KR20240057506A - A recombinant Corynebacterium having enhanced secreted production efficiency of target protein through enhanced generation of ATP - Google Patents

Abstract

The present invention relates to a recombinant microorganism of the Corynebacterium genus with improved secretion production ability, in which zwf and/or cydABDC, which are genes related to energy production in Corynebacterium, are overexpressed and a gene encoding a target protein is introduced, and the use thereof. will be. The improved recombinant microorganism of the Corynebacterium genus according to the present invention exhibits improved secretion ability in the secretion production of the target protein by helping to overproduce the energy source required for secretion production, and is therefore a host for the secretion production of the target protein, which is advantageous for industrial application. It is easy to use.

Description

{A recombinant Corynebacterium having enhanced secreted production efficiency of target protein through enhanced generation of ATP}

The present invention relates to a recombinant Corynebacterium with improved secretion production ability of a target protein, and more specifically, zwf and/or cydABDC, which are genes related to energy production that are inherently present in Corynebacterium microorganisms, are overexpressed, and the target protein is overexpressed. The present invention relates to a recombinant microorganism of the Corynebacterium genus, into which a protein-coding gene has been introduced, with improved extracellular secretion production ability of a target protein, and its use.

Microorganisms belonging to the genus Corynebacterium are industrially used in the production of amino acids and nucleic acids. They are generally recognized as safe (GRAS) strains and are used as hosts to produce vitamins and recombinant enzymes. In particular, microorganisms in the Corynebacterium genus have a secretion production system, so they can be used as hosts for secretion production of recombinant proteins. The use of secretion production systems has great industrial utility. In general, since recombinant protein production is mainly intracellular production, a cell disruption process is essential to recover the recombinant protein produced within the cell, whereas recombinant protein production using a secretion production system involves cell disruption by producing extracellular recombinant protein. This is because it has an advantage in the industrial recombinant protein production process because it does not require any processing. Accordingly, the secretion production system using Corynebacterium microorganisms can be used as an economical and effective production system because it can enable extracellular secretion production of recombinant proteins industrially.

Studies related to secretory production of recombinant proteins using Corynebacterium use the host's secretory production system (Yim, S. S. et al., (2016) Biotechnology and bioengineering, 113(1), 163-172) or synthetic There are methods to increase secretion production capacity by constructing a secretion signal peptide, or to develop a recombinant host with improved secretion production capacity by removing endogenous genes to improve secretion production capacity. However, the above methods are studies that focus on building a secretion production system for recombinant proteins or increase secretion production capacity by removing factors that affect secretion production during secretion production, and research on improving strains to improve secretion production is not carried out. It is inadequate.

Under this technical background, the present inventors, in addition to improving the secretion production ability by constructing and improving the secretion production system, have improved the secretion production ability of Corynebacterium genus microorganisms capable of secretion production of the target protein. We attempted to develop .rium, and it was confirmed that the secretion production capacity of the target protein in Corynebacterium was improved through improvement of energy metabolism-related genes that can improve secretion production capacity, and the present invention was completed.

The above information described in this background section is only for improving the understanding of the background of the present invention, and therefore does not include information that constitutes prior art already known to those skilled in the art to which the present invention pertains. It may not be possible.

Korean registered patent 10-0919704 Korean Patent Publication 10-2014-0110134 Korean Patent Publication 10-2022-0049827

Yim, S. S. et al., (2016) Biotechnology and bioengineering, 113(1), 163-172 Yim, S. S. et al, (2013) Biotechnology and bioengineering. 110, 2959-2969 An, S.J. et al., (2013) Protein Expression and Purification, 89, 251-257

The present invention aims to provide a novel Corynebacterium genus recombinant microorganism with improved extracellular secretion production capacity of a target protein and its use.

In order to achieve the above object, the present invention is (a) the promoter of the zwf gene represented by the nucleotide sequence of SEQ ID NO. 1, which is inherently present in microorganisms of the genus Corynebacterium, as the H36 promoter represented by the nucleotide sequence of SEQ ID NO. 2. substitution; And/or the promoter of the cydABDC gene represented by the nucleotide sequence of SEQ ID NO: 3, which is inherently present in microorganisms in the Corynebacterium genus, is replaced with the H30 promoter represented by the nucleotide sequence of SEQ ID NO: 4, and (b) coding for the target protein. Provides a recombinant microorganism of the Corynebacterium genus with improved extracellular secretion and production ability of a target protein, into which a gene has been introduced.

The present invention also includes the steps of (a) culturing the recombinant microorganism of the Corynebacterium genus and expressing a gene encoding the target protein to secrete and produce the target protein; and (b) recovering the secreted/produced target protein.

The improved recombinant microorganism of the Corynebacterium genus according to the present invention exhibits improved secretion ability in the secretion production of the target protein by helping to overproduce the energy source required for secretion production, and is therefore a host for the secretion production of the target protein, which is advantageous for industrial application. It is easy to use.

