배양물은 바실러스 리체니포미스 DJ5B-6 균주의 균체 파쇄물, 바실러스 리체니포미스 DJ5B-6 균주가 포함된 혼합액, 바실러스 리체니포미스 DJ5B-6 균주를 배양액 배양액, 이의 농축액, 및 이의 건조물로 이루어진 군으로부터 선택되는 1종 이상을 포함하는 것인, 바실러스 리체니포미스 DJ5B-6 균주 배양물.
According to clause 4,
The culture is a group consisting of bacterial cell fragments of the Bacillus licheniformis DJ5B-6 strain, a mixed solution containing the Bacillus licheniformis DJ5B-6 strain, a culture medium of the Bacillus licheniformis DJ5B-6 strain, a concentrate thereof, and a dried product thereof. A Bacillus licheniformis DJ5B-6 strain culture comprising one or more species selected from.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주, 또는 제 4항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물을 포함하는, 식품 조성물.
A food composition comprising a culture of the Bacillus licheniformis DJ5B-6 strain of claim 1, or the Bacillus licheniformis DJ5B-6 strain of claim 4.
 제 6항에 있어서,
상기 바실러스 리체니포미스 DJ5B-6 균주는 포자(spore)가 형성된 것인, 식품 조성물.
According to clause 6,
The Bacillus licheniformis DJ5B-6 strain is a food composition in which spores are formed.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주, 또는 제 4항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물을 포함하는, 화장료 조성물.
A cosmetic composition comprising a culture of the Bacillus licheniformis DJ5B-6 strain of claim 1, or the Bacillus licheniformis DJ5B-6 strain of claim 4.
 제 8항에 있어서,
상기 바실러스 리체니포미스 DJ5B-6 균주는 포자(spore)가 형성된 것인, 화장료 조성물.
According to clause 8,
The Bacillus licheniformis DJ5B-6 strain is a cosmetic composition in which spores are formed.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주, 또는 제 4항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물을 포함하는, 사료 조성물.
A feed composition comprising a culture of the Bacillus licheniformis DJ5B-6 strain of claim 1, or the Bacillus licheniformis DJ5B-6 strain of claim 4.
 제 10항에 있어서,
상기 바실러스 리체니포미스 DJ5B-6 균주는 포자(spore)가 형성된 것인, 사료 조성물.
According to clause 10,
The Bacillus licheniformis DJ5B-6 strain is a feed composition in which spores are formed.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주, 또는 제 4항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물을 포함하는, 비료 조성물.
A fertilizer composition comprising a culture of the Bacillus licheniformis DJ5B-6 strain of claim 1, or the Bacillus licheniformis DJ5B-6 strain of claim 4.
 제 12항에 있어서,
상기 바실러스 리체니포미스 DJ5B-6 균주는 포자(spore)가 형성된 것인, 비료 조성물.
According to clause 12,
The Bacillus licheniformis DJ5B-6 strain is a fertilizer composition in which spores are formed.
 제 1항의 바실러스 리체니포미스 DJ5B-6 균주, 또는 제 4항의 바실러스 리체니포미스 DJ5B-6 균주를 배양한 배양물을 포함하는, 프로바이오틱스 제제.
A probiotic preparation comprising a culture of the Bacillus licheniformis DJ5B-6 strain of claim 1, or the Bacillus licheniformis DJ5B-6 strain of claim 4.
 제 14항에 있어서,
상기 바실러스 리체니포미스 DJ5B-6 균주는 포자(spore)가 형성된 것인, 프로바이오틱스 제제.According to clause 14,
The Bacillus licheniformis DJ5B-6 strain is a probiotic preparation in which spores are formed.
KR1020220183920A 2022-12-26 2022-12-26 Novel heat resistant spore forming strains and probiotics uses thereof KR20240103082A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020220183920A KR20240103082A (en) 2022-12-26 2022-12-26 Novel heat resistant spore forming strains and probiotics uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020220183920A KR20240103082A (en) 2022-12-26 2022-12-26 Novel heat resistant spore forming strains and probiotics uses thereof

