KR20140110134A - Synthetic Promoter for Expressing Corynebacteria - Google Patents

Abstract

The present invention relates to a synthetic promoter for expressing corynebacteria and, more specifically, to a screening method of a synthetic promoter able to exhibit high expression efficiency in corynebacteria and to a synthetic promoter for expressing corynebacteria manufactured by the method. If a promoter of the present invention is used, recombinant protein produced in corynebacterium can be produced in a relatively higher yield as exhibited is a gene expression that is a lot stronger than the promoter used in recombinant protein mass production in strains inside the existing corynebacterium.

Description

Synthetic Promoter for Expressing Corynebacteria < RTI ID = 0.0 >

The present invention relates to a synthetic promoter for coryneform bacteria expression, and more particularly, to a synthetic promoter capable of exhibiting high expression efficiency in corynebacteria and a screening method thereof.

Corynebacterium glutamicum, which efficiently produces glutamic acid in the mid-1950s, has been found and industrialization has been made, and Corynebacterium glutamicum Lactic acid, lysine, phenylalanine, glutamine, arginine, tryptophan, leucine, isoleucine, histidine and the like are produced industrially by the fermentation method using the auxotrophic mutants of the present invention.

In the 1980s, host-vector systems for Corynebacterium strains were developed as well as Escherichia coli, making it more reasonable to develop strains. In the 1990s, a variety of metabolic engineering techniques were developed to study the molecular biology of Corynebacterium, Research was concentrated. In addition, new technologies such as metabolic flow analysis and metabolic regulation analysis have been applied to select target genes, and various information obtained from multiple studies has been applied to the development of better production strains.

To engineer cells, it is necessary to control the degree of expression of various related genes, and this regulation of gene expression requires various efficient expression systems. The selection of the promoter is most important for the development of the expression system because the promoter is involved in the degree of expression and regulation of the gene. Several promoters available in Corynebacterium glutamicum have been reported, mainly promoters derived from Corynebacterium or E. coli ( J. Biotechnol ., 104: 311-323, 2003).

However, the promoter derived from Escherichia coli exhibits relatively low activity in Corynebacterium because of low permeability of expression inducing factors and absence of gene expression inhibiting substance. Also, even with the same promoter, the expression efficiency varies depending on the gene encoding the target protein, and the intensity of the promoters usable in Corynebacterium is also small. Therefore, it is not easy to produce an expression system suitable for the purpose. In particular, when the expression of various genes such as the establishment of a metabolic pathway is regulated together, it is a reality that Corynebacterium can not make various choices as in Escherichia coli.

Synthetic promoter library technologies have been developed to overcome these difficulties in the development of expression systems and the usefulness of synthetic promoter libraries in various microorganisms such as Escherichia coli and lactic acid bacteria has been confirmed. A synthetic promoter library is a technique using a reporter protein such as an enzyme or a fluorescent protein, which can randomly sequence a gene corresponding to a promoter and confirm the degree of activity of the promoter corresponding to each sequence. The synthetic promoter library has advantages in that it can easily hold various promoters having a wide range of intensities in a single library construction, and has a merit that a promoter exhibiting strong activity that does not exist in the natural world can be found.

As a result of intensive efforts to discover promoters capable of inducing strong gene expression in the Corynebacterium strain, a synthetic promoter library using a green fluorescent protein as a reporter protein was constructed, and a fluorescence activated cell sorter Thereby screening a synthetic promoter showing strong activity, thereby completing the present invention.

It is an object of the present invention to provide a synthetic promoter showing strong activity in Corynebacterium glutamicum strains.

It is another object of the present invention to provide a method for screening a strong synthetic promoter for expression of Corynebacterium sp.

In order to achieve the above object, the present invention provides a recombinant vector comprising a promoter for expression of a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, a recombinant vector containing the promoter and a recombinant microorganism transformed with the recombinant vector to provide.

The present invention also provides a method for producing a recombinant microorganism, which comprises culturing a recombinant microorganism transformed with the recombinant vector to produce a target protein expressed by a target gene; And recovering the produced protein. The present invention also provides a method for producing a target protein.

(A) preparing a plasmid library containing a promoter and a reporter gene having 62 random base sequences in front of a ribosome attachment site having a base sequence of AGGA and 8 random base sequences in the rear; (b) transforming the plasmid library into a genus of genus Corynebacterium to prepare a library for screening synthetic promoters; (c) culturing a library for screening synthetic promoter to obtain a strain having an excellent expression amount of a reporter gene; And (d) obtaining a promoter contained in the obtained strain. The present invention also provides a method for screening a strong synthetic promoter for expression of Corynebacterium sp.

