KR20240068807A - Method for manufacturing yuzu enzyme reactant with reduced bitterness and health functional food composition for diet comprising the same - Google Patents

Abstract

The present invention relates to a method for producing a citron enzyme reaction with reduced bitterness and a health functional food composition for diet containing the same. The citron enzyme reaction product not only effectively reduces the inherent bitterness of citron, but also improves solubility by reducing particle size. The uniformity and dispersion also increased, and the dietary fiber isolated from this is expected to be useful in suppressing fat production or promoting lipolysis, so it can be effectively used in the production of a health functional food composition for diet.

Description

Method for manufacturing yuzu enzyme reactant with reduced bitterness and health functional food composition for diet comprising the same {Method for manufacturing yuzu enzyme reactant with reduced bitterness and health functional food composition for diet comprising the same}

The present invention relates to a method for producing a citron enzyme reaction with reduced bitterness and a health functional food composition for diet containing the same, and more specifically, to a substrate composition containing citron, an enzyme derived from Aspergillus niger or The present invention relates to a method for producing a citron enzyme reaction product with reduced bitterness by reacting Aspergillus oryzae strain culture supernatant and a health functional food composition for diet containing the same.

Citron is the only specialty product of Korea's southern coast, and is estimated to be produced annually around 20,000 tons, mainly on Geoje Island. Currently, citron is overproduced and farms have almost given up on growing it, and the citron syrup (for citron tea) that has been processed and produced so far is only consumed seasonally in the winter and cannot be stored during the summer, so a huge amount is being discarded. This is the situation.

Yuzu is not only rich in vitamins C, P, and E, but also contains limonin and citron, a compound of the limonoid family that is currently found in grapefruits and oranges in the United States and Japan and has been shown to be a powerful anti-cancer substance. It was confirmed that nomilin was contained in a significant amount. In particular, it was found that it contains a large amount of flavonoid compounds such as limonene, carvone, coumarin, and terpinene, which have high anti-cancer properties. Citron is a fruit that must be eaten with its peel because the peel contains a large amount of these bioactive substances.

Until now, citrons were mainly used as citron syrup, and the only way to do this was to pickle finely chopped citrons in about 60% sugar, add a certain amount of water, and use it as tea. Recently, citron juice sold by some companies is made by adding water to citron extract or diluting citron juice squeezed by pressing citron with water, so the effective bioactive substances in the peel are hardly utilized.

The main components of yuzu's bitter taste are naringin and hesperidin, which are contained in large amounts compared to other citrus fruits. Even when the fruit is ripe, citron retains its bitter taste because, unlike other citrus fruits, it does not have the naringinase enzyme that breaks down these bitter substances. Additionally, it contains more than three times the pectin content of other citrus fruits, making it a fresh fruit. It was impossible to juice it with the skin. When making yujacheong, it is made by pickling it with more than 60% of the total amount of sugar to remove the bitter taste. Therefore, the excessive amount of sugar sweetness masks the bitter taste of naringin, making it less bitter. Currently, most of the citron produced is consumed as citron syrup, which results in excessive amounts of sugar being consumed, and most of the citron peels in the citron syrup are discarded without being eaten.

The bitter taste present in some citrus fruits, especially yuzu, is present in excessive amounts and is a limitation in the production of yuzu juice. Also, due to the strong bitter taste of ginseng, ginseng drinks are not becoming a favorite beverage for the public, including children. Therefore, making drinks by removing the bitter taste of citrus fruits and ginseng is very commercially useful in popularizing citrus drinks and ginseng drinks.

Methods for producing fungal cultures have been studied to produce naringinase enzyme, which removes the bitter taste of citron. Naringinase-producing strains are known to produce beta-glucosidase enzyme in addition to naringinase during culture. It is known that the mechanism by which the bitter taste of citron is removed is because beta-glucosidase and naringinase work step by step to decompose naringin, which produces a bitter taste, into prunin and naringenin, which do not have a bitter taste.

Accordingly, the present inventors found that when a substrate composition containing citron is reacted with an enzyme derived from Aspergillus niger or an Aspergillus oryzae strain culture supernatant, the inherent bitter taste of citron is effectively reduced. The manufactured dietary fiber has an effect of suppressing fat production and promoting lipolysis, and water holding capacity (WHC), oil holding capacity (OHC), swelling capacity (SC), and solubility are increased. confirmed.

Accordingly, the object of the present invention is to provide a substrate composition containing citron, an Aspergillus niger or Aspergillus duckweed strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and To provide a method for producing a citron enzyme reaction with reduced bitterness, which includes a reaction step of contacting a reaction solution containing at least one selected from the group consisting of fractions of the culture supernatant.

Another object of the present invention is to provide a substrate composition containing citron, an Aspergillus niger or Aspergillus duckweed strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and the above. The present invention provides a health functional food composition for diet containing a citron enzyme reaction product with reduced bitterness, prepared by reacting a reaction solution containing at least one selected from the group consisting of fractions of culture supernatants.

Another object of the present invention is to provide a substrate composition containing citron, an Aspergillus niger or Aspergillus duckweed strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and It relates to the use of a citron enzyme reaction with reduced bitterness, prepared by reacting a reaction solution containing at least one selected from the group consisting of fractions of the culture supernatant, for dieting, suppressing fat production, or promoting lipolysis.

The present invention relates to a method for producing a citron enzyme reaction product with reduced bitterness and a health functional food composition for diet containing the same. The citron enzyme reaction product prepared by the enzyme reaction according to the present invention has a reduced bitter taste and can be used as a diet separated therefrom. Fiber is useful for dieting, inhibiting fat production, or promoting fat breakdown.

The present inventors reacted Aspergillus niger-derived enzyme or Aspergillus oryzae strain culture supernatant with a substrate composition containing citron to prepare a citron enzyme reaction product in which the inherent bitter taste of citron was reduced. , the dietary fiber produced from this exhibits the effect of suppressing fat production and promoting lipolysis, and has water holding capacity (WHC), oil holding capacity (OHC), swelling capacity (SC), and It was confirmed that solubility increased.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a substrate composition containing citron, an Aspergillus niger or Aspergillus duckweed strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and the above. A method for producing a citron enzyme reaction with reduced bitterness, comprising a reaction step of contacting a reaction solution containing at least one selected from the group consisting of fractions of culture supernatants.

In the present invention, the citron may be provided in one or more forms selected from the group consisting of pickled sugar, freeze-dried powder, concentrate, and juice.

In the present invention, the citron may be one or more types selected from the group consisting of the whole fruit, pulp, and skin.

In the present invention, the culture supernatant of the Aspergillus niger strain is selected from the group consisting of β-glucosidase, cellulase, hemicellulase, and protease. It may include one or more types, for example, β-glucosidase, cellulase, hemicellulase, and protease, but is not limited thereto.

In the present invention, the Aspergillus duck material strain may be the Aspergillus duck material NYO2 strain deposited under the accession number KCTC14898BP.

In the present invention, the concentration of the reaction solution may be 0.01 to 1.00% (v/v) based on the total enzyme reaction product.

When the reaction solution is a fraction of the culture supernatant of the Aspergillus niger strain, the fraction of the culture supernatant may include β-glucosidase, cellulase, hemicellulase, and protease, preferably The concentration of the reaction solution is 0.02 to 1.00% (v/v), 0.05 to 1.00% (v/v), 0.08 to 1.00% (v/v), 0.10 to 1.00% (v/v) based on the total enzyme reaction product. , 0.01 to 0.50% (v/v), 0.02 to 0.50% (v/v), 0.05 to 0.50% (v/v), 0.08 to 0.50% (v/v), 0.10 to 0.50% (v/v) , 0.01 to 0.20% (v/v), 0.02 to 0.20% (v/v), 0.05 to 0.20% (v/v), 0.08 to 0.20% (v/v), 0.10 to 0.20% (v/v) , may be 0.01 to 0.10% (v/v), 0.02 to 0.10% (v/v), or 0.05 to 0.10% (v/v), for example, 0.08 to 0.20% (v/v). It may be, but is not limited to this.

When the reaction solution is a culture supernatant of Aspergillus oryzae strain, the concentration of the reaction solution is preferably 0.02 to 1.00% (v/v), 0.05 to 1.00% (v/v), based on the total enzyme reaction product. 0.08 to 1.00% (v/v), 0.10 to 1.00% (v/v), 0.20 to 1.00% (v/v), 0.50 to 1.00% (v/v), 0.01 to 0.80% (v/v), 0.02 to 0.80% (v/v), 0.05 to 0.80% (v/v), 0.08 to 0.80% (v/v), 0.10 to 0.80% (v/v), 0.20 to 0.80% (v/v), 0.50 to 0.80% (v/v), 0.01 to 0.50% (v/v), 0.02 to 0.50% (v/v), 0.05 to 0.50% (v/v), 0.08 to 0.50% (v/v), Alternatively, it may be 0.10 to 0.50% (v/v), for example, 0.20 to 0.50% (v/v), but is not limited thereto.

