KR20240034967A - Method for Fabrication of Cell Construct Comprising Cell-Spheroid Using Hybrid Bio-printing Technique - Google Patents

Abstract

The present invention relates to a composition for producing a cell-spheroid containing oil and cells, a hybrid 3D cell structure using the cell-spheroid, a method for producing the same, and a hybrid vascularized artificial bone tissue. When using the composition for producing cell-spheroids containing the oil and cells of the present invention, hybrid cells containing cell-spheroids can precisely control their size and position while preventing loss and damage of the cells-spheroids. Since the structure can be manufactured, it can be usefully used to manufacture complex tissues containing various tissues such as blood vessels and nerves as well as vascularized bone tissue.

Description

Method for Fabrication of Cell Construct Comprising Cell-Spheroid Using Hybrid Bio-printing Technique}

The present invention relates to a method for producing a cell structure containing cell-spheroids using hybrid bioprinting technology and its use in tissue engineering.

Human tissue generally has a complex structure consisting of a central tissue and various tissues such as blood vessels and nerves that support it. Tissue engineering aims to assemble functional structures that restore or improve human tissues or organs with such complex structures when they are damaged. Cartilage and skin artificially engineered through tissue engineering are approved by the FDA ( It has been approved by the Food and Drug Administration and is currently being used in patients. Recently, three-dimensional (3D) bio-printing has shown strong potential as one of the additive manufacturing processes in the manufacture of bio-structures in the field of tissue engineering.

Existing bioprinting technology simply prints bioink mixed with various cells or alternately prints various bioinks each containing cells. Existing technologies for introducing cell-spheroids into a three-dimensional cell-loaded scaffold (scaffold containing cells) require a period of about 3 days to prepare the cell-spheroids before the printing process. This is required. The formed cell-spheroids are 1) applied (seeding) to a cell structure produced using bioprinting technology to attach the cell-spheroids, or 2) the cell-spheroids are included in bioink and produced using bioprinting technology. Go through the process. This process can result in loss or damage of cell-spheroids, and has several limitations, such as difficulty in precisely and uniformly distributing them to the desired location. In addition, cell-loaded scaffolds produced using hydrogel-based bioink containing cells exhibit low cell-cell interaction.

Therefore, in order to solve the limitations of the existing technology described above, cell-spheroids with advantages such as high cell-cell interaction and effective secretion of signaling factors are used in the production of cell constructs. Method development is needed.

KR 10-2126733 B1

The present inventors made extensive research efforts to develop a hybrid cell structure containing cell-spheroids that can precisely control the size and location of the cell-spheroids while preventing loss and damage to them. As a result, a new technology was developed to produce a hybrid type of artificial tissue containing both cell-spheroids and cell structures by combining cell-containing mineral oil with bioprinting technology. Using this, vascularized bone tissue, etc. The present invention was completed by demonstrating that it can be effectively used to produce various composite tissues.

Therefore, an object of the present invention is to provide a composition for producing cell-spheroids containing oil and cells.

Another object of the present invention is to provide a hybrid three-dimensional cell construct.

Another object of the present invention is to provide a method for manufacturing a hybrid 3D cell structure.

Another object of the present invention is to provide a hybrid vascularized artificial bone tissue.

According to one aspect of the present invention, the present invention provides a composition for producing a cell-spheroid containing oil and cells.

The present inventors made extensive research efforts to develop a hybrid cell structure containing cell-spheroids that can precisely control the size and location of the cell-spheroids while preventing loss and damage to them. As a result, a new technology was developed to produce a hybrid type of artificial tissue containing both cell-spheroids and cell structures by combining oil containing cells with bioprinting technology. Using this, various types of tissue, such as vascularized bone tissue, were developed. It was found that it can be effectively used to produce composite tissues.

In one embodiment of the present invention, the oil may be mineral oil.

As used herein, the term 'cell-spheroid' refers to a group of cells or aggregated cells that have a spherical or spherical shape in which cells are attached to each other. Cell-spheroids do not necessarily have to be perfectly spherical and do not adhere to any culture substrate. General definitions of cell-spheroids known in the art and conventional cell-spheroid production methods are described in several publications (Fennema, Eelco, et al. Trends in biotechnology 31.2 (2013): 108-115.; and Lin, Ruei -Zhen, and Hwan-You Chang. Biotechnology Journal: Healthcare Nutrition Technology 3.9-10 (2008): 1172-1184.