When the promoter of the present invention is used, the recombinant protein produced in the genus Corynebacterium can be produced at a higher yield than the conventional promoters used for mass production of recombinant protein in the strain of genus Corynebacterium Can be produced.

1 shows a vector system of a synthetic promoter library according to the present invention.
2 shows a screening process of a synthetic promoter library through a fluorescence activated cell sorter.
FIG. 3 shows the degree of expression of green fluorescent protein expressed by two strong promoters (H30 and H36) extracted from a synthetic promoter library by (a) fluorescence intensity analysis, (b) Western blotting, (Negative: Corynebacterium glutamicum containing the pCES208 vector, Positive: Corynebacterium glutamicum containing the vector obtained by linking the trc promoter and the green fluorescent protein to the pCES208 vector).
FIG. 4 shows comparative analysis of the expression levels of two strong synthetic promoters obtained by linking antibody fragments (scFv) to each other. (A) Western blot analysis was performed to compare the expression amounts of antibody fragments through synthetic promoters (Corynebacterium glutamicum containing the pCES208 vector (lane 1); Corynebacterium glutamicum containing the vector obtained by ligating the trc promoter and the antibody fragment to the pCES208 vector (lane 2) ; Corynebacterium glutamicum: (H30 (lane 3), H36 (lane 4)) containing a vector with an antibody fragment attached to a synthetic promoter; (b) Enzyme-linked (pCES208 vector: Corynebacterium glutamicum (◇); pCES208 vector containing the trc promoter and the antibody (pCES208 vector). The expression of the antibody fragment and the activity of the antibody fragment were analyzed by immunosorbent assay Connect Fragment Corynebacterium glutamicum containing a vector: (1) Corynebacterium glutamicum containing the vector obtained by ligating an antibody fragment to a synthetic promoter: (H30 (), H36 ()), ( c) is a comparative analysis of expression amounts of antibody fragments through a synthetic promoter through Western blotting (Corynebacterium glutamicum containing a vector in which a trc promoter and an antibody fragment are ligated to a pCES208 vector ); Corynebacterium glutamicum containing the vector in which the sod promoter and the antibody fragment were ligated to the pCES208 vector (lane 2): Corynebacterium glutamicum containing a vector having an antibody fragment ligated to a synthetic promoter : (H30 (lane 3), H36 (lane 4)).
FIG. 5 is a comparative analysis of expression amounts of xylanase ligated to H30 and H36 synthetic promoters, wherein (a) is a comparative analysis of expression amounts of xylanase by a synthetic promoter through SDS-PAGE (pCES208 vector (Lane 1): Corynebacterium glutamicum containing the trc promoter and xylanase-linked vector in the pCES208 vector (lane 2); a synthetic promoter Corynebacterium glutamicum containing the vector linking xylanase: (H30 (lane 3), H36 (lane 4)). (B) (Corynebacterium glutamicum containing the pCES208 vector (◇): Corynebacterium glue containing the vector obtained by ligating the porB promoter and xyla lane into the pCES208 vector Tamikum: (■); a synthetic promoter Corynebacterium containing the vector connecting the Rana azepin Solarium glutamicum: (H30 (●), H36 (△)).
FIG. 6 shows the results of fermentation of xylalanase using Corynebacterium glutamicum strains producing xylalanase expressed by the H36 promoter, wherein (a) shows the cell growth curve following fermentation and glucose in the medium (B) shows the SDS-PAGE of the fermentation broth obtained over time, and (b) shows the amount of xylanase protein expression (cell growth curve: PAGE results.
FIG. 7 is a comparative analysis of the amount of green fluorescent protein expressed and the amount of transcription when the H36 synthetic promoter gene sequence was changed. FIG. 7 (a) (A), (b), and (c), respectively. In the quantitative reverse transcription PCR, the internal sequence of the H36 synthetic promoter was A, T , G, and C, respectively, of the green fluorescent protein gene.

In one aspect, the present invention relates to a promoter for expression of a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 1, a recombinant vector containing the promoter, and a recombinant microorganism transformed with the recombinant vector.

SEQ ID NO: 1: GGTACCAAAGTAACTTTTCGGTTAAGGTAGCGCATTCGTGGTGTTGCCCGTGGCCCGGTTGGTTGGGCAGGAGTATATTGGGATCC

The promoter of the present invention is a strong synthetic promoter and is a promoter capable of expressing a target protein at a much higher efficiency than that of the sod promoter or the porB promoter used in the Corynebacterium sp. Strain.