Figure 1 is a schematic diagram of the mechanism and strain improvement for increasing NADPH, an energy source, and the NADPH measurement results. Figure 1A is the mechanism of the zwf gene, Figure 1B is a schematic diagram of an improved Corynebacterium in which the zwf gene of the chromosome is replaced with the H36 promoter (Patent Publication 10-2014-0110134), and Figure 1C is a schematic diagram of the zwf gene of the chromosome replaced with the H36 promoter. This is the result of measuring the amount of NADPH after substitution.
Figure 2 shows the SDS-PAGE results of the target protein secretion production system and the secretion-produced recombinant protein applied to view changes in secretion production ability. Figure 2A is a plasmid schematic diagram of secretion production of This is the SDS-PAGE result comparing the secretion production ability by concentrating the protein 30 times.
Figure 3 is a schematic diagram of the cydABDC overexpression plasmid system introduced to increase ATP, an energy source, and the result of measuring the amount of ATP accordingly. Figure 3A is a schematic diagram of a system that overexpresses the cydABDC gene under the H30 promoter (Yim, SS et al, (2013) Biotechnology and bioengineering. 110, 2959-2969), and Figure 3B shows a plasmid overexpressing cydABDC or the cydABDC gene. This is the comparison result of ATP amount measurement of C. glutamicum SP002 strain with pXMJ19 (empty plasmid).
Figure 4 shows SDS-PAGE results comparing the secretion production ability of XynA in C. glutamicum SP002 strains with a plasmid overexpressing cydABDC or with pXMJ19 (empty plasmid) without the cydABDC gene. Each secretion production is the result of 10-fold concentration.
Figure 5 is a schematic diagram of the improved C. glutamicum SP003, which replaces the zwf gene of the chromosome with the H36 promoter and overexpresses cydABDC using a plasmid system, and shows the SDS-PAGE results comparing the production ability of various recombinant proteins using it. Figure 5A is a schematic diagram of C. glutamicum SP003, an improved Corynebacterium strain in which the promoter of the inherent zwf gene is replaced with the H36 promoter and cydABDC is overexpressed using a plasmid system. Figure 5B is the SDS-PAGE result comparing the secretion production capacity of XynA in C. glutamicum SP002 and C. glutamicum SP003, showing the result of 10-fold concentration of secretion-produced XynA. Figure 5C is the SDS-PAGE result comparing the secretion production ability of cAbHuL22 in C. glutamicum ATCC13032 (WT) and C. glutamicum SP003, showing the result of 30-fold concentration of secretion-produced cAbHuL22. Figure 5D shows the SDS-PAGE results comparing the secretion production capacity of M18 in C. glutamicum ATCC13032 (WT) and C. glutamicum SP003, showing the result of 50-fold concentration of secretion-produced M18.
Figure 6 is a schematic diagram of the C. glutamicum SP004 strain with improved target protein secretion production ability.
Figure 7 shows SDS-PAGE results comparing the amount of ATP and secretion production capacity in C. glutamicum SP004 and C. glutamicum SP002. Figure 7A shows the results of measuring the amount of ATP in C. glutamicum SP004 and C. glutamicum SP002, which have pHCP (Empty plasmid, Korean Patent Publication No. 10-2018-0092110) and a system that secretes and produces cAbHuL22. Figure 7B is the SDS-PAGE result of 30-fold concentration of the secreted protein to compare the secretion production ability of cAbHuL22 in C. glutamicum SP004 and C. glutamicum SP002. Lane C is pHCP (empty plasmid), and lane 1 is pHCP (empty plasmid). cAbHuL22 is secreted and produced using C1 secretion signal peptide (Korean patent application 10-2021-0092055).
Figure 8 shows SDS-PAGE results comparing the secretion production capacity of XynA in C. glutamicum SP002, C. glutamicum SP003, and C. glutamicum SP004. Secreted XynA was confirmed by 10-fold concentration.
Figure 9 shows SDS-PAGE results comparing the cAbHuL22 secretion production ability of the ppk co-expression system and C. glutamicum SP004.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

Because microorganisms in the Corynebacterium genus have an inherent protein secretion system, they are widely used to produce industrially useful recombinant proteins. However, no system has been developed to improve energy metabolism required for protein secretion production.

In one embodiment of the present invention, it was confirmed that the secretion amount of the target protein can be significantly increased by introducing a system for overexpressing the zwf gene and cydABDC gene that are endogenously present in microorganisms of the Corynebacterium genus.

Therefore, the present invention, in one aspect, is (a) replacing the promoter of the zwf gene represented by the nucleotide sequence of SEQ ID NO: 1, which is inherently present in microorganisms of the genus Corynebacterium, with the H36 promoter represented by the nucleotide sequence of SEQ ID NO: 2. ; And/or the promoter of the cydABDC gene represented by the nucleotide sequence of SEQ ID NO: 3, which is inherently present in microorganisms in the Corynebacterium genus, is replaced with the H30 promoter represented by the nucleotide sequence of SEQ ID NO: 4, and (b) coding for the target protein. This relates to a recombinant microorganism of the genus Corynebacterium that has an improved extracellular secretion and production ability of a target protein, into which a gene has been introduced.

SEQ ID NO: 1: nucleotide sequence of zwf gene (1545 bp)

GTGAGCACAAACACGACCCCCTCCAGCTGGACAAACCCACTGCGCGACCCGCAGGATAAACGACTCCCCCGCATCGCTGGCCCTTCCGGCATGGTGATCTTCGGTGTCACTGGCGACTTGGCTCGAAAGAAGCTGCTCCCGCCATTTATGATCTAGCAAACCGCGGATTGCTGCCCCCAGGATTCTCGTTGGTAGGTTACGGCCGCCGCGAATGGTCCAAAGAAGACTTTGAAAAATACGTACGCGATGCCGCAAGTGCTG GTGCTCGTACGGAATTCCGTGAAAATGTTTGGGAGCGCCTCGCCGAGGGTATGGAATTTGTTCGCGGCAACTTTGATGATGATGCAGCTTTCGACAACCTCGCTGCAACACTCAAGCGCATCGACAAAAC CCGCGGCACCGCCGGCAACTGGGCTTACTACCTGTCCATTCCACCAGATTCCTTCACAGCGGTCTGCCACCAGCTGGAGCGTTCCGGCATGGCTGAATCCACCGAAGAAGCATGGCGCCGCGTGATCATC GAGAAGCCTTTCGGCCACAACCTCGAATCCGCACACGAGCTCAACCAGCTGGTCAACGCAGTCTTCCCAGAATCTTCTGTGTTCCGCATCGACCACTATTTGGGCAAGGAAACAGTTCAAAACATCCTGGCTCTGCGTTTTGCTAACCAGCTGTTTGAGCCACTGTGGAACTCCAACTACGTTGACCACGTCCAGATCACCATGGCTGAAGATATTGGCTTGGGTGGACGTGCTGGTTACTACGACGGCATCGGCGCGC AGCCCGCGACGTCATCCAGAACCACCTGATCCAGCTCTTGGCTCTGGTTGCCATGGAAGAACCAATTTCTTTCGTGCCAGCGCAGCTGCAGGCAGAAAAGATCAAGGTGCTCTCTGCGACAAAGCCGTGC TACCCATTGGATAAAACCTCGTCGTGGTCAGTACGCTGCCGGTTGGCAGGGCTCTGAGTTAGTCAAGGGACTTCGCGAAGAAGATGGCTTCAACCCTGAGTCCACCACTGAGACTTTTGCGGCTTGTAC CTTAGAGATCACGTCTCGTCGCTGGGCTGGTGTGCCGTTCTACCTGCGCACCGGTAAGCGTCTTGGTCGCCGTGTTACTGAGATTGCCGTGGTGTTTAAAGACGCACCACACCAGCCTTTCGACGGCGAC ATGACTGTATCCCTTGGCCAAAACGCCATCGTGATTCGCGTGCAGCCTGATGAAGGTGTGCTCATCCGCTTCGGTTCCAAGGTTCCAGGTTCTGCCATGGAAGTCCGTGACGTCAACATGGACTTCTCTC ACTCAGAATCCTTCACTGAAGAATCACCTGAAGCATACGAGCGCCTCATTTTGGATGCGCTGTTAGATGAATCCAGCCTCTTCCCTACCAACGAGGAAGTGGAACTGAGCTGGAAGATTCTGGATCCAATTCTTGAAGCATGGGATGCCGATGGAGAACCAGAGGATTACCCAGCGGGTACGTGGGGTCCAAAGAGCGCTGATGAAATGCTTTCCCGCAACGGTCACACCTGGCGCAGGCCATAA