Previously, three-dimensional cell structures were produced by forming cell-spheroids and then applying (seeding) them to the cell structures, or by using bioink containing pre-formed cell-spheroids in bioprinting technology, but these existing cells -Techniques for introducing spheroids into three-dimensional cell structures have limitations that cause loss and damage to cell-spheroids and make it difficult to precisely and uniformly distribute them to the desired location.

In order to overcome these limitations, the present inventors proposed that it can be instantly and simply combined with the existing bioprinting process, allowing the formation of cell structures during the culture process after the bioprinting process without forming cell-spheroids through prior 3-day culture. We attempted to produce a composition for producing cell-spheroids that can be formed at a desired location.

As a result, the present inventors dropped a novel composition for producing cell-spheroids containing endothelial cells (EC) and mineral oil droplets onto hydrogel and then cultured them, forming hydrogel and It was confirmed that cell-spheroids were formed through stable self-assembly due to the hydrostatic pressure of the hydrogel acting on the interface between the endothelial cells and the mineral oil. In the present invention, the method for producing spontaneous cell-spheroids using mineral oil droplets is referred to as a three-dimensional cell aggregation process. As will be described later, using the above-described method, it is possible to precisely and uniformly distribute cell-spheroids to the desired location of the 3D cell structure without loss or damage to the cell-spheroids compared to conventional techniques.

As used herein, the term ‘bio-printing’ refers to an automated process of producing tissues or organs by arranging cells in a bio-material in a controlled pattern in three-dimensional space.

As used herein, the term ‘bio-ink’ refers to a material capable of bioprinting used in the bioprinting process defined above, and includes biomaterials containing living cells. Bioinks include scaffold-based materials such as hydrogels, microcarriers and decellularized matrices, as well as scaffold-free materials such as cell aggregates. .

For details on the terminology, bioprinting, and bioink used in this specification, refer to various literature known in the art (Hospodiuk, Monika, et al. Biotechnology advances 35.2 (2017): 217-239.).

In one embodiment of the present invention, in the cell-spheroid production composition, the cells are included in the oil.

In one embodiment of the present invention, the oil is characterized in that it contains the cells therein at a cell density of 1.0×10 ⁶ cells/mL to 1.0×10 ⁸ cells/mL. In another embodiment of the present invention, the oil contains the cells inside 1.0×10 ⁶ cells/mL to 1.0×10 ⁸ cells/mL, 1.0×10 ⁶ cells/mL to 5.0×10 ⁷ cells/mL, 1.0×10 ⁶ cells/mL to 3.0×10 ⁷ cells/mL, 1.0×10 ⁷ cells/mL to 4.0×10 ⁷ cells/mL, 1.0×10 ⁷ cells/mL to 3.0×10 ⁷ cells/mL, or 1.0 It is characterized in that it contains a cell density of between ×10 ⁷ cells/mL and 2.0×10 ⁷ cells/mL.

When the density of endothelial cells (EC) inside the oil is 1.0×10 ⁷ cells/mL to 4.0×10 ⁷ cells/mL, the diameter of the endothelial cell spheroid is 100 μm to 300 μm.

In one embodiment of the present invention, the cells self-assemble within the oil.

As used herein, the term ‘self-assembly’ refers to the spontaneous organization of individual components into patterns and functional nanostructures through non-covalent bonds that balance thermodynamic equilibrium and global or local equilibrium.

In one embodiment of the present invention, the cells are primary cells or stem cells.

In one embodiment of the present invention, the stem cells are pluripotent stem cells.

In one embodiment of the present invention, the stem cells are mesenchymal stem cells (MSC).

As used herein, the term ‘primary cell’ refers to a cell directly isolated from a tissue or organ of interest.

As used herein, the term ‘mesenchymal stem cell (MSC)’ refers to a stromal cell that has the ability to self-renew and exhibits multilineage differentiation.

In one embodiment of the present invention, the primary cell is an endothelial cell, or the mesenchymal stem cell (MCS) is an adipose-derived stem cell; ASC).

In one embodiment of the present invention, the primary cell is a primary endothelial cell. In a specific embodiment of the present invention, the primary endothelial cells include umbilical vein endothelial cells, aortic endothelial cells, coronary artery endothelial cells, and pulmonary artery endothelial cells. (pulmonary endothelial cell), iliac artery endothelial cell, saphenous vein endothelial cell, dermal microvascular endothelial cell, cardiac microvascular endothelial cell, and lung microvascular Any one selected from the group consisting of blood vessels (pulmonary microvascular endothelial cells), but is not limited thereto.

