KR20240054473A - A composition for inhibiting senescence inducing transcriptional activation of Oct4 gene - Google Patents

Abstract

The present invention relates to an anti-aging composition that induces transcriptional activation of the Oct4 gene and its use.
The present invention relates to a CRISPR/dCas9 system targeting the Oct4 gene promoter, which induces transcriptional activation of the endogenous Oct4 gene, which induces reprogramming in cells and is associated with aging in vitro and in vivo. By improving the phenotype, aging-related diseases can be prevented, improved, or treated.

Description

Anti-aging composition that induces transcriptional activation of Oct4 gene {A composition for inhibiting senescence inducing transcriptional activation of Oct4 gene}

The present invention relates to an anti-aging composition that induces transcriptional activation of the Oct4 gene and its use.

Ultimately, differentiated somatic cells can be reprogrammed into pluripotent stem cells (induced pluripotent stem cells, iPSCs) through overexpression of the four Yamanaka factors Oct4, Sox2, Klf4 and c-Myc (OSKM). Numerous studies have demonstrated that cell fate can be altered by forced expression of the above factors, confirming the potential of approaches using cell reprogramming for the treatment of many diseases, and the potential of this approach for preventing aging has also been confirmed. there is. In particular, it has been reported that transient expression of OSKM can improve aging characteristics in cells and increase regenerative capacity.

However, transient expression of OSKM in vivo has been reported to induce tumorigenesis in various tissues (K. Ohnishi et al., Cell 156, 663-677, 2014), and Klf4 and c-Myc for cell reprogramming. It has been reported that there is a risk of causing teratoma formation during dedifferentiation when overexpression of the same factor (M. Abad et al., Nature 502, 340-345, 2013). In addition, expression of the ectopic Oct4 gene in the early stages of dedifferentiation reprogramming induces an indiscriminate transcriptome network, resulting in off-target reprogramming. For this reason, anti-aging technology based on cell reprogramming through expression of OSKM in vivo is a technology that still has significant limitations in terms of stability and efficiency.

Meanwhile, CRISPR-Cas9 technology is used to edit genome sequences using Cas9, a nuclease, but can also be used as a gene regulation tool that is sequence-specific and does not cause mutations. This repurposing is performed using dead Cas9 (dCas9), which lacks endonuclease activity (L. S. Qi et al., Cell 152, 1173-1183, 2013; S. Brezgin et al., Int J Mol Sci 20, 2019 ) was made possible by using a mutant Cas9 called ). Although dCas9 cannot cut DNA, it has the ability to bind to specific DNA guided by sgRNA (single guide RNA). Accordingly, the expression of the target gene can be directly controlled by combining dCas9, which can bind to the target gene, with proteins that have the function of regulating gene expression.

Under this background, the present inventors demonstrated that when the transcriptional activation of the endogenous Oct4 gene is induced using the CRISPR/dCas9 system targeting the Oct4 gene promoter, it efficiently and accurately induces reprogramming in cells, resulting in aging-related phenotypes in vitro and in vivo. By confirming that aging-related diseases can be prevented, improved, or treated by improving the present invention, the present invention was completed.

One object of the present invention is a guide RNA consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; and dCas9; to provide a CRISPR/dCas9 complex for increasing the activity of the Oct4 gene.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating aging-related diseases, comprising the CRISPR/dCas9 complex of the present invention as an active ingredient.

Another object of the present invention is to provide an anti-aging method comprising administering the pharmaceutical composition of the present invention to a subject.

Another object of the present invention is to provide a composition for inhibiting cellular aging, comprising the CRISPR/dCas9 complex of the present invention.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

One aspect of the present invention is a guide RNA consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; and dCas9; and provides a CRISPR/dCas9 complex for increasing the activity of the Oct4 gene.

In the present invention, the term “guide RNA (gRNA)” refers to a single-stranded RNA that finds the location of a specific target DNA and guides the Cas protein to the target DNA. The guide RNA is 10 strands of the target DNA. As an example, the guide RNA may include a sequence complementary to a base sequence of ~25bp, 1 to 3 additional nucleotides in front of the 5' region of the sequence that can form base pairs with the complementary chain of the target DNA sequence. More specifically, as another example, the guide RNA may have a sequence complementary to the sequence in the target DNA (also known as a spacer region, target DNA recognition sequence, base pairing region, etc.). business card) and a hairpin structure for Cas protein binding, for example, a portion having a sequence complementary to the sequence in the target DNA, a hairpin structure for Cas protein binding, and a terminator sequence. In the present invention, the guide RNA is a single-stranded guide RNA and may be used interchangeably with sgRNA (single guide RNA).

In the present invention, the guide RNA may target the Oct4 gene. As an example, the guide RNA may target the promoter region of the Oct4 gene. As another example, the guide RNA may target a region 59bp upstream from the start codon of the Oct4 gene.

Specifically, the guide RNA of the present invention may have, include, or consist of the base sequence of SEQ ID NO: 1, or may essentially consist of the amino acid sequence.

In the present invention, the term “Oct4 (Octamer-Binding Transcription Factor 4)” is a transcription factor also called POU5F1 (POU domain, class 5, transcription factor 1), which induces stemness in adult cells and pluripotency in induced pluripotent stem cells ( It is known to be an important factor in maintaining pluripotency.

In the present invention, Oct4 may have, include, or consist of the amino acid sequence shown in SEQ ID NO: 11, or may consist essentially of the amino acid sequence. Specifically, the Oct4 may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 11.

The sequence information of Oct4 can be obtained from GenBank of the National Center for Biotechnology Information (NCBI), a known database. In the present invention, the amino acid sequence of Oct4 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the amino acid sequence shown in SEQ ID NO: 11. , may include an amino acid sequence having more than 99.5%, 99.7%, or 99.9% homology or identity. In addition, if the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 11, the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.

For example, addition or deletion of sequences, naturally occurring mutations, silent mutations or conservation within the amino acid sequence at the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the protein of the present invention. This is the case with enemy substitution.

The term “conservative substitution” means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.

In the present invention, the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably.

The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing to all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with a polynucleotide containing a common codon or a codon taking codon degeneracy into account.

Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ed.,] Academic Press, San Diego, 1994, and [CARILLO ET AL/.] (1988) SIAM J Applied Math 48: 1073), BLAST, National Center for Biotechnology Information Database. Alternatively, homology, similarity, or identity can be determined using ClustalW.

Homology, similarity or identity of polynucleotides or polypeptides is defined in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. This can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a binary comparison matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

In the present invention, the polynucleotide encoding Oct4 may be the Oct4 gene. The Oct4 gene can be used interchangeably with the POU5F1 gene.

The polynucleotide encoding Oct4 of the present invention may include a base sequence encoding the amino acid sequence shown in SEQ ID NO: 11. As an example of the present invention, the polynucleotide encoding Oct4 of the present invention may have or include the sequence of SEQ ID NO: 12. Additionally, the polynucleotide encoding Oct4 of the present invention may consist of or consist essentially of the sequence of SEQ ID NO: 12. Specifically, the Oct4 may be encoded by the polynucleotide described in the base sequence of SEQ ID NO: 12.

The polynucleotide encoding the Oct4 gene of the present invention is encoded within the range that does not change the amino acid sequence of Oct4, taking into account codon degeneracy or the codon preferred in the organism in which the Oct4 gene of the present invention is to be expressed. Various modifications can be made to the area. Specifically, the polynucleotide encoding Oct4 of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, and at least 96% homology or identity with the sequence of SEQ ID NO: 12. It has or includes a base sequence that is at least 97%, at least 98%, or has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95% homology or identity with the sequence of SEQ ID NO: 12. % or more, 96% or more, 97% or more, or 98% or more base sequences, or may consist essentially of base sequences, but are not limited thereto.