In the present invention, the concentration of the substrate composition may be 0.10 to 15.00% (v/w), preferably 0.50 to 15.00% (v/w), 1.00 to 15.00% (v/w), based on the total enzyme reaction. ), 2.50 to 15.00% (v/w), 5.00 to 15.00% (v/w), 0.10 to 10.00% (v/w), 0.50 to 10.00% (v/w), 1.00 to 10.00% (v/w) ), 2.50 to 10.00% (v/w), 5.00 to 10.00% (v/w), 0.10 to 7.50% (v/w), 0.50 to 7.50% (v/w), 1.00 to 7.50% (v/w) ), 2.50 to 7.50% (v/w), 5.00 to 7.50% (v/w), 0.10 to 5.00% (v/w), 0.50 to 5.00% (v/w), or 1.00 to 5.00% (v/ w), for example, 2.50 to 5.00% (v/w), but is not limited thereto.

In the present invention, the reaction step may be performed for 1 to 24 hours.

When the reaction solution is a fraction of the culture supernatant of the Aspergillus niger strain, preferably the reaction step lasts 2 to 24 hours, 3 to 24 hours, 4 to 24 hours, 6 to 24 hours, or 10 to 24 hours. It may be performed for a period of time, for example, 12 to 24 hours, but is not limited thereto.

When the reaction solution is a culture supernatant of an Aspergillus oryzae strain, preferably the reaction step is 2 to 24 hours, 4 to 24 hours, 6 to 24 hours, 8 to 24 hours, 10 to 24 hours, or 12 hours. It may be performed for from 15 to 24 hours, for example, 15 to 24 hours, but is not limited thereto.

Another aspect of the present invention is a substrate composition containing citron, an Aspergillus niger or Aspergillus duckweed strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and the above. It is a health functional food composition for diet containing a citron enzyme reaction product with reduced bitter taste, prepared by reacting a reaction solution containing one or more selected from the group consisting of fractions of culture supernatants.

In the present invention, the citron may be provided in one or more forms selected from the group consisting of pickled sugar, freeze-dried powder, concentrate, and juice.

In the present invention, the citron may be one or more types selected from the group consisting of the whole fruit, pulp, and skin.

In the present invention, the culture supernatant of the Aspergillus niger strain may contain one or more types selected from the group consisting of β-glucosidase, cellulase, hemicellulase, and protease, for example , may include all of β-glucosidase, cellulase, hemicellulase, and protease, but are not limited thereto.

In the present invention, the Aspergillus duck material strain may be the Aspergillus duck material NYO2 strain deposited under the accession number KCTC14898BP.

In the present invention, the concentration of the reaction solution may be 0.01 to 1.00% (v/v) based on the total enzyme reaction product.

When the reaction solution is a fraction of the culture supernatant of the Aspergillus niger strain, the fraction of the culture supernatant may include β-glucosidase, cellulase, hemicellulase, and protease, preferably The concentration of the reaction solution is 0.02 to 1.00% (v/v), 0.05 to 1.00% (v/v), 0.08 to 1.00% (v/v), 0.10 to 1.00% (v/v) based on the total enzyme reaction product. , 0.01 to 0.50% (v/v), 0.02 to 0.50% (v/v), 0.05 to 0.50% (v/v), 0.08 to 0.50% (v/v), 0.10 to 0.50% (v/v) , 0.01 to 0.20% (v/v), 0.02 to 0.20% (v/v), 0.05 to 0.20% (v/v), 0.08 to 0.20% (v/v), 0.10 to 0.20% (v/v) , may be 0.01 to 0.10% (v/v), 0.02 to 0.10% (v/v), or 0.05 to 0.10% (v/v), for example, 0.08 to 0.20% (v/v). It may be, but is not limited to this.

When the reaction solution is a culture supernatant of Aspergillus oryzae strain, the concentration of the reaction solution is preferably 0.02 to 1.00% (v/v), 0.05 to 1.00% (v/v), based on the total enzyme reaction product. 0.08 to 1.00% (v/v), 0.10 to 1.00% (v/v), 0.20 to 1.00% (v/v), 0.50 to 1.00% (v/v), 0.01 to 0.80% (v/v), 0.02 to 0.80% (v/v), 0.05 to 0.80% (v/v), 0.08 to 0.80% (v/v), 0.10 to 0.80% (v/v), 0.20 to 0.80% (v/v), 0.50 to 0.80% (v/v), 0.01 to 0.50% (v/v), 0.02 to 0.50% (v/v), 0.05 to 0.50% (v/v), 0.08 to 0.50% (v/v), Alternatively, it may be 0.10 to 0.50% (v/v), for example, 0.20 to 0.50% (v/v), but is not limited thereto.

In the present invention, the concentration of the substrate composition may be 0.10 to 15.00% (v/w), preferably 0.50 to 15.00% (v/w), 1.00 to 15.00% (v/w), based on the total enzyme reaction. ), 2.50 to 15.00% (v/w), 5.00 to 15.00% (v/w), 0.10 to 10.00% (v/w), 0.50 to 10.00% (v/w), 1.00 to 10.00% (v/w) ), 2.50 to 10.00% (v/w), 5.00 to 10.00% (v/w), 0.10 to 7.50% (v/w), 0.50 to 7.50% (v/w), 1.00 to 7.50% (v/w) ), 2.50 to 7.50% (v/w), 5.00 to 7.50% (v/w), 0.10 to 5.00% (v/w), 0.50 to 5.00% (v/w), or 1.00 to 5.00% (v/ w), for example, 2.50 to 5.00% (v/w), but is not limited thereto.

In the present invention, the citron enzyme reaction product reacts with the reaction solution to improve solubility, water holding capacity (WHC), oil holding capacity (OHC), and swelling capacity (SC) compared to the substrate composition. One or more characteristics selected from the group consisting of may be improved. With the improvement of these properties, the yuzu enzyme reaction product of the present invention is well hydrated in water and its bioavailability is greatly improved, so that it can be effectively used as a food composition for diet.

When using the health functional food composition of the present invention as a food additive, the health functional food composition can be added as is or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. In general, when manufacturing a food or beverage, the health functional food composition of the present invention may be added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials.

There are no special restrictions on the types of foods above. Examples of foods to which the above substances can be added include meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, etc. These include alcoholic beverages and vitamin complexes, and include all foods in the conventional sense.

The beverage may contain various flavors or natural carbohydrates as additional ingredients. The above-mentioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. . The ratio of the natural carbohydrates can be appropriately determined by the selection of a person skilled in the art.

In addition to the above, the health functional food composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, and glycerin. , alcohol, and carbonating agents used in carbonated beverages. In addition, the health functional food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients can be used independently or in combination. The proportions of these additives can also be appropriately selected by those skilled in the art.

The present invention relates to a method for producing a citron enzyme reaction with reduced bitterness and a health functional food composition for diet containing the same. The citron enzyme reaction product not only effectively reduces the inherent bitterness of citron, but also improves solubility by reducing particle size. The uniformity and dispersion also increased, and the dietary fiber isolated from this is expected to be useful in suppressing fat production or promoting lipolysis, so it can be effectively used in the production of a health functional food composition for diet.