SEQ ID NO: 2: nucleotide sequence of H36 promoter (75 bp)

TCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGG

SEQ ID NO: 3: nucleotide sequence of CydABDC gene (5646 bp)

GTGGATGTCGTCGACATCGCACGGTGGCAATTCGGAATTACCACCGTCTATCACTTCATTTTTGTCCCACTGACCATTGGCTTAGCGCCGCTGGTCGCAATCATGCAAACGTTTTGGCAAGTTACCGGCAAAGAGCACTGGTATCGGGCCACAAGATTTTTTGGCACTGTGCTGCTCATCAACTTCGCGGTTGGTGTAGCAACGGGCATTGTGCAGGAGTTCCAGTTCGGTATGAACTGGTCGGAATATTCGCGTTTCGTCGGTGATGTTTTCGGCGGACCGCTGGCTTTGGAGGGTCTTATCGCGTTCTTCCTTGAGTCTGTATTCCTGGGACTGTGGATTTTCGGATGGGGGAAGATTCCTGGTTGGTTGCACACTGCATCCATTTGGATCGTTGCTATTGCGACGAATATTTCTGCCTATTTCATCATCGTGGCCAACTCGTTTATGCAGCATCCGGTGGGTGCTGAGTATAACCCTGAGACTGGTCGTGCGGAGCTTACTGATTTTTGGGCTCTTCTCACAAACTCCACCGCGCTGGCTGCGTTCCCGCATGCTGTTGCCGGTGGTTTTTTAACAGCTGGAACTTTCGTTCTCGGAATTTCGGGTTGGTGGATTATTCGTGCGCACCGTCAGGCCAAGAAGGCTGAGTCGGAAATCGAGTCGAAGCATTCGATGCACAGGCCCGCGTTGTGGGTTGGTTGGTGGACCACAGTTGTCTCTTCCGTGGCGCTGTTCATCACTGGCGATATCCAGGCGAAGCTCATGTTCGTGCAGCAGCCAATGAAGATGGCGTCGGCGGAATCCTTGTGTGAAACCGCCACAGATCCAAACTTCTCCATTCTGACAATTGGTACGCACAACAACTGCGATACGGTAACCCACCTGATCGATGTTCCGTTTGTGCTTCCATTCTTGGCTGAAGGAAAATTCACCGGTGTGACTTTGCAGGGTGTAAACCAGCTCCAAGCTGCAGCGGAGCAAGCATACGGTCCTGGCAACTACTCCCCTAACTTGTTTGTCACCTACTGGTCATTCCGCGCAATGATCGGCCTGATGCTTGGTTCTTTGGCTATCGCTGCGATTGCGTGGCTGTTGCTGCGTAAGAAGCGCACACCAACTGGAAAGATTGCTCGTCTGTTCCAGATCGGCAGCCTCATTGCTATCCCGTTCCCATTCTTGGCCAACTCTGCTGGTTGGATCTTCACCGAGATGGGCCGCCAGCCTTGGGTGGTGCACCCGAACCCTGAATCTGCCGGCGATGCCCGAACAGAGATGATCCGGATGACTGTTGATATGGGTGTATCTGATCATGCGCCATGGCAAGTCTGGCTGACTCTCATTGGCTTCACGATTCTCTATCTCATTTTGTTCGTGGTGTGGGTGTGGCTGATTCGCCGCGCAGTTCTGATCGGACCACCAGAGGAAGGCGCTCCATCCGTGGAGGCAAAGACTGGACCGGCAACCCCGATTGGTTCAGATATGCCCATGACACCGCTGCAATTTACTGCCGCTGCCCCAACCACAGGTGAAAAGGAATAACCATGGATCTCAATACCTTTTGGTTTATTCTCATCGCATTTTTGTTTGCGGGATACTTTCTCCTCGAAGGATTCGACTTCGGCGTCGGAATTTTGGCACCCATCATCGGTAAAGATTCAGCGGCTAGGAACACAGTGATCCGTACGATTGGCCCTGTCTGGGACGGAAATGAAGTGTGGCTGATCGTGGCAGGTGGCGCTTTGTTTGCTGCCTTCCCTGAGTGGTACGCAACGATGTTCTCCGGAATGTATCTGCCGCTGTTCCTCGTGCTTGTGTCGTTGATCATGCGCGTGGTGGGCCTTGAATGGCGCAAGAAAGTCGATGATCCTCGTTGGCAAAAGTGGTCTGACCGGGCCATCTTTATTGGTTCTTGGACTCCACCGCTGATGTGGGGATTCATCTTCGCCAATATTTTGCGTGGCATGCCCCTCAAGGCGGATCACACCATCGATGCTGCGGCAGCCCTTCCTGGCATGGTCAACGTCTTCGCCATTCTGGGTGCACTTGCGTTCACCGCACTGTTCGCCCTTCATGGTCTCGCATTCATCCGCCTGAAAACTGCTGGTCGGGTGCGCACCGATGCGGCGAAGGCAGCTCCAGTAGTCGCACTTCTTGCTGCGGTGACTGGTGGACCTTTCGTGTTGTGGGCTGCCATCGCATACGGCCGTTCCTGGTCCTGGATCCTCGCAGTGCTGATCATCGCAGCGGTTCTCGGTGGAGCTTTCGCACTGATCAAAGACCGCGATGGATTAAGCTTCCTGTCCACTTCCGTCGCTGTCATCGGTGTCGTTGCACTGCTGTTTAGTTCGCTTTTCCCCAACGTCATGCCAACAACGCTTGCTGATGGCGTGAGCCTGGATATCTGGAACGCCTCCGCAAGCGCCTACGCATTTACTATCCTGACTTGGACCGCCGCTGTGATCGCACCGCTGGTTGTCCTCTACCAAGGCTGGACCTACTGGGTGTTCCGCAAACGACTTCACGCCGAGCCAGTGTCTGCTTAAAGTTGGAAAAATTGAGTACTAAATCTTCAGCTCCTGCAAAAAGGCGCGCCGGCCCCGTCGATCCGCGGCTTTTGCGCCTATCCCCCGCTACCCGCCGTTGGGTGATAATCGCAGGTGTTCTCACCGCGTTGAAAACCCTCGCGACAGTCGCAATGGGCTTGCTCATCGGCCAGATGGCAGCGGGCATCATTGAGGTTTCGGGAAGTTCTTTGCCCCGAATGGAACTCATCGCGCTCGCCATCACGGTGGTTGTGCGCGGACTTCTTGCGTGGGCACAGGATCGGTTCGCGCAACGCGCATCGTCCCAGGTGACTGTGGATCTTCGGGAGAAAACCCTGCGGCACCTGGCACAAAGCGATCCCCGCACCATCGATCAAGCCTTGTGGCGCACCCGTTTGACCTCTGGCCTTGATGGTTTGGGGCCTTACCTCACCGGATTTTTGCCAGCTCTAGCCGCCACGATCATTGCCACCCCGGTCATGCTCGCGGTGGTGGGTTGGCTGGATGTTGGGTCCATGGTCATCGCGATCATCACGCTCCCCCTCATTCCGGTGTTCATGTGGCTGGTGGGAACACTCACCGCAGGTCGCACCGAACAACGCCTCAGCGACCTAGCCATTTTGGGAGGTCAGCTGCTTGATCTCATCGCAGGCTTGCCCACCTTGCGAGCATTCAGGCGCCACCAAGACATGGCAGCTCAGGTCACGCGACTATCCTCCCAACATGCAAGCTCCACGTTGAGCGTGCTGAAAATCGCGTTCCTTTCCAGCTTTGTGTTGGAATTTTTGGCCACACTATCGGTCGCATTGGTAGCGGTTGGCATCGGATTTCGCCTGCTCGCGGGCGATCTCACCCTCGCCATCGGCCTGACCGTACTGATCATCATCCCAGAGGTCTACGCGCCGATCCGCGAAGTCGGCACCCGCTTCCACGACGCCCAAGACGGCCTGGTTGCCACCGATGAGATCCTAAAATTACTCAGCGTTTCTTCGCTTGTCGACGCGCCTACCCACACACCCCGCGACGTTGCAGGCGGGCTGGAGGTGAGCGTCGAAAAGCTTCGCGCTGATGGACGCGATGGGCCGAGGCCTGCTGATTTGTCGTTCACCGCAAAGCCTGGGCAGTTGACGGTGCTGTGGGGGCCAAACGGCAGCGGCAAATCCACGGCCTTGCTAGCGGTGTTGGGCTTGGCGACGGAAGGCATCACTGGAGAGGTTTCCGTCAAGGATGCCTCGGGCCAGGAATTTAAGGACAGCGCATTGTGGGAGCACTGCGCATATTTGCCGCAGCGGCCGGTCATTGATCCGGAAAGTGTCAGTGATTATGCGGAACTGTCGCTTGGGCAGCGCCAACGGCTTGCGCTGAAACGTGAGCTTGGGGCGCAATTGCTCCTGTTGGATGAGCCGACCGCGCACCTGGATCCAGACAACGCTGCGATCATGATCCAGCAATTGCAGGCTGAAGCCCGCCGAGGCACCACAGTACTGGCGGTTTCGCATGATCCTTTGCTGCGTGCGGCTGCCGATGAAGTGGTGGAGGTCAAATGAACACCCTGGTAAAACTTCGTTTCCGCGAGCTAATTCCCGCCGTTGTTGCAGGTAGCGTCACGATGATCGCCTCCATCACCCTGACGGTGGTGTCGGCCTGGCTGATCACCAAAGCTTGGGAAATGCCGCCAGTGATGGATCTGACCGTGGCGGTCACCGCTGTGCGAGCCCTGGGCATTAGCCGTGCGATGTTCCGTTATATAGAGAGAATCGTTTCACATGACTTGGCGTTGAAGGCAGCCAGCCGAGCCCGTTCGAGTGCATATCAACGCCTGGCTTCGTCGCCAAACTCTGCGTTGACGATGCGCCGCGGCGAACTGCTTAGCCGCCTTGGTGTGGATATCGATTCGGTTGCCGATGTCATCGTCCGCGCCGTCATTCCCGCCGGAGTTGCCCTGCTCACCGGAGTTGTCGCGATCATCTTCACCGCGATTCTCAGCCCCGCAACCGCACTTGTCCTGGCGATTGGATTGATTGCTGCTGCAATTATCCCTCCCCTGCTTGCTGCTCGCGGAGTTAAAACAGCCGAAGCCCGGCGCGCTGAATCCAGCGAAGCCTACTTGAGTTCCTTGGATCAGGTGCTGTCCAACCAGGCGGCGCTTCGTGTTCGTGGTGAAATGCCGGCCGCTCTGTCCAAGGCGGATGTGGCTGCGCGTTCCTATTCTTCTTCACTGGAGGCAGGCGCGAAAGACACTGCCATTGGCGCAGCGAGTTCCCTGTGGATTCACGGTTTCACTGTCATTGGTGTGCTCATGGTTTCCGCGTCACTGTATGCAGATGGAAGCCATTCACCGCAGTGGTTTGGTGTGTTGGTGCTGCTTTCACTCGCAGCTTTCGAGGCTGTCTCTGTTCTCCCCGATGCTGCGATTGCTCGTACCCGCGCCGCAGATGCCACCAGGAGGCTTGCGGAAATCTCGGCGCTGCCAGAATCTGTCTCTCTTGAGCTTCGCACGGCCTCTGACCAGCCCGTATTACGCGCCGAGAATCTAGTTTATGGATGGGACAGCGACCTAGGCACGAGCAACCTGGATCTCACCTTTGGTTCACGACATGAAATCATCGCACCCTCTGGAACTGGCAAAACGACCCTGCTGCTCACACTTGCGGGGCTGTTGGAACCTCGTGGAGGCCAAGTGCTTATCGACGGCACCAATCCTTCCGAGTTGAAAAACGCCGTGCTGTTCAGTCCAGAAGATGCCCACATTTTTGCCACCACTGTCCGAGATAACTTAGCACTCGGAGCACCGGAAGCAACCGACGCGGAAATGACATCGATCCTGGAACATGTTGGTTTGTCAGAGTGGGTTCAAGGTTTACCCGATGGTCTTGGCACTGTCCTTGATTCAGGTGCCGATAGTCTCTCGGGAGGTCAGCGCCGCCGCCTGCTCCTTGCCCGCGTACTACTAAGTGATGCACCAATTCTGCTTTTGGATGAACCCACCGAGCACCTCGACACTGCAGGCTCCTCTGAAATCTTGTCTATGCTGGCCTCCGATGAACTCCCTGGTAAAAGAGCTAGGAGAACCGTAGTGATTGTGAGGCATGTGAGGTAA

SEQ ID NO: 4: nucleotide sequence of H30 promoter (74 bp)

AAAGTAACTTTTCGGTTAAGGTAGCGCATTCGTGTGTGTTGCCGTGGCCCGGTTGGTTGGGCAGGAGTATATTG

In the present invention, the “zwf gene” refers to a gene encoding glucose-6-phosphate dehydrogenase (G6PD, G6PDH), and is characterized by the base sequence of SEQ ID NO: 1. It can be done, but is not limited to this. The glucose-6-phosphate dehydrogenase is an enzyme that catalyzes the following chemical reaction.