In the present invention, the term “Cas9” refers to “CRISPR-Cas9,” and CRISPR-Cas9 is a third-generation gene scissors that recognizes, cuts, and edits specific base sequences to be used, and inserts specific genes into the target site of the genome. Sequence information of the Cas9 protein or gene can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI). In addition, the Cas9 protein may be appropriately linked to additional domains depending on its purpose.

Cas9 according to the present invention may be a mutant Cas9 without endonuclease activity, that is, “dead Cas9 (dCas9)”. Although dCas9 cannot cut DNA, it has the ability to bind to specific DNA guided by sgRNA. Accordingly, the expression of the target gene can be directly controlled by combining dCas9, which can bind to the target gene, with proteins that have the function of regulating gene expression.

In the present invention, dCas9 may have, include, or consist of the amino acid sequence shown in SEQ ID NO: 13, or may consist essentially of the amino acid sequence. Specifically, the dCas9 may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 13.

In the present invention, the amino acid sequence of dCas9 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the amino acid sequence shown in SEQ ID NO: 13. , may include an amino acid sequence having more than 99.5%, 99.7%, or 99.9% homology or identity. In addition, if the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 13, the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.

In the present invention, the polynucleotide encoding dCas9 may be the dCas9 gene.

The polynucleotide encoding dCas9 of the present invention may include a base sequence encoding the amino acid sequence shown in SEQ ID NO: 13. As an example of the present invention, the polynucleotide encoding dCas9 of the present invention may have or include the sequence of SEQ ID NO: 14. Additionally, the polynucleotide encoding dCas9 of the present invention may consist of or essentially consist of the sequence of SEQ ID NO: 14. Specifically, the dCas9 may be encoded by the polynucleotide shown in the base sequence of SEQ ID NO: 14.

The polynucleotide encoding the dCas9 gene of the present invention has various variations in the coding region within the range that does not change the amino acid sequence of dCas9, taking into account codon degeneracy or the codon preferred in organisms intended to express the dCas9 gene of the present invention. Transformations can occur. Specifically, the polynucleotide encoding dCas9 of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, and at least 96% homology or identity with the sequence of SEQ ID NO: 14. It has or includes a base sequence that is at least 97%, at least 98%, or has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95% homology or identity with the sequence of SEQ ID NO: 14. % or more, 96% or more, 97% or more, or 98% or more base sequences, or may consist essentially of base sequences, but are not limited thereto.

In the present invention, the CRISPR/dCas9 complex includes a guide RNA base sequence consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; and a polynucleotide encoding dCas9.

In the present invention, the term “vector” refers to DNA that can proliferate by introducing the desired DNA fragment into a host cell, and is also called a cloning vehicle. “Expression vector” refers to the desired coding sequence and a specific host cell. In the present invention, the vector may be used in the same sense as an expression vector.

The vector used in the present invention is not particularly limited as long as it can replicate within the host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used. , pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used, and as viral vectors, adeno-associated virus (AAV) vectors, adenovirus vectors, herpes virus vectors, retrovirus vectors, lentivirus vectors, and vaccinia vectors can be used. Niavirus vectors, poxvirus vectors, herpes simplex virus vectors, etc. can be used.

Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.

In the present invention, the term “transformation” refers to introducing a recombinant vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoding the polynucleotide can be expressed within the host cell. As long as the transformed polynucleotide can be expressed in the host cell, it can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome. The transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Examples include, but are not limited to, the lithium acetate-DMSO method.

In addition, the term "operably linked" as used herein means that the polynucleotide sequence is functionally connected to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present invention. do. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.

In the present invention, the CRISPR/dCas9 complex of the present invention can increase the intrinsic transcriptional activity of the Oct4 gene compared to the intrinsic transcriptional activity of the wild-type Oct4 gene.

The CRISPR/dCas9 complex of the present invention can increase the expression of endogenous Oct4 by increasing the endogenous transcriptional activity of the Oct4 gene.

In one embodiment of the present invention, 10 candidate sgRNAs targeting the Oct4 distal or proximal promoter region were designed to induce endogenous Oct4 activation by the CRISPR/dCas9 activation system (Table 1), and cells were incubated with each sgRNA. As a result of transfection with the dCas9-activator vector, endogenous Oct4 activation was induced (Figure 1b), and the induction of Oct4 activation was confirmed through Western blot (Figures 1c and d).

In particular, Oct4 activation occurs in cells transformed with a dCas9-activator vector containing #10 sgRNA (SEQ ID NO: 1) targeting a region 59bp upstream from the start codon of the Oct4 gene, when transformed with a dCas9-activator vector containing a different sgRNA. It was confirmed that there was a significant increase compared to the cells (Figure 1b).

In the present invention, the CRISPR/dCas9 complex of the present invention may have an inhibitory effect on cellular aging.

The term "aging" of the present invention is a concept that generally encompasses the phenomenon of deteriorating changes that occur as the structure and function of the body deteriorates with age. Changes due to aging include the weight and weight of each tissue due to a decrease in the number of parenchymal cells. Loss of body weight, change in connective tissue, change in body composition, decrease in elasticity of blood vessels and skin, decrease in the function of each organ, decrease in anti-disease recovery ability including immune ability, decrease in sensory function, cognitive function, memory, learning ability, etc. There are many reasons, including a decrease in comparative ability.

“Ageing inhibition” of the present invention refers to any act of suppressing or preventing or improving or delaying the above-described aging symptoms by administering the composition of the present invention, and specifically, the above-described aging-related parameters, such as symptoms of It refers to all actions that at least reduce the degree, and includes actions in which aging symptoms are improved, alleviated, or beneficially changed by administration of the composition of the present invention. Additionally, the above term may be used interchangeably with “anti-aging.” The “inhibition of aging” may also be expressed as “treating aging” and also includes treatment and/or improvement of diseases related to aging.

The cellular aging inhibition effect according to the present invention includes increasing the intrinsic transcriptional activity of the Oct4 gene; And/or it may be achieved by increasing the expression of endogenous Oct4.

The cellular aging inhibition effect may be any one or more effects selected from the following:

i) reduced expression levels of aging-related genes;

ii) reduced levels of DNA double-strand breaks;

iii) reduced apoptosis; and

iv) Age-related decrease in the number of beta-galactosidase positive cells.

The aging-related gene of i) may be any one or more selected from the group consisting of a stress response gene, an extracellular matrix (ECM) remodeling gene, a Senescence-Associated Secretory Phenotype (SASP) gene, and an aging-related gene.

Examples of the stress response genes include Ccl8, p16, p21, Btg2, and Atf, but are not limited thereto.

The ECM remodeling genes may be, for example, MMP12, MMP13, and IL-6, but are not limited thereto.

The SASP gene may be, for example, Cdkn2a, Cdkn1a, and IL-a, but is not limited thereto.

With regard to i) reducing the expression level of aging-related genes, in one embodiment of the present invention, the aging-related genes Ccl8, IL-6, Cdkn2a, Btg2, Atf3, MMP12, MMP13, p16 and p21 in aged fibroblasts. The expression level of was significantly increased, but was recovered by introduction of the dCas9-activator vector (Figure 2e).

From this, it can be seen that the dCas9-activator vector can efficiently improve aging-related molecular phenotypes by activating endogenous Oct4 activation in aging fibroblasts.