In one embodiment of the present invention, in order to screen for a strong synthetic promoter capable of expressing an exogenous protein at a high expression level in a strain of the genus Corynebacterium, 62 ribram sequence sequences are located in front of the ribosome attachment site having the base sequence of AGGA A plasmid library containing green fluorescent protein (GFP) as a reporter gene and a promoter having eight random nucleotide sequences in the rear were prepared, and the plasmid library was transformed into Corynebacterium glutamicum strains to obtain a strong synthetic promoter screening And a strain expressing high fluorescence intensity was selected using a fluorescence activated cell sorter, and a strain showing excellent fluorescence intensity was selected by using a fluorescence activated cell sorter after culturing a Corynebacterium strain of a synthetic promoter screening library In the present invention, Were identified.

In the present invention, the recombinant microorganism is preferably a microorganism belonging to the genus Corynebacterium, more preferably Corynebacterium glutamicum.

In another aspect, the present invention relates to a promoter for expression of a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 2, a recombinant vector containing the promoter, and a recombinant microorganism transformed with the recombinant vector.

SEQ ID NO: 2:

GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCAT N GGATCC

The promoter of the present invention may be characterized in that it has a nucleotide sequence selected from the group consisting of SEQ ID NOS: 3 to 6, each having the sequence of A, T, G and C in the N sequence of SEQ ID NO: 2.

The term " vector " means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in the appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art.

In the present invention, the recombinant vector may include a plasmid vector, a bacteriophage vector, a cosmid vector, and a yeast artificial chromosome (YAC) vector. For the purpose of the present invention, a plasmid vector is preferably used. Typical plasmid vectors that can be used in the present invention include, in one aspect, (a) a cloning initiation point at which replication is efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

The vectors used in the present invention include a multicloning site (MCS) containing several restriction enzyme cleavage sites, which are located in the lacZ gene. Since MCS does not destroy the reading frame of the lacZ gene, lacZ is expressed in a suitable host cell to synthesize a beta-galactosidase enzyme having biological activity. When this host cell is cultured in a medium containing X-gal, a colorless chemical, X-gal is degraded by this enzyme to form an insoluble blue substance. Therefore, the host cell colonies transformed with the plasmid vector into which the foreign DNA is not inserted into the MCS are blue. Conversely, when foreign DNA is inserted into MCS, the lacZ reading frame of the plasmid vector is broken and beta-galactosidase is not produced, resulting in the formation of colorless host cell colonies.

After ligation, the vector should be transformed into the appropriate host cell. In the present invention, a preferred host cell is a prokaryotic cell. Suitable prokaryotic host cell is E.coli strain DH5a, E.coli strain JM101, E.coli K12 strain 294, strain E.coli W3110, E.coli strain X1776, E.coli XL-1Blue (Stratagene ) , and E.coli B , Correlbacterium sp., Etc., and the most preferable host cell used for producing the target protein is a Corynebacterium glutamicum.

Transformation of prokaryotic cells can be readily accomplished using the calcium chloride method described in section 1.82 of Sambrook et al., Supra. Alternatively, electroporation (Neumann et al., EMBO J., 1: 841 (1982)) can also be used to transform these cells.

The expression " expression control sequence " means a DNA sequence that is essential for the expression of a coding sequence operably linked to a particular host organism. Such regulatory sequences include promoters for carrying out transcription, any operator sequences for regulating such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. For example, regulatory sequences suitable for prokaryotes include promoters, optionally operator sequences, and ribosome binding sites.

Eukaryotic cells include promoters, polyadenylation signals and enhancers. The most influential factor on the expression level of the gene in the plasmid is the promoter. As the promoter for high expression, SRα promoter and cytomegalovirus-derived promoter are preferably used.

A nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way that the appropriate molecule (e. G., Transcriptional activator protein) is capable of gene expression when bound to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, " operably linked " means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be contacted. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.

As used herein, the term " expression vector " is usually a recombinant carrier into which a fragment of different DNA is inserted, and generally means a fragment of double-stranded DNA. Herein, the heterologous DNA means a heterologous DNA that is not naturally found in the host cell. Once an expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated.

As is well known in the art, to increase the level of expression of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in the selected expression host. Preferably the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further comprise a useful expression marker in the eukaryotic expression host.

 As used herein, the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.

The present invention relates to a promoter for expression of Corynebacterium sp. Strain having 90% or more sequence homology with the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, a recombinant vector containing the promoter and a recombinant microorganism transformed with the recombinant vector .

In one embodiment of the present invention (Example 5), the specific G base sequence of the promoter having the nucleotide sequence of SEQ ID NO: 3 was replaced with A, T and C, and the foreign gene expression ability of the promoter was confirmed. It was confirmed that it has an expression ability similar to that of the promoter having the nucleotide sequence.

