KR20240086736A - Dna aptamer specifically binding to histamine and using the same - Google Patents

Abstract

The present invention relates to a DNA aptamer that specifically binds to histamine and its use. Specifically, the DNA aptamer according to the present invention binds strongly and specifically to histamine, suppresses the expression of inflammatory factors, and significantly improves itching, making it useful for detecting histamine or treating skin diseases such as itching. can be used

Description

DNA aptamer specifically binding to histamine and use thereof {DNA APTAMER SPECIFICALLY BINDING TO HISTAMINE AND USING THE SAME}

The present invention relates to a DNA aptamer that specifically binds to histamine and its use.

Allergy is a symptom of an abnormal hypersensitivity reaction of the immune system and is accompanied by symptoms such as hives, itching, runny nose, and cough due to causative substances such as pollen and mites. If allergies are severe, they can be life-threatening, such as difficulty breathing, acute hypotension, and shock. Recently, the number of allergy patients is continuously increasing due to the increase in indoor living and the increase in allergenic substances due to urbanization and industrialization.

Allergy symptoms occur when IgE antibodies are formed in the body due to allergenic substances, and when the formed IgE antibodies bind to mast cells, histamine is secreted. Secreted histamine acts on vascular endothelial cells to dilate blood vessels through capillary smooth muscle and arteriolar muscle relaxation, or binds to histamine receptor, one of the G-protein coupled receptors (GPCR), to participate in various actions. Of the four known types of histamine receptors, H ₁ is associated with allergic reactions, causing a hypersensitivity reaction associated with itching and hives.

Currently, avoidance therapy to avoid contact with allergy-causing substances, immunotherapy to develop tolerance to allergy-causing substances, or drug therapy using antihistamines are used to alleviate and treat allergy symptoms. Among these, immunotherapy is expensive because it requires long-term treatment, and it is difficult to select an appropriate antigen for treatment. Meanwhile, drug therapy can cause side effects such as central nervous system depression, glaucoma, and prostate enlargement when used in excessive amounts.

In this regard, Republic of Korea Patent Publication No. 10-2021-0157899 relates to a pharmaceutical composition for preventing or treating allergic diseases containing 6'-hydroxy justicidin-B. It is disclosed that Din-B can be used in the treatment of allergic diseases due to its excellent Th2 cytokine suppression effect, anti-allergic asthma suppression effect, and anaphylaxis suppression effect.

Republic of Korea Patent Publication No. 10-2021-0157899

The purpose of the present invention is to provide a DNA aptamer that specifically binds to histamine and its use.

In order to achieve the above object, the present invention provides a DNA aptamer that specifically binds to histamine and is composed of a base sequence selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 15.

Additionally, the present invention provides a composition and kit for detecting histamine containing the DNA aptamer.

Additionally, the present invention provides a histamine detection method comprising reacting the DNA aptamer with a sample.

Additionally, the present invention provides an anti-allergy pharmaceutical composition and external skin preparation containing the DNA aptamer.

Additionally, the present invention provides a pharmaceutical composition and external skin preparation containing the DNA aptamer for preventing or treating allergic skin diseases.

Furthermore, the present invention provides a health functional food for preventing or improving allergic skin diseases containing the DNA aptamer.

The DNA aptamer according to the present invention specifically binds strongly to histamine, inhibits the expression of inflammatory factors, and significantly improves itching, so it can be usefully used to detect histamine or treat skin diseases such as itching. .