Regarding the above ii) reduction in the level of DNA double-strand breaks, in one embodiment of the present invention, the phosphorylation level of the histone marker γ-H2AX was analyzed to evaluate the level of DNA double-strand breaks associated with cellular aging, and the results showed that the histone marker γ The phosphorylation level of -H2AX was significantly reduced by introduction of the dCas9-activator vector (Figure 2b). In addition, the number of cells with phosphorylated histone marker γ-H2AX or abnormal nuclei was also significantly reduced by endogenous Oct4 activation by introduction of the dCas9-activator vector (Figures 2c and 2d).

In another embodiment of the present invention, dCas9-containing #10 sgRNA that induces Oct4 gene transcriptional activation and #6 sgRNA that does not induce Oct4 gene transcriptional activation, respectively, in cells transformed with lentivirus overexpressing progerin. As a result of confirming the phosphorylation level of the histone marker γ-H2AX by introduction of the activator vector, cells introduced with the dCas9-activator vector containing #10 sgRNA were more abnormal than cells introduced with the dCas9-activator vector containing #6 sgRNA. decreased (Figure 3).

Accordingly, the dCas9-activator vector containing #10 sgRNA (SEQ ID NO: 1) targeting a region 59bp upstream from the start codon of the Oct4 gene is significantly more effective than the dCas9-activator vector containing sgRNA targeting the promoter region of other Oct4 genes. It can be seen that it has the effect of reducing the level of DNA double strand breaks and inhibits cell aging.

Regarding the above iii) reduction of apoptosis, in one embodiment of the present invention, endogenous Oct4 activation was increased by introduction of the dCas9-activator vector, and the number of apoptotic cells in senescent fibroblasts was significantly reduced compared to the control group ( Figures 2f and 2g).

Regarding the above iv) decrease in the number of senescence-related beta galactosidase-positive cells, in one embodiment of the present invention, endogenous Oct4 activation is increased by introduction of a dCas9-activator vector, thereby increasing senescence-related beta galactosidase in senescent fibroblasts. The number of positive cells was significantly reduced compared to the control group (Figures 2h and 2i).

In the present invention, the CRISPR/dCas9 complex of the present invention may be combined with one or more selected from inorganic nanoparticles or organic nanoparticles.

The inorganic nanoparticles may be metal nanoparticles, but are not limited thereto. For example, the metal nanoparticles may be gold, silver, iron, platinum, copper, zinc, tin, ruthenium, rhodium, gadolinium, dysprosium, manganese, titanium, palladium, and chromium, and may specifically be gold nanoparticles. , but is not limited to this.

The organic nanoparticles may be cationic polymers, but are not limited thereto.

For example, the cationic polymers include polyethyleneimine (PEI), chitosan, gelatin, collagen, poly-L-lysine, poly-L-histidine, poly-L-arginine, hyaluronic acid, polygamma glutamic acid, alginate, carboxyalkyl Cellulose, glycogen, amylose, dextran, poly(meth)acrylic acid, pullulan, beta-glucan, starch, hydroxy(alkyl)cellulose, polyvinylpyrrolidone, polyethylene glycol, polyvinyl alcohol, polyvinyl alkyl ether. , polyaminoalkyl (meth)acrylate, polylactic acid, polyglycolic acid, polylactic glycolic acid, polycaprolactone, and copolymers thereof, and may specifically be polyethyleneimine, but is not limited thereto.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating aging-related diseases, comprising the CRISPR/dCas9 complex of the present invention as an active ingredient.

The terms used here are the same as described above.

In the present invention, the term “aging-related disease” refers to a disease that induces premature aging or a disease induced by aging.

In the present invention, diseases that induce premature aging include, for example, Hutchinson Guilford progeria syndrome (HGPS), premature aging associated with HIV infection, muscle dystrophy, and Charcot-Marie-Tooth disease. -Tooth disease, Werner syndrome, insulin resistance type II diabetes, osteoporosis, skin aging and restrictive dermopathy, etc., but are not limited to these, and include pathological features of premature aging. Any disease can be included. Specifically, the disease that induces premature aging may be Hutchinson-Gilford Progeria Syndrome, but is not limited thereto.

In the present invention, diseases induced by aging include, for example, arteriosclerosis, hypertension, sarcopenia, dry eye, macular degeneration, hyperopia, myopia, cataracts, tinnitus, hearing loss, indigestion, diarrhea, autoimmune disease, and pneumonia. , influenza, tetanus, infectious endocarditis, pneumonia, flu, tetanus, infectious endocarditis, cancer, overactive bladder, urinary incontinence, benign prostatic hyperplasia, lower urinary tract symptoms, glomerulonephritis, chronic renal failure, stroke, osteoporosis, arthritis, diabetes, renal failure, chronic obstructive pulmonary disease. It may include, but is not limited to, disease and pulmonary fibrosis, and any disease that includes pathological characteristics caused by aging may be included. Specifically, the disease induced by aging may be a disease induced by aging of vascular endothelial cells, and more specifically, may be arteriosclerosis, but is not limited thereto.

In the present invention, the term "prevention" refers to any action that suppresses or delays the onset of an age-related disease by administering the composition, and "treatment" refers to improving symptoms caused by an age-related disease or improving symptoms by administering the composition. It refers to all actions that are beneficially changed.

In the present invention, the term "improvement" refers to any action that improves or benefits the symptoms of an individual suspected of or suffering from an age-related disease using the composition.

The pharmaceutical composition of the present invention may further include appropriate carriers, excipients, or diluents commonly used in the preparation of pharmaceutical compositions. At this time, the content of the active ingredient included in the pharmaceutical composition is not particularly limited, but may include 0.0001% by weight to 10% by weight, specifically 0.001% by weight to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition may be any selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. It may have a single dosage form, or may have several oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain one or more compounds and at least one excipient, such as starch, calcium carbonate, sucrose, or lactose ( It is prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurel, glycerogelatin, etc. can be used.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

In the present invention, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the individual, age, gender, and severity of the disease. It can be determined based on factors including the type, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but for desirable effects, the pharmaceutical composition of the present invention is administered at 0.0001 to 500 mg/day. It may be better to administer in kg, specifically 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered several times. The pharmaceutical composition can be administered to various mammals such as rats, livestock, and humans by various routes, and the method of administration includes without limitation any method conventional in the art, for example, orally, rectally, or intravenously. It may be administered by intramuscular, subcutaneous, intrauterine, intrathecal, or intracerebrovascular injection.

In addition, the pharmaceutical composition of the present invention can be used not only in the form of a medicine for humans, but also in the form of an animal medicine. Here, animals are a concept that includes livestock and companion animals.

In the present invention, the CRISPR/dCas9 complex of the present invention may have the effect of improving aging-related diseases.

The effect of improving the age-related disease may be any one or more effects selected from the following:

i) Reduce spinal curvature;

ii) inhibiting weight loss;

iii) increased lifespan; and

iv) Inhibition of vascular aging.

In one embodiment of the present invention, when AuNPs/dCas9-activator/PEI nanocomposite was injected into HGPS model mice showing progeria, the appearance of the mice was significantly improved after injection, including a decrease in spinal curvature compared to the control group (Figure 4c). , it was confirmed that weight loss was suppressed (Figure 4d) and lifespan increased (Figure 4e).

In the present invention, the aging-related disease may include a disease that induces premature aging or a disease induced by aging.

The disease that induces premature aging is as described above, and may specifically be Hutchinson-Gilford Progeria Syndrome, but is not limited thereto.