6-phospho-D-glucono-1,5-lactone + NADPH + H⁺ D-glucose 6-phosphate + NADP ⁺ + H ₂ O

6-phospho-D-glucono-1,5-lactone + NADPH + H ⁺

In the present invention, the “cydABDC gene” is cydABDC It is used in the same sense as gene cluster, and may be characterized by being represented by the base sequence of SEQ ID NO: 3, but is not limited thereto. cydA and cydB Each gene is cytochrome bd Codes subunit I and subunit II of oxidase, cydC and cydD The gene is active cytochrome bd Codes the ABC transporter required for oxidase formation.

In the present invention, the “H36 promoter” and “H30 promoter” may be characterized by being represented by the base sequences of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, but are not limited thereto.

In one embodiment of the present invention, the “H36 promoter” and “H30 promoter” are substituted for overexpression of the zwf gene and the cydABDC gene, respectively, and the promoters that act to overexpress the zwf gene and the cydABDC gene are related to their types in terms of operating principle. It will be apparent to those skilled in the art that it can be used without.

In the present invention, the substitution or introduction includes not only cases where the gene is introduced into the host microorganism and integrated into the genome itself, but also cases where the gene is independently introduced into the host microorganism genome in the form of a plasmid or vector.

In one embodiment of the present invention, the expression promoter of the zwf gene in the chromosome of Corynebacterium glutamicum is replaced with H36, or a plasmid is constructed into which the cydABDC gene and the H30 promoter are inserted into the Corynebacterium glutamicum strain. Transformed, or the expression promoter of the zwf gene in the chromosome of Corynebacterium glutamicum was replaced with H36, and the expression promoter of the cydABDC gene in the chromosome was replaced with the H30 promoter.

In one embodiment of the present invention, a recombinant vector into which a gene encoding a secretion signal peptide and a gene encoding a target protein are introduced can be used. In this case, it is preferable that the gene encoding the secretion signal peptide and the gene encoding the target protein are introduced into one recombinant vector. The target protein is expressed in operably linked with a secretion signal peptide, thereby promoting extracellular secretion of the target protein.

In the present invention, the vector that can be used to introduce the gene may be one or more selected from the group consisting of pHCP, pXMJ19, pTac15K, pBBR1MCS, pEKEx1, and pCES208, but is not limited thereto.

In the present invention, the introduction or amplification of a gene means that when the peptide or protein produced by the gene is not in the host microorganism, it is artificially expressed in the host microorganism to have the activity or function of the peptide or protein. Rather, it includes modifications so that the activity or function of the peptide or protein produced by the gene is enhanced compared to the intrinsic activity or function.

In the present invention, the term "intrinsic activity or function" refers to the activity or function possessed by enzymes, peptides, proteins, etc. that the original microorganism has in its unmodified state, and "modified to enhance compared to the intrinsic activity or function." "It means that the activity or function is newly introduced or further improved compared to the activity or function of the peptide in the state before modification, and a gene showing the activity or function is introduced or the copy number of the gene is increased (e.g. (e.g., expression using a plasmid into which a gene has been introduced), modification of the expression control sequence, for example, use of an improved promoter, etc., the activity of the microorganism after the manipulation is compared to the activity of the microorganism before the manipulation. It means a state of increased activity or function.

In the present invention, “enhancement of peptide function” includes not only introducing or increasing the function of the peptide itself to produce effects beyond the original function, but also increasing intrinsic gene function and amplifying intrinsic genes from internal or external factors. , the function is increased by increasing the number of gene copies, introducing genes from outside, modifying the expression control sequence, especially promoter replacement or modification, and increasing the peptide function by intragene mutation.

In the present invention, the term "overexpression" refers to a higher level of expression than the level at which the corresponding gene is expressed in the cell under normal conditions, and refers to replacing the promoter of a gene present in the genome with a strong promoter or using an expression vector corresponding to the gene. It is a concept that includes increasing the expression level by cloning genes and transforming them into cells.

In the present invention, the term “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable control sequence capable of expressing the DNA in a suitable host. Vectors can be plasmids, phage particles, or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vector, “plasmid” and “vector” are sometimes used interchangeably herein. For the purposes of the present invention, it is preferred to use plasmid vectors. A typical plasmid vector that can be used for this purpose is (a) an origin of replication that allows efficient replication to contain several to hundreds of plasmid vectors per host cell, and (b) a selection site for host cells transformed with the plasmid vector. It has a structure that includes (c) an antibiotic resistance gene that allows the DNA fragment to be inserted, and (c) a restriction enzyme cut site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method. After ligation, the vector must be transformed into an appropriate host cell. Transformation can be easily achieved using the calcium chloride method or electroporation (Neumann, et al., EMBO J., 1:841, 1982).

The promoter of the vector may be constitutive or inducible and may be further modified for the effect of the present invention. Additionally, the expression vector includes a selectable marker for selecting host cells containing the vector, and, in the case of an expression vector capable of replication, includes an origin of replication (Ori). Vectors can self-replicate or integrate into host genomic DNA. Preferably, the gene inserted into the vector and delivered is irreversibly fused into the genome of the host cell so that gene expression within the cell continues stably for a long period of time.

In the present invention, a base sequence is “operably linked” when placed in a functional relationship with another nucleic acid sequence. This may be a gene and regulatory sequence(s) linked in a way that allows gene expression when an appropriate molecule (e.g., transcriptional activation protein) is bound to the regulatory sequence(s). For example, the DNA for the pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a pre-protein that participates in secretion of the polypeptide; A promoter or enhancer is operably linked to the coding sequence if it affects transcription of the sequence; or the ribosome binding site is operably linked to the coding sequence when it affects transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence when positioned to facilitate translation. Generally, “operably linked” means that the linked DNA sequences are in contact and, in the case of a secreted leader, are in contact and are in reading frame. However, the enhancer need not be in contact. Linking of these sequences is accomplished by ligation at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker is used according to a conventional method.

As is well known in the art, in order to increase the level of expression of a transgene in a host cell, the gene must be operably linked to transcriptional and/or translational expression control sequences that are functional within the selected expression host. Preferably, the expression control sequence and/or the corresponding gene are included in a single recombinant vector that also contains a bacterial selection marker and a replication origin. When the host cell is a eukaryotic cell, the recombinant vector must further contain an expression marker useful in the eukaryotic expression host.