Figure 1 shows the PCR product amplified from a random DNA library (A), the purified product of the amplified PCR product (B), and the single-stranded DNA amplification product (C) confirmed through agarose gel electrophoresis in one embodiment of the present invention. This is the resulting drawing.
Figure 2 is a graph showing the results of confirming the binding force between the DNA aptamer and histamine obtained in an example of the present invention according to the number of SELEX runs.
Figure 3 is a graph showing the results of confirming the binding force between 15 DNA aptamers selected in an example of the present invention and histamine.
Figure 4 is a diagram showing the results of confirming the structures of five DNA aptamers selected in an example of the present invention.
Figure 5 is a diagram showing the results of predicting the binding structure of five selected DNA aptamers and histamine in an example of the present invention.
Figure 6 is a graph showing the results of confirming the effect of suppressing the expression of inflammatory factors in an animal model in which allergy is induced by the DNA aptamer selected in an example of the present invention.
Figure 7 is a graph showing the results of confirming the effect of improving itching in an animal model induced by allergy by a DNA aptamer selected in an example of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer that specifically binds to histamine and is composed of a base sequence selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 15.

As used herein, the term “histamine” is a biological amine synthesized from histidine, an amino acid, and causes inflammation and allergic reactions in tissues. Histamine is mainly secreted by mast cells or basophils, and the secreted histamine is stored in granules. When IgE antibodies bind to the cell membrane where histamine is stored and sensitize it, it is released from the granules (degranulation). . Substances with pharmacological activity that block the action of histamine are called antihistamines, and antihistamines that act on H ₁ receptors relieve inflammation or allergic reactions.

As used herein, the term “aptamer” refers to a nucleic acid molecule that can bind to a specific substance with high affinity and specificity. The aptamer can be prepared by a method well known in the art, and the method can be appropriately modified as needed.

The DNA aptamer according to the present invention may be selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 15. As long as the DNA aptamer maintains the characteristic of specifically binding to histamine, it has at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% homology to the base sequences shown in SEQ ID NOs: 1 to 15. You can have it.

The DNA aptamer may be modified with the sugar residue of each nucleotide, specifically ribose or deoxyribose, to increase binding and stability to the target substance. The above formula may be one in which any one or more oxygen atoms selected from the group consisting of the 2', 3', and 4' positions of the sugar residue are replaced with another atom. Examples of modifications may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, etc. Modification of the sugar residue as described above can be performed by conventional methods.

Additionally, the nucleotide base of the DNA aptamer may be modified to increase binding to the target substance. The modification of the nucleotide base includes pyrimidine modification at position 5, purine modification at position 6, purine modification at position 8, modification at extracyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo. Or it may include substitution with 5-iodine-uricyl, etc.

Additionally, the phosphate group of the DNA aptamer may be modified to be resistant to nucleases, hydrolases, etc. For example, the phosphate group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, etc. Furthermore, the DNA aptamer may include modifications at the 3' end or 5' end, and the modifications include capping, biotinyl, polyethyl glycol, amino acids, peptides, nucleic acids, nucleosides, myristoyl, etc. , lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl , lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer drugs, toxins, enzymes, radioactive substances, biotin, etc. may be added.

Additionally, the present invention provides a composition and kit for detecting histamine containing the DNA aptamer.

The DNA aptamer included in the composition and kit for detecting histamine according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences shown in SEQ ID NOs: 1 to 15.

The DNA aptamer included in the composition for detecting histamine according to the present invention may be a conjugate labeled with a detecting agent such as a chromogenic enzyme, a fluorescent substance, a radioactive isotope, or a colloid. The chromogenic enzyme may be peroxidase, alkaline phosphatase, or acid phosphatase, and the fluorescent substance may be thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, or fluorescein-6-yl. , 2',7'-dichlorofluorescein-5-yl, 2',7'-dichlorofluorescein-6-yl, dihydro tetramethylrosamine-4-yl, tetramethylrhodamine-5-yl , tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacen-3-ethyl or 4,4-difluoro rho-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhoda It may be Min-B-isothiocyanate (RITC), Phycoerythrin (PE), or Rhodamine.

Additionally, the DNA aptamer may include a ligand that can specifically bind to the DNA aptamer. The ligand may be a conjugate labeled with a detector such as a chromogenic enzyme, a fluorescent substance, a radioactive isotope, or a colloid, and a ligand treated with streptavidin or avidin. In addition to the reagents described above, the detection composition of the present invention may further include distilled water or a buffer solution to keep their structures stable.

