KR20240101972A - A Composition for preventing or treating sporadic Alzheimer's disease inducing inhibitor of Insulin-like growth factor-binding protein 3 and uses thereof - Google Patents

Abstract

The present invention relates to a composition for preventing or treating sporadic Alzheimer's disease (AD) containing an insulin-like growth factor-binding protein 3 (IGFBP3) inhibitor and its use.
When IGFBP3 is inhibited in neurons expressing APOE4 in the early stages of amyloid formation using an IGFBP3 inhibitor, the sAD phenotype can be improved by reducing the level of amyloid formation, the number of amyloid puncta, and the hyperphosphorylation level of tau protein. IGFBP3 Inhibitors can be provided for the prevention, improvement or treatment of sAD.

Description

Composition for preventing or treating sporadic Alzheimer's disease inducing inhibitor of Insulin-like growth factor-binding protein 3 and uses thereof}

The present invention relates to a composition for preventing or treating sporadic Alzheimer's disease (sAD) containing an insulin-like growth factor-binding protein 3 (IGFBP3) inhibitor and its use.

Alzheimer's disease (AD) is one of the most common forms of dementia and is characterized by progressive loss of memory and cognitive function, but the cause of the disease is still largely unknown. AD brains have several unique neuropathological features, including intracellular neurofibrillary tangles composed primarily of abnormally phosphorylated tau protein and senile plaques whose major components are amyloid-beta (Aβ) peptides.

It has been reported that approximately 5-15% of AD patients have genetic defects. Early-onset AD is mostly associated with autosomal dominant inherited mutations in the app (amyloid precursor protein), psen1 (presenilin 1), and psen2 (presenilin 2) genes. This case is called familial Alzheimer's disease (fAD), and its characteristics are well known.

On the other hand, the remaining 85-95% of AD patients have late-onset AD, also called sporadic Alzheimer's disease (sAD), and are affected by various pathological factors such as genetics and environmental exposures. Recently, among APOE protein isoforms, APOE4 (Apolipoprotein E4; Apolipoprotein E ε4, APOE ε4) has been found to be an important factor in the development of sAD, and it has been reported that the risk of AD worsens by 2 to 15 times if APOE4 is present. . Accordingly, for the fundamental treatment of sAD, an approach is required to discover and target the mediator of the APOE4 effect.

Meanwhile, RNA interference (RNAi) or gene silencing can suppress the expression of target genes through siRNA (small interfering RNA), shRNA (small hairpin RNA), etc., resulting in efficient gene knockdown. It is used as a method or gene therapy method.

Under this background, the present inventors discovered IGFBP3 (Insulin-like growth factor-binding protein 3) as a mediator of the APOE4 effect, an important factor in the development of sAD, and confirmed that inhibiting it can prevent, improve, or treat sAD. Thus, the present invention was completed.

1. Huang Y, et al. Cell. 2012;148(6):1204-22. 2. Kim J, et al. Neurons. 2009;63(3):287-303. 3. Liu C-C, et al. Nat Rev Neurol. 2013;9(2):106-18. 4. Kanekiyo T, et al. Neuron. 2014;81(4):740-54. 5. Huang Y, et al. Neurobiol Dis. 2014;72:3-12.

One object of the present invention is to provide a pharmaceutical composition for preventing or treating sporadic Alzheimer's disease (sAD), which contains an inhibitor of insulin-like growth factor-binding protein 3 (IGFBP3) as an active ingredient.

Another object of the present invention is to provide a method for preventing or treating sporadic Alzheimer's disease, comprising administering the pharmaceutical composition of the present invention to a subject.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

One aspect of the present invention is to provide a pharmaceutical composition for preventing or treating sporadic Alzheimer's disease (sAD), which includes an IGFBP3 (Insulin-like growth factor-binding protein 3) inhibitor as an active ingredient.

In the present invention, the term “IGFBP3 (Insulin-like growth factor-binding protein 3)” is one of the six IGFBP families, and binds strongly to IGF-I (Insulin like growth factor I) and IGF-II, thereby increasing the activity of these growth factors. It is known to play a role in suppressing cell proliferation and promoting cell death by regulating . In contrast to these effects, research results have also reported that IGFBP3 promotes cell proliferation or inhibits cell death.

In the present invention, IGFBP3 may have, include, or consist of the amino acid sequence shown in SEQ ID NO: 1, or may consist essentially of the amino acid sequence. Specifically, the IGFBP3 may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 1.

The IGFBP3 can be obtained from NIH GenBank, a well-known database. In the present invention, the amino acid sequence of IGFBP3 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the amino acid sequence shown in SEQ ID NO: 1. , may include an amino acid sequence having more than 99.5%, 99.7%, or 99.9% homology or identity. In addition, if the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 1, the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.

For example, addition or deletion of sequences, naturally occurring mutations, silent mutations or conservation within the amino acid sequence at the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the protein of the present invention. This is the case with enemy substitution.

The term “conservative substitution” means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.

In the present invention, the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably.

The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing to all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with a polynucleotide containing a common codon or a codon taking codon degeneracy into account.

Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ed.,] Academic Press, San Diego, 1994, and [CARILLO ET AL/.] (1988) SIAM J Applied Math 48: 1073), BLAST, National Center for Biotechnology Information Database. Alternatively, homology, similarity, or identity can be determined using ClustalW.

Homology, similarity or identity of polynucleotides or polypeptides is defined in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. This can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a unitary matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

In the present invention, the polynucleotide encoding IGFBP3 may be the Igfbp3 gene.

The polynucleotide encoding IGFBP3 of the present invention may include a base sequence encoding the amino acid sequence shown in SEQ ID NO: 1. As an example of the present invention, the polynucleotide encoding IGFBP3 of the present invention may have or include the sequence of SEQ ID NO: 2. In addition, the polynucleotide encoding IGFBP3 of the present invention may consist of or consist essentially of the sequence of SEQ ID NO: 2. Specifically, the IGFBP3 may be encoded by the polynucleotide described in the base sequence of SEQ ID NO: 2.

The base sequence encoding IGFBP3 can be obtained from the National Institutes of Health GenBank, a well-known database. In the present invention, the polynucleotide encoding IGFBP3 of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95% homology or identity with the sequence of SEQ ID NO: 2. , has or includes a nucleotide sequence of 96% or more, 97% or more, 98% or more, or has 70% or more, 75% or more, 76% or more, 85% or more, 90% homology or identity with the sequence of SEQ ID NO. It may consist of or essentially consist of more than 95%, more than 96%, more than 97%, more than 98% of base sequence, but is not limited thereto.

As used herein, the term “IGFBP3 inhibitor” refers to all agents that reduce the expression or activity of IGFBP3 mRNA or IGFBP3 protein, and specifically includes all agents that reduce the expression of IGFBP3 by interfering with the expression of IGFBP3 at the transcriptional level. In the present invention, “IGFBP3” may be interpreted as referring to both IGFBP3 mRNA and protein.

The IGFBP3 inhibitor of the present invention can target the gene encoding the amino acid sequence of SEQ ID NO: 1. As an example, the IGFBP3 inhibitor of the present invention may target the base sequence of SEQ ID NO: 2 encoding IGFBP3. The base sequence of SEQ ID NO: 2 may be a genomic gene of the subject to be administered.