In another embodiment of the present invention, the mesenchymal stem cells are any one selected from the group consisting of umbilical cord, endometrial polyps, bone marrow, and adipose tissue. It may be derived from, but is not necessarily limited to. In another embodiment of the present invention, the mesenchymal stem cells are adipose-derived stem cells (ASC), cord blood-derived stem cells, bone marrow-derived stem cells, or perivascular stem cells (perivascular stem cells). ), but is not necessarily limited thereto.

In still another embodiment of the present invention, the cells are osteoblasts, osteoclasts, or fibroblasts, but are not necessarily limited thereto.

In a specific embodiment of the present invention, the cells are characterized in that they are isolated from mammals. In a more specific embodiment of the present invention, the cells may be isolated from mice, rats, guinea pigs, rabbits, pigs, non-human primates, or humans, but are not necessarily limited thereto.

In one embodiment of the present invention, the oil or mineral oil is characterized in that it is a mixture of hydrocarbons having a carbon number of C ₁₅ to C ₅₀ extracted through refining of crude oil. The hydrocarbons include, but are not necessarily limited to, alkanes and cycloalkanes, and may include any hydrocarbon that can be extracted during the refining process of crude oil or petroleum known in the art. In the present invention, oil may include liquid by-products generated from manufacturing gasoline and other petroleum products.

According to another aspect of the present invention, the present invention provides a hybrid three-dimensional cell construct comprising:

(i) strut containing extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells; and

(ii) a composition for producing cell-spheroids according to an embodiment of the present invention;

The strut includes a groove structure, the cell-spheroid production composition is in the form of a droplet, and the droplet is disposed on the groove structure.

In one embodiment of the present invention, the extracellular matrix may be separated from bone. The extracellular matrix may be separated from bone by removing minerals and/or removing cells. The extracellular matrix may be bone solubilized. The solubilization may be through pepsin treatment. The bone may be isolated from a mammal.

β-TCP (β-tricalcium phosphate) used in the present invention is a compound represented by the chemical formula Ca ₃ (PO ₄ ) ₂ and is known as a bioactive substance that induces efficient bone formation.

In one embodiment of the present invention, the stem cells may be mesenchymal stem cells. The mesenchymal stem cells (MSC) are characterized as adipose-derived stem cells (ASC). For example, the mesenchymal stem cells are human adipose-derived stem cells (human ASC; hASC).

In the present invention, a strut refers to a rod-shaped structure in which bioink is extruded by pneumatic pressure through a nozzle of a bioprinting system.

In the present invention, the ‘groove structure’ of a strut refers to a structure including a concave surface that appears as a valley-type structure in the cross-section of the strut. The composition for producing a cell-spheroid according to one embodiment of the present invention flows out from a nozzle in the form of a droplet and is placed on the above-described groove structure, and then the groove structure in which the droplet is placed through culturing the hybrid 3D cell structure. Cell-spheroids are formed on top.

In one embodiment of the present invention, the bioink includes extracellular matrix, β-TCP, and mesenchymal stem cells. The extracellular matrix may be isolated from pig bone tissue. The extracellular matrix is demineralized. Decellularized, and/or pepsin treated. The extracellular matrix is included in the bioink at a final concentration of 30 mg/mL to 70 mg/mL. The β-TCP is included in the bioink at a final concentration of 150 mg/mL to 250 mg/mL. The mesenchymal stem cells may be human adipose-derived stem cells (hASC). The hASCs are included in the bioink at a final concentration of 1.0 × 10 ⁶ cells/mL to 1.0 × 10 ⁸ cells/mL.

In one embodiment of the present invention, the struts may be stacked.

In one embodiment of the present invention, the struts are parallel or intersect each other. The struts may be parallel to each other on the same floor and may cross each other on different floors. When the struts intersect each other, depending on the purpose of utilizing the hybrid 3D cell structure containing cell-spheroids, they may intersect each other at various angles, for example, greater than 0° to less than 180°. For example, at least two struts on the same floor may be parallel to each other, and at least two struts on different floors may intersect each other at 30° (degree), 60°, or 90°.