The kit according to the present invention can be bound to a solid substrate to facilitate subsequent steps, such as washing the DNA aptamer contained therein or separating the complex. At this time, synthetic resin, nitrocellulose, glass substrate, metal substrate, glass fiber, microspheres, or microbeads may be used as the solid substrate. Additionally, polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, or nylon may be used as the synthetic resin.

In addition, the kit can be manufactured by conventional manufacturing methods known to those skilled in the art, and may further include buffers, stabilizers, inactive proteins, etc. The kit is used for ultra-high throughput screening through a fluorescence method performed by detecting the fluorescence of a fluorescent substance attached as a detector to detect the amount of reagent, or a radiography method performed by detecting the radiation of a radioisotope attached as a detector. screening (HTS) system, the SPR (surface plasmon resonance) method that measures plasmon resonance changes on the surface in real time without labeling the detector, or the SPRI (surface plasmon resonance imaging) method that confirms the SPR system by imaging it.

Additionally, the present invention provides a histamine detection method comprising reacting the DNA aptamer with a sample.

The DNA aptamer used in the histamine detection method according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences shown in SEQ ID NOs: 1 to 15.

The sample may include any sample for which histamine is to be detected. Additionally, the sample may be pretreated using methods such as anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, continuous extraction, centrifugation, or gel electrophoresis.

Additionally, the present invention provides an anti-allergy pharmaceutical composition and external skin preparation containing the DNA aptamer.

The DNA aptamer included in the anti-allergy pharmaceutical composition and external skin preparation according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences shown in SEQ ID NOs: 1 to 15.

The pharmaceutical composition according to the present invention may contain 10 to 95% by weight of DNA aptamer, which is an active ingredient, based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may further include one or more active ingredients that exhibit the same or similar functions in addition to the above-mentioned effective ingredients.

The pharmaceutical composition of the present invention may include carriers, diluents, excipients, or mixtures thereof commonly used in biological products. Any pharmaceutically acceptable carrier can be used as long as it is suitable for delivering the composition into the body. Specifically, the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline solution, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or mixtures thereof. Additionally, conventional additives such as antioxidants, buffers, bacteriostatic agents, etc. can be added as needed.

When formulating the composition, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be added.

The composition of the present invention may be formulated as an oral preparation or a parenteral preparation. Oral preparations may include solid preparations and liquid preparations. The solid preparation may be a tablet, pill, powder, granule, capsule, or troche, and such solid preparation may be prepared by adding at least one excipient to the composition. The excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or mixtures thereof. Additionally, the solid preparation may contain a lubricant, examples of which include magnesium styrate and talc. Meanwhile, the liquid preparation may be a suspension, oral solution, emulsion, or syrup. At this time, the liquid formulation may contain excipients such as wetting agents, sweeteners, fragrances, preservatives, etc.

The parenteral preparations may include injections, suppositories, powders for respiratory inhalation, aerosol sprays, powders and creams. The injection may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, etc. At this time, the non-aqueous solvent or suspension may be propylene glycol, polyethylene glycol, vegetable oil such as olive oil, or injectable ester such as ethyl oleate.

The composition of the present invention can be administered orally or parenterally depending on the desired method. Parenteral administration may include intraperitoneal, intrarectal, subcutaneous, intravenous, intramuscular, or intrathoracic injection.

The composition can be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, activity of the drug, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used simultaneously, etc. However, for a desirable effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg. The administration may be once or several times a day.

The composition of the present invention can be administered alone or in combination with other therapeutic agents. When administered in combination, administration may be sequential or simultaneous.