As another example, the IGFBP3 inhibitor may be a peptide, compound, antibody, or binding fragment that specifically binds to IGFBP3. For example, the peptide, compound, antibody, or binding fragment may target the amino acid sequence of SEQ ID NO: 1.

As another example, the IGFBP3 inhibitor may be polynucleotide-based.

As another example, the IGFBP3 inhibitor of the present invention may inhibit IGFBP3 by specifically inducing RNAi phenomenon on IGFBP mRNA.

In the present invention, the term "RNA interference (RNAi)" refers to double-stranded RNA (sense RNA, which is a homologous sequence to the mRNA of a target gene) and anti-sense RNA, which is a complementary sequence. By introducing double strand RNA (dsRNA), the expression of the target gene can be suppressed by more than 80% by inducing destruction of the target gene mRNA after transcription by dsRNA, also called gene silencing.

As an example of one of the above-described embodiments, the IGFBP3 inhibitor of the present invention may target the base sequence of SEQ ID NO: 2 encoding IGFBP3 and inhibit IGFBP3 mRNA expression by binding complementary to the sequence.

For example, the IGFBP3 inhibitor of the present invention may be one or more selected from siRNA, shRNA, miRNA, antisense oligonucleotide, or aptamer. The inhibitor may specifically bind to a target sequence, and the target sequence may be the gene or mRNA of IGFBP3.

In the present invention, the terms "siRNA (small interfering RNA)" and "shRNA (small hairpin RNA)" are nucleic acid molecules that can mediate RNA interference (RNAi) or gene silencing, and are used to control the expression of target genes. Because it can be suppressed, it is used as an efficient gene knockdown method or gene therapy method.

The siRNA refers to a short dsRNA of about 21 to 22 bp that induces RNAi phenomenon.

In addition, as a vector system that can change the phenotype by expressing such siRNA in cells for a long period of time, siRNA is generated under an RNA pol III promoter (e.g., U6 promoter, H1 promoter, etc.) that can transcribe short RNA transcripts. A sense oligonucleotide and a complementary antisense oligonucleotide are expressed with an appropriate number (5 to 9 nt) of loop sequences in between, allowing the synthesis of a short hairpin RNA (small hairpin RNA, shRNA). Vectors have been developed. The shRNA synthesized in this way is cleaved by Dicer or Rnase III, which are siRNA processing enzymes present in the cell, and becomes siRNA, a dsRNA of 8 to 30 nucleotides in size, and is specifically directed to the mRNA of the target gene with a complementary sequence. By combining, they can induce gene silencing.

Therefore, which of shRNA and siRNA to use can be decided by a person skilled in the art, and if the mRNA sequences they target are the same, a similar expression reduction effect can be expected.

The method for producing the siRNA is not particularly limited, and methods known in the art can be used. siRNA can be synthesized chemically or enzymatically. For example, a method of directly chemically synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cutting long double-stranded RNA synthesized by in vitro transcription using enzymes, Expression methods include, but are not limited to, expression methods through intracellular delivery of shRNA expression plasmids or viral vectors and expression methods through intracellular delivery of PCR (polymerase chain reaction)-induced siRNA expression cassettes.

As another example of the above-described embodiments, the IGFBP3 inhibitor of the present invention may be shRNA targeting IGFBP3. The shRNA targeting IGFBP3 of the present invention may include a sense oligonucleotide and an antisense oligonucleotide complementary thereto, and may include a loop sequence between the sense and antisense oligonucleotides. As another example, the shRNA targeting IGFBP3 of the present invention may include the base sequences of SEQ ID NOs: 3 and 4 as a sense oligonucleotide and an antisense oligonucleotide complementary thereto, respectively. Additionally, loop sequences (uucaagaga) may be included between these sequences.

In the present invention, the term "miRNA (micro RNA)" refers to a substance that naturally exists within cells and is involved in the regulation of a specific gene by inducing the RNAi phenomenon. Any miRNA that can inhibit the expression or activity of IGFBP3 of the present invention is not limited to its type and can be included in the present invention.

In the present invention, the term "antisense oligonucleotide" refers to DNA, RNA, or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a characteristic mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into protein. It can work. The antisense oligonucleotide sequence is complementary to the IGFBP3 target sequence of SEQ ID NO: 2 and may be a DAN or RNA sequence capable of binding to the sequence. The antisense oligonucleotide may be 5 to 100 nt, 8 to 60 nt, 10 to 40 nt, or 10 to 30 nt in length. The antisense oligonucleotide may be synthesized in vitro using a conventional method and administered in vivo, or may be administered in the form of an antisense oligonucleotide synthesized in vivo. Antisense oligonucleotides can be synthesized in vitro by biological/chemical methods according to conventional methods in the technical field of the present invention. In addition, the form in which the antisense oligonucleotide is synthesized in vivo can be realized using a recombinant vector expressing the antisense oligonucleotide, and this method can be easily carried out according to a conventional method in the technical field of the present invention. there is. Therefore, the design of the antisense oligonucleotide of the present invention can be easily produced according to methods known in the art, referring to the base sequence of SEQ ID NO: 2.

In the present invention, the term “aptamer” refers to a single-stranded oligonucleotide, about 20 to 60 nucleotides in size, and a nucleic acid molecule that has binding activity to a predetermined target. It has a variety of three-dimensional structures depending on its sequence, and can have high affinity for specific substances, like an antigen-antibody reaction. An aptamer can inhibit the activity of a given target by binding to it. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may also be in a linear or circular form. Preferably, the aptamer may bind to IGFBP3 mRNA and serve to inhibit the expression or activity of IGFBP3. Such an aptamer can be prepared from the IGFBP3 target sequence of SEQ ID NO: 2 by a method known to those skilled in the art.

As another example of the above-described embodiments, the IGFBP3 inhibitor of the present invention may be a vector expressing shRNA targeting IGFBP3.

In the present invention, the term “vector” refers to DNA that can proliferate by introducing the desired DNA fragment into a host cell, and is also called a cloning vehicle. “Expression vector” refers to the desired coding sequence and a specific host cell. In the present invention, the vector may be used in the same sense as an expression vector.

The vector used in the present invention is not particularly limited as long as it can replicate within the host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used. , pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used, and as viral vectors, adeno-associated virus (AAV) vectors, adenovirus vectors, herpes virus vectors, retrovirus vectors, lentivirus vectors, and vaccinia vectors can be used. Niavirus vectors, poxvirus vectors, herpes simplex virus vectors, etc. can be used.

Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.

In the present invention, the term “transformation” refers to introducing a recombinant vector containing a target polynucleotide into a host cell so that the polynucleotide can be expressed within the host cell. As long as the transformed polynucleotide can be expressed in the host cell, it can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome. The transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Examples include, but are not limited to, the lithium acetate-DMSO method.

In addition, the term "operably linked" as used herein means that the polynucleotide sequence is functionally connected to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present invention. do. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.

In the present invention, the term “Alzheimer's disease (AD)” is also called “dementia” and is a general cognitive impairment other than loss of reasoning ability, forgetting, concentration, and decline in intelligence. AD is a disease that exhibits functional decline, and its severity varies depending on the individual, and can be caused by various diseases, such as Dementia of Alzheimer's disease (Dementia of Alzheimer's disease), Vascular Dementia, and Brain. Dementia due to head trauma, Dementia due to Parkinson's Disease, Dementia due to Hunting ton's Disease, Dementia due to Pick's Disease), Dementia due to Creutzfeldt-Jakob Disease, Dementia due to Other General Medical Conditions, Substance-Induced Persisting Dementia , Dementia due to Multiple etiologies, and Dementia Not Otherwise Specified.