Host cells transformed by the above-described recombinant vector constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or through completion of chromosomal integration.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequence of the present invention. Likewise, not all hosts perform equally well for the same expression system. However, those skilled in the art can make an appropriate selection among various vectors, expression control sequences and hosts without undue experimental burden and without departing from the scope of the present invention. For example, when choosing a vector, the host must be considered, because the vector must replicate within it. The copy number of the vector, the ability to control copy number and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In addition, the gene introduced in the present invention can be characterized as being introduced into the genome of the host cell and existing as a factor on the chromosome. For those skilled in the art to which the present invention pertains, it will be obvious that inserting the above gene into the genomic chromosome of a host cell will have the same effect as when introducing a recombinant vector into the host cell as described above.

In the present invention, the target protein secreted and produced using the recombinant Corynebacterium genus microorganisms may be characterized as endoxylanase (XynA), cAbHuL22, or M18, but is not limited thereto. Other recombinant proteins may be applied.

In the present invention, the target protein may be introduced by being operably linked to a secretion signal peptide that induces secretion of the target protein in Corynebacterium genus microorganisms.

In the present invention, the secretion signal peptide that induces secretion of the target protein is Cg2052 secretion signal peptide, Cg1514 secretion signal peptide, CgR0949 secretion signal peptide, TorA secretion signal peptide, CspA secretion signal peptide, Prorin B (PorB) secretion signal peptide, It may be characterized as being selected from the group consisting of C1 secretion signal peptide, CgR_2070 secretion signal peptide, and AprE secretion signal peptide, but is not limited thereto. In other words, it will be apparent to those skilled in the art that secretion signal peptides that can induce secretion of a target protein from microorganisms of the Corynebacterium genus can be used without limitation.

In the present invention, the microorganisms of the Corynebacterium genus are Corynebacterium glutamicum , Corynebacterium acetoglutamicum , and Corynebacterium acetoacidophilum . , Corynebacterium thermoaminogenes , and Corynebacterium ammoniagenes , but are not limited thereto.

From another aspect, the present invention includes the steps of: (a) culturing the recombinant microorganism of the Corynebacterium genus and expressing a gene encoding the target protein to secrete and produce the target protein; and (b) recovering the secreted/produced target protein.

Since the method of the present invention relates to a method of producing a target protein using the above-described “recombinant microorganism of the genus Corynebacterium ,” duplicate content will be omitted.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example One: NADPH Overproduction for Corynebacterium genus Microbiological improvement

In order to increase NADPH, one of the intracellular energy sources, the zwf gene (Figure 1A), which is involved in NADPH production, can be expressed under the H36 promoter (Patent Publication 10-2014-0110134), a strong promoter on the chromosome of Corynebacterium. Corynebacterium was improved (Figure 1B). In order to replace the expression promoter of the zwf gene in the chromosome with H36, Corynebacterium ATCC13032 was used as a template and the zwf gene was grown into zwfUp_F (SEQ ID NO: 5), zwfUp_R (SEQ ID NO: 6), zwfDown_F (SEQ ID NO: 7), and zwfDown_R (SEQ ID NO: 8) was amplified by PCR, and these two PCR products and the H36 promoter part (Yim, S. S. et al, (2013) Biotechnology and bioengineering. 110, 2959-2969) were cloned into pCES208_confirm_F (SEQ ID NO: 9) and H36_R (SEQ ID NO: Using the H36 promoter PCR product amplified using 10), overlap PCR was performed with zwfUp_F and zwfDown_R to obtain the final product. The primer sequences of SEQ ID NO: 5 to SEQ ID NO: 10 are as shown in Table 1 below.

primer sequence order
number Primer name Sequence(5’-> 3’) 5 zwfUp_F GATTAGCATGCTCCACTCTGTGGCTTCCTTCTT 6 zwfUp_R TGAACGCCGGAGGATCAGCTACTTCAGGCGAGCTTCCATG 7 zwfDown_F AACTTTAAGAAGGAGATATACATGTGAGCACAAACACGACCCC 8 zwfDown_R GTAATCCCGGGTCTTCGGTGGATTCAGCCAT 9 pCES208_confirm_F ctgatcctccggcgttca 10 H36_R atgtatatctccttcttaaagtt

PCR reaction conditions were 98°C for 5 minutes, 1 cycle; 98℃ 5 minutes, 55℃ 20 seconds, 72℃ 1 minute 30 seconds, 30 cycles; It was performed at 72°C for 5 minutes, 1 cycle. This was treated with Sph I and Prepare pK19MobSacB_H36_zwf to be at least 1 μg/μl and inoculate it with Corynebacterium glutamicum of Korean Patent Publication No. 10-2022-0049827. glutamicum ) SP002 strain was induced to undergo primary recombination using electroporation. At this time, the electroporated strain was spread on an LB agar plate containing 20 μg/μl kanamycin to isolate colonies, and then it was confirmed through PCR and base sequence analysis whether it was properly inserted into the induced position on the genome. To induce secondary recombination, the isolated strain was cultured overnight in LB agar liquid medium containing 10% sucrose, and then spread on a sucrose agar plate at the same concentration to isolate colonies. After checking whether the finally isolated colonies were resistant to the antibiotic kanamycin, it was confirmed through base sequence analysis whether the H36 promoter was inserted among the non-antibiotic resistant strains.

The Corynebacterium glutamicum SP002 strain ( C. glutamicum SP002 ::H36 zwf ) created in this way, in which the H36 promoter was inserted for NADPH overproduction, was subjected to BHI (Brain heart infusion, BD) to confirm whether the amount of NADPH increased. The medium was inoculated and cultured at 30°C and 200 rpm for 24 hours. Afterwards, 1/100 of the volume of the cultured strain was transferred to 50 mL of medium containing 15 g/L yeast extract and 7 g/L casamino acid in fresh CGXII medium in a 250 mL flask and cultured under the same conditions. After culturing for 10 hours, it was recovered by centrifugation (13,000 rpm, 10 min, and 4°C) at OD600nm. To measure the amount of NADPH, the NADP/NADPH quantification colorimetoric kit (BioVision, Korea) was used. The recovered Corynebacterium glutamicum SP002 strain with the H36 promoter inserted was dissolved in 400 μL of NADP/NADPH extraction buffer and disrupted for 7 minutes under conditions of 50% pulse and 20% amplitude (Sonics, Newtown, CT, USA). This was centrifuged again (13,000 rpm, 10 min, and 4°C) to recover the supernatant, and the amount of NADPH was measured using the manufacturer's colorimetric method.

As a result of NADPH measurement, it was confirmed that the amount of NADPH increased compared to before substitution with the H36 promoter (Figure 1C).