Additionally, the skin external preparation may include a pharmaceutically acceptable carrier and excipient. The carrier and excipient are preservatives. It may include stabilizers, wetting agents, emulsification accelerators, and buffering agents. Specifically, the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone, or mixtures thereof. The skin external preparation can be appropriately prepared according to methods well known in the art. The skin external preparations can be manufactured in the form of powder, gel, ointment, cream, liquid, and aerosol.

Additionally, the present invention provides a pharmaceutical composition and external skin preparation containing the DNA aptamer for preventing or treating allergic skin diseases.

The DNA aptamer included in the pharmaceutical composition and external skin preparation for preventing or treating allergic skin diseases according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences shown in SEQ ID NOs: 1 to 15.

The allergic skin disease may refer to a skin disease caused by hypersensitivity of the human immune system due to repeated exposure to an allergen. The allergic skin disease may include urticaria, atopy, itching, eczema, edema, erythema, etc.

Furthermore, the present invention provides a health functional food for preventing or improving allergic skin diseases containing the DNA aptamer.

The DNA aptamer included in the health functional food for preventing or improving allergic skin diseases according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences shown in SEQ ID NOs: 1 to 15.

The DNA aptamer of the present invention can be added as is to food or used together with other foods or food ingredients. At this time, the content of the added active ingredient may be determined depending on the purpose, and may generally be 0.01 to 90 parts by weight of the total weight of the health functional food.

The form and type of health functional food are not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids, and pills. The health functional food may contain various flavors, sweeteners, or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of natural sweeteners include thaumatin and stevia extract. Meanwhile, examples of synthetic sweeteners include saccharin and aspartame. Additionally, the natural carbohydrate may be monosaccharide, disaccharide, polysaccharide, oligosaccharide, sugar alcohol, etc.

In addition to the additional ingredients described above, the health functional food of the present invention contains nutrients, vitamins, electrolytes, flavors, colorants, pexane and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, and preservatives. , glycerin, alcohol, etc. may be further included. These ingredients can be used independently or in combination. The ratio of the additive may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in detail through the following examples. However, the following examples are only for illustrating the present invention and are not intended to limit the present invention thereto. Anything that has substantially the same structure as the technical idea described in the claims of the present invention and achieves the same operation and effect is included in the technical scope of the present invention.

Example 1. Amplification of random DNA library

To select a DNA aptamer that specifically binds to histamine, a DNA library was first prepared as described below.

Specifically, a template DNA of 76 bp size (SEQ ID NO: 16: 5'-ATACCAGCTTATTCAATTN) containing 40 random base sequences (N ₄₀ ) containing dA:dG:dC:dT in a ratio of 1.5:1.15:1.25:1 ₄₀ AGATAGTAAGTGCAATCT-3') and its forward primer (SEQ ID NO: 17: 5'-ATACCAGCTTATTCAATT-3') and the reverse primer biotinylated at the 5'-end (SEQ ID NO: 18: 5'-AGATAGTAAGTGCAATCT-3 ') was custom-produced by Bioneer (Korea). 1 μl template DNA, 5 μl 10x PCR buffer, 4 μl 2.5 mM dNTP mixture, 2 μl 10 μM forward primer, 2 μl 10 μM biotinylated reverse primer, 0.25 μl ExTaq polymerase (Takara) , Japan) (1 unit/㎕) and 35.75 ㎕ of distilled water were mixed to prepare a PCR reaction. PCR was performed on the prepared reaction product under the conditions described in Table 1 below. The results of confirming the obtained PCR product through 2% agarose gel electrophoresis are shown in Figure 1A, and the results of purifying the PCR product using a purification kit (Qiagen, USA) and confirming it through agarose gel electrophoresis are shown in Figure 1B. It was.

early metamorphic stage 95℃, 5 minutes 1 time denaturation stage 95℃, 30 seconds 20 times Annealing step 55℃, 30 seconds Elongation step 72℃, 30 seconds Late elongation stage 72℃, 7 minutes 1 time

As shown in Figures 1A and 1B, amplification of the DNA random library was confirmed.

