KR20240041297A - Pharmaceutical composition for intra-arterial administration comprising an adult stem cell transfected with neurogenic transcription factor gene with basic helix-loop-helix motif - Google Patents

Abstract

The present invention includes an adult stem cell line into which a basic helix-loop-helix (bHLH) series neurogenesis transcription factor gene has been introduced, and is administered intra-arterially after mannitol is administered. It relates to a pharmaceutical composition for preventing or treating neurological diseases, and administration of the pharmaceutical composition can overcome chronic physical disorders caused by cell death accompanying stroke, including stroke, Parkinson's disease, Alzheimer's disease, and spinal cord disease. It has been developed as a new treatment applicable to neurological diseases such as injuries and can be widely used for clinical and various research purposes.

Description

Pharmaceutical composition for intra-arterial administration comprising an adult stem cell line into which a basic helix-loop-helix (bHLH) family neurogenic transcription factor gene has been introduced cell transfected with neurogenic transcription factor gene with basic helix-loop-helix motif}

The present invention relates to a pharmaceutical composition comprising an adult stem cell line into which a basic helix-loop-helix (bHLH) family neurogenic transcription factor gene has been introduced, specifically, basic helix-loop-helix (bHLH) series neurogenic transcription factor genes have been introduced into the pharmaceutical composition. Preventing neurological diseases, including an adult stem cell line into which a basic helix-loop-helix (bHLH) family neurogenic transcription factor gene has been introduced, and administering mannitol followed by intra-arterial administration, or It relates to a pharmaceutical composition for treatment.

Mesenchymal stem cells are generally support cells (stroma) that assist hematopoiesis in the bone marrow, and while maintaining an undifferentiated state, they grow into various mesodermal lineage cells, including bone, cartilage, fat, and muscle cells. Because it has differentiation properties, it is very useful as a material for developing artificial tissues.

As it was reported that mesenchymal stem cells have the potential to differentiate into glial cells in the brain (Azizi et al., Proc. Natl. Acad. Sci. USA, 94, 4080-4085 (1998); Kopen et.al., Proc. Natl. Acad. Sci. USA, 96, 10711-10716 (1999)) The possibility of treating diseases of the central nervous system using mesenchymal stem cells has been raised (Li et al., Neurosci. Lett., 315 , 67-70 (2001); and Chen., et al., Stroke 32, 1005-1011 (2001)).

A method of using growth factors or hormones is known as a differentiation method to create artificial nerve cells using these undifferentiated cells, but this method has the problem of generating additional cells other than nerve cells (Sanchez-Ramos et al. , Exp. Neurol., 164, 247-256 (2000); Woodbury et al., J. Neurosci. Res., 61, 364-370 (2000); Deng et al., Biochem. Biophys. Res. Comm., 282, 148-152 (2001)), it has been reported that this phenomenon is especially noticeable during brain transplantation in animal models (Azizi., et al., Proc. Natl. Acad. Sci. USA, 94, 4080-4085 ( 1998); and Kopen., et al., Proc. Natl. Acad. Sci. USA, 96, 10711-10716 (1999)). Therefore, the development of a direct method for inducing mesenchymal stem cells to differentiate into nerve cells continues to be required.

Neurogenin and NeuroD are transcription factors of the basic helix-loop-helix (bHLH) family that play a key role in the formation of the nervous system, and are bHLHs such as E12 or E47. It forms a complex with a structural protein and binds to a DNA sequence containing the E-box (CANNTG) or, rarely, the N-box. This binding has been shown to be essential for bHLH structural transcription factors to activate the expression of tissue-specific genes that promote neuronal differentiation (Lee, Curr. Opni. Genet. Dev., 7, 13-20 (1997)) .

Accordingly, research was conducted to develop a material that effectively differentiates highly stable mesenchymal stem cells into neural cells, and the result was the introduction of bHLH family transcription factors such as Neurogenin or NeuroD into mesenchymal stem cells. When mesenchymal stem cells that continuously expressed these transcription factors were prepared and transplanted into the brain of an animal model, it was confirmed that they differentiated into neural cells at a high rate (Korean Patent Publication Nos. 10-2004-0016785 and 10 -2012-0130584).

However, the effect of administering mesenchymal stem cells that introduce bHLH family transcription factors such as Neurogenin or NeuroD and continuously express these transcription factors is due to the blood-brain barrier; This can only be achieved if the treatment effectively penetrates the BBB and reaches the lesion.

The blood-brain barrier (BBB) acts to change the composition of permeable substances within the brain parenchyma by selectively allowing substances in the blood to permeate into the brain parenchyma. However, it has been reported several times that this role of the blood-brain barrier reduces the effectiveness of treatment by limiting the delivery of the treatment into the brain parenchyma when administering treatment for brain diseases such as brain tumors. In the case of chronic stroke, the damage to the blood-brain barrier in the acute phase due to stroke onset and subsequent recovery of blood-brain barrier opening did not result in the therapeutic effect of intravenously injected treatments. To overcome these limitations, selection of an administration route that can effectively penetrate the blood-brain barrier and development of additional agents that can effectively penetrate the blood-brain barrier are required.

Methods for administering cell therapy include intracerebral administration, intravenous administration, and arterial administration. Intracerebral (IC) administration is the most reliable administration method for cell transplantation, but it is not preferred in the clinical field due to dangerous complications such as seizures, chronic subconjunctival hematoma, cortical vein occlusion, and clinical deterioration after the procedure, and intravenous administration is not preferred. (Intravenous, IV) has the problem of potentially reducing the therapeutic effect because most of the mesenchymal stem cells are filtered out in the liver or lungs before they arrive at the target location. In contrast, in the case of intra-arterial (IA) administration, it was judged to be more feasible because it theoretically has a higher predictability of transplantation compared to intravenous administration and is less invasive than intracerebral administration, but there was no disclosure about the actual treatment effect. .

Mannitol is a sugar alcohol widely used as a raw material for food, medicine, pharmaceuticals, and cosmetics. The chemical formula is C ₆ H ₁₄ O ₆ , and both D- and L- forms exist, but D-type mannitol is widely distributed in nature. In addition, mannitol is an osmotic agent and has a diuretic effect. In addition, it is known to have various effects such as changing the structure of red blood cells, improving microcirculation by reducing hematocrit, and destroying blood vessel walls.

Accordingly, the present inventors studied a method of administering a pharmaceutical composition containing as an active ingredient an adult stem cell line into which a basic helix-loop-helix (bHLH) series neurogenesis transcription factor gene has been introduced. As a result, it was confirmed that administering mannitol followed by intra-arterial (IA) administration of mesenchymal stem cells into which neurogenic transcription factor genes were introduced maximized the effectiveness of preventing or treating neurological diseases, especially chronic stroke and Alzheimer's. The invention was completed.

Patent Document 1: Korean Patent Publication No. 10-2004-0016785 Patent Document 2: Korean Patent Publication No. 10-2012-0130584

The purpose of the present invention is to provide a pharmaceutical composition for temporarily opening the blood-brain barrier to allow stem cell therapeutics to access the infarcted area and increase the therapeutic efficacy of neurological diseases.

In order to achieve the above object, the present invention includes as an active ingredient an adult stem cell line into which a basic helix-loop-helix (bHLH) series neurogenic transcription factor gene has been introduced, and mannitol is administered. Provided is a pharmaceutical composition for preventing or treating neurological diseases, which is administered by intra-arterial administration.

The present invention includes an adult stem cell line into which a basic helix-loop-helix (bHLH) series neurogenesis transcription factor gene has been introduced, and is administered intra-arterially after mannitol is administered. It relates to a pharmaceutical composition for preventing or treating neurological diseases, and administration of the pharmaceutical composition can overcome chronic physical disorders caused by cell death that accompany stroke, including stroke, Parkinson's disease, Alzheimer's disease, and neuropathy. It has been developed as a new treatment applicable to neurological diseases such as tone chorea, amyotrophic lateral sclerosis, and spinal cord injury, and can be widely used for clinical and various research purposes.