Early-onset AD is mostly associated with autosomal dominant inherited mutations in the app (amyloid precursor protein), psen1 (presenilin 1), and psen2 (presenilin 2) genes. This case is called familial Alzheimer's disease (fAD), and its characteristics are well known.

On the other hand, the remaining 85-95% of AD patients have late-onset AD, also called sporadic Alzheimer's disease (sAD), and are affected by various pathological factors such as genetics and environmental exposures.

In the present invention, the term "sporadic Alzheimer's disease (sAD)" refers to AD that accounts for the majority of AD patients and has various pathological factors such as genetic and environmental exposures. The sAD may be late-onset AD. The delayed-onset Alzheimer's disease is an Alzheimer's disease that appears in elderly patients in their 60s or older due to various environmental factors.

In the present invention, sAD may develop as nerve cells express APOE4 in the early stages of amyloid formation.

In the present invention, the term "APOE4 (Apolipoprotein E4; Apolipoprotein E ε4, APOE ε4)" is one of the isoforms of the APOE (Apolipoprotein) protein, a plasma lipoprotein that acts as a carrier of lipids and cholesterol in the circulatory system, and is used in the lungs, spleen, and lungs. It is widely expressed in other tissues such as the ovaries, but is known to be produced in the liver and brain. Additionally, APOE4 is known to be a major cause of sAD onset.

In vivo , the initial stage of amyloid formation may refer to the stage before amyloid accumulates and forms senile plaques and/or before synaptic damage appears due to amyloid accumulation, and before amyloid accumulation is confirmed but leads to the onset of Alzheimer's disease. You can. The time from the initial accumulation of amyloid to the time of senile plaque formation or synaptic damage varies from individual to individual, but generally takes about 5 to 15 days.

In vitro , the initial stage of amyloid formation may be 5 to 15 days, specifically 6 to 10 days, and more specifically 6 to 8 days after direct cross-differentiation of induced nerve cells.

The initial stage of amyloid formation can be determined by measuring the level of amyloid oligomers. Specifically, the initial stage of amyloid formation can be determined to be a case where the level of amyloid oligomers measured at the current time increases within a certain range compared to the normal control group. For example, if the amyloid oligomer level measured at the present time increases by about 20% or more, about 30% or more, or about 40% or more, specifically about 20% to 40%, compared to the normal control group, it can be determined that the amyloid formation is in the early stage.

In one embodiment of the present invention, based on the results of measuring the level of amyloid oligomers in induced neurons derived from normal and Alzheimer's patients for 0, 5, 7, 10, and 25 days, amyloid was found on day 7 compared to days 0 to 5. By confirming that the oligomers increased by about 20% to 40%, it was determined that the initial stage of amyloid formation was 7 days after direct cross-differentiation (FIG. 19).

For example, the direct cross-differentiation may be direct cross-differentiation of somatic cells into induced nerve cells. The somatic cells may be fibroblasts.

In the present invention, the occurrence of sAD according to the present invention may have a low correlation with the presence or absence of a mutant genotype of app, psen1, or psen2. sAD according to the present invention may develop solely depending on whether nerve cells express APOE4 in the early stages of amyloid formation, regardless of whether they have a mutant genotype of app, psen1, or psen2.

In one embodiment, the present invention confirmed that the expression level of IGFBP3 was specifically increased in AD patients with APOE4 (FIG. 12B), and confirmed whether sAD phenotype was improved when IGFBP3 was inhibited.

The IGFBP3 inhibitor of the present invention may have the effect of improving the sAD phenotype.

The IGFBP3 inhibitor of the present invention may reduce the level of amyloid formation in nerve cells expressing APOE4 in the early stages of amyloid formation.

In one embodiment of the present invention, when APOE4 is induced in induced neurons differentiated from fibroblasts derived from AD patients carrying PSEN1 mutations at the early stage of amyloid formation and treated with IGFBP3 shRNA (+APOE4, day 7 +sh IGFBP3), APOE4 When induced in the amyloid worsening stage and treated with IGFBP3 shRNA (+APOE4, day 14 +sh IGFBP3), the level of amyloid formation was confirmed to be significantly reduced (Figures 13A and 16), and in AD patients with PSEN2 mutation (Figure 13B ) and cell populations derived from sAD (SDA) patients (Figure 13C).

The IGFBP3 inhibitor of the present invention may reduce the number of amyloid puncta in neurons expressing APOE4 in the early stages of amyloid formation.

In one embodiment of the present invention, induced neurons differentiated from fibroblasts derived from AD patients with PSEN1 mutations (Figure 14A), AD patients with PSEN2 mutations, and sAD (SDA) patients (Figure 14B) all use APOE4 in the early stages of amyloid formation. When induced and treated with IGFBP3 shRNA, the number of amyloid puncta was significantly reduced compared to when APOE4 was induced in the amyloid deterioration stage and treated with IGFBP3 shRNA (Figures 14 and 17A). Conversely, when IGFBP3 was overexpressed, the number of amyloid puncta increased, confirming that targeting IGFBP3 could improve the sAD phenotype (Figure 17B).

In particular, in one embodiment of the present invention, it was confirmed that there was no significant difference in the number of amyloid puncta in the early stages of amyloid formation when shRNA targeting PRKCA, PRUNE2, or SPON1 genes with large genetic expression differences other than the IGFBP3 gene was treated. (Figure 15).

Accordingly, it was confirmed that the improvement of the sAD phenotype by gene regulation in the early stages of amyloid formation occurs specifically when targeting the IGFBP3 gene.

The IGFBP3 inhibitor of the present invention may reduce the hyperphosphorylation level of tau protein in neurons expressing APOE4 in the early stages of amyloid formation.

In one embodiment of the present invention, when APOE4 is induced in induced neurons differentiated from AD patient-derived fibroblasts at the early stage of amyloid formation and treated with IGFBP3 shRNA (+APOE4, day 7 +sh IGFBP3), APOE4 aggravates amyloid. It was confirmed that the hyperphosphorylation level of tau protein was significantly reduced compared to when induced at the stage and treated with IGFBP3 shRNA (+APOE4, day 14 +sh IGFBP3) (Figure 18).

Accordingly, it was confirmed that targeting the IGFBP3 gene in induced neurons differentiated from AD patient-derived fibroblasts in which APOE4 expression was induced in the early stages of amyloid formation could inhibit the formation of hyperphosphorylation of tau protein.

As described above, it was confirmed that inhibiting IGFBP3 in neurons expressing APOE4 in the early stages of amyloid formation can improve the sAD phenotype by reducing the level of amyloid formation, the number of amyloid puncta, and the hyperphosphorylation level of tau protein.

Accordingly, it was confirmed that IGFBP3 inhibitors can be provided for the prevention, improvement, or treatment of sAD. In particular, when PRKCA, PRUNE2, or SPON1 genes, which have large genetic expression differences in addition to the IGFBP3 gene, are inhibited, the number of amyloid puncta decreases under the same conditions. As it was confirmed that there was no significant difference, it was confirmed that the effect of improving the sAD phenotype in neurons expressing APOE4 in the early stages of amyloid formation was a specific effect that occurred only when IGFBP3 was inhibited.