Example 2. Amplification of single-stranded DNA

To prepare a DNA aptamer from the obtained PCR product of 76 bp in size, single-strand DNA (ssDNA) was amplified using an asymmetric PCR method.

First, 1 μl of the PCR product obtained in Example 1, 10 μl of 10× PCR buffer, 8 μl of 2.5 mM dNTP mixture, 10 μl of 10 μM forward primer (SEQ ID NO: 17), 2 μl of 10 μM ratio. A PCR reaction was prepared by mixing an ortinylated reverse primer (SEQ ID NO: 18), 0.5 μl of ExTaq polymerase (Takara, Japan) (1 unit/μl), and 68.5 μl of distilled water. PCR was performed on the prepared reaction product under the conditions described in Table 2 below. The obtained PCR product was confirmed through 2% agarose gel electrophoresis.

early metamorphic stage 95℃, 5 minutes 1 time denaturation stage 95℃, 30 seconds Episode 15 Annealing step 55℃, 30 seconds Elongation step 72℃, 30 seconds Late elongation stage 72℃, 7 minutes 1 time

A PCI solution containing phenol:chloroform:isoamyl alcohol mixed at a volume ratio of 25:24:1 was added to the confirmed PCR product in the same volume as the PCR product, and stirred vigorously. After stirring, it was centrifuged for 15 minutes at 4°C and 13,000 rpm to obtain a supernatant. To the obtained supernatant, 1/100 volume of tRNA (Sigma aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70°C for more than 1 hour. After the reaction, it was centrifuged for 20 minutes at 4°C and 13,000 rpm to obtain a pellet. The obtained pellet was dried at 65°C and then suspended in 50 μl of distilled water to obtain DNA. The results of confirming the obtained DNA through 2% agarose gel electrophoresis are shown in Figure 1C.

As shown in Figure 1C, the amplified DNA product was confirmed.

Example 3. Recovery of ssDNA

In order to remove biotin-bound double-stranded DNA (dsDNA) and ssDNA from the ssDNA obtained above and secure pure forward ssDNA, a heating-cooling technique was performed as follows.

Specifically, 50 μl of distilled water was added to the ssDNA obtained in Example 2, which was reacted at 85°C for 5 minutes to denature dsDNA into ssDNA, and then cooled to 4°C to obtain ssDNA. The obtained ssDNA was immediately cooled to 4°C. 50 μl of streptavidin agarose resin (Pierce, USA) was added to the cooled ssDNA and reacted at room temperature for 1 hour. Afterwards, the reaction solution was centrifuged for 10 minutes at 4°C and 13,000 rpm, and only the supernatant was taken. To secure ssDNA from the obtained supernatant, extraction using PCI solution and ethanol precipitation were performed as described above. As a result, the obtained pellet was dried at 65°C and then suspended in 50 μl of distilled water to obtain ssDNA. The obtained ssDNA was confirmed through 2% agarose gel electrophoresis.

Example 4. Production of DNA aptamer with three-dimensional structure

To 40 μl of ssDNA obtained in Example 3, 60 μl of distilled water and 100 μl of 20 mM PBS (pH 7.2) were added. The mixture was denatured by boiling at 85°C for 5 minutes, then left at room temperature for more than 1 hour to gradually cool, thereby producing a three-dimensional DNA aptamer from ssDNA.

Example 5. Selection of DNA aptamers that specifically bind to histamine

5-1. Selection of DNA aptamers that specifically bind to histamine

DNA aptamers that specifically bind to histamine were selected using the SELEX technique.