Example 2: NADPH overproducing improved Corynebacterium genus Secretion function analysis using microorganisms

In order to confirm whether the NADPH-overproducing Corynebacterium glutamicum SP002 ( C. glutamicum SP002 ::H36 zwf ) constructed in Example 1 is effective in secreting the target protein, C1, a synthetic secretion signal peptide, was used. By introducing a system for secreting and producing XynA (Korean patent application 10-2021-0092055), the secreted proteins were analyzed and compared by SDS-PAGE (Figure 2). The improvement in secretion capacity was compared using Corynebacterium glutamicum SP002, which does not overproduce NADPH.

After culturing in BHI (Brain heart infusion, BD) medium at 30°C, 200 rpm, 24 hours, 1/100 of the volume was transferred to a new 250 mL flask and cultured under the same conditions. After culturing, only the culture medium was recovered through centrifugation at 13,000 rpm, 4°C, 10 minutes, and concentrated 30 times using acetone precipitation to obtain protein.

As a result, it was confirmed that the secretion ability of Corynebacterium glutamicum improved in Example 1 was improved (Figure 2B).

Example 3: ATP Overproduction Construction of a plasmid system for ATP analysis and target protein Secretory function comparison

For ATP overproduction, a system was created to overexpress the cydABDC gene of Corynebacterium glutamicum. The CydABDC gene was amplified by PCR using G_H30_cydA_F (SEQ ID NO: 11) and G_cydC_R (SEQ ID NO: 12) using Corynebacterium glutamicum ATCC13032 as a template. The primer sequences of SEQ ID NO: 11 and SEQ ID NO: 12 are as listed in Table 2 below.

primer sequence order
number Primer name Sequence(5’-> 3’) 11 G_H30_cydA_F GGTTGGTTGGGCAGGAGTATATTGGGATCCGTGGATGTCGTCGACATCGCAC 12 G_cydC_R TTGGAGCTCCACCGCGGTGGCGGCCgcttaTTACCTCACATGCCTCACAATCAC

PCR reaction conditions were 98°C for 5 minutes, 1 cycle; 98℃ 5 minutes, 55℃ 20 seconds, 72℃ 6 minutes, 30 cycles; It was performed at 72°C for 15 minutes, 1 cycle. This was inserted into the pXMJ19 plasmid into which the H30 promoter was inserted using the Gibbson assembly method to construct pXMJ19_cydABDC (Figure 3A). The constructed pXMJ19_cydABDC was transformed into Corynebacterium glutamicum SP002 strain and cultured.

The transformed strain was inoculated into BHI (Brain heart infusion, BD) medium and cultured at 30°C and 200 rpm for 24 hours. Afterwards, the cultured strain was transferred to 1/100 of the volume in 50 mL of fresh CGXII medium containing 15 g/L yeast extract and 7 g/L casamino acid in a 250 mL flask and cultured under the same conditions. After culturing for 10 hours, it was recovered by centrifugation (13,000 rpm, 10 min, and 4°C) at OD600nm.

To measure the amount of ATP, an ATP assay kit (Biomax, Korea) was used. The recovered strain was dissolved in 200 μL of ATP assay buffer and disrupted for 7 minutes under conditions of 50% pulse and 20% amplitude (Sonics, Newtown, CT, USA). This was centrifuged again (13,000 rpm, 10 min, and 4°C) to recover the supernatant, and the amount of ATP was measured using the manufacturer's Fluorometic method. As a result of ATP measurement, when comparing the empty plasmid (pXMJ19) transformed into the Corynebacterium glutamicum SP002 strain and the strain transformed with pXMJ19_cydABDC, Corynebacterium glutamicum including a system overexpressing cydABDC It was confirmed that the amount of ATP in the SP002 strain increased more than 2-fold (Figure 3B).

In order to confirm whether overexpression of CydABDC was effective in secreting the target protein, the system for secreting and producing XynA used in Example 2 was introduced, and the secreted proteins were analyzed and compared by SDS-PAGE (FIG. 4). Culture conditions were the same as those used for ATP measurement, and culture was performed for 24 hours. After culturing, only the culture medium was recovered through centrifugation at 13,000 rpm, 4°C, 10 minutes, and concentrated 10 times using acetone precipitation to obtain protein. As a result, as shown in Figure 4, it was confirmed that the secretion ability of the target protein increased in the strain having a system for overexpressing cydABDC.

Example 4: NADPH and ATP overproducing Corynebacterium genus Target protein using microorganisms Secretory function analyze

Corynebacterium glutamicum overproducing NADPH and ATP by transforming pXMJ19_cydABDC constructed in Example 3 into the Corynebacterium glutamicum strain ( C. glutamicum SP002::H36 zwf ) improved in Example 1 C. glutamicum SP003 was constructed (Figure 5A). In order to compare the secretion ability of the target protein in the improved Corynebacterium glutamicum SP003 strain, the system for secreting and producing XynA used in Example 2 was introduced, and the secreted protein was analyzed and compared by SDS-PAGE. The culture conditions were the same as in Example 3, and the proteins were obtained and compared by concentrating 10 times using an acetone precipitation method. As a result, it was confirmed that the secretion production ability increased in the Corynebacterium glutamicum SP003 strain compared to the Corynebacterium glutamicum SP002 strain (Figure 5B).

To confirm whether the target protein secretion production ability increases even when a different secretion production system is introduced, pCES_Cg1514_cAbHuL22 (Yim, S. S. et al., (2016) Biotechnology and bioengineering, 113(1), 163-172) and pCES208_H36_PorB_M18 (An, S.J. et al. al., (2013) Protein Expression and Purification, 89, 251-257) The plasmid was transformed into Corynebacterium glutamicum SP003 strain, and its secretion ability compared to the previously reported Corynebacterium glutamicum ATCC13032 strain (WT) was confirmed. was compared. cAbHuL22 was concentrated 30 times to compare its secretion ability, and M18 was concentrated 50 times to compare its secretion ability. As a result, it was confirmed that the secretion ability in the Corynebacterium glutamicum SP003 strain increased (Figure 5C, Figure 5D).

Example 5: NADPH and ATP overproducing Corynebacterium genus Microbiological improvement

Although the improvement in the target protein secretion production ability was confirmed in Corynebacterium glutamicum SP003 confirmed in Example 4, SP003 contains both a plasmid overexpressing cydABDC and a plasmid system for secreting and producing a recombinant protein. In order to use this more easily, overexpression of the cydABDC gene was attempted to be performed on the chromosome of Corynebacterium glutamicum improved in Example 1. To overexpress CydABDC, we attempted to replace the inherent promoter of cydABDC in the chromosome with a synthetic H30 promoter.