That is, the pharmaceutical composition of the present invention containing the IGFBP3 inhibitor of the present invention as an active ingredient may have the effect of preventing, improving, or treating sAD.

In any one of the above-described embodiments, the pharmaceutical composition of the present invention may be administered to a patient in the early stages of sAD.

In one embodiment of the present invention, improvement and alleviation of the sAD phenotype using the pharmaceutical composition of the present invention was confirmed in the early stage of amyloid formation, which is a characteristic of the early stage of sAD, and the pharmaceutical composition of the present invention was used to prevent the progression of early sAD. It can be used to suppress, prevent the onset, and/or treat the condition.

In the present invention, the term "prevention" refers to any action that inhibits or delays the onset of sporadic Alzheimer's disease (sAD) by administering the pharmaceutical composition of the present invention, and "treatment" refers to the administration of the pharmaceutical composition of the present invention. It refers to all actions that improve or change the symptoms of sAD to a beneficial effect.

In the present invention, the term "improvement" refers to any action that improves or benefits the symptoms of a subject suspected or affected by sAD using the pharmaceutical composition of the present invention.

The pharmaceutical composition of the present invention may further include appropriate carriers, excipients, or diluents commonly used in the preparation of pharmaceutical compositions. At this time, the content of the active ingredient included in the pharmaceutical composition is not particularly limited, but may include 0.0001% by weight to 10% by weight, specifically 0.001% by weight to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition may be any selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. It may have a single dosage form, or may have several oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain one or more compounds and at least one excipient, such as starch, calcium carbonate, sucrose, or lactose ( It is prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurel, glycerogelatin, etc. can be used.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

In the present invention, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the individual, age, gender, and severity of the disease. It can be determined based on factors including the type, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but for desirable effects, the pharmaceutical composition of the present invention is administered at 0.0001 to 500 mg/day. It may be better to administer in kg, specifically 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered several times. The pharmaceutical composition can be administered to various mammals such as rats, livestock, and humans by various routes, and the method of administration includes without limitation any method conventional in the art, for example, orally, rectally, or intravenously. It may be administered by intramuscular, subcutaneous, intrauterine, intrathecal, or intracerebrovascular injection.

In addition, the pharmaceutical composition of the present invention can be used not only in the form of a medicine for humans, but also in the form of an animal medicine. Here, animals are a concept that includes livestock and companion animals.

Another aspect of the present invention provides a method for preventing or treating sporadic Alzheimer's disease (sAD), comprising administering the pharmaceutical composition of the present invention to a subject.

The terms used here are the same as described above.

As described above, the pharmaceutical composition of the present invention contains the IGFBP3 inhibitor of the present invention as an active ingredient, thereby inhibiting IGFBP3 in nerve cells expressing APOE4 in the early stages of amyloid formation, thereby increasing the level of amyloid formation, the number of amyloid puncta, and tau. Since the sAD phenotype can be improved by reducing the level of protein hyperphosphorylation, the pharmaceutical composition of the present invention can be used for the purpose of preventing, improving, or treating sAD.

In the present invention, the term “individual” may mean any animal, including humans. The animal may be not only a human, but also a mammal such as a cow, horse, sheep, pig, goat, camel, antelope, dog, or cat that requires treatment for similar symptoms. It may also refer to animals other than humans, but is not limited thereto.

In the present invention, the term "administration" refers to introducing the pharmaceutical composition of the present invention to a subject suspected of having Alzheimer's disease or cognitive dysfunction by any appropriate method, and the route of administration is oral or parenteral as long as it can reach the target tissue. It can be administered through a variety of routes.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount, as described above.

The pharmaceutical composition of the present invention is not particularly limited and can be applied to any entity as long as it is intended to prevent or treat Alzheimer's disease or cognitive dysfunction. For example, non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds and fish can be used, and the pharmaceutical composition can be administered parenterally, subcutaneously, etc. It can be administered intraperitoneally, intrapulmonaryly and intranasally, and for topical treatment, if necessary, by any suitable method, including intralesional administration. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. For example, it may be administered orally, rectally, or by intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection, but is not limited thereto.

Another aspect of the present invention provides a health functional food composition for preventing or improving sporadic Alzheimer's disease (sAD), comprising the IGFBP3 inhibitor of the present invention.

The terms used here are the same as described above.

As described above, the composition of the present invention contains the IGFBP3 inhibitor of the present invention as an active ingredient, thereby inhibiting IGFBP3 in nerve cells expressing APOE4 in the early stages of amyloid formation, thereby increasing the level of amyloid formation, the number of amyloid puncta, and the level of tau protein. Since the sAD phenotype can be improved by reducing the level of hyperphosphorylation, the composition of the present invention can be used for the purpose of preventing or improving sAD.

The health functional food of the present invention can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and components commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a food. The health functional food composition of the present invention can be manufactured in various formulations, and unlike general drugs, it is made from food and has the advantage of not having any side effects that may occur when taking the drug for a long period of time. It is also highly portable and can be used on a daily basis. It is very useful because it can be ingested, and it can be ingested as a supplement to improve the effect of preventing or improving Alzheimer's disease or cognitive dysfunction.

The health functional food is an essential ingredient and there are no particular restrictions on other ingredients other than the IGFBP3 inhibitor. Like ordinary health functional foods, it may contain various herbal extracts, food supplements, or natural carbohydrates as additional ingredients. In addition, the food auxiliary additives include food auxiliary additives common in the art, such as flavoring agents, flavors, colorants, fillers, stabilizers, etc.

Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. In addition to the above-mentioned flavoring agents, natural flavoring agents (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

In addition to the above ingredients, the health functional food composition of the present invention contains various nutrients, vitamins, water (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid, and salts thereof. , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated drinks, and other natural fruit juices, fruit juice drinks and vegetables. May contain pulp for the manufacture of beverages. These ingredients can be used independently or in combination. In addition, health functional foods include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, gum, ice cream, soup, beverages, tea, functional water, drinks, alcoholic beverages, and vitamin complexes. It can be.

In addition, the above-mentioned health functional food may additionally contain food additives, and its suitability as a “food additive” is determined in accordance with the general provisions of the Food Additives Code and General Test Methods approved by the Food and Drug Safety Administration, unless otherwise specified. Judgment is made according to specifications and standards.

At this time, in the process of manufacturing health functional foods, the content of the composition added to food can be appropriately adjusted as needed.

In the present invention, the pharmaceutical composition of the present invention can inhibit the expression or activity of IGFBP3 by further comprising means known in the art that can inhibit the expression or activity of IGFBP3, in addition to the IGFBP3 inhibitor described above. The means are not particularly limited.

When IGFBP3 is inhibited in neurons expressing APOE4 in the early stages of amyloid formation using the IGFBP3 inhibitor of the present invention, the sAD phenotype is improved by reducing the level of amyloid formation, the number of amyloid puncta, and the level of hyperphosphorylation of tau protein. Possibly, an IGFBP3 inhibitor can be provided for the purpose of preventing, improving, or treating sAD.