First, epoxy-activated sepharose 6B (epoxy-activated sepharose 6B), which forms a covalent bond with a ligand containing an amine group (-NH), a thiol group (-SH), and a hydroxy group (-OH), was added to 1 ml of distilled water. 6B, GE Healthcare, USA) 0.01 g of powder was added and strongly stirred, then centrifuged at 13,000 rpm for 10 minutes at 4°C to remove the supernatant. 500 ㎕ of coupling buffer (100mM NaHCO ₃ , 500mM NaCl) and histamine were added and reacted for 10 minutes. After the reaction was completed, the supernatant was removed by centrifugation at 13,000 rpm for 10 minutes at 4°C to remove histamine that was not bound to epoxy-activated Sepharose 6B. 200 ㎕ of the aptamer prepared in Example 4 was added to histamine-conjugated Sepharose 6B, and reacted for 1 hour. After the reaction, the unbound DNA aptamer was removed by washing three times using 10 mM PBS (pH 7.2). After washing, 200 μl of 10 mM PBS buffer was added, boiled at 85°C for 5 minutes, and centrifuged at 4°C at 13,000 rpm for 10 minutes to obtain denatured DNA aptamer, which was performed twice. . Thereafter, PCI extraction and ethanol precipitation were performed on the obtained pellet as described above, and the DNA aptamer suspended in 50 μl of distilled water was finally recovered.

5-2. Removal of non-specifically binding DNA aptamers

The following experiment was performed to remove non-specific DNA aptamers that bind to epoxy-activated Sepharose 6B rather than histamine and to improve the specificity of DNA aptamers that bind to histamine.

First, using the DNA aptamer obtained in Example 5-1, the process of Example 5-1 was repeated six times to select a DNA aptamer with improved specificity. Negative SELEX was performed using the selected DNA aptamer to select DNA aptamers that bind to epoxy-activated Sepharose 6B to which histamine is not bound. The experiment was conducted under the same conditions and methods as in Example 5-1, except that instead of using histamine-conjugated epoxy-activated Sepharose 6B, only epoxy-activated Sepharose 6B was used. At this time, only DNA aptamers that did not bind to epoxy-activated Sepharose 6B were obtained. Using the obtained aptamer, the process of Example 5-1 was repeated 4 more times and SELEX was performed a total of 10 times to finally obtain an aptamer that specifically binds to histamine.

Example 6. Selection of DNA aptamer pools with high affinity

The affinity for histamine of the DNA aptamer obtained in each round through 10 rounds of SELEX was confirmed using real-time PCR. Real-time PCR was performed in a conventional manner using iQ SYBR Green Supermix (Bio-rad, USA) using the DNA aptamer pool obtained at each time in Example 5 as a template. As a result, a graph of the real-time PCR results is shown in Figure 2, and the obtained C(t) values are shown in Table 3.

SELEX count Dilution ratio C(t) value Episode 7 1×10 ⁰ 13.54 Episode 8 1×10 ⁰ 11.84 Episode 9 1×10 ⁰ 14.24 10 times 1×10 ⁰ 12.79

As shown in Figure 2 and Table 3, the C(t) value of the DNA aptamer obtained at the 8th time was the lowest at 11.84, and the C(t) value increased from the 9th time. Therefore, it was found that the DNA aptamer pool obtained after performing SELEX eight times binds histamine most specifically.

Example 7. Sequence confirmation of DNA aptamer

The sequence of the DNA aptamer obtained through eight SELEX acquisitions, which was confirmed to have the highest affinity for histamine above, was confirmed in the following manner.

First, PCR was performed using the DNA aptamer obtained by performing SELEX eight times as a template to obtain double-stranded DNA. The obtained dsDNA was cloned into the T-vector using the T-blunt cloning kit (SolGent, Korea) according to the manufacturer's protocol.