Figure 1a is a photograph of GFP-positive MSC and MSC/Ngn1 cells observed under a fluorescence microscope and a microscope photograph confirming superparamagnetic iron oxide (SPIO) labeling using Prussian blue staining.
Figure 1b is a picture of a brain cross-section taken by MRI at 4 and 24 hours after transplanting SPIO-labeled cells into the internal carotid artery of a chronic stroke animal model.
Figure 1c is a graph quantifying the area occupied by cells remaining in the brain tissue of an animal model based on the signal for SPIO observed on MRI.
Figure 2a is a graph measuring the vascular endothelial cell penetration resistance (TEER) after mannitol treatment in bEnd.3 cells, showing that tight junction formation is reduced by mannitol.
Figure 2b is a graph showing the permeability of a 150 kda fluorescent substance (FITC-dextran) after treating cultured bEnd.3 cells with mannitol.
Figure 2c is a fluorescence micrograph showing the results of immunocytochemistry confirming the expression of tight junction markers ZO-1 and Claudin-5 in cultured bEnd.3 cells before and after mannitol treatment.
Figure 2d is a diagram showing the results of Western blotting confirming the expression level of tight junction markers in cultured bEnd.3 cells after treating them with mannitol.
Figure 2e is a graph quantitatively showing the relative expression level of Z0-1, a tight junction marker, in cultured bEnd.3 cells after treatment with mannitol.
Figure 2f is a graph quantitatively showing the relative expression level of Claudin-5, a tight junction marker, in cultured bEnd.3 cells after treatment with mannitol.
Figure 3a is a schematic diagram of an experiment comparing the mobility of MSC-GFP and MSC/Ngn1-GFP cells after treating bEnd.3, which formed tight junctions, with mannitol.
Figure 3b is a graph showing the results of quantifying and comparing the number of cells that moved to the bottom of the insert.
Figure 4 is a graph showing the results of measuring and comparing the resistance of MSC and MSC/Ngn1 cells in an environment without serum (FBS) and hypoxic conditions.
Figure 5a is a diagram showing a photograph of brain tissue separated when mannitol and Evans blue dye were injected into the tail vein (IV) and internal carotid artery (IA) in an animal model with a normal blood-brain barrier.
Figure 5b is a photograph showing that when mannitol is injected into the internal carotid artery, the injection speed affects the blood-brain barrier permeability in a normal animal model.
Figure 6a is a schematic diagram showing the injection of mannitol into the internal carotid artery and Evans blue dye at different times in an animal model.
Figure 6b is a diagram showing a photograph of brain tissue separated after mannitol was injected into a normal animal model and Evans blue dye was injected at different times.
Figure 6c is a diagram showing a photograph of brain tissue separated after mannitol was injected into a chronic stroke animal model and Evans blue dye was injected at different times.
Figure 7a is a diagram showing a photograph of a brain cross-section after selection of a stroke animal model using MRI and transplantation of SPIO-labeled cells.
Figure 7b is a graph quantifying the cells remaining in the brain tissue of an animal model based on the signal for SPIO observed on MRI.
Figure 8a is a photograph confirming the outflow of extravascular cells 1 hour, 24 hours, and 1 week after cell transplantation.
Figure 8b is a graph showing the quantification of GFP positive cells in the area around the ischemic lesion.
Figure 8c is a graph showing the number of stem cells distributed in the ischemic lesion hemisphere quantified using AluJ-qPCR.
Figure 8d is a fluorescence micrograph showing hMT/NeuN, hMT/MAP2, and hMT/GFAP positive cells in brain tissue of a chronic stroke animal model administered MSC and MSC/Ngn1 cells after mannitol pretreatment.
Figure 9a is a graph showing the results of the Corner test in a stroke animal model.
Figure 9b is a graph showing the results of the Rotarod test in a stroke animal model.
Figure 9c is a graph showing the results of an adhesive removal test in a stroke animal model.

Hereinafter, the present invention will be described in detail.

In the present invention, the term "basic helix-loop-helix (hereinafter, bHLH)" refers to the shape of a transcription factor, where two molecules twisted like a twisted helix are connected by a loop. It is reported that transcription factors of the basic helix-loop-helix series play an important role in gene expression in multicellular animals.

In the present invention, neurogenesis transcription factors can be used as the bHLH family transcription factors, and examples of neurogenesis transcription factor genes include, for example, neurogenin 1 gene (GenBank Accession No. U63842, GenBank Accession No. U67776), neurogenesis Genin 2 gene (GenBank Accession No. 76207, GenBank Accession No. AF303001), Neuro D1 gene (GenBank Accession No. U24679, GenBank Accession No. AB018693), MASH1 gene (GenBank Accession No. M95603, GenBank Accession No. L08424), cDNA obtained from base sequence information such as the MATH3 gene (GenBank Accession No. D85845) and the E47 gene (GenBank Accession No. M65214, GenBank Accession No. AF352579) can be cloned or synthesized and used, and may exhibit equivalent or similar activity. If possible, parts of these sequences may be modified, deleted, or substituted.

In the present invention, the term "adult stem cell" refers to an undifferentiated cell that differentiates into cells of a specific tissue when necessary, and the adult stem cell line includes bone marrow, adipose tissue, blood, umbilical cord blood, umbilical cord, and liver. , may be stem cells derived from the skin, gastrointestinal tract, placenta, uterus, or aborted fetus. Preferably, the adult stem cell line is a bone marrow-derived adult stem cell line, and more preferably, it is a bone marrow-derived mesenchymal stem cell line. Bone marrow-derived adult stem cells include several types of adult stem cells, including hematopoietic stem cells that can produce blood and lymphocytes and mesenchymal stem cells (MSC). Among them, mesenchymal stem cells can proliferate in vitro. As a cell that is easily differentiated into various cell types (adipocytes, chondrocytes, muscle cells, and bone cells) (Caplan, A.I., J. Orthop. Res., 9:641-650, 1991; Beresford, J. N., et al., J. Cell Sci., 102:341-351, 1992; Pittenger, M.F., et al., Science, 284:143-147, 1999; Patricia, A. Z., et al., Tissue engineering, 7:211- 227, 2001), and can be used as a useful target in gene therapy and cell therapy (Banfi, A., et al., Exp. Hematology, 28:707-715, 2000).

In the present invention, the term "adult stem cell line into which a basic helix-loop-helix neurogenesis transcription factor gene has been introduced" refers to the basic helix-loop-helix neurogenesis transcription factor, preferably neurogenin of SEQ ID NO: 1. 1 This refers to an adult stem cell line into which a gene has been introduced.

The present invention includes an adult stem cell line into which a basic helix-loop-helix (bHLH) series neurogenesis transcription factor gene has been introduced and mannitol, and an adult stem cell line into which the bHLH series neurogenesis transcription factor gene has been introduced. Stem cell lines and mannitol provide a pharmaceutical composition for preventing or treating neurological diseases, which is administered by intra-arterial administration.

The basic helix-loop-helix (bHLH) series neurogenesis transcription factor gene may be cloned into a vector and introduced into adult stem cells.

In the present invention, the term “vector” refers to an expression vector capable of expressing a target protein in a suitable host cell, and refers to a genetic construct containing essential regulatory elements operably linked to express the gene insert.

In the present invention, the term "operably linked" means that a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest are functionally linked to perform a general function. Operational linkage with a recombinant vector can be made using genetic recombination techniques well known in the art, and site-specific DNA cutting and ligation can be done using enzymes generally known in the art.

Vectors include plasmid vectors, cosmid vectors, viral vectors, etc. Preferably, it is a viral vector. Viral vectors include retroviruses, such as Human immunodeficiency virus (HIV), Murineleukemia virus (MLV), Avian sarcoma/leukosis (ASLV), Spleen necrosis virus (SNV), Rous sarcoma virus (RSV), and Mouse mammary tumor (MMTV). This includes vectors derived from MSV (Murine sarcoma virus), Lentivirus, Adenovirus, Adeno-associated virus, and Herpes simplex virus. Not limited.