Therefore, it is obvious to those skilled in the art that the promoter having 90% or more homology with the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention has foreign gene expression ability similar to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 will be.

In another aspect, the present invention relates to a method for producing a target protein expressed by a target gene by culturing the recombinant microorganism transformed with the recombinant vector containing the promoter for expressing the genus of genus Corynebacterium and the gene encoding the target protein ; And recovering the produced protein.

In another aspect, the present invention provides a plasmid library comprising (a) a plasmid library containing a promoter and a reporter gene having 62 random base sequences in front of a ribosome attachment site having a base sequence of AGGA and 8 random base sequences rearward step; (b) transforming the plasmid library into a genus of genus Corynebacterium to prepare a library for screening synthetic promoters; (c) culturing a library for screening synthetic promoter to obtain a strain having an excellent expression amount of a reporter gene; And (d) obtaining a promoter contained in the obtained strain. The present invention also provides a method for screening a strong synthetic promoter for expression of Corynebacterium sp.

In the present invention, the reporter gene may be selected from the group consisting of a fluorescent protein, an antibiotic resistance protein, a carbohydrate hydrolase, and the like.

In one embodiment of the present invention, in order to screen a strong synthetic promoter capable of expressing a foreign protein at a high expression level in a strain of the genus Corynebacterium, 70 gene sequences corresponding to the promoter region are randomly designed, Specifically, a synthetic promoter library was constructed by linking a green fluorescent fragment with a reporter gene having a promoter activity. Specifically, 62 random base sequences were arranged in front of the ribosome attachment site having the base sequence of AGGA, and 8 random base sequences were rearward A plasmid library containing green fluorescent protein (GFP) as a promoter and reporter gene was prepared from E. coli, and the plasmid library was transformed into Corynebacterium glutamicum ATCC 13032 strain to prepare a library for screening of a synthetic promoter , Strong synthetic promoter screening A strain exhibiting a high fluorescence intensity was selected using a fluorescence activated cell sorter and a strain exhibiting excellent fluorescence intensity was selected to determine the fluorescence intensity of the strain The promoter of the invention was confirmed.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1: Production of a promoter library

A library was constructed for screening synthetic promoters for the expression of Corynebacterium which can be used for the mass production of proteins in Corynebacterium. As shown in Fig. 1, all 70 gene sequences corresponding to the promoter region were randomly designed, and a green fluorescent protein was linked to a reporter protein having a promoter activity to produce a plasmid of a synthetic promoter library.

First, the library was constructed using Escherichia coli strain Jude-1 (Invitrogen), which has high transformation efficiency. E. coli strain JM110 (New England Biolabs) was transformed with a library plasmid constructed in E. coli strain Jude-1 for demethylation of the constructed library plasmid, and then transformed with the demethylated library plasmid into the final target Corynebacterium glutamicum ATCC 13032 strain. The constructed synthetic promoter library plasmid system is shown in Fig.

As a parent vector of the synthetic promoter library, Escherichia coli-Corynebacterium shuttle vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) was used.

PCR was used as a method for constructing a synthetic promoter library part and a gene fragment coding for a green fluorescent protein. The T _m of the oligonucleotides used for PCR were all designed to be above 55 ° C.

First, a gene fragment encoding a green fluorescent protein was subjected to PCR using a gene encoding a green fluorescent protein as a template and a forward primer and a reverse primer. As a result of the PCR, a DNA sequence encoding GFP having a FLAG tag at the C-terminus as a marker molecule was obtained.

SEQ ID NO: 7: 5'-GA GGATCC ATGAGTAAAGGAGAAGAACTTTTCACTGG- 3 '

SEQ ID NO: 8: 5'-GC GCGGCCGC TTATTTGTCATCGTCATCTTTATAATCGTCGACCT

TGGATAGTTCATC-3 '

As a template for the GFP gene, pEGFP plasmid (manufacturer: Clontech) was used.

The synthetic promoter library was synthesized by PCR using a forward primer (SEQ ID NO: 3) and a reverse primer (SEQ ID NO: 4) designed with an AGGA ribosome attachment site after 62 N base sequences followed by 8 N base sequences.

SEQ ID NO: 9: 5'-GCA GGTACC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGANNNNNNNN GGATCC ATGAGTAAAGGAGAAGAACT-3 '

SEQ ID NO: 10: 5'-GTGCCATGCCCGAAGGTTATG-3 '

The green fluorescent protein and the parent pCES208 obtained by the PCR were digested with restriction enzymes BamHI and NotI, followed by ligation using T4 DNA ligase. The green fluorescent protein-cloned vector and the synthetic promoter library gene were digested with restriction enzymes KpnI Digested with NdeI and ligation was performed using T4 DNA ligase to prepare a plasmid of a synthetic promoter library.