Figure 1 is a schematic diagram showing the phylogenetic tree of the Aspergillus oryzae NYO-2 strain deposited with the accession number KCTC 14898BP, identified according to an embodiment of the present invention.
Figure 2a is a photograph of the results of TLC (Thin Layer Chromatography) analysis showing changes in bitter taste components by reacting a commercial enzyme with a citron sample according to an embodiment of the present invention.
Figure 2b is a photo of the TLC analysis results showing changes in bitter taste components in the group treated with the strain culture supernatant of the citron sample according to an embodiment of the present invention.
Figure 3 is a graph showing the removal rates of naringin and neohesperidin in the group treated with commercial enzyme and strain culture supernatant for citron samples according to an embodiment of the present invention.
Figure 4 is a graph showing the removal rate of naringin and neohesperidin in a group treated with KN enzyme and culture supernatant of Aspergillus duckweed NYO2 strain for samples of each citron substrate according to an embodiment of the present invention.
Figure 5a is a photograph showing the removal rates of naringin and neohesperidin in the KN enzyme treatment group at each concentration of citron samples according to an embodiment of the present invention.
Figure 5b is a photograph showing the removal rates of naringin and neohesperidin in the KN enzyme treatment group with different concentration of citron substrate samples according to an embodiment of the present invention.
Figure 5c is a photograph showing the removal rates of naringin and neohesperidin according to reaction time in the KN enzyme treatment group for citron samples according to an embodiment of the present invention.
Figure 6a is a graph showing the removal rates of naringin and neohesperidin in enzyme treatment groups at different concentrations for citron samples according to an embodiment of the present invention.
Figure 6b is a graph showing the removal rates of naringin and neohesperidin in the KN enzyme treatment group with different citron substrate sample concentrations according to an embodiment of the present invention.
Figure 6c is a graph showing the removal rates of naringin and neohesperidin according to reaction time in the KN enzyme treatment group for citron samples according to an embodiment of the present invention.
Figure 7a is a photograph showing the removal rates of naringin and neohesperidin by concentration in groups treated with Aspergillus oryzae NYO2 strain culture supernatant at different concentrations for citron samples according to an embodiment of the present invention.
Figure 7b is a photograph showing the removal rate of naringin and neohesperidin in a group treated with the culture supernatant of Aspergillus duckweed NYO2 strain with different concentration of citron substrate samples according to an embodiment of the present invention.
Figure 7c is a photograph showing the removal rate of naringin and neohesperidin according to reaction time in the group treated with the Aspergillus oryzae NYO2 strain culture supernatant for the citron sample according to an embodiment of the present invention.
Figure 8a is a graph showing the removal rate of naringin and neohesperidin by concentration in the Aspergillus oryzae NYO2 strain culture supernatant treatment group at each concentration for the citron sample according to an embodiment of the present invention.
Figure 8b is a graph showing the removal rates of naringin and neohesperidin in groups treated with culture supernatant of Aspergillus duckweed NYO2 strain with different concentration of citron substrate samples according to an embodiment of the present invention.
Figure 8c is a graph showing the removal rate of naringin and neohesperidin according to reaction time in the Aspergillus duck material NYO2 strain culture supernatant treatment group for the citron sample according to an embodiment of the present invention.
Figure 9a is a photograph of a sample of a KN enzyme treatment and NYO2 strain culture supernatant treatment group for a green citron sample according to an embodiment of the present invention.
Figure 9b is a photograph of a sample of a group treated with KN enzyme treatment and NYO2 strain culture supernatant for a yellow citron sample according to an embodiment of the present invention.
Figure 10a is an electronic tongue analysis graph confirming the taste change of the KN enzyme treatment and NYO2 strain culture supernatant treatment group for the green citron sample according to an embodiment of the present invention.
Figure 10b is an electronic tongue analysis graph confirming the taste change of the KN enzyme treatment and NYO2 strain culture supernatant treatment group for the yellow citron sample according to an embodiment of the present invention.
Figure 11 is an electronic tongue analysis graph confirming the degree of bitterness reduction in the KN enzyme treatment and NYO2 strain culture supernatant treatment group for green citron and yellow citron samples according to an embodiment of the present invention.
Figure 12a is a graph confirming the powder size and dispersion of the KN enzyme treatment and NYO2 strain culture supernatant treatment group for the green citron sample according to an embodiment of the present invention.
Figure 12b is a graph confirming the powder size and dispersion of the KN enzyme treatment and NYO2 strain culture supernatant treatment group for the yellow citron sample according to an embodiment of the present invention.
Figure 13 is a graph showing the results of FTIR analysis confirming the structural changes in the KN enzyme treatment and NYO2 strain culture supernatant treatment groups for citron samples according to an embodiment of the present invention.
Figure 14 is a scanning electron microscope (SEM) photograph of the surface of a citron sample according to an embodiment of the present invention.
Figure 15 is a photograph confirming the inhibitory effect of adipocyte differentiation of a citron sample according to an embodiment of the present invention.
Figure 16a is a graph confirming the effect of suppressing adipocyte differentiation of a green citron sample according to an embodiment of the present invention.
Figure 16b is a graph confirming the effect of suppressing adipocyte differentiation of a yellow citron sample according to an embodiment of the present invention.
Figure 17a is a graph confirming the effect of promoting lipolysis of a green citron sample according to an embodiment of the present invention.
Figure 17b is a graph confirming the effect of promoting lipolysis of a yellow citron sample according to an embodiment of the present invention.
Figure 18 is a graph showing the fatty acid synthase content of a citron sample according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Throughout this specification, “%” used to indicate the concentration of a specific substance means (weight/volume)% for solid/solid, (weight/volume)% for solid/liquid, and Liquid/liquid is (volume/volume)%.

All experimental results were measured three times and were expressed as the average value and standard deviation. The results were analyzed using SPSS program (v27.0, IBM Company, Chicago, IL, USA), and Duncan's multiple range test was performed at the p<0.05 level to test the significance difference between samples.

Example 1: Enzyme conditioning to remove bitter taste components from citron powder

1-1. Selection of enzymes

In this study, the South Sea variety of green citron was obtained from the Wando test site of the Orchard Research and Experiment Center of the Jeollanam-do Agricultural Research and Extension Services, and the green citron was freeze-dried, made into powder, stored at -80°C, and used in the experiment. The powder was homogenized using a 60 mesh sieve.

To remove the bitter taste of green citron, green citron powder was reacted with a commercially available enzyme. When performing TLC and HPLC analysis, the supernatant obtained by dissolving citron powder in water at a concentration of 5% was applied to the untreated group without enzyme treatment. Standard substances include naringin (Ng), prunin (P), naringenin (Nn), neohesperidin (Neo), hesperitin (Ht), hesperidin (Hd), rhamnose (Rha), fructose (Fru), Glucose (Glc), sucrose (Suc), and dextrin (Sigma-Aldrich, St.Louis, MO, USA) were used, and when naringin was reduced compared to the reaction solution without enzyme (enzyme blank; EB), the treated It can be judged that the enzyme has excellent naringin decomposition ability.

For commercial enzymes, XXL, RP, RF, CP, UF, PR, SP-L, KN (Celluase KN, B-glucosidase 20 U/g Vision Biocam), 100L were used.

Commercial enzymes and derived strains for bitter taste removal number product Derived bacteria activation One XXL Aspergillus niger, Aspergillus aculeatus Pectin lyase, polygalacturonase 2 RP Aspergillus niger polygalacturonase 3 RF Aspergillus niger, Trichodermalongibrachiatum Polygalacturonase, cellulase
Hemicellulase 4 CP Aspergillus niger Pectin degrading enzyme, polygalacturonase, 5 UF Aspergillus niger Pectinase, Glucanase, Hemicellulase 6 PR Aspergillus niger Pectin decomposition enzyme, pectin methylesterase 7 SP-L Aspergillus aculeatus polygalacturonase 8 KN Aspergillus niger β-glucosidase, cellulase, hemicellulase, protease 9 100L Aspergillus niger polygalacturonase

In the case of strain-derived enzymes, enzymes derived from the Aspergillus oryzae NYO-2 strain deposited under the accession number KCTC 14898BP, which were found to have excellent naringin decomposition ability, were treated with citron powder, and the test strain A. oryzae KTCC was used as a control. Enzyme derived from strain 6377 was used.

For the Aspergillus duckweed NYO-2 strain, samples collected from 16 types of traditional foods using yuzu were suspended and cultured on a nutrient medium, and 690 colonies picked from them were isolated and cultured to select single colonies. This strain was selected by selecting 69 strains with excellent naringin decomposition ability, selecting 6 strains with high glycolysis efficiency, and then confirming the characteristics of the best naringin decomposition ability. The phylogenetic tree was analyzed as shown in Figure 1 according to maximum-likelihood using the MEGA 2.1.0 package, and the 18S rRNA sequence is shown in Table 2 below.

sequence number designation Sequence (5'->3') One 18S rRNA_NYO-2 ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAA TGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAA CGCAAATCAATCTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCG

To obtain strain-derived enzymes, each strain was inoculated into 10 mL of MDN medium (Davis minimal broth, Dipotassium phosphate 0.7%, Monopotassium phosphate 0.2%, Sodium citrate 0.05%, Magnesium sulfate 0.01% and Ammonium sulfate 0.1%) and incubated at 37°C. The culture was cultured for 7 days while stirring at 120 rpm. The cultured strain was centrifuged at 8,000 rpm for 10 minutes (6200, Kubota, Tokyo, Japan), and the supernatant was used as an enzyme solution.

1-2. Carrying out enzyme reactions

For the enzyme reaction, 50 mg of green citron powder was dissolved in 0.9 mL of 20 mM sodium-acetate buffer solution, and then enzyme was added to a final concentration of 0.1%. The reaction was conducted at 37°C for 12 hours, and upon completion of the reaction, the enzyme was deactivated at 100°C for 15 minutes, and the supernatant was subjected to TLC (Thin Layer Chromatography) and HPLC (high-performance liquid chromatography) analysis.

For TLC analysis (primary screening), 1 μL of the enzyme reaction solution was spotted on a silica gel TLC plate, and the developing solvent was ethyl acetate:acetic acid:DW (3:1:1, v/v/v) ) was developed once for 45 minutes, and the TLC plate was immersed in UV 245 nm and a coloring solvent (a solution of 5 mL of sulfuric acid, 95 mL of methanol, and 0.05 g of N-(1-naphthyl) ethylenediamine) and then incubated at 120°C. Bake for 5 minutes and check the spot.

Mean Naringin Neohesperidin Removal rate (%) Untreated 9.22 7.71 0.00 XXL 8.48 6.90 9.16 RP 1.00 2.57 78.92 RF 1.20 1.40 84.64 CP 7.43 6.06 20.33 UF 8.13 6.04 16.27 PR 8.22 6.56 12.66 SP-L 8.05 8.66 1.33 KN 1.50 0.40 88.78 100 L 2.00 0.50 85.23 Disclosure strain 7.06 2.93 40.99 Patented strain 3.36 1.11 73.57

As can be seen in Table 3 and Figures 2a and 2b, when compared to the untreated group on TLC, XXL, RP, RF, CP, UF, PR, SP-L, KN, 100L contained naringin and neohesperidin by 9.2% and 78.9%, respectively. Among them, KN showed the best performance in reducing bitterness by reducing both naringin and neohesperidin by more than 88%.