The pharmaceutical composition of the present invention is to inject mannitol to effectively deliver the stem cells to the brain and central nervous system by opening the blood brain barrier (BBB), and to administer the stem cell line arterially.

For successful treatment of neurological diseases, it is very important to efficiently deliver drugs to the cranial nervous system. However, because the brain nervous system tissue is surrounded by the dura mater, pia mater, and blood brain barrier (BBB), the delivery efficiency of therapeutic drugs is very low. In addition, even with existing general drug administration methods, there is a problem in that in order to deliver an appropriate amount of therapeutic drug, a larger amount of drug must be administered to the affected area than the drug needed, resulting in side effects.

Therefore, as described above, in the present invention, in order to effectively deliver stem cells to the brain, mannitol is first used to open the blood-brain barrier and then the stem cells are administered, thereby effectively delivering stem cells and preventing or treating neurological diseases. It is being done. Mannitol is a vasodilator drug that reduces pressure in the superior skull, and can induce temporary and strong contraction of the endothelial cells that form the blood-brain barrier, making it effective in treating patients with brain diseases such as Alzheimer's disease. It is known as a drug used when administering drugs to patients.

For arterial administration of the present invention, carotid artery administration is preferred.

The carotid artery is one of the arteries and is divided into three blood vessels: the common carotid artery, the external carotid artery (ICA), and the internal carotid artery (ICA).

The carotid artery administration is preferably administered through the internal carotid artery (ICA).

The carotid artery administration is administered by ligating the pterygopalatine artery (PPA) before administration, but this process can be omitted depending on the patient.

The adult stem cell line into which the basic helix-loop-helix neurogenesis transcription factor gene has been introduced is administered after mannitol is injected.

The mannitol can be injected at a dose of 0.5 to 3 g/kg, preferably at a dose of 1 to 3 g/kg, and more preferably at a dose of 1 to 2 g/kg.

The mannitol may be injected as a bolus at a rate of 1 to 5 ml per 15 seconds, and preferably may be injected as a bolus at a rate of 1 to 4 ml per 15 seconds, more preferably. In other words, it may be injected as a bolus at a rate of 1 to 2 ml per 15 seconds.

Bolus injection is a fast injection method in which drugs, drugs, or other compounds are individually administered within a specific time period, generally within 1 to 30 minutes, to increase the drug concentration in the blood.

In addition, the adult stem cell line into which the basic helix-loop-helix neurogenesis transcription factor gene has been introduced may be administered at 1×10 ⁴ to 1×10 ⁹ cells/kg, preferably 1×10 ⁵ It may be administered at a dose of from 1×10 ⁸ dogs/kg, and more preferably between 5×10 ⁵ dogs/kg and 5×10 ⁷ dogs/kg.

The adult stem cell line into which the basic helix-loop-helix neurogenesis transcription factor gene is introduced differentiates into neurons and glial cells.

The pharmaceutical composition of the present invention may be administered intra-arterially for the prevention or treatment of neurological diseases. For effective prevention or treatment of neurological diseases, the present inventors studied various administration routes. Specifically, intracerebral administration (IC) is the most reliable administration method for cell transplantation, but is not preferred in the clinical field due to dangerous complications such as seizures, chronic subconjunctival hematoma, cortical vein occlusion, and clinical deterioration after the procedure. , Intravenous (IV) administration has the problem of potentially reducing the therapeutic effect because most of the mesenchymal stem cells are filtered out in the liver or lungs before they arrive at the target location. In contrast, in the case of intra-arterial (IA) administration, theoretically, it was judged to be more feasible because it has a higher predictability of transplantation compared to intravenous administration and is less invasive than intracerebral administration, as shown in Figures 9a, 9b, and 9c. As confirmed, the therapeutic effect was confirmed in neurological diseases, specifically chronic stroke.

In the present invention, the term “neurological disease” refers to a general term for various diseases related to nerves, especially cranial nerves. The neurological diseases include Parkinson's disease, Alzheimer's disease, Huntington's chorea, amyotriophic lateral sclerosis, epilepsy, schizophrenia, and chronic stroke ( It may be chronic stroke or spinal cord injury, preferably Parkinson's disease, Alzheimer's disease, amyotriophic lateral sclerosis, or chronic stroke.

In the present invention, the term “prevention” refers to any action that suppresses or delays the onset of any disease related to neurological diseases using an adult stem cell line into which the Neurogenin 1 gene has been introduced.

In the present invention, the term “treatment” refers to any action that improves or beneficially changes a neurological disease using the cell line. Preferably, chronic stroke can be effectively treated using the transformed stem cells of the present invention.

In a specific example of the present invention, the present inventors isolated mesenchymal stem cells from bone marrow and introduced Neurogenin 1 into them to prepare mesenchymal stem cells into which Neurogenin 1 was introduced.

Mesenchymal stem cells into which Neurogenin 1 has been introduced have a higher cell transplantation rate than mesenchymal stem cells into which Neurogenin 1 has not been introduced in the acute stage of stroke when the inflammatory response is active after stroke induction. This is presumed to be because the expression of inflammatory cytokines receptors increases in mesenchymal stem cells into which Neurogenin 1 has been introduced, thereby increasing the responsiveness to inflammatory cytokines in the brain injury area.

However, in the chronic stroke model, the effect of increasing the transplantation rate of neurogenin 1-introduced mesenchymal stem cells into the stroke lesion area is not shown (see Figures 1b and 1c). This result is believed to be because, unlike acute stroke, in chronic stroke, the inflammatory response has subsided and the damaged blood-brain barrier has been partially restored, so stem cells are not effectively delivered to the lesion.

Therefore, in brain diseases where the blood-brain barrier is not open or is only slightly open, such as chronic stroke, additional agents that increase the mobility of stem cells are needed.

In the present invention, mannitol was used as an agent that induces contraction of vascular endothelial cells and opens the blood-brain barrier. To determine the effect of mannitol on the tight junctions of vascular endothelial cells, the permeation resistance of vascular endothelial cells and the permeable capacity of fluorescent dextran were measured when treated with mannitol. As a result, vascular endothelial cells remained intact for up to 6 hours after treatment with mannitol. It was confirmed that the penetration resistance of decreased and the transmitted capacity of fluorescent dextran increased (see Figures 2a and 2b).

Additionally, as a result of comparing the expression of tight junction markers before and after mannitol treatment, the expression of tight junction markers decreased when treated with mannitol, confirming that mannitol can loosen the tight junctions of the blood-brain barrier (Figure 2c, 2D, 2E and 2F).

There was no difference in the speed at which the mesenchymal stem cells introduced with Neurogenin 1 and the control mesenchymal stem cells migrated to the bottom through the vascular endothelial cell layer whose permeability was increased by mannitol treatment (see Figures 3A and 3B). This is consistent with the results showing that the initial transplantation rate of mesenchymal stem cells introduced with Neurogenin 1 was not higher than that of mesenchymal stem cells in an animal model (chronic stroke model) in which the blood-brain barrier was partially restored and the inflammatory response was calmed. .

It was confirmed that mesenchymal stem cells into which Neurogenin 1 was introduced were more resistant to hypoxic conditions than mesenchymal stem cells, which means that mesenchymal stem cells into which Neurogenin 1 was introduced were effective in chronic stroke lesions, that is, mesenchymal stem cells under hypoxic conditions. It was confirmed that it has higher viability and survival than cells, showing long-term therapeutic effects, and can be useful in treating chronic stroke (see Figure 4).

Additionally, in order to investigate the in vivo resistance of cells that passed through the blood-brain barrier, a mannitol injection method was first established. As a result of investigating the injection method of mannitol in a normal animal model in which the blood-brain barrier is intact, bolus injection into the internal carotid artery (ICA) opens the blood-brain barrier more than injection into the tail vein or slow injection. The effect was high (see Figures 5A and 5B). The blood-brain barrier opened by mannitol lasts for about 1 hour and then begins to close, but in animals with chronic stroke, the effect of mannitol lasted a little longer (see Figures 6b and 6c).