Specifically, 1 μl of T-vector (10 ng/μl), 4 μl of PCR product (20 ng/μl), and 1 μl of 6x T-blunt buffer were reacted at 25°C for 5 minutes. The reaction was mixed with 100 μl of DH5α soluble strain and transformed by heat shock at 42°C for 30 seconds. This was left on ice for 2 minutes, and 900 μl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO ₄ , and 20 mM glucose) was added. Incubated at 37°C for 40 minutes. 200 ㎕ of culture medium was added with 50 ㎍/㎖ ampicillin (Sigma Aldrich, USA), 50 ㎍/㎖ kanamycin (Sigma Aldrich, USA), 50 ㎍/㎖ X-gal (X-gal, Sigma Aldrich, USA) and It was spread on LB culture plates containing 5 μg/ml IPTG (Thermo Scientific, USA). After culturing it at 37°C for 15 hours, only white colonies were selected among the colonies produced, DNA was extracted by a conventional method, and the base sequence was requested from Solgent (Korea), and a total of 15 colonies were obtained as shown in Table 4 below. The DNA aptamer sequence was confirmed.

clone Sequence (5'→3') Size (bp) sequence number HT1 CCATGACGTGTTTTGCTAACCATGACAAGTGCATCGAGTG 40 SEQ ID NO: 1 HT2 CCACACACTCCGTAATATGGCGTTCTGTCCATTTTACTTG 40 SEQ ID NO: 2 HT3 CCACAGAGCTCCATTTATTTTCTGTGATATCGTACCGTGG 40 SEQ ID NO: 3 HT4 CCCGACCACCTATACATATACTTATCGTCAAAGTTGTGTG 40 SEQ ID NO: 4 HT5 GCAAAGAAGGCCAATTCGCAAAAATTCTGTCCATCGAGCCT 40 SEQ ID NO: 5 HT6 CAAGGAAGCGAACACACCTGAAGTTAGGGCTTACTGTTTG 40 SEQ ID NO: 6 HT7 CGCGCGGGAAATGGTTTGCCCATTTGAACAGATCCTCTCA 40 SEQ ID NO: 7 HT8 CCATGTGGGTGATATTCGATTCACCCGATAACGAGTCTGG 40 SEQ ID NO: 8 HT9 CGAAATAGCAATTGTTGGATTTAAAAGTGTTGTTCTCACG 40 SEQ ID NO: 9 HT10 CAGCCAAACATTCAGGTCGAGTTATTCGGTGGAATTTACG 40 SEQ ID NO: 10 HT11 CCACAAGGTATCACCCGATAAGTTGGATAAATTGTCTTGG 40 SEQ ID NO: 11 HT12 GCAAAAGGTGCGTTGTGTCCCCAACGTTCTACTATTTTCA 40 SEQ ID NO: 12 HT13 CCAACCCCTCTATAAGTGTCTACGTCCTGCAATAGCATCG 40 SEQ ID NO: 13 HT14 CCACAGCAGTACGTCCAAATATCTTTATACGTTATGACCC 40 SEQ ID NO: 14 HT15 CCGCCATCTACCTTAGTTGCTCGATATGGATTACCAGTCT 40 SEQ ID NO: 15

Example 8. Selection of DNA aptamers with excellent affinity for histamine

After producing ssDNA aptamers as described above for the 15 DNA aptamers whose sequences were confirmed in Example 7, aptamers with each sequence were prepared at the same concentration. SELEX was performed in the same manner as described above using the prepared DNA aptamer, and the concentration of the recovered aptamer was measured using Nanodrop (Nanodrop 2000 Micro spectrophotometer, Thermo scientific) according to the manufacturer's protocol. As a result, the concentration of DNA aptamer measured by the nanodrop method is shown in Figure 3.

As shown in Figure 3, all 15 DNA aptamers whose sequences were confirmed bound to histamine with high binding affinity, and in particular, HT4, HT6, HT10, HT12, and HT14 aptamers showed better binding affinity to histamine.

Example 9. Confirmation of the structure of DNA aptamer

The results of imaging the structures of the five DNA aptamers that bind histamine with high affinity using the DNA mfold program (Rensselear polytechnic institute) are shown in Figure 4.