For HPLC analysis, the flavonoid content of the sample was measured with naringin and neohesperidin, and 1216 Infinity LC (Agilent Technologies, Inc., Santa Clara, CA, USA) was used. It was confirmed at 280 nm using C18 (Eclipse plus C18, 4.6 Acetonitrile (A) and 0.1% formic acid mixed with distilled water (B) were used as mobile phase solvents. When starting with the flow rate maintained at 1 mL/min, A : 20, B: 80; At 5-10 minutes, A: 40, B: 60; For 10-15 minutes, A: 50, B: 50; When 15-20 minutes, A: 70, B: 30; At 20-25 minutes, A: 100, B: 0 were analyzed for 25 minutes. Naringin and neohesperidin used as standards were purchased from Sigma-Aldrich.

In addition, as can be seen in Figure 3, naringinase derived from the Aspergillus oryzae NYO-2 strain has a removal rate of naringin and neohesperidin of 73.6% compared to the 40% removal rate shown in KTCC 6377 (the test strain). It seemed to decrease by about two-fold.

Therefore, reaction conditions that can efficiently reduce bitterness were investigated using KN in a commercial enzyme and an enzyme derived from the edible strain Aspergillus oryzae NYO-2.

1-3. Enzyme treatment for each citron sample for substrate selection

Enzyme reactions were performed with various citron samples using the enzyme selected through TLC and HPLC in Example 1-1. Citron samples were made by freeze-drying and pulverizing a total of five types of yuzu fruit solids (citron extract), green citron peel (green skin), yellow citron peel (yellow skin), whole green citron (green whole), and whole yellow citron (yellow whole). 50 mg of each citron sample powder was dissolved in 0.9 mL of 20 mM sodium-acetate buffer solution, and then enzyme was added to a final concentration of 0.1% and reacted for 24 hours. Aliquots were collected at 0, 6, 12, and 24 hours after the reaction, and the contents of naringin and neohesperidin were compared.

Comparison of bitter taste component removal rates for each citron sample using KN derived from Aspergillus niger reaction time (h) Naringin
(mg/g) Neohesperidin
(mg/g) entire
(mg/g) removal rate
(%) Yujacheong 0 1.05f 1.79f 2.84 0.00 6 0.00g 0.00g 0.00 100.00 12 0.00g 0.00g 0.00 100.00 Cheongyu fruit peel 0 13.11a 13.93a 27.04 0.00 6 7.49c 6.96bc 14.46 46.52 12 3.25d 3.17d 6.42 76.26 yellow citron fruit peel 0 8.45bc 7.60b 16.05 0.00 6 4.33d 3.44d 7.77 51.59 12 1.35e 1.84f 3.19 80.12 Whole Cheongyuja 0 10.55ab 7.76b 18.31 0.00 6 3.75d 2.90de 6.64 63.74 12 0.93f 1.66def 2.59 85.85 whole yellow citron 0 8.94abc 6.55c 15.49 0.00 6 3.39d 2.75de 6.14 60.36 12 1.20e 1.73def 2.93 81.08

As can be seen in Table 4 and Figure 4, KN enzyme removes bitter taste components naringin and neohesperidin by 100.0%, 76.3%, 80.1%, 85.6%, 81.1% after 12 hours of reaction in yujacheong, green bark, yellow bark, green whole body, and yellow whole body. % removed.

Comparison of bitter taste component removal rates for each citron sample using culture supernatant of Aspergillus oryzae NY0-2 strain reaction time (h) Naringin
(mg/g) Neohesperidin
(mg/g) entire
(mg/g) removal rate
(%) Yujacheong 0 0.77df 1.36hi 2.13 0.00 6 0.00g 0.00j 0.00 100.00 12 0.00g 0.00j 0.00 100.00 24 0.00g 0.00j 0.00 100.00 Cheongyu fruit peel 0 10.15a 13.37a 23.51 0.00 6 7.45bc 7.11d 14.55 38.11 12 0.52f 1.69h 2.21 90.60 24 0.00g 0.92i 0.92 96.09 yellow citron fruit peel 0 6.86bc 7.19b 14.05 0.00 6 2.55d 4.02d 6.58 53.17 12 1.10e 2.65f 3.76 73.24 24 0.00g 0.00j 0.00 100.00 Whole Cheongyuja 0 7.65bc 6.95b 14.60 0.00 6 3.26d 4.30d 7.57 48.15 12 1.36d 3.20f 4.56 68.77 24 0.00g 0.00j 0.00 100.00 whole yellow citron 0 6.44c 5.84bc 12.28 0.00 6 2.41d 3.45df 5.86 52.28 12 0.48e 1.99g 2.47 79.89 24 0.00g 0.00j 0.00 100.00

As can be seen in Figure 4 and Table 5, the enzyme derived from the Aspergillus oryzae NYO-2 strain is the bitter taste components naringin and neohesperidin after 12 hours of reaction in the solid content of citron citron, green citron peel, yellow citron peel, whole green citron, and whole yellow citron. 100%, 90.6%, 73.2%, 68.7%, 79.8% were removed.

1-4. Enzyme reaction optimization

The reaction to reduce naringin and neohesperidin contained in whole green citron was optimized using KN enzyme and Aspergillus oryzae NYO2 strain culture supernatant.

In the case of KN, the enzyme reaction conditions were based on 5% substrate, 0.1% enzyme, and 12-hour reaction, and were optimized by changing only the substrate concentration, enzyme concentration, and reaction time. The naringin and neohesperizin content of the reaction sample was measured using HPLC.

Enzyme concentration (%) Naringin Neohesperidin Removal rate (%) 0.000 10.92 8.77 0.00 0.010 6.10 4.37 46.84 0.025 5.31 3.85 53.47 0.050 2.74 2.46 73.59 0.075 0.75 1.51 88.51 0.100 0.61 1.49 89.34 0.250 0.00 0.00 100.00

As can be seen in Table 6 and Figures 5a and 6a, the enzyme concentration was used as 0, 0.01, 0.025, 0.05, 0.075, 0.1, and 0.25% of the total concentration of the enzyme reaction solution, and in the 0.1% enzyme addition group, untreated Naringin and neohesperidin decreased by 89.3% compared to the group.

Before reaction After reaction Substrate concentration (%) Naringin Neohesperidin Naringin Neohesperidin 0.10 0.47 0.40 0.00 0.00 0.50 0.95 0.80 0.00 0.00 1.00 1.89 1.59 0.00 0.00 2.50 4.73 3.98 0.00 0.00 5.00 9.46 7.95 0.00 0.00 7.50 14.18 11.93 0.36 1.38 10.00 18.91 15.90 1.83 2.10 15.00 28.37 23.86 7.39 4.58

As can be seen in Table 7 and Figures 5b and 6b, the substrate concentration was used by dissolving the sample at 0.1, 0.5, 1, 2.5, 5, 7.5, and 10%, and when 5% was dissolved, naringin and neohesperidin were each 100%. It was removed and not detected.

reaction time (h) Naringin Neohesperidin Removal rate (%) 0 8.94 6.55 0.00 One 8.46 6.16 5.58 2 7.49 5.79 14.30 3 5.76 4.65 32.79 4 5.06 3.92 42.00 6 3.39 2.75 60.37 10 1.77 1.84 76.72 12 1.20 1.73 81.08 15 0.48 1.46 87.44 24 0.00 1.41 90.92

As can be seen in Table 8 and Figures 5c and 6c, the reaction time was confirmed by aliquoting 0, 1, 2, 3, 4, 6, 10, 12, 15, and 24 hours after reaction, and the reaction was conducted after 12 hours. When doing this, naringin and neohesperidin each had a removal rate of 81%. It was confirmed that the removal rate compared to time was the highest and was efficiently reduced after 12 hours.

For NYO2, the enzyme reaction conditions were based on 5% substrate, 0.5% enzyme, and 24-hour reaction, and were optimized by changing only the substrate concentration, enzyme concentration, and reaction time.

The enzyme concentration of NYO2 was used at a final concentration of 0, 0.01, 0.025, 0.05, 0.075, 0.1, 0.25, 0.5, and 1% of the enzyme reaction solution.

EC(%) Naringin Neohesperidin Removal rate (%) - 8.79 7.91 0.00 0.010 8.16 7.49 6.32 0.025 7.45 7.11 12.91 0.050 6.68 6.68 20.05 0.075 6.01 7.12 21.44 0.100 5.03 6.02 33.85 0.250 1.62 3.10 71.74 0.500 0.13 1.84 88.19 1.000 0.00 0.61 96.33

As can be seen in Table 9 and Figures 7a and 8a, when the enzyme concentration was set to 0.5%, naringin and neohesperidin were measured at 0.13 and 1.84 mg/g, respectively, resulting in a removal rate of 88.2%, the highest compared to the untreated group and the enzyme-treated group. showed an efficient reduction.