After opening the blood-brain barrier using mannitol, cells labeled with SPIO or GFP were injected into the cerebral artery, and the mobility and survival of cells in the chronic stroke lesion area were confirmed. As a result, after a day, as time passes, mannitol and In the group administered mesenchymal stem cells introduced with Neurogenin 1, the survival of transplanted cells was significantly higher (see Figures 7A and 7B). Additionally, when mannitol was injected, it was confirmed that the injected stem cells extravasated and remained in the brain parenchyma (FIGS. 8A and 8B). In the early stages (1 to 4 hours) immediately after transplantation, the transplantation rate was higher when mannitol was injected than when it was not injected, regardless of the type of cell. The transplanted cells gradually disappear, and in the later stage (1 day to 1 week), the survival of mesenchymal stem cells introduced with Neurogenin 1 was higher than that of mesenchymal stem cells (see FIGS. 7B, 8B, and 8C). This result is consistent with the fact that Neurogenin 1 increases cell survival under hypoxic conditions (see Figure 4).

In addition, a corner test is used to measure asymmetry due to brain damage to determine whether neurological function is restored when mesenchymal stem cells introduced with neurogenin 1 are administered after mannitol pretreatment in a chronic stroke animal model. A corner test, a rotarod test that measures the running time on a cylindrical device, and an adhesive removal test that measures the time it takes to attach a tape to the animal's front paws and remove the tape were performed. After mannitol pretreatment, the group administered mesenchymal stem cells introduced with Neurogenin 1 showed the highest degree of recovery of neurological function in all tests conducted up to 8 weeks of administration. This means that cerebral artery administration of neurogenin 1-introduced mesenchymal stem cells together with pretreatment with mannitol promotes recovery of behavioral function in chronic stroke (see FIGS. 9A and 9B to 9C).

Therefore, the pharmaceutical composition of the present invention can overcome chronic physical disability caused by cell death accompanying stroke, and can therefore be developed as a new treatment or applicable to neurological diseases such as stroke, Parkinson's disease, Alzheimer's disease, and spinal cord injury. It can be widely used for clinical and various research purposes, including as the basis for cell replacement therapy and gene therapy.

Hereinafter, the present invention will be described in detail through preparation examples and examples.

However, the following preparation examples and examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following preparation examples and examples.

< Manufacturing example 1> Isolation and culture of stem cells

<1-1> From the bone marrow mesenchyme Stem Cells( M.S.C. ) separation of

Carefully add 4 ml of HISTOPAQUE 1077 (Sigma) and 4 ml of bone marrow provided by the Korea Bone Marrow Banking Association (KMDP) into a sterilized 15 ml test tube, then centrifuge at 400 g for 30 minutes at room temperature using a centrifuge. separated. After centrifugation, 0.5 ml of the middle blood buffy coat was carefully collected using a Pasteur pipette and transferred to a test tube containing 10 ml of sterilized phosphate-buffered saline (PBS). The transferred blood layer was centrifuged again at 250 g for 10 minutes, the supernatant was discarded, 10 ml of phosphate buffer solution was added to gently suspend it, and then centrifuged at 250 g for 10 minutes.

After repeating the above process twice, DMEM medium (Gibco) containing 10% FBS (Gibco) was added to the final precipitate, and the cells were seeded in a 100 mm animal cell culture vessel at 1×10 ⁷ cells. The cells were cultured in an incubator at 37°C for 4 hours while supplying 5% CO ₂ and 95% air. To remove cells that did not adhere to the bottom of the culture vessel, the supernatant was removed, new medium was added, and the cells were cultured in an incubator.

<1-2> separated mesenchyme Culture of Stem Cells

The mesenchymal stem cells (hereinafter referred to as MSCs) isolated in Preparation Example 1-1 were maintained at 37°C in a CO ₂ incubator and incubated with mesenchymal stem cell medium (10% FBS + 10 ng/ml bFGF (Sigma)) at 2-day intervals. Culture was performed while replacing with + 1% penicillin/streptomycin (Gibco) + 89% DMEM). After the cells have proliferated to a density of about 80% of the area of the culture vessel, the cells attached to the culture vessel are suspended using 0.25% trypsin/0.1mM EDTA (Gibco) and then diluted 1:20 by adding medium. Next, subculture was carried out in new medium.

< Manufacturing example 2> Neurogenin 1 was introduced mesenchyme Stem Cells( M.S.C. / Ngn1 )Manufacture of

<2-1> neurogenin One( Ngn1 ) Retroviral vector production

The sequence corresponding to the coding region (55 to 768 bp) of the gene sequence of U63842 was ligated to the pMSCV-puro vector (Clontech) using T4 DNA ligase (Roche), and then transduced into E. coli DH5a, ultimately producing pMSCV. The pMSCV-puro/hNgn1 vector was constructed in which the human neurogenin1 (hNgn1) gene was inserted into the -puro vector. The constructed pMSCV-puro/hNgn1 vector was introduced into 293T cells by calcium phosphate precipitation, and its expression was confirmed through Western blotting.

Afterwards, the pMSCV-puro/hNgn1 vector was transduced into PA317 (ATCC CRL-9078) or PG13 (ATCC CRL-10686) cells, which are retrovirus packaging cells, by calcium phosphate precipitation. After 48 hours, only the culture medium was taken and filtered through a 0.45㎛ filtration membrane to obtain a Neurogenin 1 retrovirus solution. The retrovirus solution was aliquoted and stored at -70°C before use.

<2-2> neurogenin One( Ngn1 ) the gene was introduced mesenchyme Manufacturing of Stem Cells

After culturing the mesenchymal stem cells of Preparation Example 1-2 in a 100 mm culture vessel to about 70% full, polybrene (polybrene, Sigma) 8 was added to 4 ml of the Neurogenin 1 retrovirus solution obtained in Preparation Example 2-1. ㎍/㎖ solution and 10 ng/㎖ basic fibroblast growth factor (bFGF, Dong-A Pharmaceutical) were added and cultured for 8 hours.

Then, the retrovirus solution was removed, 10 ml of mesenchymal stem cell medium was added, and the cells were cultured for 24 hours, and then infected with the retrovirus again. After repeating this process 1-4 times, the mesenchymal stem cells were finally removed with trypsin, diluted 1:20 with medium, and subcultured. During subculture, puromycin (puromycin, Sigma) was added to the medium at a concentration of 2 ㎍/ml and selected for 2 weeks to ensure that only retrovirus-infected cells survived.

Finally, mesenchymal stem cells resistant to puromycin were used as cells expressing Neurogenin 1. The prepared mesenchymal stem cells (hereinafter referred to as MSC/Ngn1) into which the Neurogenin 1 gene was introduced were cultured in DMEM (Dulbecco's modified Eagle's medium) medium with 10% fetal bovine serum (HyClone, Logan, UT, USA). and were transplanted for 5 to 7 days in growth medium containing 100 unit/ml penicillin and 100 μg/ml streptomycin (Gibco, Grand Island, NY, USA).

< Example 1> Evaluation of transplantation rate for chronic stroke model

<1-1> GFP manifestation marker

To track the in vivo transplantation rate and differentiation into neurons of MSC and MSC/Ngn1, transplanted cells were transfected with GFP-expressing lentivirus.

Specifically, the MSC of Preparation Example 1-2 and the MSC/Ngn1 of Preparation Example 2-2 were transfected with GFP-expressing lentivirus in 8 μg/ml polybrene for 7 hours to produce GFP. MSC-GFP and MSC/Ngn-GFP expressing were obtained. 10,000 MSC-GFP and MSC/Ngn1-GFP were cultured in 12-well plates for one day. The total number of cells was determined using a dissecting fluorescence microscope (Olympus), and the number of cells expressing GFP was measured. Both MSC-GFP and MSC/Ngn1-GFP cells showed a GFP expression rate of over 95%.