Figure 1 (A) Schematic diagram for creating an AD neuron model by inducing the expression of APOE4 (Apolipoprotein E4; Apolipoprotein E ε4, APOE ε4) in induced neurons differentiated from fibroblasts derived from patients with Alzheimer's disease (AD). . Expression of APOE4 was induced by treating induced neurons with doxycycline from day 7 (early stage of amyloid formation) to day 25 and from day 14 (stage of amyloid worsening) to day 25 after lentivirus infection, respectively. (B) This is the result of confirming the APOE4 protein expression level by Western blot.
Figure 2 shows immunofluorescence staining of TUJ1/NeuN (A) and MAP2/VGLUT1 (B) neuronal markers in induced neurons differentiated from AD patient-derived fibroblasts that induced APOE4 expression in the early stage of amyloid formation or in the amyloid worsening stage. This is a result confirmed by .
Figure 3 shows the number of neurons in induced neurons differentiated from AD patient-derived fibroblasts that induced the expression of APOE4 in the early stage of amyloid formation or in the stage of amyloid exacerbation using TUJ1/NeuN (A) and MAP2/VGLUT1 (B) neuronal markers. This is the result quantified.
Figure 4 shows the level of amyloid-beta (Aβ)-42/40 ratio of induced neurons differentiated from AD patient-derived fibroblasts in which APOE4 expression was induced in the early stage of amyloid formation or amyloid worsening stage was confirmed by ELISA analysis. It is a result.
Figure 5 shows the results of Western blot analysis of the level of amyloid oligomers in induced neurons differentiated from fibroblasts derived from AD patients in which the expression of APOE4 was induced in the early stage of amyloid formation or in the stage of amyloid exacerbation (A) and a graph quantifying this (B) ) am.
Figure 6 shows the results of immunofluorescence staining for the hyperphosphorylation level of tau protein in induced neurons differentiated from AD patient-derived fibroblasts in which APOE4 expression was induced in the early stage of amyloid formation or in the amyloid worsening stage (A) and the level of tau protein. This is a graph (B) quantifying the number of hyperphosphorylation-positive cells.
Figure 7 is a schematic diagram of an experiment to verify the effect of inducing the expression of APOE4 in the early stages of amyloid. Expression of APOE4 was induced by treating the induced nerve cells with doxycycline from the 7th day (early stage of amyloid formation) to the 14th day after lentivirus infection.
Figure 8 shows AD patient-derived fibers in which the expression of APOE4 was induced in the early stage of amyloid formation (+APOE4, day 7 in Figure 1A and +APOE4, day 7-14 in Figure 7) or the stage of amyloid exacerbation (+APOE4, day 14). The results of Western blot analysis of amyloid oligomer levels in induced neurons differentiated from blast cells (A) and a graph quantifying the levels (B).
Figure 9 shows the results of transcriptome analysis of induced neurons differentiated from AD patient-derived fibroblasts in which the expression of APOE4 was induced in the early stage of amyloid formation or the amyloid worsening stage.
Figure 10 shows the distribution of DEGs (differentially expressed genes) appearing in induced neurons differentiated from AD patient-derived fibroblasts that induced the expression of APOE4 in the early stages of amyloid formation.
Figure 11 is a heatmap of DEGs appearing in induced neurons differentiated from AD patient-derived fibroblasts that induced the expression of APOE4 in the early stage of amyloid formation or the aggravating stage of amyloid.
Figure 12 shows the results of RT-PCR analysis of the IGFBP3 mRNA expression level over time in induced neurons differentiated from fibroblasts derived from AD patients in which APOE4 expression was induced in the early stage of amyloid formation or in the amyloid worsening stage (A) and This is the result of RT-PCR analysis of IGFBP3 mRNA expression levels according to cell populations derived from AD patients (B).
Figure 13 shows that APOE4 is induced in the early stage of amyloid formation in induced neurons differentiated from fibroblasts derived from an AD patient with a PSEN1 mutation (A), an AD patient with a PSEN2 mutation (B), and a sAD (SDA) patient (C), and shRNA is applied. This is the result of confirming the level of amyloid formation after treatment using immunofluorescence staining.
Figure 14 shows induced neurons differentiated from fibroblasts derived from an AD patient with a PSEN1 mutation (Figure 14A), an AD patient with a PSEN2 mutation, and a sAD (SDA) patient (Figure 14B), which induce APOE4 in the early stages of amyloid formation and after shRNA treatment. This is the result of confirming the number of amyloid puncta.
Figure 15 shows the results of confirming the number of amyloid puncta after shRNA treatment targeting PRKCA, PRUNE2, or SPON1 genes with large genetic expression differences in addition to IGFBP3 among DEGs in the early stages of amyloid formation.
Figure 16 shows the results of inducing APOE4 in the early stages of amyloid formation in induced neurons differentiated from fibroblasts derived from AD patients with APOE4 mutations and confirming the level of amyloid formation by immunofluorescence staining after treatment with shRNA.
Figure 17 shows the number of amyloid puncta after shRNA treatment (A) and the number of amyloid puncta by IGFBP3 overexpression (B) in induced neurons differentiated from fibroblasts derived from sAD patients in which the expression of APOE4 was induced in the early stage of amyloid formation or the stage of amyloid worsening. This is a graph showing .
Figure 18 shows the results of immunofluorescence staining for the hyperphosphorylation level of tau protein after shRNA treatment in induced neurons differentiated from fibroblasts derived from sAD patients in which the expression of APOE4 was induced in the early stage of amyloid formation or in the stage of amyloid exacerbation (A). This is a graph showing the number of neurons positive for tau protein hyperphosphorylation (B).
Figure 19 shows amyloid (6E10) oligomer levels in induced neurons differentiated from fibroblasts derived from normal (A), AD patients with PSEN1 mutation, or AD patient with PSEN2 mutation (B) for 0, 5, 7, 10, and 25 days. This is a quantitative graph.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the embodiments according to the present invention may be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Experiment example

<Experimental Example 1> Direct cross-differentiation of human fibroblasts into induced nerve cells and induction of APOE4 expression

Human fibroblasts were cultured in medium (containing 10% FBS, 1% non-essential amino acids, 0.1% β-mercaptoethanol, and 1% penicillin/streptomycin). Human fibroblasts include control fibroblasts (GM23967, male, condition: APOE ε3/3 genotype) and fibroblasts derived from Alzheimer's disease (AD) patients (AG06848, female, condition: AD PSEN1 (ALA246GLU) mutation, APOE ε3/3 genotype; AG09908, female; AD PSEN2(ASN141ILE) mutation; APOE ε3/3 genotype; APOE ε3/4 genotype; male: APOE ε3/4 genotype; male, condition: unknown, APOE ε3/3 genotype) was used.

To directly cross-differentiate human fibroblasts into induced neurons, Ascl1 (Achaete-scute homolog 1), Brn2 (POU domain transcription factor), and Myt1l (myelin transcription factor 1 like) obtained from HEK293T cells transfected into human fibroblasts. , M2rtTA, plasmids containing apoE ε3 (Apolipoprotein E ε3) and apoE4 (Apolipoprotein E4; Apolipoprotein E ε4, apoE ε4) genes, as well as lentiviruses containing psPAX2 and pMD2.G (FUW-Ascl1, Brn2, Myt1l). Infected three times over two days. Approximately 48-72 hours after infection, the medium was replaced with neural differentiation medium (25 μg/mL insulin, 20 nM progesterone, 50 μg/mL transferrin, 100 μM putrescine, 1 μg/mL laminin, 25 μg/mL fibroblast growth factor (FGF), 10 g/mL DMEM/F12 medium containing brain-derived neurotrophic factor (BDNF), 5 μM forskolin, and 1% penicillin/streptomycin).