The plasmid thus prepared was transformed into Corynebacterium glutamicum (ATCC 13032) to prepare a synthetic promoter library.

Example 2 Screening of Synthetic Promoter Libraries via Fluorescence Activated Cell Sorter

The Corynebacterium glutamicum synthesis promoter library prepared in Example 1 was inoculated into a BHI (Brain heart infusion) medium and cultured at 30 DEG C and 200 RPM for about 24 hours. Then, fresh BHI medium was added to a volume of 1/100 And cultured under the same conditions for 24 hours. The cultured Corynebacterium glutamicum was centrifuged at 6000 rpm for 5 minutes to obtain cells. The cells were suspended in PBS (phosphate buffered saline), and cells showing fluorescence by the expression of green fluorescent protein were suspended in a fluorescence activated cell sorter Lt; / RTI > Corynebacterium glutamicum strains exhibiting a strong fluorescence intensity of less than 5% were classified and classified. Corynebacterium glutamicum was again cultured on fresh BHI medium and screened. After four rounds of cell sorting screening, the finally sorted Corynebacterium glutamicum was cultured in solid BHI agar medium to obtain colonies and analyzed (FIG. 2).

Example 3: Activity analysis of green fluorescent protein expression of two strong synthetic promoters finally excavated

Two strong synthetic promoters selected through individual colony analysis in Example 2 were named H30 and H36 and sequenced as follows.

H30: GGTACCAAAGTAACTTTTCGGTTAAGGTAGCGCATTCGTGGTGTTGCCCGTGGCCCGGTTGGTTGGGCAGGAGTATATTGGGATCC (SEQ ID NO: 1)

H36: GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCC (SEQ ID NO: 3)

Using the plasmid containing the H30 and H36 promoters and the trc promoter as a positive control, the fluorescence intensity, expression level and transcription amount of green fluorescent protein as a reporter protein were compared and analyzed.

Corynebacterium containing the pCES208 vector, Corynebacterium containing the vector in which the gene fragment to which the green fluorescent protein is linked to the trc promoter is cloned, a gene fragment in which the green fluorescent protein is linked to the H30 and H36 synthetic promoter, is cloned Corynebacterium was inoculated on BHI (Brain heart infusion) medium, cultured at 30 ° C and 200 RPM for 24 hours, transferred to fresh BHI medium by 1/100 volume, and cultured for 24 hours under the same conditions. Each of the cultures of Corynebacterium glutamicum strains was centrifuged at 6000 rpm for 5 minutes to obtain cells. The suspension was suspended in PBS to examine the amount of green fluorescent protein expressed, followed by fluorescence intensity analysis and western blotting.

As a result of fluorescence intensity analysis using a fluorescence analyzer, it was found that the Corynebacterium strain having the plasmid containing the synthetic promoters H30 and H36 as shown in Fig. 3 (a) was much higher in fluorescence than the Corynebacterium containing the trc promoter Respectively.

For Western blot, Corynebacterium having a pCES208 vector in the cells obtained by suspending in the PBS, Corynebacterium containing a vector in which a gene fragment having a green fluorescent protein linked to a trc promoter was cloned, H30 and H36 synthetic promoters Was cloned and the Corynebacterium strains were dissolved by ultrasonication and Western blotted with whole cell lysate was performed to compare the expression amounts of the respective green fluorescent proteins.

Antibodies used in Western blot experiments were antibodies (Sigma-Aldrich, USA) in which Horseradish peroxidase (HRP) was linked to Anti-FLAG M2 antibody.

As a result, as shown in Fig. 3 (b), it was confirmed that the amount of green fluorescent protein expressed by the synthetic promoter of H30 and H36 was higher than the expression of green fluorescent protein through the trc promoter.

To confirm the amount of mRNA transcribed by each promoter, RT-PCR was performed.

First, Corynebacterium containing the pCES208 vector, Corynebacterium containing the vector in which the gene fragment having the green fluorescent protein linked to the trc promoter is cloned, and a gene fragment in which the green fluorescent protein is linked to the H30 and H36 synthesis promoter are cloned Corynebacterium vector was inoculated on BHI medium, cultured at 30 ° C and 200 RPM for 24 hours, transferred to fresh BHI medium by a volume of 1/100, and cultured under the same conditions to the mid-exponentical phase. Total RNA was isolated from the cultured Corynebacterium strains using the Qiagen RNeasy Mini kit. The separated RNAs were analyzed by one step SYBR PrimeScript RT-PCR kit (TAKARA Bio, Japan) and Bio-Rad CFX Connect instrument (Bio- Rad, USA). As a result, as shown in FIG. 3C, it was confirmed by quantitative reverse transcription PCR that the transcription amount of H30 and H36 was larger than that of transcription through the trc promoter.