<1-2> SPIO mark

To confirm MSC and MSC/Ngn1 through MRI, MSC and MSC/Ngn1 were labeled with superparamagnetic iron oxide (SPIO) nanoparticles.

Specifically, MSC-GFP and MSC/Ngn1-GFP obtained in Example 1-1 were treated with a SPIO solution at a concentration of 50 μg/ml with cell culture medium and cultured for one day to remove excess SPIO nanoparticles. Washed 3 times.

To measure efficacy before transplantation, the cells were fixed with 4% paraformaldehyde, and for iron (Fe ^{3+ )} staining, Prussian blue (PB) staining was performed using potassium hexacyanophe in 3.7% hydrochloric acid. This was performed with Potassium hexacyanoferrate (trihydrate). After 30 minutes, cells were washed and SPIO was stained blue.

<1-3> Preparation and evaluation of chronic ischemic stroke model

To create a chronic ischemic stroke model, an animal middle cerebral artery occlusion/reperfusion (MCAO) model was performed using the intratibial vessel occlusion method.

Specifically, adult male Sprague-Dawley rats weighing 240 g to 320 g were anesthetized with 3% isoflurane anesthetic gas containing 70% N ₂ O and 30% O ₂ and 2% isoflurane. Flurane was maintained. Afterwards, the neck muscles were excised to expose the right common carotid artery (CCA), right internal carotid artery (ICA), and right external carotid artery (ECA), and the external carotid artery (ECA) was exposed. ) was cut. 4-0 nylon suture with round coated tip (nylon suture, filament size 4-0, diameter 0.19 mm, length 30mm; diameter with coating 0.35 +/- 0.02 mm, and coating length 5-6 mm, LMS Korea) was inserted into the ECA and ligated by gently pushing it into the ICA. 120 minutes after ligation, the nylon sutures were removed, and the animals were anesthetized again and re-perfused (MCAO). During the surgery, the body temperature of the mouse was kept constant at 37°C, and all surgical tools were sterilized.

The created animal model was confirmed to have chronic ischemic stroke through brain MRI scan and Neuro Severity Score TEST (NSS test) on the 3rd day after MCAO (FIG. 7a).

<1-4> Confirmation of initial transplantation rate upon arterial administration in chronic stroke model

MSC and MSC/Ngn1 cells were administered, and their mobility and survival in the chronic stroke lesion area were confirmed as follows.

Using the chronic stroke rat model prepared in Example 1-3 above, a model with a cerebral infarction rate of more than 50% in the acute phase (3rd day) after stroke induction was selected, and one month later (4th week), SPIO-labeled 1 × 10 ⁶ MSC and MSC/Ngn1 cells were suspended in 500 μl saline solution and injected into the internal carotid artery (ICA) for more than 2 minutes.

To enable tracking and observation on MRI, SPIO (supra paramagnetic iron oxide nanoparticles, Sigma Aldrich) at a dose of 50㎍/㎖ was added to stem cell DMEM medium [10% FBS (Gibco) + 10ng/㎖ bFGF (Sigma Aldrich) before transplantation. G) + 1% penicillin/streptomycin (Gibco) + 89% DMEM (Gibco)] and cultured for 16 hours for labeling. SPIO labeling was confirmed through Prussian blue (PB) staining (see Figure 1a). It was confirmed that there was no significant difference in the number of cells distributed in the brain between the MSC and MSC/Ngn1 cell groups in the early stages of transplantation (4 hours and 24 hours) (see Figures 1b and 1c).

< Example 2> Increased permeability of tight junctions in cerebrovascular endothelial cells following mannitol administration

<2-1> Measurement of vascular endothelial cell penetration resistance and fluorescent dextran penetration capacity

In order to confirm changes in blood brain barrier (BBB) permeability following mannitol administration, vascular endothelial cell permeability resistance (trans) is commonly used to evaluate blood brain barrier functionality and fluorescence of implanted FITC-dextran (150 kda). -endothelial electrical resistance (TEER)) was measured.

Specifically, bEnd.3 cells (CRL-2299, ATCC, Manassas VA, USA), a mouse cerebrovascular endothelial cell line, were cultured in high glucose DMEM supplemented with 10% FBS (Hyclone) and 1% penicillin/streptomycin (Gibco). Cells were cultured by adding medium (Gibco) and changing the medium every two days. 50,000 bEnd.3 cells were seeded on transwell inserts with 8㎛ pores, cultured for 5 days, and then treated with 300mM mannitol (Sigma Aldrich) suspended in physiological saline for 6 hours. Transendothelial electrical resistance (TEER) was measured using a Millicell ERS-2 voltohmmeter (Merck Millipore), and 150 kda fluorescent dextran (FITC-dextran, Sigma Aldrich) was transmitted into the chamber. The capacity was confirmed.

As a result, as shown in Figures 2a and 2b, tight junctions were created 5 days after culturing bEnd.3 cells, vascular endothelial cell penetration resistance increased, and the permeated capacity of fluorescent dextran increased. However, the permeability of cerebrovascular endothelial cell tight junctions increased until 6 hours after treatment with mannitol.

<2-2> Measurement of creation and reduction of tight junctions

The formation and reduction of tight junctions was analyzed by immunocytochemistry (ICC) using representative markers ZO-1 and claudin-5.

Specifically, primary antibodies of anti-ZO-1 (1:500, Thermo Fisher Scientific) and anti-claudin-5 (1:500, Thermo Fisher Scientific) and subsequent secondary anti-rabbit 488 or mouse- Antibody 568 (1:250, Life Technologies) was used, and nuclei were detected with Hoechst (1:2,000, Thermo Fisher Scientific). Pictures were acquired using a confocal fluorescence microscope (LSM 710, Zeiss), and bEnd.3 cells cultured for 5 days were treated with mannitol for 3 and 6 hours, and the expression of tight junction proteins was measured by Western blotting (western blotting). was analyzed by blotting). Protein samples from cells were separated by 6% and 10% SDS-PAGE and transferred to PVDF membranes. Afterwards, anti-ZO-1 (1:500, Thermo Fisher Scientific) and anti-claudin-5 (1:500, Thermo Fisher Scientific) primary antibodies followed by HRP (horseradish peroxidase) secondary anti-rabbit or The band was detected using a mouse antibody (1:10,000, Invitrogen), and Actin (1:10,000, Merck Millipore) was used as a housekeeping gene. The image of the band was acquired using the ChemiDoc imaging system (Bio-Rad), and the intensity of the band was measured using the Image J program.

As a result, as shown in Figure 1c, when mannitol was administered compared to the mannitol non-administered group, the stained ZO-1 (tight junction protein 1) and Claudin-5 (components of tight junction strands) became lighter, showing that the binding force between cells was lowered. I was able to confirm that. Additionally, as shown in Figures 1D to 1F, it was confirmed that the expression levels of ZO-1 and Claudin-5, markers of tight junctions, gradually decreased over time.

The above results suggest that administration of mannitol decreases the expression of adapter proteins and reduces intercellular junctions.

< Example 3> In vitro cell migration assay

An in vitro migration analysis was performed to confirm in vitro that MSC and MSC/Ngn1 cells migrate to the chronic stroke environment through vascular endothelial cell tight junctions whose permeability was increased by mannitol treatment.