Substrate concentration (%) Before reaction After reaction Naringin Neohesperidin Naringin Neohesperidin 1.00 1.99 1.75 0.00 0.00 2.50 4.73 3.98 0.00 0.00 5.00 9.46 7.95 0.00 1.67 6.50 12.29 9.94 0.49 2.64 9.00 16.64 14.71 1.63 4.28 10.00 18.91 15.90 2.21 5.39

As can be seen in Table 10 and Figures 7b and 8b, the substrate concentration was used by dissolving the entire Cheongyuja at 1, 2.5, 5, 6.5, 8.5, and 10%, and when 5% was dissolved, naringin and neohesperidin were each 0.00. , 1.67 mg/g, which was found to remove most of the bitter ingredients compared to the added amount.

reaction time (h) Naringin Neohesperidin Removal rate (%) 0 7.65 6.95 0.00 2 5.66 5.89 20.84 4 5.02 5.42 28.50 6 3.26 4.30 48.18 8 2.42 3.68 58.21 10 1.42 3.08 69.20 12 1.36 3.20 68.79 15 0.30 2.26 82.45 24 0.00 0.00 100.00

As can be seen in Table 11 and Figures 7c and 8c, the reaction time was confirmed by aliquoting at 0, 1, 2, 3, 4, 6, 8, 10, 12, 15, and 24 hours after reaction, and when reacting for 15 hours It was confirmed that naringin and neohesperidin were reduced most efficiently at 0.3 and 2.26 mg/g, respectively, with a removal rate of about 82.5%.

Therefore, the enzyme reaction conditions are 5% substrate, 0.1% enzyme, and 12 hours for the KN enzyme, and 5% substrate, 0.5% enzyme, and 15 hours for the NYO2 strain supernatant. When applying the reaction conditions, naringin and neohesperizin are efficient. It was confirmed that it was reduced to . As a result, both the KN-treated group and the NYO2-treated group showed a decrease of more than 80% compared to the naringin and neohesperidin content before the enzyme reaction. Therefore, citron powder with reduced bitterness was prepared by reacting whole green citron powder with KN enzyme and NYO2 strain supernatant, and material properties and efficacy were evaluated.

Example 2: Investigation of properties of citron powder with reduced bitterness

2-1. Quality characteristics of citron powder

Powder prepared by freeze-drying whole green yuzu or yellow yuzu was analyzed by photographing the powder after freeze-drying the entire enzyme reaction product treated with KN enzyme and NYO2 strain culture supernatant.

As can be seen in Figures 9a and 9b, the yellow color increased in the NYO2 strain culture supernatant treatment group.

Next, 1 g of enzyme-treated samples of green citron and yellow citron powder were dissolved in distilled water at 10% (v/v), and the pH, acidity, sugar content, and color were measured and compared.

pH was measured in dissolved samples using a pH meter (Benchtop pH Meter, MettlerToledo, Columbus, OH, USA).

Acidity was measured by adding 2-3 drops of 1% (v/v) phenolphthalein (Junsei chemical Co., Ltd., Tokyo, Japan) to the sample and then adding 0.1 N NaOH (Sigma-Aldrich, St.Louis, MO, After measuring NaOH consumption by titration using (USA), the total acidity of the sample was converted to citric acid (Sigma-Aldrich, St.Louis, MO, USA).

Sugar content was measured in dissolved samples using a refractometer (digital handheld PAL-1, ATAGO Co., Ltd, Tokyo, Japan).

Chromaticity was measured using a colorimeter (Handheld color spectrophotometer 45/0 NS 800, Shenzhen 3nh Technology Co., Ltd, Shenzhen, China), L (Lightness), a (Redness), b (yellowness), and ΔE (Total color difference). Measured.

Physical properties of blue citron and yellow citron according to enzyme treatment Sample pH acidity
(%) Sugar content
(Brix) Chromaticity (Hunter’s color value) L a b ΔE Hwang Yuja Con 3.41 ± 0.02 14.55 ± 1.27 3.23 ± 0.12 92.926 ± 0.003 0.146 ± 0.005 36.370 ± 0.002 98.868 ± 0.004 KN 3.62 ± 0.03 14.07 ± 0.32 3.77 ± 0.06 86.632 ± 0.006 2.405 ± 0.004 38.664 ± 0.018 93.997 ± 0.013 NYO2 4.03 ± 0.01 15.51 ± 0.94 3.70 ± 0.00 81.554 ± 0.007 4.609 ± 0.002 41.692 ± 0.011 90.832 ± 0.011 Cheong Yuja Con 3.48 ± 0.02 15.27 ± 0.73 2.80 ± 0.00 87.305 ± 0.010 -3.847 ± 0.005 26.884 ± 0.005 90.485 ± 0.011 KN 3.70 ± 0.03 16.39 ± 0.35 3.43 ± 0.06 82.366 ± 0.004 -1.081 ± 0.003 28.891 ± 0.008 86.358 ± 0.006 NYO2 3.94 ± 0.01 16.39 ± 0.30 3.23 ± 0.06 79.999± 0.004 0.527 ± 0.005 32.139 ± 0.002 85.297 ± 0.003

As can be seen in Table 12, pH showed an increase in the group treated with KN enzyme or NYO2 strain culture supernatant compared to the untreated group, and in particular, it increased by more than 20% in the group treated with NYO2 strain culture supernatant for Cheongyuja. Sugar content tended to increase upon enzyme treatment, and it was believed that this was because sugar components were liberated through decomposition of cellulose and hemicellulose. The color yellowness ( b ) increased upon enzyme treatment, and bitterness-reduced citron powder with increased overall preference was produced.

2-2. Dietary fiber content analysis

Commercial enzymes and enzymes derived from native bacteria include a variety of enzymes in addition to enzymes that deglycosylate naringin and neohesperidin, and among them, enzymes related to structural changes in dietary fiber are also included.

To measure the content of dietary fiber, acid detergent fiber (ADF), neutral detergent fiber (NDF), lignin, and pectin were measured. Mix 0.5 g of sample with 200 mL of acidic surfactant solution and 200 mL of neutral surfactant solution, filter at 100°C for 1 hour, and use 40 mL of water (90°C) and 40 mL of acetone to remove the color of the residue. After washing until dry, it was dried at 105°C for 12 hours and its weight was measured.

ADF and NDF were calculated by dividing the weight of the sample by the weight of the residue. For lignin, 15 mL of 72% sulfuric acid was added to 0.5 g of the sample, mixed for 2 hours, and then 356 mL of distilled water was added to dilute the sulfuric acid to 3%. It was filtered at 98°C for 3 hours, washed with 150 mL of hot water, dried in an oven at 105°C, and then weighed. Lignin was calculated by dividing the weight of the sediment by the weight of the sample, cellulose was calculated as the difference in content between ADF and lignin, and hemicellulose was calculated as the difference in content between NDF and ADF. Pectin was measured using a pectin kit (pectin identification kit, Megazyme, Ireland), and the calibration curve used low ester pectin extracted from citrus fruits.

Changes in total dietary fiber content according to enzyme treatment of green citron and yellow citron (%) TDF SDF IDF SDF/IDF Cheong Yuja Con 49.45ab 18.21ab 31.24a 0.58 KN 51.19a 21.41a 29.78a 0.72 NYO2 47.16ab 21.52a 25.64ab 0.84 Hwang Yuja Con 35.74b 21.90ab 13.84a 1.58 KN 39.26a 27.13a 12.13b 2.24 NYO2 36.70b 27.04a 9.66c 2.80

As can be seen in Table 13, as a result of dietary fiber analysis, the total dietary fiber (TDF) content of both green citron and yellow yuja did not change significantly, but soluble dietary fiber (SDF) tended to increase. Insoluble dietary fiber (IDF) showed a tendency to decrease.

In particular, in the group treated with NYO2 strain culture supernatant for yellow citron, IDF showed a decrease of more than 33%, and in the case of SDF, it increased by more than 25%. The dietary fiber content of yellow yuja was three times higher than that of green yuja, and the ratio of soluble and insoluble dietary fiber increased by 24% and 45% in green yuja and 45% in yellow yuja, respectively, in the KN enzyme or NY02 strain culture supernatant treatment group compared to the untreated group, respectively. increased by 42% and 77%.

Changes in dietary fiber composition according to enzyme treatment of green citron and yellow citron (mg/g) Cellulose Hemicellulose Lignin pectin entire Cheong Yuja Con 67.8a 56.0a 70.4a 188.8a 273.5 KN 33.8b 46.2b 35.8bc 163.5c 158.2 NYO2 34.9b 39.3bc 42.6b 166.1b 167.1 Hwang Yuja Con 83.3a 29.8a 39.2a 205.8a 230.2 KN 67.8ab 16.4b 23.2b 184.3ab 180.5 NYO2 19.6c 21.7ab 39.6a 177.5c 121.0

As can be seen in Table 14, cellulose, hemicellulose, lignin, and pectin, which are components of dietary fiber, all tended to decrease in the KN enzyme or NYO2 strain culture supernatant treatment group for whole green citron and yellow citron powder. In particular, total dietary fiber decreased by 32% and 40% for green citron, and 22% and 48% for yellow citron, respectively, in the group treated with KN enzyme or NYO2 strain culture supernatant. Among the ingredients, the insoluble dietary fibers cellulose and hemicellulose were greatly reduced, improving water solubility.