Example 4 Production of Antibody Fragment and Xylalanase Through a Synthetic Promoter

The porB signal sequence, which can be applied to secretory production, was ligated to the synthetic promoters H30 and H36, and a gene encoding an antibody fragment and a gene encoding a xylanase were ligated to apply secretion production to the two proteins.

PCR was used as a method for constructing the antibody fragment linked to the porB signal sequence and the xylanase gene fragment linked to the porB signal sequence. The T _m of the oligonucleotides used for PCR were all designed to be above 55 ° C.

First, PCR was carried out using primer pairs of SEQ ID NOS: 11 to 12, with the gene coding for the antibody fragment as a template for the preparation of the gene fragment coding for the antibody fragment linked to the porB signal sequence. As a result of the PCR, a DNA sequence coding for an antibody fragment having a FLAG tag at its C-terminal was obtained.

Corynebacterium glutamicum chromosome was used as the template for the amplification of the porB signal sequence and pMoPac16-M18 (Proc. Natl. Acad. Sci. USA, 101: 9193 -9198, 2004) plasmid was used.

SEQ ID NO: 11: 5'-TG GGATCC ATGAAGCTTTCACACCGCATCGCAGCAATGGCAGCAACCGCAGGCATCACAGTGGCAGCATTCGCAGCACCTGCTTCCGCAATGGACATTCAGATGACCC- 3 '

SEQ ID NO: 12: 5'-GTG GCGGCCGC TTATCACTTATCATCGTCGTCCTTGTAGTCGGAAGACACGGTAACGGAGG-3 '

An antibody fragment is linked to a Corynebacterium, H30 and H36 synthetic promoter containing a vector in which a gene fragment with an antibody fragment linked to Corynebacterium, trc promoter and sod promoter (Gene ID: 3343659) containing the pCES208 vector is cloned Corynebacterium with the vector fragment in which the gene fragment was cloned was inoculated on BHI medium, cultured at 30 DEG C and 200 RPM for 24 hours, transferred to fresh BHI medium by 1/100 volume, and incubated for 24 hours under the same conditions. The cultured Corynebacterium glutamicum was centrifuged at 13000 rpm for 10 minutes, and proteins were obtained by acetone precipitation in the supernatant. Western blot was performed on the obtained supernatant protein samples to compare the expression amounts of the respective antibody fragments.

Antibodies used in Western blot experiments were antibodies (Sigma-Aldrich, USA) in which Horseradish peroxidase (HRP) was linked to Anti-FLAG M2 antibody.

As a result, as shown in Fig. 4 (a), it was confirmed that the expression amount of the antibody fragment through the synthetic promoter of H30 and H36 was higher than the expression amount of the antibody fragment through the trc promoter.

In addition, as shown in FIG. 4 (c), it was confirmed that the expression amount of the antibody fragment through the synthetic promoter of H30 and H36 was higher than the expression level of the antibody fragment through the trc and sod promoters.

In addition, immunoadsorption experiments were performed to compare and analyze the activity and relative amounts of antibody fragments. Immunosuppression experiments were carried out according to the method of Jeong KJ and Rani M. (Jeong KJ and Rani M., Bioprocess Biosyst Eng, 34 (7): 811, 2011). After the initial coating of antigen PA toxin, cultures except Corynebacterium cells were used for the reaction. Antibody fragments were assayed by using anti-FLAG M2 antibody (Sigma-Aldrich, USA) conjugated with Horseradish peroxidase Respectively.

As a result, it was confirmed that the amount of the antibody fragment produced through the synthetic promoters H30 and H36 was much larger than that of the antibody fragment produced by the trc promoter as shown in Fig. 4 (b).

In addition, PCR was carried out using primer pairs of SEQ ID NOS: 12 to 13 with a gene coding for xylanase as a template in the preparation of a gene fragment coding for xylalanase linked to the porB signal sequence. As a result of the PCR, a DNA sequence encoding a xylanase having a FLAG tag at its C-terminus as a marker molecule was obtained.

Based on the information of the Corynebacterium glutamicum chromosomal gene as a template for the porB signal sequence, the gene xylanase gene is a chromosomal gene (GenBank accession number AL939125.1) of streptomycet Koeley color A3 (2) Was used as a template.