Specifically, 5 × 10 ⁴ bEnd.3 cells per well were dispensed into the transwell insert of Figure 2a and cultured for 5 days. To prepare a brain tissue sample to be added to the lower chamber, the hemisphere of the chronic stroke cerebrum (ipsilateral hemisphere one month after stroke induction) was homogenized in 3 ml phosphate-buffered saline (PBS) and incubated at 12000 rpm for 5 minutes. was centrifuged, the supernatant was harvested, and the protein in the sample was quantified using BCA Protein Assay (ThermoFisherScientific). After removing the bEnd.3 cells that formed tight junctions by treating them with 300mM concentration of mannitol for 3 and 6 hours, 500㎕ of DMEM medium (1% penicillin) containing 100㎍ protein of chronic stroke tissue hemisphere sample extraction was added to the lower chamber. /Streptomycin (Gibco) was added, and 10,000 MSC-GFP or MSC/Ngn1-GFP cells were added to the insert in 100 ㎕ stem cell DMEM medium [10% FBS (Gibco) + 10 ng/ml bFGF (Sigma Aldrich). + 1% penicillin/streptomycin (Gibco) + 89% DMEM (Gibco)] and cultured in a 5% CO ₂ incubator at 37°C for 24 hours. Next, cells expressing GFP that had passed through the bEnd.3 cell layer and moved to the bottom of the insert were observed under a fluorescence microscope (Olympus) and the number of cells was counted.

As a result, as shown in Figure 3b, it was confirmed that there was no significant difference in the number of MSC and MSC/Ngn1 cells that passed through the bEnd.3 cell layer and migrated to the bottom surface of the insert after mannitol treatment. This means that the opening effect on tight junctions after mannitol treatment is equivalent. However, when treated with mannitol, it was confirmed that transwell migration of MSC and MSC/Ngn1 vascular endothelial cells rapidly increased.

< Example 4> Confirmation of resistance under hypoxic conditions

To compare the resistance of MSC and MSC/Ngn1 cells in ischemic brain tissue in vitro, an experiment was performed in which MSC and MSC/Ngn1 cells were exposed to hypoxic culture conditions for 24 hours as follows.

Specifically, cells were cultured under serum-free and hypoxic conditions. MSC and MSC/Ngn1 cells were cultured in a 5% CO ₂ incubator at 37°C using serum-free DMEM medium [1% penicillin/streptomycin (Gibco) + 99% DMEM (Gibco)], or cultured in a hypoxia chamber. , 2% O ₂ + 5% CO ₂ + 93% N ₂ ) and cultured in an incubator at 37°C.

As a result, as shown in Figure 4, MSC cells decreased under serum deprivation conditions (20% oxygen, serum deprivation) and hypoxic, serum deprivation conditions (2% oxygen, serum deprivation). However, it was confirmed that MSC/Ngn1 cells showed resistance even under serum deprivation and hypoxic serum deprivation conditions (n=5; One-way ANOVA, ***p <0.001).

The above results suggest that MSC/Ngn1 cells are more resistant than MSC cells and exhibit long-term therapeutic effects, making them useful for treating brain diseases such as stroke.

< Example 5> Mannitol blood brain barrier (BBB) Confirmation of increased permeability effect

The injection route and injection speed of mannitol were selected to determine whether the blood-brain barrier penetration effect of mannitol was achieved in normal and chronic stroke models.

Specifically, in normal animals, 25% concentration of mannitol was injected into the tail vein (IV) or internal carotid artery (IA) at an amount of 5 ㎖/kg, and then Evans blue dye at a dose of 4 mg/kg was immediately administered. Immediately after injection into the tail vein and internal carotid artery, the heart was perfused with 0.9% saline solution, fixed with 10% formalin solution, and the brain was removed and photographed using a dissecting microscope (Zeiss).

In addition, when administering to the internal carotid artery, in order to compare the mannitol infusion rate, 25% mannitol was injected as a bolus at a rate of 1.6 ml/15 seconds at a dose of 5 ml/kg, or injected at a rate of 1.6 ml/min and then injected with Evans Blue. The permeability of the dye was measured.

As a result, as shown in Figure 5a, when mannitol was administered through the tail vein, staining did not occur because the blood-brain barrier was not opened, whereas when mannitol was administered arterially, it was confirmed that Evans blue staining occurred after mannitol administration.

In addition, as shown in Figure 5b, it was confirmed that the effect of increasing blood brain barrier permeability by mannitol was effective upon bolus injection (Figure 5b).

< Example 6> Mannitol-induced in chronic stroke model blood brain barrier (BBB) Confirmation of increased permeability effect

The effect of increasing the permeability of the blood-brain barrier by mannitol in a chronic stroke animal model was confirmed by performing the following experiment.

Specifically, 25% mannitol was injected bolus at a dose of 5 mL/kg at a rate of 1.6 mL/15 seconds into the internal carotid artery of a chronic stroke animal model and normal animals 1 month after stroke induction, and administered for 5 and 30 minutes. , 1 hour and 2 hours later, a dose of 4 mg/kg of Evans blue dye was administered through the same route. Immediately after administration of Evans blue dye, the heart was perfused with 0.9% saline solution and fixed with 10% formalin solution. Afterwards, the brain was removed and photographs were taken using a dissecting microscope (Zeiss) (Figure 6a).

One month after the stroke induction of the ischemic stroke mouse model prepared in Example 1-3 above, 25%, 5 mL/kg of mannitol was administered at a dose of 1.6 to the internal carotid artery (ICA) of the chronic stroke animal model. A bolus was injected at a rate of ㎖/15 seconds, and after 5 minutes, 30 minutes, 1 hour, and 2 hours, a dose of 4 mg/kg of Evans blue dye was administered through the same route.

As a result, as shown in Figure 6b, in the control group, the staining peaked at 5 minutes after mannitol injection and disappeared 1 hour later, confirming that the blood-brain barrier was opened and restored. Through this, it was confirmed that mannitol improved blood-brain barrier permeability, allowing the injected Evans blue dye to leak into brain tissue, and that the blood-brain barrier was restored, confirming that mannitol is not toxic to vascular endothelial cells.

Additionally, as shown in Figure 6c, the permeability of the blood-brain barrier by mannitol lasted for more than 1 hour in the chronic stroke animal model. The above results mean that the effect of increasing blood-brain barrier permeability by mannitol administration is higher in the damaged brain of the ischemic model than in the normal control group.

< Example 7> Stem cells through arterial administration and mannitol blood brain barrier Check the increase in passing

After opening the blood-brain barrier using mannitol, MSC and MSC/Ngn1 cells were administered, and their mobility and survival in the chronic stroke lesion area were confirmed as follows.

Specifically, MSC and MSC/Ngn1 cells were treated with SPIO (supra paramagnetic iron oxide nanoparticles, Sigma Aldrich) at a dose of 50 μg/ml using the same method and conditions as in Example 1-2 before transplantation to enable tracking and observation on MRI. ) was added to stem cell DMEM medium [10% FBS (Gibco) + 10 ng/ml bFGF (Sigma Aldrich) + 1% penicillin/streptomycin (Gibco) + 89% DMEM (Gibco)] and incubated for 16 hours. It was cultured and labeled. SPIO labeling was confirmed through Prussian blue staining. Cells were fixed with 4% glutaraldehyde for 10 minutes, washed three times with phosphate buffer solution for 5 minutes each, and treated with staining solution [2% potassium ferrocyanide (Sigma Aldrich) + 3.7% hydrochloric acid] for 30 minutes. Washed with phosphate buffer solution for 5 minutes. Photographs were taken using a dissecting microscope (Zeiss).

In addition, using the chronic stroke model of Examples 1-3, an animal model with a cerebral infarction rate of more than 50% was selected at the beginning of the stroke animal production (day 3), and mannitol (after the 4th week) was administered one month after model production (after the 4th week). 25%, Sigma Aldrich) and control group (0.9% saline) were injected into the internal carotid artery (ICA) at a rate of 1.6 ㎖/15 seconds, and immediately after, 1 × 10 ⁶ MSC and 500 MSC/Ngn1 cells were injected through the same route. It was suspended in ㎕ physiological saline and injected for 2 minutes. The pterygopalatine artery (PPA) was ligated before injection of mannitol and stem cell treatment, and reperfused after completion of injection. MRI T2 star-weighted images were taken at 1 hour, 4 hours, 24 hours, 1 week, 4 weeks, and 8 weeks after stem cell injection, and the number of SPIO-positive pixels appearing in the whole brain tissue MRI image of the animal model was calculated. Quantified. Quantification was performed using the NIH Image J program.