The diseases induced by aging are as described above. Specifically, the diseases induced by aging may be diseases induced by aging of vascular endothelial cells, and more specifically, may be arteriosclerosis, but are limited thereto. It doesn't work.

In any one of the above-described embodiments, the CRISPR/dCas9 complex of the present invention may have the effect of improving vascular aging or diseases induced by vascular endothelial cell aging.

The disease induced by vascular aging or vascular endothelial cell aging may specifically be arteriosclerosis, but is not limited thereto.

The improvement in arteriosclerosis may be achieved by one or more of the following effects:

i) reduced degeneration of vascular smooth muscle cells;

ii) decreased adventitial thickness of the aorta; and

iii) Reduced expression levels of aging-related genes in the aorta.

In one embodiment of the present invention, when AuNPs/dCas9-activator/PEI nanocomposite was injected into HGPS model mice showing progeria, degeneration of vascular smooth muscle cells (VSMC) in mice was reduced compared to the control group ( Figure 4f and g). The adventitia and central thickness phenotypes of the aorta were restored (Figures 4h and i).

In another embodiment of the present invention, as a result of injecting AuNPs/dCas9-activator/PEI nanocomplex into HGPS model mice showing progeria, aging-related genes Ccl8, IL-6, Cdkn2a, Btg2, and Atf3 were increased in the mouse aorta compared to the control group. , the expression levels of MMP12, MMP13, p16, and p21 were restored (Figure 6).

Ultimately, differentiated somatic cells can be reprogrammed into pluripotent stem cells (induced pluripotent stem cells, iPSCs) through overexpression of the four Yamanaka factors Oct4, Sox2, Klf4 and c-Myc (OSKM). Numerous studies have demonstrated that cell fate can be altered by forced expression of these factors, confirming the potential of approaches using cell reprogramming for the treatment of many diseases. In particular, it has been reported that transient expression of OSKM can improve aging characteristics in cells and increase regenerative capacity.

However, transient expression of OSKM in vivo has been reported to induce tumorigenesis in various tissues (K. Ohnishi et al., Cell 156, 663-677, 2014), and Klf4 and c-Myc for cell reprogramming. It has been reported that there is a risk of causing teratoma formation during dedifferentiation when overexpression of the same factor (M. Abad et al., Nature 502, 340-345, 2013). In addition, expression of the ectopic Oct4 gene in the early stages of dedifferentiation reprogramming induces an indiscriminate transcriptome network, resulting in off-target reprogramming. For this reason, anti-aging technology based on cell reprogramming through expression of OSKM in vivo is a technology that still has significant limitations in terms of stability and efficiency.

Accordingly, the present invention relates to a CRISPR/dCas9 system targeting the Oct4 gene promoter, which induces transcriptional activation of the endogenous Oct4 gene, in vitro and without the side effects of tumor or teratoma formation due to expression or overexpression of the above-mentioned OSKM. It is significant that it is the first to confirm the effect of improving aging-related phenotypes in vivo.

In one embodiment of the present invention, as a result of confirming whether tumors are formed upon activation of endogenous Oct4 activation through tail-vein injection of AuNPs/dCas9-activator/PEI nanocomplex in HGPS model mice showing progeria, the mice lost weight after injection. and lifespan did not differ from the control group (Figures 5a and 5b), and no tumors were observed, but tumors were confirmed to be formed in several organs in exogenously induced OSKM mice (Figures 5c and 5d). In addition, RT-qPCR analysis results confirmed that tumor-related genes were not induced in the liver of mice after injection, but tumor-related genes were induced in exogenously induced OSKM mice (Figure 5e).

In another embodiment of the present invention, as a result of confirming whether a dysplastic phenotype is induced upon activation of endogenous Oct4 activation through tail-vein injection of AuNPs/dCas9-activator/PEI nanocomplex in HGPS model mice showing progeria, AuNPs/dCas9 Since administration of the -activator/PEI nanocomplex transiently induced endogenous Oct4 activation in vivo, no specific dysplastic phenotype was observed in mice after injection (Figure 5f).

From this, it can be seen that partial reprogramming following in vivo administration of the AuNPs/dCas9-activator/PEI nanocomposite is safe as it does not cause tumor formation or dysplastic growth.

Another aspect of the present invention provides an anti-aging method comprising administering the pharmaceutical composition of the present invention to a subject.

The terms used here are the same as described above.

The method of the present invention may be a method of preventing or treating diseases that induce premature aging or diseases induced by aging.

As described above, the CRISPR/dCas9 complex of the present invention has an anti-aging effect and/or an effect of improving diseases that induce premature aging or diseases induced by aging, and a pharmaceutical composition containing the same can prevent or prevent aging. It can be used for the purpose of preventing, improving, or treating diseases that induce premature aging or diseases induced by aging.

The disease that induces premature aging may be, but is not limited to, Hutchinson-Gilford Progeria Syndrome. This is the same as described above.

The disease induced by aging may be a disease induced by aging of vascular endothelial cells, and more specifically, may be arteriosclerosis, but is not limited thereto. This is the same as described above.

In the present invention, the term “individual” may mean any animal, including humans. The animal may be not only a human, but also a mammal such as a cow, horse, sheep, pig, goat, camel, antelope, dog, or cat that requires treatment for similar symptoms. It may also refer to animals other than humans, but is not limited thereto.

In the present invention, the term "administration" means introducing the pharmaceutical composition of the present invention into a subject suspected of having an age-related disease by any appropriate method, and the route of administration is various oral or parenteral routes as long as it can reach the target tissue. It can be administered through.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount, as described above.

The pharmaceutical composition of the present invention is not particularly limited and can be applied to any entity as long as it is intended to prevent or treat aging-related diseases. For example, non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds and fish can be used, and the pharmaceutical composition can be administered parenterally, subcutaneously, etc. It can be administered intraperitoneally, intrapulmonaryly and intranasally, and for topical treatment, if necessary, by any suitable method, including intralesional administration. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. For example, it may be administered orally, rectally, or by intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection, but is not limited thereto.

Another aspect of the present invention provides a health functional food composition for preventing or improving aging-related diseases, comprising a CRISPR/dCas9 complex.

Another aspect of the present invention provides a health functional food composition for inhibiting aging, comprising a CRISPR/dCas9 complex.

The terms used here are the same as described above.

The composition of the present invention may be used to prevent or improve diseases that induce premature aging or diseases induced by aging.

As described above, the CRISPR/dCas9 complex of the present invention has an anti-aging effect and/or an effect of improving diseases that induce premature aging or diseases induced by aging, and a pharmaceutical composition containing the same can prevent or prevent aging. It can be used for the purpose of improving, preventing or improving diseases that induce premature aging or diseases induced by aging.

The disease that induces premature aging may be, but is not limited to, Hutchinson-Gilford Progeria Syndrome. This is the same as described above.

The disease induced by aging may be a disease induced by aging of vascular endothelial cells, and more specifically, may be arteriosclerosis, but is not limited thereto. This is the same as described above.

The health functional food of the present invention can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and components commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a food. The health functional food composition of the present invention can be manufactured in various formulations, and unlike general drugs, it is made from food and has the advantage of not having any side effects that may occur when taking the drug for a long period of time. It is also highly portable and can be used on a daily basis. It is very useful because it can be ingested, and it can be ingested as a supplement to inhibit, prevent, improve or delay aging.