2-3. Free sugar content analysis

After the enzyme reaction occurred, the bonds between cellulose and hemicellulose were broken, and the cell wall collapsed, releasing glucose, xylose, galacturonic acid, and fructose. This showed a similar pattern to the decrease in cellulose and hemicellulose content in the dietary fiber content analysis. Additionally, it can be viewed in the same context as the decomposition of cellulose, hemicellulose, and lignin in FT-IR.

In order to measure the free sugars contained in green citron and yellow citron powder after enzyme reaction, 1216 Infinity LC (Agilent Technologies, Inc., Santa Clara, CA, USA) was used. Carbohydrate (5 μm, 4.6 The measurement was performed for 45 minutes while maintaining the column oven temperature of 40°C, injection volume of 10 μL, and flow rate of 0.6 mL/min, and galacturonic acid, glucose, fructose, sucrose, and arabinose were used as standard substances. RID-10A (Agilent Technologies, Inc., Santa Clara, CA, USA) was used as a detector.

(mg/g) Rhamnose Xylose Fructose Glucose Sucrose Glalacturonic
acid Total Cheong Yuja Con 0.000c 0.000c 2.917c 2.423c 6.836a 0.000c 12.18 KN 3.602a 0.428a 4.470a 4.226a 4.022b 0.268ab 17.27 NYO2 2.188b 0.151b 3.482b 3.317b 4.223b 0.360a 14.13 Hwang Yuja Con 0.000b 0.000c 7.879c 6.890c 5.349a 0.000c 20.12 KN 2.425a 1.223a 9.010a 8.485a 3.271b 0.520a 24.68 NYO2 2.350a 1.047b 7.850b 7.074b 3.590b 0.771b 21.93

As can be seen in Table 15, glucose and rhamnose, which are dividend components of naringin and neohesperidin, were detected as free sugars. Sucrose showed a decrease in both green citron and yellow yuja due to an enzyme reaction. In particular, the KN enzyme-treated group of green citron decomposed the most rhamnose at 3.61 mg/g, and glucose also showed a 1.7-fold increase compared to the untreated group.

The free sugar content of green citron and yellow citron increased by 30-40% overall in the enzyme treatment group, and in particular, rhamnose produced by decomposition from naringin and neohesperidin increased significantly. It was confirmed that hemicellulose was decomposed, xylose and glucose increased, and pectin was decomposed to produce galactronic acid.

2-4. Analysis of changes in bitter taste components

The electronic tongue has 7 sensors (CTS = salty; PKS = sweet; NMS = umami; ANS = bitter; AHS = sour; cofactors = CPS, SCS). Aside from naringin and neohesperidin, the bitter taste of citron contains a variety of ingredients, and it is difficult to judge bitterness with just one sensor.

Therefore, naringin was added to CON at different concentrations of 0.1, 0.25, and 0.5%, and bitterness based on naringin was added using a new sensor. Rather than chemically measuring ingredients, the sensor detected the overall taste of the sample and displayed each sensor's sensitivity within the range of 0-10.

For electronic tongue analysis, 5 g of citron powder was dissolved in distilled water at a 5% concentration, and then 100 mL of the solution was measured for 120 seconds using an electronic tongue (Astree2, Alpha MOS, Toulouse, France). Measurements were repeated five times for each sample, and the taste component pattern of each sample was analyzed through discriminant function analysis (DFA) using the program AlphaSoft 17 ver. (Alpha MOS, Toulouse, France) provided by Alpha MOS. Derived.

As a result, the bitter taste based on naringin was reduced in the group treated with KN enzyme or NYO2 strain culture supernatant for both green citron and yellow citron compared to the untreated group, and the overall taste became richer. In particular, the NYO2 strain culture supernatant treatment group was judged to be superior in terms of sensory quality, with increased umami, sourness, and salty taste compared to the KN enzyme treatment group.

Cheong Yuja Con 845mg/mL KN 45 mg/mL NYO2 24mg/mL Hwang Yuja Con 247 mg/mL KN 38mg/mL NYO2 6 mg/mL

As can be seen in Table 16 and Figures 10a, 10b, and 11, as a result of analyzing the degree of reduction in bitterness based on naringin using electronic tongue, in Cheongyuja, 5.0% in the KN enzyme-treated group compared to the untreated group, and NY02 strain culture supernatant. In the treatment group, only 2.9% bitterness remained. In addition, yellow citron showed a bitter taste of 15.4% in the KN enzyme treated group and 2.5% in the NY02 strain culture supernatant treated group compared to the untreated group.

In general, green citron was four times more bitter than yellow citron, which can be seen to be equivalent to 845 mg of naringin.

2-5. Investigation of physical characteristics of enzyme-treated citron powder

2-5-1. Particle size analysis

To investigate particle size and dispersion, it was measured using a nanoparticle size analyzer (ELSZ-2000ZS, Otsuka Electronics Co., Ltd.). Blue citron and yellow citron powder were dissolved at 0.1% in distilled water, 2 mL was added to a cell, and measurements were repeated three times at 25°C.

Compared to the untreated group, the group treated with KN enzyme or NYO2 strain culture supernatant for green citron and yellow citron lowered the dispersion degree and made the particle size smaller. In particular, in the case of yellow yuja, the particle size was reduced by more than 80% in the NYO2 strain culture supernatant treated group compared to the untreated group. When the particle size is reduced, the aqueous solution and surface area increase, improving solubility and increasing water solubility.

Measurement of size and dispersion of blue citron and yellow citron according to enzyme treatment Sample Particle size (Dia. nm) Uniformity (PDI) Dispersion (Zeta potential, mV) Hwang Yuja Control 316.3±15.9a 0.38±0.03a -23.96±2.09a KN 188.1±12.4c 0.23±0.04b -35.56±1.4b NYO 210.0±7.8b 0.19±0.03bc -39.99±1.12c Cheong Yuja Control 1184.3±61.4a 0.64±0.04a -21.31±1.27a KN 530.3±19.5b 0.34±0.01b -37.49±2.25b NYO 340.1±41.5c 0.26±0.01bc -39.96±1.45bc

As can be seen in Table 17 and Figures 12a and 12b, the particle size of both yellow and blue citron decreased and the dispersion increased in the enzyme-treated group compared to the untreated group. In particular, the size of the particles was reduced by more than 10 times, producing small particles. The PDI value ranged from 0 to 1. In this case, monodisperse means that the particle size is uniform.

2-5-2. FTIR analysis

To investigate structural changes in blue citron and yellow yuja due to treatment with KN enzyme or NYO2 strain culture supernatant, FTIR (Fourier transform infra-red spectroscopy, perkin Elmer Spectrum 400) was used. The transmittance at the corresponding frequency (3411, 3927, 1730, 1029) changes according to changes in hemicellulose, cellulose, lignin, etc., and 3411, 2927, 1730, and 1029 cm ^-1 are -OH molecules in the cellulose and hemicellulose crystal regions, respectively. Internal hydrogen bonding, peak reduction when -OH collapses due to -OH hydrogen bonding of cellulose, acetyl and uronic ester groups of hemicellulose, COC in lignin or pyranose ring of hemicellulose It means CO and when reduced, it indicates the decomposition of lignin and hemicellulose.

Pectin powder was analyzed for changes in functional groups using a FTIR spectrophotometer (Frontier-89063; PerkinElmer, Inc., Waltham, USA) and a MIR TGS detector, and the measurement wavelength was 500-4000 cm ^-1 .

As can be seen in Figure 13, overall, the amount of change in dietary fiber was greater in the NYO2 strain supernatant treatment group than in the KN enzyme for both yellow citron and green citron, and insoluble dietary fibers such as cellulose, hemicellulose, and lignin were decomposed and decreased more.

2-5-3. Surface analysis using a scanning electron microscope

After enzymatic reaction under 5% green citron or yellow citron substrate conditions, deactivation and freeze-drying were performed, and the surface was confirmed using a scanning electron microscope (SEM). SEM can confirm the three-dimensional structure of the sample surface by injecting electron beams into the sample surface.

Microstructure was observed using a field emission scanning electron microscope (FE-SEM, Gemini 500, Zeiss, Oberkochen, Germany). The dry sample was coated with platinum and observed at an acceleration voltage of 15 kV and 400x magnification.

As can be seen in Figure 14, when comparing the shape of the powder particles of the untreated (control) group and the enzyme-treated group, the surface of the untreated group was smooth, but the surface of the enzyme-treated group was porous. If it takes on a porous appearance, the moisture retention capacity increases, and as the cell wall structure of the citron is destroyed by enzyme treatment, the flavonoids bound to the cell wall are released and transformed into functional dietary fiber.

On the other hand, the appearance of the holes in the KN enzyme or NYO2 strain culture supernatant treatment group showed a different appearance. If the surface pores in the KN enzyme treatment group were regular, the holes in the NYO2 strain culture supernatant treatment group showed irregular holes. It seemed.