MRI was performed using a 9.4-T animal MRI scanner (Sungkyunkwan University, Biospec 94/30; Bruker BioSpin MRI GmbH, Germany). T2-weighted images have repetition time (TR) = 5000 ms, echo time (TE) = 20 ms, average 2, acquisition matrix = 256 Х 256; 10 slides were obtained with a 1 mm slice thickness (ST) and a flip angle FA = 90°. T2*-weighted images were obtained using a gradient echo sequence with the following acquisition parameters: TR = 500 ms, TE = 12 ms, average = 4. , acquisition matrix = 256×256, 10 slices, ST = 1 mm, FA = 30°. T2*-weighted images were obtained at 1 hour, 4 hours, 24 hours, 1 week, 4 weeks, and 8 weeks after transplantation. A total of 10 slides were scanned to cover the entire rat brain. Ischemic area of each T2-weighted image was displayed directly and calculated through a program (Philips DICOM Viewer R3.0 SP3). The relative infarct volume (RIV) was normalized through the formula RIV = [LT - (RT - RI)] × d (Neumann-Haefelin et al., 2000), where LT and RT are left and right, respectively. Each represents a hemisphere; RI is the infarct area and d is the slice thickness (1 mm). Relative infarct volume (RIV) was expressed as a percentage of right hemisphere volume.

As a result, as shown in Figures 7a and 7b, in the early stages of transplantation (1 hour and 4 hours), the MSC and MSC/Ngn1 cell groups (+Mannitol MSC, +Mannitol MSC/Ngn1) injected with mannitol were compared to the control group (-Mannitol MSC). , -Mannitol It was confirmed that a significantly larger number of cells were distributed in the brain compared to MSC/Ngn1). However, at 24 hours after transplantation, the MSC/Ngn1 group injected with mannitol (+Mannitol MSC/Ngn1) showed significant differences from the MSC group (+Mannitol MSC) and the control group (-Mannitol MSC, -Mannitol MSC/Ngn1). confirmed. After 1 week and 4 weeks, it was confirmed that there was a difference between the MSC/Ngn1 group injected with mannitol (+Mannitol MSC/Ngn1) and the MSC control group (-Mannitol MSC).

As a result of the above results, mannitol, which is used as a blood-brain barrier permeable agent in stem cell administration for chronic stroke, promotes the delivery of injected cells to the peri-infarct area, and once delivered to the brain parenchyma, MSC/Ngn1 is more effective than MSC in chronic stroke. It was confirmed that survival was increased in brain tissue (n=2; One-way ANOVA, *p<0.05, **p<0.01, ***p<0.001).

< Example 8> Confirmation of distribution and extravasation of cells administered to the artery after mannitol administration

To confirm extravasation of the injected stem cells into the brain tissue after carotid administration of mannitol, the cortical area around the ischemic brain lesion was stained with GFP and RECA1 antibodies. To quantify the number, the number of GFP-positive cells was counted and AluJ- qPCR was performed.

Specifically, the right external carotid artery (ECA) was exposed in the model mice of Examples 1-3. After intraarterial administration of mannitol in Example 5, MSC-GFP and MSC/Ngn-GFP prepared in Example 1-2 were each prepared at a density of 1 × 10 ⁶ in 500 μl PBS and administered to the right external carotid artery. It was administered slowly over 2 minutes from the artery (ECA) to the right internal carotid artery (ICA). During administration, the pterygopalatine artery was temporarily sutured and opened after cell administration. Blood flow in the internal carotid artery was maintained during administration. As a control group, the same procedure was performed except that saline solution was used instead of mannitol.

In addition, immunohistochemical staining and AluJ-qPCR were performed to confirm the administered cells.

Specifically, for immunohistochemical staining, rats were deeply anesthetized and perfused with 0.9% saline solution followed by cardiovascular perfusion with 10% formalin. The brain was then removed and fixed overnight. Brains were placed in 15% sucrose PBS and 30% sucrose PBS until tissue deposition. Then, the brain was frozen in isopentane and maintained at -70°C. The frozen tissue was placed in OCT compound and cut to a thickness of 18㎛ using a cryostat. For fluorescent immunohistochemical staining, antigen retrieval was performed by boiling the samples in 10mM sodium citrate buffer (pH 6.0) for 30 minutes at 98°C and washed three times with PBS. To block non-specific staining, slides were incubated with 10% normal serum for 1 hour, and primary antibodies were applied overnight at 4°C. Primary antibodies used were rabbit anti-GFAP (1:500; G9269, Sigma Aldrich), rabbit anti-Iba1 (1:3000; 019-19741, WAKO, USA), and mouse anti-CD68 (1:200; MCA341R, Bio). -rad), mouse anti-hMT (1:300; MAB1273, EMD millipore), rabbit anti-MAP2 (1:200; AB2290, Merck Millipore), rabbit anti-NeuN (1:200; ABN78, EMD millipore) G), mouse anti-RECA-1 (1:50; LS-C140163, LSBio), chicken anti-gFP (1:300; ab13970, Abcam) were used. Next, the tissue was incubated for 1 hour, washed twice with 1% Triton Cultured and cross-stained for 5 minutes using Hoechst. Slide sections were mounted on Fluoromount-G (SouthernBiotech, USA), and fluorescence images were obtained using a Zeiss LSM710 confocal microscope (Carl Zeiss, Oberkochen, Germany).

Additionally, human genomic DNA was isolated from the homogenized right brain hemisphere using a Qiagen kit (Cat No.69504) for qPCR at 1 hour, 24 hours, and 1 week after cell transplantation. Brains were stored at -80°C prior to isolation of genomic DNA. AluJ-qPCR was performed using primers with the sequences shown in Table 1 below.

Sequence (5'→3') sequence number forward primer CACCTGTAATCCCCAGCACTTT SEQ ID NO: 2 reverse primer CCCAGGCTGGAGTGCAGT SEQ ID NO: 3

Amplification was performed at an initial holding temperature of 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 56°C for 30 seconds, and 72°C for 30 seconds, and melting curve analysis was performed from 60°C to 95°C in 1°C increments. The reaction was performed in a volume of 20 μl containing 10 μl of SYBR PCR Master Mix (Thermo Fisher Scientific, A25742), 0.005 nM of each primer, and 100 ng of DNA template diluted with water to the final volume. qPCR analysis was performed using a StepOne Plus real-time PCR machine. The crossing threshold (Ct) value was calculated using the StepOne software. The qPCR standard curve for absolute quantification was determined using a mixture obtained by 10-fold serial dilutions of genomic DNA extracted from the left brain of a normal rat, starting with 100ng of human genomic DNA. qPCR was performed four times per sample, and the number of human cells was calculated by converting from a standard curve using 0-100ng human genomic DNA.

As a result, as shown in Figures 8a and 8b, it was confirmed that when mannitol was not injected (-Mannitol), extravasation of the injected MSCs and MSC/Ngn1 cells was not observed until 24 hours. On the other hand, when mannitol was injected (+Mannitol), extravasation of MSC and MSC/Ngn1 cells was observed 24 hours after injection, and a significant difference in the number of remaining GFP-positive cells was confirmed.

In addition, as shown in Figure 8c, when MSC/Ngn1 cells were administered after mannitol administration, the cells were significantly increased compared to the group administered MSC (+Mannitol MSC) and the control group (-Mannitol MSC, -Mannitol MSC/Ngn1). It was confirmed that many cells remained.

The above results indicate that hyperosmolar mannitol can move cells into the brain parenchyma of chronic stroke, and through this, MSC/Ngn1 cells administered intraarterially pre-treated with mannitol are more likely to leak out of the blood vessel and survive longer than MSCs. You can check that.

< Example 9> Chronic stroke in model M.S.C. / Ngn1 Confirmation of neural differentiation

To analyze the ability of stem cells remaining in the brain tissue to differentiate into neurons during the 1st and 4th weeks of mannitol administration and MSC and MSC/Ngn1 administration, the distribution of neurons and glial cells was confirmed in the lesion and brain parenchyma of the ischemic hemisphere.