SEQ ID NO: 13: 5'-TG ATGAAGCTTTCACACCGCATCGCAGCAATGGCAGCAACCGCAGGCATCACAGTGGCAGCATTCGCAGCACCTGCTTCCGCAGCCGAGAGCACGCTC GGATCC-3 '

SEQ ID NO: 14'-CG CATATG CTATTAATGATGGTGATGGTGATGGGTGCGGGTCCAGC-3 '

Corynebacterium containing the pCES208 vector, Corynebacterium containing the vector cloned with the gene fragment to which the xylanase is linked in the porB promoter, a vector cloned with the gene fragment in which the xylanase is linked to the H30 and H36 synthesis promoter Corynebacterium was inoculated into BHI medium, cultured at 30 ° C and 200 RPM for 24 hours, transferred to fresh BHI medium by 1/100 volume, and incubated for 24 hours under the same conditions. The culture solution of Corynebacterium glutamicum was centrifuged at 13000 rpm for 10 minutes, and the supernatant was taken and protein was obtained by the acetone precipitation method. SDS-PAGE was performed on the obtained proteins to compare the amounts of xylanase produced in each strain. it was confirmed that the expression amount of xylalanase through the synthetic promoter according to the present invention was higher than the expression amount of xylalanase through the porB promoter (Fig. 5A).

In order to compare the activity and expression level of secreted xylanase, xylanase activity was measured by DNS measurement experiment. Each culture supernatant of Corynebacterium and DNS solution (7.5 g 3,5-dinitrosalicylic acid (DNS), 14 g NaOH, 216.1 g Rochelle salt, 5.4 mL phenol and 5.9 g Na ₂ S ₂ O ₅ ) Was mixed with 1: 3, reacted at 100 ° C for 5 minutes, and absorbance was measured at 550 nm through a spectrophotometer. As a result, as shown in Fig. 5 (b), the amount of expression of the synthetic promoters H30 and H36 was much higher than the amount of expression of xylanase through the porB promoter.

Through the above experiments, the H36 promoter was selected as the strongest synthetic promoter and mass production of xylenase was carried out by fermentation with Corynebacterium containing the vector to which the xylanase was linked in the H36 promoter. As a result, as shown in Fig. 6, 746 mg / L of xylanase was secreted to the outside of the cell for 35.6 hours through the fermentation experiment.

Example 5: Analysis of the activity of the strongest synthetic promoter finally discovered by gene sequence base substitution

A portion of the most promising synthetic promoter H36 promoter was finally identified and replaced by A, T, G, and C, and the activity of each of the substituted promoters was determined by linking the green fluorescent protein Expression level, fluorescence intensity, and transfer amount were compared and analyzed.

Sequence substitution of the H36 promoter was accomplished by PCR. PCR was performed using the primer pairs of SEQ ID NOs: 15 and 16, SEQ ID NOs: 15 and 17, SEQ ID NOs: 15 and 18 using the nucleotide sequence of SEQ ID NO: 3 (H36) as a template.

SEQ ID NO: 15: CGCGCAATTAACCCTC

SEQ ID NO: 16: tGGATCCtATGCTACTC

SEQ ID NO: 17: tGGATCCgATGCTACTC

SEQ ID NO: 18: tGGATCCaATGCTACTC

The vector obtained by ligating the H36 promoter substituted with the sequence obtained in the above PCR and the H36 promoter to the green fluorescent protein was digested with restriction enzymes KpnI and BamHI, followed by ligation using T4 DNA ligase to obtain a sequence-substituted H36 promoter Plasmids (H36_ATA, H36_ATC, H36_ATT) with green fluorescent protein were synthesized.

The sequence of the substituted H36 promoter was as shown in SEQ ID NOS: 4 to 6, and the expression of green fluorescent protein, a reporter protein, was quantitatively analyzed by fluorescence intensity in the same manner as in Example 3 (FIG. 7).

7a and 7b show comparative analysis of the amount of green fluorescent protein expressed when the internal sequence of the H36 synthesis promoter was changed to A, T, G, and C through the fluorescence activated cell sorter . Corynebacterium glutamicum containing a pCES208 vector as a negative control, Corynebacterium glutamicum containing a vector having a trc promoter and a green fluorescent protein linked to a pCES208 vector as a positive control, and (H36, H36_ATA, H36_ATC, H36_ATT) containing a vector in which a portion of the H36 synthetic promoter gene sequence was changed to A, T, G, and C and a green fluorescent protein was ligated.

FIG. 7C is a comparative analysis of the amount of the green fluorescent protein gene transferred when the internal sequence of the H36 synthetic promoter was changed to A, T, G, and C through quantitative reverse transcription PCR experiments. (H36, H36_ATA, H36_ATC, H36_ATT) containing a vector in which a portion of the H36 synthetic promoter gene sequence was changed to A, T, G, and C and a green fluorescent protein was ligated.