<Experimental Example 2> Production of sporadic AD neuron model

To induce APOE4 expression in differentiated induced neurons, the induced neurons were treated with 2 μg/mL doxycycline. Specifically, to distinguish between induced neurons in the early stage of amyloid formation and induced neurons in the amyloid worsening stage, from day 7 (early stage of amyloid formation) to day 25 and day 14 (amyloid worsening stage) after lentivirus infection, respectively. By treating doxycycline from day 25 to day 25, a sAD neuron model was created (Figure 1A). Induced neurons that did not induce APOE4 expression were -APOE4, induced neurons that induced APOE4 expression on day 7 after lentivirus infection were +APOE4, day 7, and induced neurons that induced APOE4 expression on day 14 after lentivirus infection. was named +APOE4, day 14.

<Experimental Example 3> RNA isolation and RT-qPCR

All RNA was collected and purified using the eCube tissue RNA mini kit (Philekorea) according to the manufacturer's instructions. RNA was then reverse transcribed into cDNA using AccuPower® CycleScript RT PreMix (Bioneer, #K-2044-B). RT-qPCR analysis was performed using AccuPower® PCR PreMix (Bioneer, #K-2016) with the primers in Table 1 below. All reactions were performed using the Rotor-Gene Q real-time PCR cycler (Qiagen).

sequence number sequence name Sequence (5' - > 3') 13 IGFBP3-forward aaatgctagtgagtcggagg 14 IGFBP3-reverse ctgggtatctgtgctctgag

<Experimental Example 4> Western Blot

Cells were washed with 1x phosphate-buffered saline (PBS) and then incubated in RIPA buffer (50 mmol/L Tris containing 1% NP-40, 0.5% sodium deoxycholate (DOC), 0.1% SDS, and 150 mmol/L NaCl, pH 8.0). , Sigma-Aldrich) and 1x protease inhibitor and homogenized. Samples were mixed with 5x loading buffer and boiled at 100°C for 10 min. 10 ug of extracted protein was separated by SDS-PAGE on a 12% polyacrylamide gel and transferred to a nitrocellulose membrane (10600001, GE Healthcare). Protein concentration was quantified using the Quick Start Bradford protein assay (Bio-Rad). Membranes were blocked in 5% bovine serum albumin (BSA) and incubated with primary antibodies overnight at 4°C. Primary antibodies were used at the dilution recommended by the manufacturer. The membrane was washed three times with PBS and then incubated with secondary antibodies for 2 hours at room temperature. Representative images of each protein band were obtained using Image J software and Chemidoc TRS+. The antibodies used were anti-β-amyloid (6E10) (1:300, Biolegend), anti-APOE4 (1:1000, Millipore), and anti-β-actin (1:1000, AbFrontier). It was used as a loading control.

<Experimental Example 5> Transcriptome analysis

cDNA derived from induced neurons with or without induced APOE4 expression was synthesized and subjected to microarray analysis using the GeneChip WT (Whole Transcript) amplification kit and Affymetrix GeneChip Human Gene 2.0 ST Array according to the manufacturer's protocol. The microarray analysis results were analyzed using the RMA (Robust multiarray averaging) method using the affy R package. Additionally, when multiple probes were available, the average value per gene was applied.

<Experimental Example 6> shRNA production

An shRNA targeting the IGFBP3 gene (SEQ ID NO: 2), which was discovered as a mediator of the APOE4 effect, was produced. The shRNA sequence used in this study was selected from the National Institutes of Health GenBank, and the shRNA lentiviral vector was obtained from Applied Biological Materials Inc. It was commissioned and produced by (abm). The sense oligonucleotide of siRNA and its complementary antisense oligonucleotide were expressed with a loop sequence (uucaagaga) in between, thereby synthesizing shRNA with a short hairpin structure.

The shRNA sequences produced above are shown in Table 2 below.

sequence number sequence name Sequence (5' - > 3') 3 shIGFBP3 sense tcaagaaagggcatgctaaagacagccag 4 shIGFBP3 antisense ctggctgtctttagcatgccctttcttga 5 sh PRKCA sense ttgtatgaaatgcttgccgggcagcctc 6 sh PRKCA antisense gaggctgcccggcaagcatttcatacaa 7 sh PRUNE2 sense actggccatgatcccacagccaacaaa 8 shPRUNE2 antisense tttgttggctgtgggatcatggccagt 9 shSPON1 sense tgaatgccccattgactgtgagctcaccg 10 sh SPON1 antisense cggtgagctcacagtcaatggggcattca 11 control sense caccgcgctacaaagttgactatgattcaagagatcatagtcaactttgtagcgcttttttg 12 control antisense caaaaaagcgctacaaagttgactatgatctcttgaatcatagtcaactttgtagcgcggtg

<Experimental Example 7> Immunofluorescence staining

After washing the cultured cells with 1x PBS, they were treated with 4% paraformaldehyde and fixed at room temperature for 10 minutes. The fixed cells were washed twice with 1x PBS containing 0.1% Triton-X and then blocked with PBS containing 3% BSA and 0.1% Triton X-100 for 3 hours at room temperature. Cells were incubated with primary antibodies for 24 hours at 4°C. Primary antibodies were used at the dilution recommended by the manufacturer. Then, they were incubated with secondary antibodies conjugated to Alexa488 or Alexa 594 (Invitrogen) for 2 hours at room temperature. After washing with 1x PBS containing 0.1% Triton-X, the cells were stained with DAPI (4',6-diamidino-2-phenylindole) and mounted with a drop of mounting fluid and fixed with a cover glass. Images were taken using a versatile confocal microscope (LSM-800, Zeiss), and immunofluorescence signals were quantified within the area using Image J software. Antibodies used were anti-βIII-tubulin (1:1000, Sigma-Aldrich), anti-NeuN (1:500, Millipore), anti-MAP2 (1:200, Cell Signaling), and anti-VGLUT1 (1:200). , Invitrogen), anti-β-amyloid (6E10) (1:500, Biolegend), anti-phosphorylated tau protein (1:400, Millipore), and anti-EEA1 (1:500, Millipore).

<Experimental Example 8> Lentiviral vector production

Plasmids containing Ascl1, Brn2, Myt1l, M2rtTA, apoE ε3, and apoE4 genes as well as lentiviral vectors (FUW-Ascl1, Brn2, Myt1l) containing psPAX2 and pMD2.G were constructed. HEK293T cells were cultured in DMEM medium containing 10% FBS and 1% P/S. The day before transfection, 2X10 ⁷ cells were seeded in a 15 cm culture dish containing medium. The next day, cells were co-transfected with lentiviral constructs psPAX2, pMD2.G and lentiviral vector via calcium phosphate co-precipitation. The medium was changed 24 hours after transfection, and virus was obtained 72 hours after transfection. The supernatant containing lentivirus was collected, centrifuged to remove cell debris, and then filtered through a 0.45 μm filter. Lentivirus was pelleted via standard ultracentrifugation and resuspended in cold PBS. FUW-GFP was used as a control to monitor GFP expression and calculate the multiplicity of infection before the virus titer (infectious units mL ^-1 ) was determined.