In one embodiment of the present invention, the strut has a diameter of 150 μm to 600 μm. In another embodiment of the present invention, the strut is 150 μm to 600 μm, 150 μm to 550 μm, 150 μm to 500 μm, 150 μm to 450 μm, 150 μm to 400 μm, 250 μm to 450 μm, 250 μm to 450 μm. It has a diameter of μm to 400 μm, 300 μm to 450 μm, or 300 μm to 400 μm, but is not limited thereto.

The diameter of the strut is proportional to the air pressure of the nozzle that extrudes bioink. Specifically, when the air pressure is 60 kPa, a strut is not stably formed, and when the air pressure is 90 kPa, a strut with a diameter of 349.7 ± 36.5 μm is stably formed. When the air pressure is 120 kPa, a strut with a diameter of 491.9 ± 50.6 μm is formed, but when the air pressure is more than 120 kPa, the survival rate of cells included in the strut may be relatively reduced. Therefore, the present inventors formed struts with a diameter of 250 μm to 450 μm in order to obtain stably formed struts with a relatively high cell survival rate by adjusting the air pressure of the bioink nozzle to more than 60 kPa and less than 120 kPa.

In one embodiment of the present invention, the hybrid 3D cell structure is characterized by having a pore size of 100 μm to 350 μm. In another embodiment of the present invention, the hybrid 3D cell structures are 100 μm to 350 μm, 100 μm to 300 μm, 100 μm to 250 μm, 100 μm to 230 μm, 100 μm to 210 μm, and 100 μm to 100 μm. 200 μm, 150 μm to 350 μm, 150 μm to 300 μm, 150 μm to 250 μm, 150 μm to 230 μm, 150 μm to 210 μm, 150 μm to 200 μm, 170 μm to 350 μm, 170 μm to 300 μm , 170 μm to 250 μm, 170 μm to 230 μm, 170 μm to 210 μm, 170 μm to 200 μm, 190 μm to 350 μm, 190 μm to 300 μm, 190 μm to 250 μm, 190 μm to 200 μm, 190 μm It has a pore size of, but is not limited to, μm to 230 μm, 190 μm to 210 μm, or 150 μm.

It is known that high porosity exceeding 70% and interconnected pores in the cellular structure are important for high permeability of nutrients and smooth removal of metabolic wastes, thus promoting vascularization and osteoconductivity. For this purpose, the cell structure must have an appropriate pore size.

The present inventors found that when the pore size of the cell structure is 350 μm, the area expressing OPN (osteopontin) is reduced, so osteogenic activity is reduced, and capillary sprouting occurs when the pore size is 150 μm compared to when the pore size is 50 μm or 350 μm. (capillary sprout) formation was more active and the expression of the angiogenic gene Pecam1 was confirmed to increase.

According to another aspect of the present invention, the present invention provides a method for producing a hybrid 3D cell structure comprising the following steps:

(a) extruding bioink containing extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells onto a printing plate to form a strut with a groove structure;

(b) placing the cell-spheroid production composition according to one embodiment of the present invention in the form of a droplet on the groove structure of the strut of step (a); and

(c) repeating steps (a) and (b) above.

In one embodiment of the present invention, in step (a), the bio-ink is bioprinted using a nozzle. The temperature of the bioprinting may be maintained at 24°C to 26°C. The size of the nozzle may be 25G (25 gauge), but is not limited thereto.

In one embodiment of the present invention, in step (a), the bioink may be bioprinted at a printing speed of 3 mm/s to 7 mm/s, but is not limited thereto.

In one embodiment of the present invention, in step (a), the bioink is bioprinted at a pneumatic pressure of 60 kPa to 120 kPa.

In one embodiment of the present invention, in step (a), the plate is maintained at 35°C to 39°C.

In one embodiment of the present invention, in step (a), the struts are parallel to each other or cross each other.

In one embodiment of the present invention, in step (b), the cell-spheroid production composition is bioprinted using a 30G (30 gauge) nozzle.

In one embodiment of the present invention, in step (b), the cell-spheroid production composition is printed at an oil flow rate of 2.0 μL/min to 4.5 μL/min.

In one embodiment of the present invention, in step (b), the cell-spheroid production composition is printed at a nozzle movement speed of 4.0 mm/s to 6.0 mm/s.

In one embodiment of the present invention, a cell structure having a layered structure is obtained by repeating step (c).

In one embodiment of the present invention, after step (c), a step (d) of culturing is further included.

The culture time may be from 3 to 28 days.

The culture conditions may be 37°C and 5% CO ₂ , but are not limited thereto.