Specifically, MSC and MSC/Ngn1 cells were analyzed using human-specific hMT antibodies, and the markers NeuN (nucleus of neurons) and MAP2 (dendrites of neurons), which can confirm differentiation into neurons, and glial cell markers (GFAP) was used to analyze immunohistochemistry. anti-NeuN (1:500, EMD Millipore), anti-MAP2 (1:200, Sigma-Aldrich), anti-GFAP (1:500, Sigma Aldrich) and anti-hMT (1:250, EMD Millipore) G) Primary antibody and secondary anti-mouse 488 or rabbit antibody 568 (1:250, Life Technologies) were used, and nuclei were detected with Hoechst (1:2,000, Thermo Fisher Scientific). Photographs were acquired using a confocal fluorescence microscope (LSM 710, Zeiss).

As a result, as shown in Figures 8b and 8c, the survival of MSC/Ngn1 cells in brain tissue at 1 week after cell transplantation was higher than that of MSCs, but differentiation of these cells could not be observed. As shown in Figure 8d, in the brain tissue after 4 weeks, some remaining MSC cells differentiated and distributed into hMT/GFAP positive cells, while MSC/Ngn1 cells differentiated into hMT/NeuN and hMT/MAP2 positive neurons. I was able to. This is supported by the fact that MSC/Ngn1 has increased survival in the body regardless of whether it is differentiated into nerve cells, and that resistance is increased under hypoxic and serum-free conditions. In addition, when mannitol and MSC/Ngn1 cells are administered, the distribution of nerve cells around brain lesions increases, making them useful for treating brain diseases such as stroke.

<Example 10> Evaluation of neurological function recovery of MSC/Ngn1

To evaluate the effectiveness of stem cells transplanted into animals with chronic stroke, MSC/Ngn1 administered chronic stroke model through animal behavioral analysis, specifically corner test, rotarod test, and attachment removal test, MSC was administered instead of MSC/Ngn1. Neurological function recovery was evaluated up to 8 weeks after administration in a chronic stroke model and a chronic stroke model in which saline was administered instead of MSC/Ngn1.

Specifically, the Corner test was used to evaluate asymmetry in rotation preference, and animals were placed in an apparatus consisting of two boards (50 cm × 30 cm × 30 cm) placed closely at a 30° angle. . When the animal moved deeper into the corner and its whiskers touched the wall, the direction in which the animal turned around was measured, and the average value was recorded after 10 attempts per animal. Normal animals rotate randomly, so the laterality index appears close to 0, whereas in animal models with unilateral brain damage (unilateral abnormality), they rotate in the damaged direction (ipsilateral). The rate of corner movement was expressed as an indicator of defect.

The Rotarod test is a test that measures the time an experimental animal runs on a cylindrical device accelerated from 4 rpm to 40 rpm for 5 minutes. The test was performed 3 times per animal and expressed as the average value. The Adhesive Removal test is a test that measures the time it takes to attach a 10 mm x 10 mm tape to the back of both front paws of an animal and remove the tape from both front paws, with a cutoff time of 300 seconds.

A week before creating the stroke model (-5w), pre-behavior training including corner test, rotarod test, and attachment removal test was performed. Stroke was induced at -4w, and behavioral analysis was performed at weekly intervals. . One month after creating the stroke model (0w), mannitol (25%, 1.6 ㎖/15 seconds, Sigma Aldrich) was injected into the internal carotid artery, and then 1 × 10 ⁶ MSC and MSC/Ngn1 cells were administered through the same route. . Physiological saline was administered as a control group, and behavioral analysis results were observed until 8 weeks after cell transplantation into the animal model.

As a result, as shown in Figure 9, there was no significant difference in the rotarod test between groups. However, motor coordination showed a steady trend of improvement in all animals. Impairment of tactile extinction, as measured by the attachment removal test, recovered in the MSC and MSC/Ngn1 groups after 8 weeks compared to the control group, but there was no significant difference between the MSC and MSC/Ngn1 groups. In the corner test, which can identify sensorimotor deficits and postural asymmetry, the MSC/Ngn1 group showed significant differences in functional results compared to other groups at 6 to 8 weeks after transplantation. In conclusion, it was confirmed that arterial administration of MSC/Ngn1 along with mannitol pretreatment promotes recovery of behavioral function in chronic stroke (n=6, *p<0.05, saline vs. MSC/Ngn1 groups, #p<0.05 saline vs. MSC,†p<0.05, MSC vs. MSC/Ngn1).

<110> Cellebrain Co., Ltd. <120> Pharmaceutical composition for intra-arterial administration comprising an adult stem cell transfected with neurogenic transcription factor gene with basic helix-loop-helix motif <130> 2020P-11-078 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 716 <212> DNA <213> Artificial Sequence <220> <223> Ngn1 cDNA <400> 1 atgccagccc gccttgagac ctgcatctcc gacctcgact gcgccagcag cagcggcagt 60 gacctatccg gcttcctcac cgacgaggaa gactgtgcca gactccaaca ggcagcctcc 120 gcttcggggc cgcccgcgcc ggcccgcagg agcgcgccca atatctcccg ggcgtctgag 180 gttccagggg cacaggacga cgagcaggag aggcggcggc gccgcggccg gacgcgggtc 240 cgctccgagg cgctgctgca ctcgctgcgc aggagccggc gcgtcaaggc caacgatcgc 300 gagcgcaacc gcatgcacaa cttgaacgcg gccctggacg cactgcgcag cgtgctgccc 360 tcgttccccg acgacaccaa gctcaccaaa atcgagacgc tgcgcttcgc ctacaactac 420 atctgggctc tggccgagac actgcgcctg gcggatcaag ggctgcccgg aggcggtgcc 480 cgggagcgcc tcctgccgcc gcagtgcgtc ccctgcctgc ccggtccccc aagccccgcc 540 agcgacgcgg agtcctgggg ctcaggtgcc gccgccgcct ccccgctctc tgaccccagt 600 agcccagccg cctccgaaga cttcacctac cgccccggcg accctgtttt ctccttccca 660 agcctgccca aagacttgct ccacacaacg ccctgtttca ttccttacca ctaggc 716 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 2 cacctgtaat cccagcactt t 21 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 cccaggctgg agtgcagt 18

Claims (13)

A pharmaceutical composition for treating neurological diseases containing an adult stem cell line into which Neurogenin (Ngn), a basic helix-loop-helix (bHLH) family neurogenesis transcription factor gene, has been introduced, and mannitol. ,
The adult stem cell line and mannitol are administered into the carotid artery,
The mannitol is administered via bolus;
A pharmaceutical composition for treating neurological diseases, characterized in that the stem cell line is administered after the mannitol is administered.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the carotid artery is an internal carotid artery (ICA).
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the carotid artery administration is performed by ligation of the pterygopalatine artery (PPA) before administration.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the mannitol destroys the blood brain barrier (BBB) by osmotic pressure.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the mannitol is present at a concentration of 20 to 30%.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the mannitol is administered in a dose of 1 to 10 mg/kg.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the mannitol is bolus injected at a rate of 1 to 2 ml per 15 seconds.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the adult stem cell line is administered at 5×10 ⁵ cells/kg to 5×10 ⁷ cells/kg.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the adult stem cell line is differentiated into neurons and glial cells.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the neurogenin is Neurogenin 1 (Ngn1), Neurogenin 2 (Ngn2), or Neuro D1.
The pharmaceutical method for treating neurological diseases according to claim 1, wherein the adult stem cell line is selected from the group consisting of stem cells derived from bone marrow, blood, cord blood, umbilical cord, adipose tissue, liver, skin, gastrointestinal tract, placenta, and uterus. Composition.
The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the adult stem cell line is a mesenchymal stem cell line.

The pharmaceutical composition for treating neurological diseases according to claim 1, wherein the neurological disease is one of neurological diseases including chronic stroke or a chronic physical disorder accompanying a stroke.