The health functional food is an essential ingredient and there are no particular restrictions on other ingredients other than the CRISPR/dCas9 complex. Like ordinary health functional foods, it may contain various herbal extracts, food supplements, or natural carbohydrates as additional ingredients. In addition, the food auxiliary additives include food auxiliary additives common in the art, such as flavoring agents, flavors, colorants, fillers, stabilizers, etc.

Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. In addition to the above-mentioned flavoring agents, natural flavoring agents (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

In addition to the above ingredients, the health functional food composition of the present invention contains various nutrients, vitamins, water (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid, and salts thereof. , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated drinks, and other natural fruit juices, fruit juice drinks and vegetables. May contain pulp for the manufacture of beverages. These ingredients can be used independently or in combination. In addition, health functional foods are any form of meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, gum, ice cream, soup, beverages, tea, functional water, drinks, alcoholic beverages, and vitamin complexes. It can be.

In addition, the above-mentioned health functional food may additionally contain food additives, and its suitability as a “food additive” is determined in accordance with the general provisions of the Food Additives Code and General Test Methods approved by the Food and Drug Safety Administration, unless otherwise specified. Judgment is made according to specifications and standards.

At this time, in the process of manufacturing health functional foods, the content of the composition added to food can be appropriately adjusted as needed.

Another aspect of the present invention provides an injectable composition for preventing or treating aging-related diseases, comprising a CRISPR/dCas9 complex.

The terms used here are the same as described above.

The composition of the present invention may further include any suitable excipients commonly used in injectable compositions, such as preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents, or isotonic agents, etc. It is not limited to this.

Another aspect of the present invention provides a composition for inhibiting cellular aging, comprising a CRISPR/dCas9 complex.

The terms used here are the same as described above.

The inhibition of cellular aging may be ex vivo, in vivo, or in vitro.

The composition may inhibit cellular aging ex vivo, in vivo, or in vitro. For example, the composition may inhibit cellular aging ex vivo or in vitro, but is not limited thereto.

The present invention relates to a CRISPR/dCas9 system targeting the Oct4 gene promoter, which induces transcriptional activation of the endogenous Oct4 gene, which induces reprogramming in cells and is associated with aging in vitro and in vivo. By improving the phenotype, aging-related diseases can be prevented, improved, or treated.

Figure 1 shows data verifying the induction of transcriptional activation of the Oct4 gene using the CRISPR/dCas9 system targeting the Oct4 gene promoter. (a) is a diagram illustrating the process of inducing transcriptional activation of the Oct4 gene using the CRISPR/dCas9 system targeting the Oct4 gene promoter. (b) is the result confirming through qRT-PCR that the mRNA level of the Oct4 gene increases after treatment with the CRISPR/dCas9 system targeting the Oct4 gene promoter in mouse fibroblasts. (d) and (e) are the results of Western blot confirmation that the intracellular Oct4 protein expression level increases after treatment with the CRISPR/dCas9 system targeting the Oct4 gene promoter in various mouse fibroblasts. (g) shows the results of qRT-PCR analysis of transcriptional activation of 10 off-target sites (Table 3) that can be targets of the Oct4 sgRNA sequence.
Figure 2 shows data verifying that aging-related phenotypes are improved in aged cells by expressing Oct4 using the CRISPR/dCas9 system targeting the Oct4 gene promoter. (a) is a diagram simulating the experimental process of treating aged cells with the CRISPR/dCas9 system targeting the Oct4 gene promoter. (b) By treating aged cells with the CRISPR/dCas9 system targeting the Oct4 gene promoter, the number of cells labeled with p-γH2AX decreases, and the number of cells with abnormal nuclear shapes decreases through immunofluorescence staining. This is the confirmed result, and (c) and (d) are data quantifying this. (e) is the result confirming through qRT-PCR that the level of aging-related gene RNA decreases when aged cells are treated with the CRISPR/dCas9 system targeting the Oct4 gene promoter. (f) is the result confirming through immunofluorescence staining that the number of cells labeled with cleaved caspase-3 decreases when aged cells are treated with the CRISPR/dCas9 system targeting the Oct4 gene promoter, and (g) is the quantification of this. It's data. (h) is the result confirming that the number of cells showing β-galactosidase activity decreases when aged fibroblasts are treated with the CRISPR/dCas9 system targeting the Oct4 gene promoter, and (i) is data quantifying this. .
Figure 3 shows data confirming the phosphorylation level of the histone marker γ-H2AX by introduction of the dCas9-activator vector containing #10 sgRNA that induces Oct4 gene transcriptional activation and #6 sgRNA that does not induce Oct4 gene transcriptional activation.
Figure 4 shows data verifying that aging-related symptoms are alleviated in HGPS (Hutchinson-Gilford Progeria Syndrome) model mice, which are premature aging mice, through the CRISPR/dCas9 system targeting the Oct4 gene promoter. (a) is a diagram illustrating the process of alleviating aging-related symptoms in the aorta of the mouse heart after inducing transcriptional activation of the Oct4 gene by injecting the CRISPR/dCas9 system targeting the Oct4 gene promoter into a premature aging mouse model. (b) shows the results of confirming the transcriptional activation level of the Oct4 gene in the mouse heart aorta through qRT-PCR after inducing Oct4 gene transcriptional activation by injecting the CRISPR/dCas9 system targeting the Oct4 gene promoter. (c) is the result of confirming the degree of spine curvature after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (d) and (e) are the results confirming that the lifespan of prematurely aged mice increases and weight loss is improved over time after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (f) is the result of confirming the number of cells labeled with α-SMA (Alpha Smooth Muscle Actin) in the cardiac aorta of prematurely aging mice using immunofluorescence staining, and (g) is data quantifying this. (h) is the result confirming through H&E staining that the vascular adventitia thickness is reduced in the cardiac aorta after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter, and (i) is data quantifying this. (j) Data confirmed through Western blot that the level of H3K9me3 increases and the level of H4K20me3 decreases in the cardiac aorta after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter.
Figure 5 shows data verifying tumor formation through the CRISPR/dCas9 system targeting the Oct4 gene promoter. (a) This is the result of measuring the body weight of control, tetO-OSKM, and sgOct4-treated wild-type mice 7 weeks after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (b) This is the result of measuring the survival rate of control, tetO-OSKM, and sgOct4-treated wild-type mice after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (c) and (d) Data showing that primary tumor formation (arrow) was not observed in mice after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (e) Data confirming the levels of tumor-related genes in tetO-OSKM and sgOct4 treated mice through RT-qPCR analysis after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter. (f) Data showing representative cross sections of the liver, kidney, and skin of mice 5 months after sgCtrl or sgOct4 treatment.
Figure 6 shows data confirming the levels of aging-related genes in the aorta of mice through RT-qPCR analysis after injection of the CRISPR/dCas9 system targeting the Oct4 gene promoter.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the embodiments according to the present invention may be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Experiment example

<Experimental Example 1> Vector production

To construct a dCas9-activator vector for Oct4 activation using the CRISPR/dCas9 system, the PB-UniSAM (Addgene, #99866) vector was linearized through BbsI treatment at 37°C for 2 hours. Two complementary single-stranded oligonucleotides were then made into double-strands by annealing 3 μl of each oligo using T4 PNK (NEB) in a 10 μl reaction volume. Ten types of Oct4 sgRNA (single guide RNA) (#1-10 sgRNA) shown in Table 1 below were produced using the annealing method described above. Table 1 below shows the sense strand of each sgRNA.