As a result, it was confirmed that the promoter having the substituted sequence also exhibited an excellent expression amount.

SEQ ID NO: 2:

GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCAT N GGATCC

H36_ATA (SEQ ID NO: 4)

: GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCAT a GGATCC

H36_ATT (SEQ ID NO: 5)

: GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCAT t GGATCC

H36_ATC (SEQ ID NO: 6)

: GGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCAT c GGATCC

<110> Korea Advanced Institute of Science and Technology <120> Synthetic Promoter for Expressing Corynebacteria <130> P13-B040 <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 1 ggtaccaaag taacttttcg gttaaggtag cgcattcgtg gtgttgcccg tggcccggtt 60 ggttgggcag gagtatattg ggatcc 86 <210> 2 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 2 ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct 60 tggttggtag gagtagcatn ggatcc 86 <210> 3 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 3 ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct 60 tggttggtag gagtagcatg ggatcc 86 <210> 4 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 4 ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct 60 tggttggtag gagtagcata ggatcc 86 <210> 5 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 5 ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct 60 tggttggtag gagtagcatt ggatcc 86 <210> 6 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> synthetic promoter <400> 6 ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct 60 tggttggtag gagtagcatc ggatcc 86 <210> 7 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gaggatccat gagtaaagga gaagaacttt tcactgg 37 <210> 8 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcgcggccgc ttatttgtca tcgtcatctt tataatcgtc gaccttggat agttcatc 58 <210> 9 <211> 109 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcaggtaccn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 60 nnnnnnnnnn naggannnnn nnnggatcca tgagtaaagg agaagaact 109 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtgccatgcc cgaaggttat g 21 <210> 11 <211> 108 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tgggatccat gaagctttca caccgcatcg cagcaatggc agcaaccgca ggcatcacag 60 tggcagcatt cgcagcacct gcttccgcaa tggacattca gatgaccc 108 <210> 12 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 gtggcggccg cttatcactt atcatcgtcg tccttgtagt cggaagacac ggtaacggag 60 g 61 <210> 13 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 tgggatccat gaagctttca caccgcatcg cagcaatggc agcaaccgca ggcatcacag 60 tggcagcatt cgcagcacct gcttccgcag ccgagagcac gctc 104 <210> 14 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cgcatatgct attaatgatg gtgatggtga tgggtgcggg tccagc 46 <210> 15 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 cgcgcaatta accctc 16 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tggatcctat gctactc 17 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tggatccgat gctactc 17 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tggatccaat gctactc 17

Claims (21)

1. A promoter for expression of a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 1.
A recombinant vector containing the promoter of claim 1.
3. The recombinant vector according to claim 2, further comprising a gene encoding a target protein.
A recombinant microorganism transformed with the recombinant vector of claim 3.
5. The recombinant microorganism according to claim 4, which is a genus of Corynebacterium.
Culturing the recombinant microorganism of claim 4 or 5 to produce a target protein; And recovering the produced protein.
A promoter for expressing a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 2.
8. The expression promoter according to claim 7, which has the nucleotide sequence selected from SEQ ID NOS: 3-6.
9. A recombinant vector containing the promoter of claim 7 or 8.
10. The recombinant vector according to claim 9, which contains a target gene.
A recombinant microorganism transformed with the vector of claim 10.
12. The microorganism according to claim 11, which is a genus of Corynebacterium.
Culturing the recombinant microorganism of claim 11 or 12 to produce a target protein; And recovering the produced target protein.
A method for screening a synthetic promoter for expression of Corynebacterium sp.
(a) preparing a plasmid library containing a promoter and a reporter gene having 62 random base sequences and 8 random base sequences in front of a ribosome attachment site having a base sequence of AGGA;
(b) transforming the plasmid library into a genus of genus Corynebacterium to prepare a library for screening synthetic promoters;
(c) culturing a library for screening synthetic promoter to obtain a strain having an excellent expression amount of a reporter gene; And
(d) obtaining a promoter contained in the obtained strain.
15. The method of claim 14, wherein the reporter gene is selected from the group consisting of a fluorescent protein, an antibiotic- Carbohydrate hydrolase, and a protein encoding a protein selected from the group consisting of carbohydrate hydrolase.
A promoter for expression of a genus of genus Corynebacterium having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and having 90% or more homology.
A recombinant vector containing the promoter of claim 16.
18. The recombinant vector according to claim 17, further comprising a gene encoding a target protein.
A recombinant microorganism transformed with the recombinant vector of claim 18.
20. The recombinant microorganism according to claim 19, which is a genus of Corynebacterium.
Culturing the recombinant microorganism of claim 19 or 20 to produce a target protein; And recovering the produced protein.

Images