Example 3: Formulation stability of functional citron powder

Water holding capacity (WHC) and oil holding capacity (OHC) are closely related to the quality of dietary fiber. Dietary fiber with high water retention capacity can contain a lot of moisture and promotes bowel movements, and dietary fiber with high water retention capacity keeps high-fat foods stable and contributes to extending their shelf life.

To measure moisture retention, 0.5 g of dried sample was mixed with 10 mL of water (1:20, w/v) and left at 25°C for 24 hours. After centrifugation at 4000

Water retention capacity (WHC) (g/g)= (W _wet W _dry )/W _dry

To measure oil holding capacity (OHC), 0.5 g of dried sample was mixed with 5 mL of olive oil (1:10, w/v) and left at 4°C for 1 hour. Afterwards, it was centrifuged at 4000 The retention capacity was measured using the formula below.

Retention capacity (OHC) (g/g)= (W _pellet W _dry )/W _dry

To measure swelling capacity (SC), 0.5 g of dried sample was mixed with 10 mL of water (1:20, w/v) and left at 4°C for 18 hours. After measuring the volume occupied by the sample, the swelling power was calculated using the formula below, where V _wet is the volume of the hydrated sample, V _dry is the volume of the dry sample, and W _dry is the mass of the dry sample.

Swelling power (SC) (mL/g)= (V _wet V _dry )/W _dry

To measure solubility, 10 mL of water was added to 0.5 g of the sample, reacted at 60 rpm for 60 minutes, centrifuged at 4000 Solubility was calculated using the formula below, where W _dry represents the weight of the sample after drying and W _sample represents the sample weight.

Solubility (%)= (1W _dry /W _sample )

Investigation of formulation stability of enzyme-treated green citron and yellow citron Formulation stability WHC(g/g) OHC(g/g) Solubility (%) Swelling power (mL/g) Cheong Yuja Con 5.18±0.03bc 3.60±0.01d 20.99±1.41f 9.50±0.71b KN 5.29±0.28b 5.85±0.07ab 71.99±4.24ab 10.00±0.85ab NYO2 5.49±0.15a 6.25±0.35a 77.5±7.78a 11.50±2.12a Hwang Yuja Con 4.44±0.06e 2.59±0.00e 13.00±4.24d 6.66±2.31cd KN 4.84±0.08d 5.40±0.28c 37.99±2.83c 7.40±1.03c NYO2 5.03±0.05c 6.05±0.07ab 65.50±6.36ab 10.34±1.51b

Both Cheongyuja and Hwangyuja showed a tendency to increase water retention and oil retention capacity in the enzyme-treated group. In particular, the water retention capacity of the NYO2 strain culture supernatant treatment group for Cheongyuja showed the highest value of 5.50 g/g. This is closely related to swelling power, and the group treated with NYO2 strain culture supernatant for green citron showed the highest swelling power, rising by more than 20%. The retention capacity of both blue citrus and yellow yuja showed an increase of more than two times compared to the untreated group. The solubility showed a more than 5-fold increase in the NYO2 strain culture supernatant treated group compared to the untreated group, which suggests that it is well hydrated in water and the bioavailability may have been greatly increased.

Example 4: Evaluation of diet efficacy of citron powder

4-1. Cytotoxicity evaluation

A toxicity study on the sample was conducted using pre-adipocytes 3T3-L1. Specifically, an experiment was conducted to investigate the accumulated fat content through an Oil red O experiment, and an experiment to examine the glycerol content liberated from decomposed adipocytes was performed. Toxicity studies were conducted by concentration of citron samples according to different test methods.

The mouse-derived preadipocyte cell line 3T3-L1 used in this experiment was purchased from the American type culture collection (ATCC, Manassas, Virginia, USA). The 3T3-L1 cell line was cultured in DMEM supplemented with 10% BCS and 1% p/s at 37°C and 5% CO ₂ , and subcultured when the cells grew to more than 70%.

For differentiation of 3T3-L1 cells, the cells were distributed in a 24- ^well plate at 2 After 96 hours, the medium was replaced with differentiation medium (DMEM + 10% FBS + 0.5 mM IBMX + 1 μM dexamethasone + 1 μg/mL insulin) and cultured for 72 hours to initiate differentiation. Afterwards, the cells were treated with adipocyte maintenance medium (DMEM + 10% FBS + 1 μg/mL insulin) and cultured for 72 hours. Finally, the cells were treated with terminal differentiation medium (DMEM + 10% FBS) and cultured for 72 hours to complete differentiation from preadipocytes to adipocytes.

To measure the cytotoxicity of samples in 3T3-L1 cells, water-soluble tetrazolium (WST) assay was performed. Differentiation was performed by distributing cells in a 24 ^- well plate at 2 At this time, in order to evaluate cytotoxicity in the adipogenesis inhibition model, various concentrations (0-250 μg/mL) were used starting from differentiation medium treatment. Samples were processed.

On the other hand, for evaluation in the lipolysis promotion model, samples were processed for 72 hours after cell differentiation was completed. After cell culture, reagents from the EZ-Cytox kit were added and reacted for 2 hours, and cell viability was confirmed by measuring absorbance at 450 nm with a spectrophotometer (BioTek Instruments, Winooski, VT, USA). The experimental results were expressed as survival rate compared to the 0 μM sample treatment group.

Cell viability for Oil-red O test using pre-adipocytes (3T3-L1) Inhibition of lipogenesis (Oil-red O) 0 μg/mL 50 μg/mL 100 μg/mL 250 μg/mL Cheong Yuja Con 100.00±1.81 79.04±8.08* 83.45±6.83* 81.66±7.99* KN 100.00±1.96 89.01±4.05* 77.64±3.21* 65.82±4.93* NYO2 100.00±2.78 85.94±4.14* 74.93±3.90* 61.14±1.71* Hwang Yuja Con 100.00±0.84 93.75±6.04 76.24±5.27* 73.58±4.22* KN 100.00±2.51 85.32±2.18* 79.52±7.79* 65.39±2.46* NYO2 100.00±4.10 81.44±0.83 76.52±6.56 64.03±2.79

Cell viability for free glycerol test using pre-adipocytes (3T3-L1) Promotes fat breakdown (Glycerol) 0 μg/mL 50 μg/mL 100 μg/mL 250 μg/mL Cheong Yuja Con 100.00±7.06 93.13±3.34* 94.96±4.46* 94.90±6.52 KN 100.00±4.19 103.48±2.48 98.13±1.83* 99.77±5.13 NYO2 100.00±6.68 92.58±4.78 89.59±2.26* 93.72±2.64 Hwang Yuja Con 100.00±6.16 100.49±6.56 90.30±8.51 82.34±4.04* KN 100.00±5.32 98.26±3.49 96.87±6.02 88.87±5.29* NYO2 100.00±5.09 100.92±2.97 99.69±4.59 89.12±8.74

As can be seen in Tables 19 and 20, when samples were treated from 0 to 200 μg concentration, it was confirmed that all samples showed toxicity starting from the treatment at 50 μg/mL concentration.

Therefore, subsequent experiments were conducted below 40 μg/mL, which is a non-toxic safe concentration range.

4-2. Confirmation of the effect of inhibiting lipogenesis

Oil red o staining was performed to confirm the effect of inhibiting lipogenesis in the sample. Cells were distributed in a 24- ^well plate at 2 At this time, the concentration of the sample was conducted within a safe range that did not show toxicity as a result of the cytotoxicity evaluation in Example 4-1.

Additionally, Epigallocatechin Gallate (EGCG) was used as a positive control. After differentiation was completed, the cells were washed once with 1X PBS and 1 mL of 10% formalin was added. After reacting for 30 minutes, the reaction was washed twice with PBS, oil red o solution (0.2 g/100 mL isopropranol) was added, and reaction was performed for 1 hour.

After washing twice with PBS, H ₂ O was added and observed under a microscope (Nikon, Tokyo, Japan). After observation, H ₂ O was removed, completely dried, and 0.5 mL of isopropanol was added, reacted for 30 minutes, and absorbance was measured with a spectrophotometer at 510 nm.

As can be seen in Figure 15, when the experiment was conducted at a concentration range of 40 μg or less, which is a safe concentration range without cytotoxicity, both green citron and yellow citron powder were converted to adipocytes in the KN enzyme or NYO2 strain culture supernatant treated group compared to the untreated group. It was confirmed that differentiation was reduced. This could also be confirmed in photos of cells stained with 3T3-L1 with Oil red O.

(%) Cheong Yuja Hwang Yuja PRE 30.65±3.84 31.00±3.89 Control 100.12±11.13 100.00±6.12 EGCG 50 μM 34.02±4.97 46.87±2.85 Con 10 μg/mL 92.24±10.67 97.08±4.45 20 μg/mL 74.43±12.33 86.95±8.18 40 μg/mL 64.02±12.44 82.41±3.07 KN 10 μg/mL 92.52±11.26 93.86±10.55 20 μg/mL 63.62±26.07 78.25±12.01 40 μg/mL 56.24±9.05 65.24±14.98 NYO2 10 μg/mL 80.54±13.25 78.28±6.21 20 μg/mL 60.68±17.15 62.18±7.39 40 μg/mL 50.43±9.94 61.12±11.43

As can be seen in Table 21 and Figures 16a and 16b, green citron had a more excellent effect of inhibiting adipocyte differentiation than yellow citron. In particular, it most effectively inhibited differentiation of preadipocytes in the group treated with 40 μg of NYO2 strain culture supernatant. Therefore, as a result of this experiment, it was believed that all groups treated with Con, KN enzyme, or NYO2 strain culture supernatant would be able to suppress fat production and accumulation by inhibiting the differentiation of pre-adipocytes into adipocytes.