Using Corynebacterium ATCC13032 as a template, the promoter part of the cydABDC gene was amplified by PCR using HindIII_Cg1302_A_F (SEQ ID NO: 13) and Cg1302_R (SEQ ID NO: 14), and pXMJ19_cydABDC constructed in Example 3 was used as a template to produce Cg1302_H30_F (SEQ ID NO: 15) and XbaI_CydA_B_R (SEQ ID NO: 16) were amplified by PCR. These two PCR products were subjected to overlap PCR using HindIII_Cg1302_A_F (SEQ ID NO: 13) and XbaI_CydA_B_R (SEQ ID NO: 16) to obtain the final product. The primer sequences of SEQ ID NO: 13 to SEQ ID NO: 16 are as shown in Table 3 below.

primer sequence sequence number Primer name Sequence(5’-> 3’) 13 HindIII_Cg1302_A_F AATTaagcttCAGAAACAATGGATTTTGGCAA 14 Cg1302_R GCTTGGTTGCGGTGGTTAC 15 Cg1302_H30_F GTAACCACCGCAACCAAGCgggaacaaaagctgggtacc 16 XbaI_CydA_B_R TTAAtctagaAGCTCCGCACGACCAGTCT

PCR reaction conditions were 98°C for 5 minutes, 1 cycle; 98℃ 5 minutes, 55℃ 20 seconds, 72℃ 1 minute 30 seconds, 30 cycles; It was performed at 72°C for 5 minutes, 1 cycle. This was treated with Hind III and pK19MobSacB_H30_CydA was further improved in Corynebacterium glutamicum ( C. glutamicum SP002 ::H36 zwf ) improved in Example 1 using electroporation as in Example 1, and base sequence analysis was performed to determine whether the H30 promoter was inserted. It was confirmed through . This final improved strain was named Corynebacterium glutamicum ( C. glutamicum ) SP004 (FIG. 6).

Example 6: Corynebacterium glutamicum ATP measurement and target protein using SP004 Secretory function analyze

To compare the amount of ATP, pHCP (Korean Patent Publication 10-2018-0092110), an empty plasmid, was used in Corynebacterium glutamicum SP002 and Corynebacterium glutamicum SP004 strains, and synthetic secretion signal peptide C1 was used in the pHCP system. A system secreting cAbHuL22 was introduced and compared. In order to secrete and produce cAbHuL22 using the secretion signal peptide C1, the ), and the synthetic C1 secretion signal peptide in Example 2 was amplified by PCR using NdeI_C1_F (SEQ ID NO: 19) and NotI SfiI SapI_C1_R (SEQ ID NO: 20). The primer sequences of SEQ ID NO: 17 to SEQ ID NO: 20 are as shown in Table 4 below.

primer sequence sequence number Primer name Sequence(5’-> 3’) 17 SapI_cAbHuL22_F TAGAGCTCTTCTGCAcaggtccaactgcaagaaagcggt 18 NotI_cAbHuL22_R atgcatgcgcggccgctcagtgatggtgatgatgatgtgaagagac 19 NdeI_C1_F aacatATGAATAAGAGTAAGGACTCTTCC 20 NotI SfiI SapI_C1_R TCTTgcggccgcGGCCCCCGAGGCCAAAAGCTCTTCATGCTCTTGGTGCTGGGGT

PCR reaction conditions were 98°C for 5 minutes, 1 cycle; 98℃ 5 minutes, 55℃ 20 seconds, 72℃ 1 minute 30 seconds, 30 cycles; It was performed at 72°C for 5 minutes, 1 cycle. The two PCR products and the pHCP vector used in Example 2 were treated with Nde I, Sap I, and Not I restriction enzymes and then cloned to construct pHCP_C1_cAbHuL22, which was transformed into Corynebacterium glutamicum SP002 and SP004. used.

As a result of measuring the amount of ATP in the same manner as in Example 3, it was confirmed that the amount of ATP in Corynebacterium glutamicum SP004 increased (FIG. 7A).

In addition, the culture conditions and recovery method of secretion-produced protein were the same as in Example 3, and when the secretion ability of Corynebacterium glutamicum SP002 and SP004 strains was compared using SDS-PAGE (secretion-produced cAbHuL22 (30-fold concentration and comparison), it was confirmed that the secretion ability was improved in the improved Corynebacterium glutamicum SP004 strain (Figure 7B). As a result of comparing the secretion and production of

Example 7: Corynebacterium glutamicum Target protein using SP004 Secretory function comparison

Although not applied to secretion production of the target protein, the polyphosphate kinase (PPK) co-expression method previously used as a strategy to enhance ATP biosynthesis to enhance intracellular metabolism (Motomura K, et al., Appl Environ Microbiol. 2014 Apr;80( 8):2602-8, Chen H, Zhang YPJ. Crit Rev Biotechnol 2021 Feb;41(1):16-33) and Corynebacterium glutamicum SP004. Culture conditions and recovery methods of secreted produced proteins were as described in Example 3.

As a result of comparing the secretion ability of the PPK co-expressing Corynebacterium glutamicum strain and the SP004 strain using SDS-PAGE, it was confirmed that secretion of the target protein in the SP004 strain was significantly increased (FIG. 9).

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (4)

(a) Replacement of the promoter of the zwf gene, represented by the nucleotide sequence of SEQ ID NO: 1, which is endogenously present in Corynebacterium genus microorganisms, with the H36 promoter represented by the nucleotide sequence of SEQ ID NO: 2; And/or the promoter of the cydABDC gene represented by the nucleotide sequence of SEQ ID NO: 3, which is inherently present in microorganisms in the Corynebacterium genus, is replaced with the H30 promoter represented by the nucleotide sequence of SEQ ID NO: 4, and (b) coding for the target protein. A recombinant microorganism of the Corynebacterium genus with improved extracellular secretion and production capabilities of the target protein, into which a gene has been introduced.
The recombinant microorganism of the Corynebacterium genus according to claim 1, wherein the target protein is introduced by being operably linked to a secretion signal peptide that induces secretion of the target protein in the Corynebacterium genus microorganism.
The method of claim 2, wherein the secretion signal peptide that induces secretion of the target protein is Cg2052 secretion signal peptide, Cg1514 secretion signal peptide, CgR0949 secretion signal peptide, TorA secretion signal peptide, CspA secretion signal peptide, and Prorin B (PorB) secretion signal peptide. , a recombinant microorganism of the Corynebacterium genus, characterized in that it is selected from the group consisting of C1 secretion signal peptide, CgR_2070 secretion signal peptide, and AprE secretion signal peptide.
Secretion/production method of target protein comprising the following steps:
(a) culturing a recombinant microorganism of the Corynebacterium genus according to any one of claims 1 to 3 and expressing a gene encoding the target protein to secrete and produce the target protein; and
(b) Recovering the secreted/produced target protein.