<Experimental Example 9> IGFBP3 overexpression

The entire polynucleotide sequence encoding IGFBP3 was inserted into the TA vector by PCR. Afterwards, an IGFBP3 overexpression lentiviral vector was created through ligation with an existing lentiviral vector. The lentiviral vector and the TA vector into which IGFBP3 cDNA was inserted were treated with EcoRI restriction enzyme, then ligated and used as an IGFBP3 overexpression vector. Lentivirus was prepared using the IGFBP3 overexpression vector prepared above, and it was transfected into cells to induce the expression of IGFBP3.

Example

<Example 1> Confirmation of Alzheimer's disease-related symptoms in induced neurons with induced APOE4 expression

To confirm whether the sAD phenotype appears when an AD neuron model was created by inducing APOE4 expression in induced neurons differentiated from fibroblasts derived from AD patients, 7 days after lentivirus infection of the induced neurons (early stage of amyloid formation) Expression of APOE4 was induced by treatment with doxycycline from day 14 (amyloid deterioration stage) to day 25, and from day 14 (amyloid deterioration stage) to day 25 (Figure 1A).

1-1. APOE4 protein expression level

As a result of confirming the APOE4 protein expression level by performing Western blot, it was confirmed that induced neurons differentiated from AD patient-derived fibroblasts did not express APOE4 protein before doxycycline treatment, but APOE4 protein was expressed after doxycycline treatment ( Figure 1B).

1-2. Expression of neuronal markers from induced neurons

As a result of confirming the expression of neuronal markers in the induced neurons by performing immunofluorescence staining, APOE4 expression was not induced in the induced neurons differentiated from AD patient-derived fibroblasts (-APOE4) or when APOE4 was induced in the amyloid exacerbation stage. (+APOE4, day 14), TUJ1+, NEUN+ markers (Figures 2A and 3A) and MAP2+, VGLUT1+ markers (Figures 2B and 3B) were expressed and neurons were efficiently generated, but neurons differentiated from fibroblasts derived from AD patients When APOE4 was induced in induced neurons at the early stage of amyloid formation (+APOE4, day 7), the number of TUJ1+, NEUN+ markers (Figures 2A and 3A) and MAP2+, VGLUT1+ markers (Figures 2B and 3B) decreased. Confirmed.

Accordingly, it was confirmed that neuronal production was inhibited when APOE4 was induced in the early stages of amyloid formation.

1-3. Amyloid-beta (Aβ)-42/40 ratio level

As a result of confirming the Aβ-42/40 ratio by performing ELISA analysis, APOE4 expression was not induced in induced neurons differentiated from fibroblasts derived from AD patients (-APOE4; Figure 4A), or when APOE4 was induced in the amyloid exacerbation stage. (+Dox, day 14; Figure 4C), there was no difference in the Aβ-42/40 ratio, but when APOE4 was induced in induced neurons differentiated from AD patient-derived fibroblasts at the early stage of amyloid formation (+Dox, day 7), there was no difference in the Aβ-42/40 ratio. Figure 4B) It was confirmed that the Aβ-42/40 ratio specifically increased. When the expression of APOE3, an APOE isoform, was induced in AD patient-derived neurons, it was confirmed that there was no significant effect on the Aβ-42/40 ratio depending on the stage of amyloid formation.

1-4. Amyloid oligomer levels

As a result of confirming the level of amyloid oligomers by performing Western blot, the level of amyloid oligomers was significantly low when APOE4 expression was not induced in induced neurons differentiated from fibroblasts derived from AD patients (-APOE4; Figure 5A), and the level of amyloid oligomers was significantly low in fibers derived from AD patients. When APOE4 was induced in induced neurons differentiated from blast cells at the early stage of amyloid formation (+APOE4, day 7; Figure 5B) and when APOE4 was induced at the amyloid worsening stage (+APOE4, day 14; Figure 5C), amyloid Oligomer levels increased. In particular, when APOE4 is induced at the early stage of amyloid formation on day 7, amyloid oligomers rapidly increase after 10 days, and when APOE4 is induced at the early stage of amyloid formation, the level of amyloid oligomers increases significantly compared to when induced at the amyloid deterioration stage. It was confirmed that

1-5. Hyperphosphorylation levels of tau protein

As a result of confirming the hyperphosphorylation level of tau protein by performing immunofluorescence staining, when APOE4 was induced in induced neurons differentiated from AD patient-derived fibroblasts at the early stage of amyloid formation (+APOE4, day 7), AD patient-derived fibers It was confirmed that the hyperphosphorylation level of tau protein was significantly increased compared to when APOE4 expression was not induced in induced neurons differentiated from blast cells (-APOE4) or when APOE4 was induced in the amyloid worsening stage (+APOE4, day 14) ( Figure 6).

From the results of Example 1, induced neurons differentiated from AD patient-derived fibroblasts show the sAD phenotype when APOE4 is induced at 7 days after lentivirus infection (early stage of amyloid formation), and do not induce APOE4 or lenti-induced It was confirmed that the sAD phenotype did not appear when APOE4 was induced 14 days after virus infection (amyloid exacerbation stage).

<Example 2> Pathological verification of Alzheimer's disease according to the period of amyloid formation in nerve cells with induced APOE4 expression

The doxycycline treatment period was adjusted for induced neurons differentiated from AD patient-derived fibroblasts, and the expression of APOE4 was induced by treating doxycycline from day 7 (early stage of amyloid formation) to day 14 after lentivirus infection, respectively (Figure 7 ), it was confirmed whether the sAD phenotype appears.

As a result of confirming the level of amyloid oligomers by performing Western blot, in both cases APOE4 was induced in the early stage of amyloid formation in induced neurons differentiated from fibroblasts derived from AD patients (+APOE4, day 7 in Figure 1A and day 7 in Figure 7 +APOE4, day 7-14), compared to when APOE4 expression was not induced in induced neurons differentiated from AD patient-derived fibroblasts (-APOE4) or when APOE4 was induced in the amyloid exacerbation stage (+APOE4, day 14) It was confirmed that the level of amyloid oligomers significantly increased (Figure 8).

Accordingly, it was confirmed that even if APOE4 was induced only on the 7th to 14th day after lentivirus infection, which is the early stage of amyloid formation, the level of amyloid oligomers increased and the sAD phenotype appeared.

<Example 3> Discovery of intermediaries for the APOE4 effect

Gene expression profiling was confirmed by performing transcriptome analysis of induced neurons differentiated from AD patient-derived fibroblasts in which APOE4 expression was induced in the early stage of amyloid formation and the amyloid worsening stage of Example 1.

As a result, a total of 203 DEGs (differentially expressed genes) were identified in the early stages of amyloid formation (Figure 9), and the overall gene expression pattern was confirmed graphically (Figure 10), showing the expression of 15 genes with large genetic expression differences. is shown as a heat map (Figure 11).

Among 15 genes with large genetic expression differences in the early stages of amyloid formation, the IGFBP3 gene was discovered as a mediator of the APOE4 effect.

<Example 4> Confirmation of improvement in sporadic Alzheimer's disease symptoms through inhibition of APOE4 effect mediator expression

4-1. Expression level of IGFBP3 in the early stages of amyloid formation

As a result of confirming the expression level of IGFBP3 mRNA by performing RT-PCR in the AD neuronal cell model in which APOE4 expression was induced in Example 1, APOE4 was induced in the induced neuronal cells differentiated from fibroblasts derived from AD patients at the early stage of amyloid formation. (+APOE4, day 7), it was confirmed that the expression level of IGFBP3 mRNA significantly increased over time compared to when APOE4 was induced in the amyloid worsening stage (+APOE4, day 14) (Figure 12A).