4-3. Analysis of the effect of promoting lipolysis through free glycerol analysis

Neutral fat is a combination of one glycerol molecule and three fatty acid molecules. After neutral fat is broken down, the fatty acid is used to resynthesize neutral fat, while glycerol is released into the extracellular blood and transported to the liver. Therefore, we sought to indirectly confirm the effect of promoting lipolysis through the glycerol content released from pre-adipocytes.

Free glycerol assay was performed to confirm the effect of promoting lipolysis of the sample. Cells were distributed in a 24- ^well plate at 2 At this time, the concentration of the sample was within a safe range that did not show toxicity as a result of previous cytotoxicity evaluation.

After differentiation was completed, the cell supernatant was collected and the free glycerol content was measured using an EZ-free glycerol assay kit according to the manufacturer's experimental method. The experimental results were expressed as the amount of free glycerol released compared to the untreated group.

(%) Cheong Yuja Hwang Yuja Control 100.00±0.59 100.00±0.82 EGCG 50 μM 124.60±0.16 119.80±0.15 Con 10 μg/mL 100.40±0.33 99.60±0.75 20 μg/mL 106.05±0.55 106.10±0.45 40 μg/mL 106.95±0.28 108.60±0.55 KN 10 μg/mL 104.10±0.52 101.80±0.88 20 μg/mL 108.90±0.41 105.10±0.88 40 μg/mL 110.30±0.69 116.20±0.59 NYO2 10 μg/mL 107.40±0.42 107.20±0.39 20 μg/mL 111.70±0.55 109.80±0.54 40 μg/mL 116.80±0.68 118.20±0.59

As can be seen in Table 22 and Figures 17a and 17b, the free glycerol content was found to be higher in all samples compared to the untreated group. In particular, as with the results of the previous Oil red O experiment, It was confirmed that free glycerol increased most effectively in the group treated with 40 μg of NYO2 strain culture supernatant for Cheongyuja. Therefore, all samples from the KN enzyme or NYO2 strain culture supernatant treatment groups for green citron and yellow citron had a lipolysis-promoting effect that decomposes neutral fat, and it is expected that the effect will be especially excellent for the samples from the NYO2 treatment group for green citron. It has been done.

4-4. Analysis of lipogenesis inhibition effect through ELISA of fatty acid synthase content

Fatty acid synthase is an enzyme that catalyzes the synthesis of long-chain fatty acids and is essential for the synthesis of neutral fats. Therefore, after treating enzyme-treated citron samples with differentiated pre-fat cells, the fatty acid synthesis enzyme content contained in each cell was investigated to confirm the effect of suppressing fat synthesis through the reduced content of the enzyme.

To confirm the effect of inhibiting lipogenesis in the sample, the amount of fatty acid synthase was measured by ELISA. in 6 well plate ¹ After dispensing cells to a total volume of 4 mL, they were differentiated into adipocytes and treated with samples (20 μg/mL).

Afterwards, the cells were collected, lysed with RIPA buffer, homogenized, stored on ice, and used in experiments. Dispense 100 μL of standard material and sample into each well of a 96-well plate for ELISA, react for 2 hours at 37°C, remove the supernatant, and add 100 μL of biotin-detection antibody to each well. added to the well. Reaction was performed at 37°C for 1 hour, washed with washing buffer, and 100 μL of HRP-avidin was added and treated for 1 hour.

After washing, 90 μL of TMB substrate was reacted for 15 minutes, then 50 μL of stop solution was added, mixed gently, and absorbance was measured at 450 nm. In addition, Bradford reagent was added to the homogenized cell nuclei, reacted for 15 minutes, absorbance was measured at 595 nm, and it was expressed as pg/mg protein by substituting BSA into the calculation formula using the standard curve.

Control EGCG 50 Cheong Yuja Hwang Yuja CON KN NYO CON KN NYO 179.04±22.71 72.76±2.84 133.08±9.92 116.16±1.01 106.29±2.22 133.95±4.88 130.32±2.40 102.57±2.38

As can be seen in Table 23 and Figure 18, the content of fatty acid synthase was significantly reduced in all samples compared to the untreated group, and the untreated group, KN-treated group, and NYO2-treated group were found to be effective in that order. Therefore, when the results of this experiment were combined with the results of the oil red O experiment, it was determined that the sample could inhibit the synthesis and accumulation of fat by reducing the expression of fatty acid synthase.

Compared to the control group (179 pg), the fatty acid synthase content of green citron and yellow citron decreased by 74% (133 pg) in the untreated group, with KN (116 pg) and NYO2 (106 pg) for green citron and KN (130 pg) for yellow citron. ), the NYO2-treated group powder, which was enzyme-treated from yellow citron with NYO2 (102 pg), contained the lowest amount of lipolytic enzyme at 57%.

Summarizing the above results, it was confirmed that the powder treated with NYO2 strain culture supernatant of green citron and yellow citron was positive for inhibiting lipogenesis, promoting lipolysis, and suppressing the expression of lipogenic enzymes. In addition, there were differences in degree in the other KN treatment groups, but all showed significant effects. Therefore, all of the citron powders with reduced bitterness used in this experiment suppressed fat production by reducing the expression of fatty acids, an enzyme involved in fat production, and promoted the decomposition of neutral fat, so they could be developed as effective ingredients for dieting in the future. It was expected that it would be possible.

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC14898BP 20220315

Sequence list electronic file attached

Claims (16)

Aspergillus niger or Aspergillus oryzae strain in a substrate composition containing citron, a culture of the strain, a concentrate of the culture, a dried substance of the culture, and a culture supernatant of the strain. and a reaction step of contacting a reaction solution containing at least one selected from the group consisting of a fraction of the culture supernatant. The method of claim 1, wherein the citron is provided in one or more forms selected from the group consisting of pickled sugar, freeze-dried powder, concentrate, and juice. The method of claim 1, wherein the citron is one or more selected from the group consisting of whole fruit, pulp, and skin. The method of claim 1, wherein the culture supernatant of the Aspergillus niger strain is a group consisting of β-glucosidase, cellulase, hemicellulase, and protease. A method for producing a citron enzyme reaction product with reduced bitterness, comprising at least one selected from the group consisting of: The method of claim 1, wherein the Aspergillus duck material is the Aspergillus duck material NYO2 strain deposited under the accession number KCTC14898BP. The method of claim 1, wherein the concentration of the reaction solution is 0.01 to 1.00% (v/v) based on the total enzyme reaction product. The method of claim 1, wherein the concentration of the substrate composition is 0.10 to 15.00% (v/w) based on the total enzyme reaction product. The method of claim 1, wherein the reaction step is performed for 1 to 24 hours. Aspergillus niger or Aspergillus oryzae strain in a substrate composition containing citron, a culture of the strain, a concentrate of the culture, a dried substance of the culture, and a culture supernatant of the strain. A health functional food composition for diet comprising a citron enzyme reaction product with reduced bitterness prepared by reacting a reaction solution containing at least one selected from the group consisting of fractions of the culture supernatant. The health function for diet comprising a citron enzyme reaction product with reduced bitterness according to claim 9, wherein the citron is provided in one or more forms selected from the group consisting of pickled sugar, freeze-dried powder, concentrate, and juice. Food composition. The health functional food composition for diet containing a citron enzyme reaction product with reduced bitterness according to claim 9, wherein the citron is at least one selected from the group consisting of the whole fruit, pulp, and skin. The method of claim 9, wherein the culture supernatant of the Aspergillus niger strain is a group consisting of β-glucosidase, cellulase, hemicellulase, and protease. A health functional food composition for diet containing a citron enzyme reaction product with reduced bitterness, comprising at least one selected from the following. The health functional food composition for diet containing a citron enzyme reaction product with reduced bitterness according to claim 9, wherein the Aspergillus duckweed strain is Aspergillus duckweed NYO2 strain deposited under the accession number KCTC14898BP. The health functional food composition for diet containing a citron enzyme reaction product with reduced bitterness according to claim 9, wherein the concentration of the reaction solution is 0.01 to 1.00% (v/v) based on the total enzyme reaction product. The health functional food composition for diet containing a citron enzyme reactant with reduced bitterness according to claim 9, wherein the concentration of the substrate composition is 0.10 to 15.00% (v/w) based on the total enzyme reactant. The method of claim 9, wherein the citron enzyme reaction product has solubility, water holding capacity (WHC), oil holding capacity (OHC), and swelling capacity compared to the substrate composition as it reacts with the reaction solution. A health functional food composition for diet, wherein at least one characteristic selected from the group consisting of SC) is improved.