A dCas9-activator vector was constructed by ligating 50 ng of the linearized PB-UniSAM vector to 7 ㎕ of each sgRNA prepared above using ligation buffer. After transforming NIH/3T3 cells and tail-tip fibroblasts (TTFs) with the vector, it was confirmed whether the vector was introduced through Sanger sequencing.

sequence number sgRNA sequence name ~TSS
(transcription start sites) Sequence (5'->3') One #10 sgOct4 ~59 AAAGACGGCTCACCTAGGGA 2 #1 sgOct4 ~2348 ATTATACTCTAGGCACGCTT 3 #2 sgOct4 ~2188 CTGCAGGCATACTTGAACTG 4 #3 sgOct4 ~1778 GGGGATGAGCTTGGACCATG 5 #4 sgOct4 ~1300 CAGTCTGAGGTCCCATTAC 6 #5 sgOct4 ~1207 TAGTGTCTTTCCGCCAGCAC 7 #6 sgOct4 ~486 TATCTAGGACTCTAGACGGGG 8 #7 sgOct4 ~196 AACCTCCGTCTGGAAGACAC 9 #8 sgOct4 ~160 TGTGGGGGTGGGAGAAAACTG 10 #9 sgOct4 ~136 CTCTGCTCCTCCACCCACCC

<Experimental Example 2> Production of CRISPR/dCas9 system delivery complex

A complex of gold nanoparticles (AuNPs) modified with six different thiol ligands (RRRGYC) and cationic polyethyleneimine (PEI) conjugated to the dCas9-activator vector was used for gene delivery (Y. Chang et al. al., Biomaterials 192, 500-509, 2019). AuNPs/dCas9-activator/PEI nanocomposite (5 μg ligand-modified AuNPs, 1 μg dCas9-activator vector, and 3 μg PEI) was prepared in a total volume of 50 μl.

NIH/3T3 cells and tail tip fibroblasts were cultured with AuNPs/dCas9-activator/PEI nanocomposite at 37°C for 4 hours, then the medium was changed to DMEM medium (Gibco) containing 10% fetal bovine serum (FBS). It was replaced.

<Experimental Example 3> Production of mouse model and injection of CRISPR/dCas9 system delivery complex

HGPS (Hutchinson-Gilford Progeria Syndrome) model mice with the G608G laminA/C mutation (The Jackson Laboratory, stock number 101667) or wild-type C57BL/6 male mice (Korea Research Institute of Bioscience and Biotechnology) were used. All mice had free access to food and water, and were maintained under 12-hour/12-hour light/dark cycle conditions at 23 ± 1°C. Five-month-old control and HGPS male mice were anesthetized with tribromoethanol (Avertin, 120 mg/kg), and AuNPs/dCas9-activator/PEI nanocomplex diluted in 0.9% saline solution was injected into the tail vein. After injection, mice were kept warm until fully recovered from anesthesia. Two weeks after the first injection, the AuNPs/dCas9-activator/PEI nanocomposite was injected a second time. Biochemical and histological analysis was performed 2 months after the second injection.

<Experimental Example 4> Cell culture

All cells were cultured in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin (P/S) at 37°C and 5% CO ₂ conditions. Tail tip fibroblasts were isolated from transgenic mice expressing enhanced green fluorescent protein (eGFP) under the control of the mouse Oct4 locus (Oct4-eGFP mice). 1-2 mm sections of the tail tip were obtained from mice and washed in 70% ethanol for 30 seconds. Tissues were washed with fresh phosphate-buffered saline (PBS), minced in 10 cm tissue culture dishes using a sterile razor blade, and cultured with 0.25% trypsin (Gibco) containing ethylene-diamine-tetraacetic acid (EDTA) for 30 minutes at 37°C. Incubated for minutes.

<Experimental Example 5> RNA isolation and RT-qPCR

All RNA was collected and purified using the eCube tissue RNA mini kit (Philekorea) according to the manufacturer's instructions. RNA was then reverse transcribed into cDNA using AccuPower® CycleScript RT PreMix (Bioneer, #K-2044-B). RT-qPCR analysis was performed using AccuPower® PCR PreMix (Bioneer, #K-2016) with the primers in Table 2 below. All reactions were performed using the Rotor-Gene Q real-time PCR cycler (Qiagen).

sequence number sequence name Sequence (5' - > 3') 15 Oct4 Forward Primer TGG AGG AAG CCG ACA ACA AT 16 Oct4 Reverse Primer AGC TGA TTG GCG ATG TGA GT

<Experimental Example 6> Western Blot

Cells and tissues were mixed with RIPA buffer (50 mmol/L Tris, pH 8.0, Sigma-Aldrich containing 1% NP-40, 0.5% sodium deoxycholate (DOC), 0.1% SDS, and 150 mmol/L NaCl) and 1x protease inhibitors. It was homogenized. Next, the samples were mixed with 5x loading buffer and boiled at 100°C for 10 min. 10 ug of extracted protein was separated by SDS-PAGE on a 12% polyacrylamide gel and transferred to a nitrocellulose membrane (10600001, GE Healthcare). Protein concentration was quantified using the Quick Start Bradford protein assay (Bio-Rad). Membranes were blocked in 5% bovine serum albumin (BSA) and incubated with primary antibodies overnight at 4°C. The membrane was washed three times with TBS (Tris-buffered saline) containing 0.1% Triton-X100 and then incubated with secondary antibodies for 2 hours at room temperature. Each protein band was visualized using an ECL kit (DG-WF200; Dogen) and quantified using ImageJ (NIH) software. Antibodies used were anti-H3K9me3 (abcam, #ab8898), anti-H4K20me3 (abcam, #ab78517), anti-Oct4 (abcam, #ab18976, santacruz, #sc-5279) and anti-β actin (abfrontier, #LF). -PA0207), and β-actin was used as a loading control.

<Experimental Example 7> Immunofluorescence staining

Cells were transformed with the dCas9-activator vector and cultured in a 24-well plate for 24 hours. For immunofluorescence staining, cells were washed with PBS, treated with 4% paraformaldehyde, and fixed for 10 minutes at room temperature. After washing twice with PBS, the cells were blocked with PBS containing 3% BSA and 0.1% Triton X-100 at room temperature for 3 hours. Primary antibodies were used at the dilution recommended by the manufacturer. Cells were stained with mouse anti-Oct4 (Santacruz), rabbit anti-phospho-gammaH2AX (Santacruz), rabbit anti-cleaved caspase-3 (Santacruz), or α-SMA (Alpha Smooth Muscle Actin) for 24 hours at 4°C. , incubated with secondary antibodies conjugated with Alexa488 or Alexa 594 (Invitrogen), and stained with DAPI (4',6-diamidino-2-phenylindole). Cell counts in 10 randomly selected fields on the plate were calculated at 200X magnification using a versatile confocal microscope (LSM-800, Zeiss).

<Experimental Example 8> Lentiviral vector production

A lentiviral vector containing mouse complementary DNA (cDNA) for FUW-TetO-mutant laminA/C (LMNA) and overexpressing Progerin was constructed. HEK293T cells were cultured in DMEM medium containing 10% FBS and 1% P/S. The day before transfection, 2X10 ⁷ cells were seeded in a 15 cm culture dish containing medium. The next day, cells were cotransfected with lentiviral constructs psPAX2, pMD2.G, and FUW-tetO-mutant LMNA via calcium phosphate co-precipitation. The medium was replaced 24 hours after transfection, and virus was obtained 72 hours after transfection. The supernatant containing lentivirus was collected, centrifuged to remove cell debris, and then filtered through a 0.45 μm filter. Lentivirus was pelleted via standard ultracentrifugation and resuspended in cold PBS. FUW-GFP was used as a control to monitor GFP expression and calculate the multiplicity of infection before the virus titer (infectious units mL ^-1 ) was determined.