Example 10. Prediction of binding structure of histamine and DNA aptamer

First, based on the two-dimensional structures of the five DNA aptamers identified in Example 9, the three-dimensional structures were predicted using the RNAcomposer website (http://rnacomposer.cs.put.poznan.pl/). Afterwards, the DNA structure was obtained from the predicted three-dimensional RNA structure using the Pymol program. Meanwhile, histamine structure was obtained from the PubChem website. The combined structure using the obtained DNA aptamer and histamine structures was analyzed using MOE (molecular operating environment) software. Before structure prediction, the DNA aptamer and histamine structures were prepared by minimizing all energies, and the binding prediction for the entire structure was evaluated by setting the histamine structure as the receptor and the DNA aptamer as the ligand. Additionally, refinement was set to rigid body. As a result, the binding prediction results between histamine and DNA aptamer are schematically shown in Figure 5, and the binding force between them is shown in Table 5.

Aptamer S score HT4 -17.3923 HT6 -16.7134 HT10 -16.9505 HT12 -19.5070 HT14 -15.3405

As shown in Figure 5 and Table 5, all five selected DNA aptamers bound to histamine with excellent binding affinity.

Example 11. Inhibition of allergic reaction by DNA aptamer

The effect of suppressing allergic reactions was confirmed in an animal model using the HT12 DNA aptamer, which was confirmed to have the highest binding affinity to histamine.

11-1. Inhibition of inflammatory factor expression

First, an allergy animal model was prepared by administering 50 μg of Compound 48/80 per injection site to the shoulder area of a 6-week-old male HR-1 hairless mouse. HT14 aptamer was administered to the animal model prepared above by intravenous injection into the tail at a dose of 1, 10, or 20 mg/kg. 1 hour after administration, the mouse was sacrificed using a conventional method to obtain liver tissue. RNA was extracted from liver tissue obtained according to the manufacturer's protocol using TRI reagent (Sigma aldrich, USA), and cDNA was synthesized using the same amount of RNA as a template using the TOPscript™ cDNA synthesis kit (Enzynomics, Korea). . Using the synthesized cDNA as a template, the expression levels of inflammatory factors TNF-α, TGF-β1, iNOS, and COX-2 were confirmed using real-time PCR. At this time, real-time PCR was performed by a conventional method, and as a result, the expression level of each inflammatory factor was confirmed, and a graph of the results is shown in Figure 6.

As shown in Figure 6, the expression of inflammatory factors increased by the administration of compound 48/80, which induces the expression of histamine, was significantly suppressed by the HT12 aptamer.

11-2. Improvement of itching

The aptamer was administered to the mouse, and the effect of improving itching was confirmed by measuring the number of times the mouse scratched the area causing itching for 1 hour. The number of scratches was confirmed by dividing the value measured over 1 hour by the total recorded time, and the results are shown in Figure 7.

As shown in Figure 7, the number of scratches in mice was significantly reduced depending on the dose of aptamer.

Therefore, from the above results, it could be seen that the aptamer according to the present invention can be used for the treatment of skin diseases such as itching.

Sequence list electronic file attached

Claims (10)

A DNA aptamer that specifically binds to histamine and consists of a base sequence selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 15.
A composition for detecting histamine comprising the DNA aptamer of claim 1.
A kit for histamine detection comprising the DNA aptamer of claim 1.
A histamine detection method comprising reacting the DNA aptamer of claim 1 with a sample.
An anti-allergy pharmaceutical composition comprising the DNA aptamer of claim 1.
An external skin preparation for anti-allergy containing the DNA aptamer of claim 1.
A pharmaceutical composition for preventing or treating allergic skin diseases comprising the DNA aptamer of claim 1.
The pharmaceutical composition for preventing or treating allergic skin diseases according to claim 7, wherein the allergic skin diseases include urticaria, atopy, itching, eczema, edema, or erythema.
An external skin preparation for the prevention or treatment of allergic skin diseases containing the DNA aptamer of claim 1.
The health functional food for preventing or improving allergic skin diseases according to claim 7, wherein the allergic skin disease is itching.