In addition, as a result of measuring the level of amyloid (6E10) oligomers in induced neurons derived from normal, AD patients with PSEN1 mutation or AD patients with PSEN2 mutation for 0, 5, 7, 10, and 25 days, direct cross-differentiation into induced neurons was found. On the 7th day, it was confirmed that the level of amyloid (6E10) oligomers significantly increased (Figure 19).

Accordingly, it was confirmed that the expression level of IGFBP3 specifically increased in the early stage of amyloid formation, and the initial stage of amyloid formation was specified to be 7 days after direct cross-differentiation into induced nerve cells.

4-2. Expression level of IGFBP3 in the early stages of amyloid formation

As a result of performing RT-PCR to confirm the expression level of IGFBP3 mRNA in fibroblasts derived from AD patients and induced neurons differentiated therefrom, there was no difference in the expression level of IGFBP3 mRNA between fibroblasts derived from AD patients, but APOE ε3/4 In induced neurons differentiated from fibroblasts derived from AD patients, the expression level of IGFBP3 mRNA was confirmed to be significantly increased (Figure 12B).

Accordingly, it was confirmed that the expression level of IGFBP3 was specifically increased in AD patients with APOE4.

4-3. Levels of amyloid formation upon inhibition of IGFBP3 expression in the early stages of amyloid formation

An shRNA targeting the IGFBP3 gene, which was discovered as a mediator of the APOE4 effect in Example 3, was produced, and this was produced from fibroblasts derived from AD patients in which APOE4 expression was induced in the early stage of amyloid formation and the amyloid worsening stage in Example 1. It was confirmed whether the sAD phenotype was improved by treating differentiated induced neurons.

As a result of confirming the level of amyloid formation by performing immunofluorescence staining, when APOE4 was induced in the induced neurons differentiated from fibroblasts derived from AD patients with PSEN1 mutation at the early stage of amyloid formation and treated with shRNA (+APOE4, day 7 +sh) IGFBP3), when APOE4 was induced in the amyloid worsening stage and treated with shRNA (+APOE4, day 14 +sh IGFBP3), the level of amyloid formation was confirmed to be significantly reduced compared to (Figures 13A and 16), AD patients with PSEN2 mutation The same results were confirmed in cell populations derived from (Figure 13B) and sAD (SDA) patients (Figure 13C).

As a result of quantifying the above results and confirming the number of amyloid puncta, induced nerves differentiated from fibroblasts derived from an AD patient with a PSEN1 mutation (Figure 14A), an AD patient with a PSEN2 mutation, and a sAD (SDA) patient (Figure 14B) When APOE4 was induced in the early stage of amyloid formation and treated with shRNA in all cells, the number of amyloid puncta was significantly reduced compared to when APOE4 was induced in the amyloid deterioration stage and treated with shRNA (Figures 14 and 17A). Conversely, when IGFBP3 was overexpressed, the number of amyloid puncta increased, confirming that targeting IGFBP3 could improve the sAD phenotype (Figure 17B).

In addition, it was confirmed that there was no significant difference in the number of amyloid puncta in the early stages of amyloid formation when treated with shRNA targeting PRKCA, PRUNE2, or SPON1 genes, which have large genetic expression differences in addition to the IGFBP3 gene (FIG. 15).

Accordingly, it was confirmed that the improvement of the sAD phenotype by gene regulation in the early stages of amyloid formation occurs specifically when targeting the IGFBP3 gene.

4-4. Hyperphosphorylation levels of tau protein upon inhibition of IGFBP3 expression in the early stages of amyloid formation.

shRNA targeting the IGFBP3 gene was treated with induced neurons differentiated from AD patient-derived fibroblasts, in which APOE4 expression was induced in the early stage of amyloid formation and the aggravating stage of amyloid in Example 1.

As a result of confirming the hyperphosphorylation level of tau protein by performing immunofluorescence staining, APOE4 was induced in induced neurons differentiated from AD patient-derived fibroblasts at the early stage of amyloid formation and treated with shRNA (+APOE4, day 7 +sh IGFBP3), when APOE4 was induced at the stage of amyloid deterioration and treated with shRNA, the hyperphosphorylation level of tau protein was confirmed to be significantly reduced compared to (+APOE4, day 14 +sh IGFBP3) (Figure 18).

Accordingly, it was confirmed that targeting the IGFBP3 gene in induced neurons differentiated from AD patient-derived fibroblasts in which APOE4 expression was induced in the early stages of amyloid formation could inhibit the formation of hyperphosphorylation of tau protein.

From the results of the above example, it was confirmed that inhibiting IGFBP3 in neurons expressing APOE4 in the early stages of amyloid formation can improve the sAD phenotype by reducing the level of amyloid formation, the number of amyloid puncta, and the hyperphosphorylation level of tau protein. , IGFBP3 inhibitors can be provided for the prevention, improvement or treatment of sAD.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be interpreted as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Sequence list electronic file attached

Claims (17)

A pharmaceutical composition for preventing or treating sporadic Alzheimer's disease, comprising an IGFBP3 inhibitor as an active ingredient.
The composition of claim 1, wherein the sporadic Alzheimer's disease develops when nerve cells express APOE4 in the early stages of amyloid formation.
The composition of claim 2, wherein the initial stage of amyloid formation is before synaptic damage appears due to accumulation of amyloid.
The composition of claim 1, wherein the IGFBP3 inhibitor targets the base sequence of SEQ ID NO: 2.
The composition of claim 1, wherein the IGFBP3 inhibitor is polynucleotide-based.
The composition of claim 5, wherein the IGFBP3 inhibitor is at least one selected from the group consisting of siRNA, shRNA, miRNA, antisense oligonucleotide, and aptamer.
The composition of claim 6, wherein the IGFBP3 inhibitor is shRNA.
The composition of claim 5, wherein the IGFBP3 inhibitor comprises the base sequences of SEQ ID NOs: 3 and 4.
The composition of claim 1, wherein the IGFBP3 inhibitor reduces the level of amyloid formation in nerve cells expressing APOE4 in the early stages of amyloid formation.
The composition of claim 1, wherein the IGFBP3 inhibitor reduces the number of amyloid puncta in nerve cells expressing APOE4 in the early stages of amyloid formation.
The composition of claim 1, wherein the IGFBP3 inhibitor reduces the hyperphosphorylation level of tau protein in nerve cells expressing APOE4 in the early stages of amyloid formation.
A method for preventing or treating sporadic Alzheimer's disease, comprising administering a pharmaceutical composition containing an IGFBP3 inhibitor as an active ingredient to a subject other than a human.
The method of claim 12, wherein the IGFBP3 inhibitor targets the base sequence of SEQ ID NO: 2.
The method of claim 12, wherein the IGFBP3 inhibitor is polynucleotide-based.
The method of claim 14, wherein the IGFBP3 inhibitor is at least one selected from the group consisting of siRNA, shRNA, miRNA, antisense oligonucleotide, or aptamer.
The method of claim 15, wherein the IGFBP3 inhibitor is shRNA.
The method of claim 14, wherein the IGFBP3 inhibitor comprises the base sequences of SEQ ID NOs: 3 and 4.