<Experimental Example 9> Transfection

The day before transfection, cells were seeded at 75-80% density on the plate. Three consecutive transfections were performed for 72 hours using Lipofectamine 3000 reagent (Thermo Fisher). Monolayers of cells in 6-well plates were transfected with constructs at a 5:2 or 6:2 ratio of Lipofectamine 3000 reagent to DNA and then cultured for 12 hours according to the manufacturer's protocol. The medium was changed 12 hours after transfection.

<Experimental Example 10> Flow cytometry

Cells were separated into single cells by incubating in 0.25% trypsin containing EDTA for 3 minutes at 37°C, washed twice with PBS, and fixed with 4% paraformaldehyde for 15 minutes. After washing the cells again with PBS, the cells were resuspended in flow cytometry buffer (PBS containing 1% BSA) and measured using a C6 flow cytometer (BD) with FlowJo software (Tree Star, Inc., Ashland, OR, USA). It was analyzed by Biosciences Franklin, NJ, USA).

<Experimental Example 11> Senescence-associated beta-galactosidase (SA-β-gal) analysis

Cells were fixed with 4% paraformaldehyde for 5 minutes at room temperature and then washed twice with PBS. In staining solution containing 40mM citric acid/Na phosphate buffer, 5mM K4[Fe(CN)6] 3H ₂ O, 5mM K3[Fe(CN)6], 150mM sodium chloride, 2mM magnesium chloride and 1mg/ml X-gal. Cultured overnight at 37°C. The cells were washed twice with PBS and once with methanol, dried, and photographed using a bright field microscope.

Example

<Example 1> Transcriptional activation of endogenous Oct4 gene through CRISPR/dCas9 activation system

We evaluated whether transcriptional activation of the endogenous Oct4 gene through the CRISPR/dCas9 activation system and subsequent expression of the Oct4 gene could be used to induce partial reprogramming to prevent cell aging. To induce endogenous Oct4 activation by the CRISPR/dCas9 activation system, 10 candidate sgRNAs targeting the Oct4 distal or proximal promoter region were designed ( Fig. 1A and Table 1 ).

Two days after transfection of NIH/3T3 cells with dCas9-activator vector containing each sgRNA, #7 targeting the Oct4 proximal promoter region, which was identified as the most efficient targeting site for Oct4 transactivation activity. Alternatively, endogenous Oct4 activation via the CRISPR/dCas9 activation system was induced in mCherry-positive cells transfected with a dCas9-activator vector containing #10 sgRNA (Figure 1b).

Next, it was confirmed through Western blot that Oct4 activation was induced by the introduction of the dCas9-activator vector in mouse NIH/3T3 cells and tail tip fibroblasts (TTFs) (Figures 1c and d). In particular, Oct4 activation in cells transfected with dCas9-activator vector containing #10 sgRNA targeting a region 59bp upstream from the start codon of the Oct4 gene was significantly higher than in cells transfected with dCas9-activator vector containing other sgRNAs. An increase was confirmed.

Next, to investigate the off-target effects of the dCas9-activator vector, 10 off-target sites (Table 3) that could be targeted by the Oct4 sgRNA sequence were derived. Potential off-target sites were predicted using Cas-OFFinder (http://www.rgenome.net/cas-offinder/) and verified through qRT-PCR analysis.

As a result, it was confirmed that none of the 10 off-target sites showed transcriptional activation (Figure 1e).

From this, it can be seen that the dCas9-activator vector specifically activates endogenous Oct4 gene expression in mouse somatic cells without off-target effects.

sequence number sequence name gene Target sequence (5'->3') Chromosome Position Direction 17 ON Oct4 AAAGACGGCTCACCTAGGGA CGG chr17 35506040 - 18 OFF1 Fgf16 AAAGACGGCTCACCccGGGA GGG chrX 105774054 + 19 OFF2 Cacna1i AAAGAgGGaTCACCTAGaGA GGG chr15 80354947 - 20 OFF3 Bcas1 AAAGAgGGCTCAgCaAGGGA GGG chr2 170396745 - 21 OFF4 L3mbtl4 AAAGACGGCTCAgCTcGGGg GGG chr17 68320571 - 22 OFF5 Slc25a37 AcAGAgGGCTCACCcAGGGA GGG chr14 69280821 + 23 OFF6 oxtr AAAGACGGCaCACCTAGGatTGG chr6 112476725 - 24 OFF7 Zmat4 AAAGcCGGCaCACaTAGtGA GGG chr8 24093943 + 25 OFF8 Fer1l6 AAAcACGGaTCACCaAtGGA TGG chr15 58515869 + 26 OFF9 Ldb2 AtAGAaGGCTttCCTAGGGA AGG chr5 44791366 + 27 OFF10 Fhl2 AAAGAaacCTCACCTtGGGA AGG chr1 43184305 -

<Example 2> Improvement of aging-related indicators in senescent fibroblasts by transcriptional activation of the endogenous Oct4 gene

We investigated whether aging-related phenotypes could be improved in vitro through CRISPR/dCas9-mediated transcriptional activation of the endogenous Oct4 gene.

Mutant laminA/C(LMNA) was transduced into aged mouse fibroblasts with a dCas9-activator vector to activate endogenous Oct4 ( Fig. 2A ). The level of phosphorylated histone marker γ-H2AX was analyzed to evaluate the level of DNA double-strand breaks associated with cellular aging.

As a result, phosphorylation of the histone marker γ-H2AX was significantly reduced by introduction of the dCas9-activator vector (Figure 2b). In addition, the number of cells with phosphorylated histone marker γ-H2AX or abnormal nuclei was also significantly reduced by endogenous Oct4 activation by introduction of the dCas9-activator vector (Figures 2c and 2d).

Next, in cells transfected with a lentivirus overexpressing progerin, by introduction of a dCas9-activator vector containing #10 sgRNA that induces Oct4 gene transcription activation and #6 sgRNA that does not induce Oct4 gene transcription activation, respectively. As a result of checking the phosphorylation level of the histone marker γ-H2AX, the number of abnormal cells was reduced in cells introduced with the dCas9-activator vector containing #10 sgRNA compared to cells introduced with the dCas9-activator vector containing #6 sgRNA (Figure 3 ).

Accordingly, in the following examples, the dCas9-activator vector containing #10 sgRNA was transformed into cells.

Next, to evaluate the expression levels of aging-related genes, stress response genes Ccl8, p16, p21, Btg2, and Atf3, ECM (extracellular matrix) remodeling genes MMP12, MMP13, and IL-6, and Senescence-Associated Secretory Phenotype (SASP) ) RT-qPCR analysis was performed on the gene Cdkn2a. As a result, the expression level of aging-related genes was significantly increased in aged fibroblasts expressing mutant LMNA, but was recovered by introduction of the dCas9-activator vector (Figure 2e).

From this, it can be seen that the dCas9-activator vector can efficiently improve aging-related molecular phenotypes by activating endogenous Oct4 activation in aging fibroblasts.

Next, aging-related phenotypes were investigated through immunofluorescence analysis.

Two days after activation of endogenous Oct4 activation by introduction of the dCas9-activator vector, immunofluorescence analysis was performed. Specifically, the expression level of cleaved caspase 3 in fibroblasts was measured to determine the number of apoptotic cells.

As a result, the number of apoptotic cells in senescent fibroblasts in which endogenous Oct4 activation was activated by introduction of the dCas9-activator vector was significantly reduced compared to the control group (Figures 2f and 2g).