Publications (1)

Publication Number Publication Date
KR20240103082A true KR20240103082A (en) 2024-07-04

Family

ID=91913204

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020220183920A KR20240103082A (en) 2022-12-26 2022-12-26 Novel heat resistant spore forming strains and probiotics uses thereof

Country Status (1)

Country Link
KR (1) KR20240103082A (en)

Similar Documents

Publication Publication Date Title
US10251920B2 (en) Bacteria isolated from fresh honey or the honey producing tract of honey bees
KR101370941B1 (en) Novel Bacillus subtilis
KR101485182B1 (en) Novel Lactobacillus plantarum from kimchi with inhibiting activities on pathogenic microorganism and use thereof
KR102387028B1 (en) A novel Bacillus coagulans CC strain having high productivity for alpha glucosidase inhibitor
KR101381547B1 (en) Novel Leuconostoc mesenteroides from kimchi with inhibiting activities on pathogenic microorganism and use thereof
KR20160057855A (en) Lactic acid bacterium separated from kimchii and having antifungal activity, and compositon including it
KR101580616B1 (en) Bacillus methylotrophicus C14 strain having acid-resistance, bile acid-resistance and antimicrobial activity and uses thereof
KR101873898B1 (en) Novel lactobacillus sp. and feed composition for animal comprising thereof
KR101873899B1 (en) Lactobacillus salivarius cjls1511, composition for adding animal feed comprising the same or heat-killed bodies thereof, and method for preparing the heat-killed bodies
KR102130646B1 (en) Novel lactobacillus salivarius and feed additives for aquacultural fish and crustacea comprising the same
KR102424598B1 (en) Lactobacillus pentosus OKBL-L.PE 1 strain having antioxidant activity, anti-inflammatory activity, skin whitening activity, antimicrobial activity against pathogenic microorganism and anti-thrombotic activity and uses thereof
KR102424594B1 (en) Lactobacillus fermentum OKBL-L.FE 1 strain having anti-inflammatory activity and antimicrobial activity against pathogenic microorganism and uses thereof
KR102313770B1 (en) LACTOBACILLUS PLANTARUM WiKim0127 STRAIN DERIVED FROM JEJU PICKLED CABBAGE FOOD AND METHOD FOR PREPARING COMPOSITION USING SAME
KR101181269B1 (en) Exopolysaccharides with antioxidant and antiaging activity produced by Bacillus sp. strains isolated from kimchi, a fermented korean food and the method for manufacturing the same
KR100864006B1 (en) Lactic acid bacteria separated from kimchi and uses thereof
KR20060108964A (en) Enterococcus faecalis cbt-sl(5), preparation of its culture fluid and composition comprising the same
KR20220081475A (en) Lactobacillus plantarum OKBL-L.PL 1 strain having anti-inflammatory activity, skin whitening activity, antimicrobial activity against pathogenic microorganism and anti-thrombotic activity and uses thereof
KR102315879B1 (en) Novel Rhizopus oligosporus strain and antibacterial and antifungal composition comprising the same
KR20160099830A (en) Rhodobacter sphaeroides CB 8521 strain, having the effect of reducing malodor and immune activity in livestock industry, and microbial agent using it
KR20240103082A (en) Novel heat resistant spore forming strains and probiotics uses thereof
KR102370532B1 (en) Compositions containing enzyme hydrosis of soybean sprout by-product
KR102457366B1 (en) Lactobacillus plantarum wikim0127 strain derived from jeju pickled cabbage food and method for preparing composition using same
KR102626196B1 (en) New strain Lactobacillus brevis KU-024 and method for production of high concentration GABA by fed-batch cultivation of its strain
KR20240112382A (en) Novel Lactobacillus reuteri strain producing prebiotic alternan and uses thereof
KR102457367B1 (en) Lactobacillus plantarum wikim0126 strain derived from jeju pickled brussels sprout food and method for preparing composition using same