Additionally, senescence-related beta-galactosidase-positive cells were significantly reduced in senescent fibroblasts in which endogenous Oct4 activation was activated by introduction of the dCas9-activator vector compared to the control group (Figures 2h and 2i).

<Example 3> Improvement of aging-related indicators in HGPS model mice showing progeria by transcriptional activation of the endogenous Oct4 gene

We investigated whether aging-related phenotypes could be improved in vivo through CRISPR/dCas9-mediated transcriptional activation of the endogenous Oct4 gene. The endogenous Oct4 gene was activated by injecting AuNPs/dCas9-activator/PEI nanocomplex into HGPS model mice showing progeria (Figure 4a).

One week after injection, we examined endogenous Oct4 transcription levels in the mouse aorta and found that the level of transcriptional activation of the endogenous Oct4 gene was significantly increased, whereas other pluripotency factors such as Sox2, Klf4 and c-Myc were not affected. (Figure 4b).

In addition, in mice after injection, it was confirmed that the appearance was significantly improved, including a decrease in spinal curvature, compared to the control group (Figure 4c), weight loss was suppressed (Figure 4d), and lifespan was increased (Figure 4e).

Next, previous studies have reported that transient expression of OSKM in vivo induces tumor formation in various tissues (K. Ohnishi et al., Cell 156, 663-677, 2014), in HGPS model mice exhibiting progeria. We investigated whether tumors were formed upon activation of endogenous Oct4 activation through tail-vein injection of AuNPs/dCas9-activator/PEI nanocomposite. As a result, in mice after injection, there was no difference in body weight and lifespan compared to the control group (Figures 5a and 5b), and no tumors were observed, but in mice induced with exogenous OSKM, tumors were confirmed to be formed in several organs (Figures 5c and 5d) ). In addition, RT-qPCR analysis results confirmed that tumor-related genes were not induced in the liver of mice after injection, but tumor-related genes were induced in exogenously induced OSKM mice (Figure 5e).

Next, previous studies have reported that activation of exogenous Oct4 results in dysplastic growth in epithelial tissue that is dependent on persistent Oct4 activation (K. Hochedlinger, et al., Cell 121, 465-477, 2005). We investigated whether activation of endogenous Oct4 activation through tail-vein injection of AuNPs/dCas9-activator/PEI nanocomplex in HGPS model mice showing progeria induces a dysplastic phenotype.

As a result, administration of the AuNPs/dCas9-activator/PEI nanocomplex temporarily induced endogenous Oct4 activation in vivo, so no specific dysplastic phenotype was observed in mice after injection (Figure 5f).

From this, it can be seen that partial reprogramming following in vivo administration of the AuNPs/dCas9-activator/PEI nanocomposite is safe as it does not cause tumor formation or dysplastic growth.

<Example 4> Improvement of aortic aging-related indices in HGPS model mice showing progeria by transcriptional activation of the endogenous Oct4 gene

HGPS has been reported to present cardiovascular diseases such as aortic sclerosis and impaired cardiac function due to progerin-induced vascular smooth muscle cell (VSMC) death, similar to those seen in most older adults (M. R. Hamczyk et al. al., Circulation 138, 266-282, 2018), it was confirmed whether activation of endogenous Oct4 activation through tail-vein injection of AuNPs/dCas9-activator/PEI nanocomplex in HGPS model mice showing progeria improves cardiovascular disease. .

As a result, after injection, mice showed reduced degeneration of VSMC compared to the control group (Figures 4f and g). The adventitia and central thickness phenotypes of the aorta were restored (Figures 4h and i).

In addition, after injection, the expression of Lmna-mutant progerin was suppressed in VSMC of mice compared to the control group (Figure 4j).

Next, we investigated the expression levels of aging-related genes in the aorta after tail-vein injection of AuNPs/dCas9-activator/PEI nanocomposite in HGPS model mice showing progeria.

As a result of RT-qPCR analysis, the expression level of aging-related genes was restored in the mouse aorta after injection (Figure 6).

From this, it can be seen that endogenous Oct4 activation in vivo following in vivo administration of AuNPs/dCas9-activator/PEI nanocomplex significantly improves the phenotype and vascular stiffness of aging-related VSMC.

From the results of the above examples, the CRISPR/dCa9 system targeting the Oct4 gene promoter, which induces transcriptional activation of the endogenous Oct4 gene, induces reprogramming in cells and causes aging-related phenotypes in vitro and in vivo. By improving, aging-related diseases can be prevented, improved or treated.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be interpreted as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Claims (14)

Guide RNA consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; and dCas9; CRISPR/dCas9 complex for enhancing the activity of the Oct4 gene.
The method of claim 1, wherein the CRISPR/dCas9 complex includes a guide RNA base sequence consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; And a polynucleotide encoding dCas9, which is a vector containing a CRISPR/dCas9 complex.
The CRISPR/dCas9 complex according to claim 1, wherein the CRISPR/dCas9 complex increases the intrinsic transcriptional activity of the Oct4 gene compared to the intrinsic transcriptional activity of the wild-type Oct4 gene.
Guide RNA consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; A pharmaceutical composition for preventing or treating aging-related diseases, comprising as an active ingredient a CRISPR/dCas9 complex for increasing the activity of the Oct4 gene, including dCas9.
The composition according to claim 4, wherein the pharmaceutical composition has an inhibitory effect on cellular aging.
The composition according to claim 5, wherein the cell aging inhibition effect is one or more effects selected from the following:
i) reduced expression levels of aging-related genes;
ii) reduced levels of DNA double-strand breaks;
iii) reduced apoptosis; and
iv) Age-related decrease in the number of beta-galactosidase positive cells.
The composition according to claim 4, wherein the pharmaceutical composition has an effect of improving aging-related diseases.
The composition according to claim 7, wherein the effect of improving aging-related diseases is one or more effects selected from the following:
i) Reduce spinal curvature;
ii) inhibiting weight loss;
iii) increased lifespan; and
iv) Inhibition of vascular aging.
The composition according to claim 4, wherein the aging-related disease is at least one selected from a disease that induces premature aging or a disease induced by aging.
The method of claim 9, wherein the disease that induces premature aging is Hutchinson Guilford progeria syndrome (HGPS), premature aging associated with HIV infection, muscle dystrophy, and Charcot-Marie-Tooth disease. disease), Werner syndrome, insulin resistance type II diabetes, osteoporosis, skin aging, and restrictive dermopathy.
The method of claim 9, wherein the diseases induced by aging include arteriosclerosis, hypertension, sarcopenia, dry eye, macular degeneration, hyperopia, myopia, cataracts, tinnitus, hearing loss, indigestion, diarrhea, autoimmune disease, pneumonia, and influenza. , tetanus, infectious endocarditis, pneumonia, influenza, tetanus, infectious endocarditis, cancer, overactive bladder, urinary incontinence, prostatic hyperplasia, lower urinary tract symptoms, glomerulonephritis, chronic renal failure, stroke, osteoporosis, arthritis, diabetes, renal failure, chronic obstructive pulmonary disease, and A composition comprising at least one selected from the group consisting of pulmonary fibrosis.
An anti-aging method comprising administering the pharmaceutical composition of claim 4 to a subject other than a human.
Guide RNA consisting of the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto; A composition for inhibiting cellular aging, comprising a CRISPR/dCas9 complex for increasing the activity of the Oct4 gene, including dCas9.
The composition for inhibiting cellular aging according to claim 13, wherein the composition inhibits cellular aging in vitro or ex vivo.