In one embodiment of the present invention, the cell-spheroid is formed in step (d).

The method for producing a hybrid 3D cell structure according to the present invention can be performed under a 3D bioprinting system known in the art. Any 3D bioprinting system including at least two barrels equipped with at least two nozzles can be used in the method for manufacturing a hybrid 3D cell structure of the present invention, and is not particularly limited. For example, you can use the 3D bioprinting system (DTR3-2210 T-SG) provided by DASA Robot. The 3D bioprinting system includes a dispenser. For example, the dispenser may be AD3000C provided by Ugin-tech, but is not necessarily limited thereto, and any dispenser used in a 3D bioprinting system known in the art may be used without limitation. Additionally, the 3D bioprinting system includes a printing plate or plates. The printing plate is maintained at 35°C to 39°C. For example, the printing plate is maintained at 37°C. Bioink extruded from the printing plate by a nozzle forms a strut.

Hereinafter, the present invention will be described in detail step by step.

Step (a): Extruding bioink containing extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells onto a printing plate to form a strut with a groove structure.

Step (a) of forming the strut of the present invention is a step of putting the bio-ink according to the present invention into a barrel in the above-described 3D bioprinting system and extruding it on a printing plate. The barrel is maintained at 23°C to 27°C, for example 25°C.

The bioink is extruded by a 25 G nozzle. The nozzle is maintained at 23°C to 27°C, for example 25°C.

The bioink includes extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells. The extracellular matrix is separated from bone. The extracellular matrix may be separated from bone by removing minerals and/or removing cells. The extracellular matrix is solubilized after demineralization and decellularization. The solubilization is by pepsin treatment. The bone may be isolated from a mammal, such as a pig. The extracellular matrix is included in the bioink at a final concentration of 30 mg/mL to 70 mg/mL, for example, at a final concentration of 50 mg/mL. The β-TCP is included in the bioink at a final concentration of 150 mg/mL to 250 mg/mL, for example, 200 mg/mL. The stem cells may be mesenchymal stem cells. The mesenchymal stem cells are human adipose-derived stem cells (hASC). The hASCs are included in the bioink at a final concentration of 1.0 × 10 ⁶ cells/mL to 1.0 × 10 ⁸ cells/mL, for example, 1.2 × 10 ⁶ cells/mL.

The bioink is extruded by the printing plate to form a strut. The strut is a rod-shaped structure in which bioink is extruded by pneumatic pressure through a nozzle of a bioprinting system.

The extrusion can be performed by pneumatic pressure. The air pressure may be 60 kPa to 120 kPa, greater than 60 kPa and less than 120 kPa, 70 kPa to 110 kPa, 80 kPa to 100 kPa, or 90 kPa.

The struts may be laminated. The struts are parallel to each other or intersect each other. The struts may be parallel to each other on the same floor and may cross each other on different floors. When the struts intersect each other, they may intersect each other at various angles, for example, greater than 0° and less than 180°. For example, at least two struts on the same floor may be parallel to each other, and at least two struts on different floors may intersect each other at 90°. The strut has a groove structure. The strut has a structure including a concave surface that appears as a valley-type structure in a cross-section of the strut. The strut may have a diameter of 250 μm to 450 μm, such as 350 μm.

The strut has a pore size of 100 μm to 250 μm, such as 150 μm. Cell constructs using previously known cell-containing hydrogel-based bioinks exhibit low cell-to-cell interactions, whereas hASCs contained in struts with the above-mentioned pore size exhibit high cell-to-cell interactions with endothelial cell-spheroids, which will be described later. By showing interaction and secreting effective signaling factors, that is, by exhibiting highly cooperative crosstalk, it exhibits excellent angiogenic and osteogenic activities.

Step (b): placing the cell-spheroid production composition according to one embodiment of the present invention in the form of a droplet on the groove structure of the strut of step (a).

The step (b) of disposing the composition for producing cell-spheroids of the present invention in the form of a droplet is performed by placing the composition for producing cell-spheroids according to the present invention into a barrel in the above-described 3D bioprinting system and forming the strut formed in step (a). This is the step of placing it on the groove structure. The barrel is maintained at 23°C to 27°C, for example 25°C.

In this step, the composition for producing cell-spheroids is not extruded continuously like the bioink in step (a), but is extruded from the nozzle discontinuously, that is, in the form of droplets.

The cell-spheroid production composition is extruded by a 30 G nozzle. The nozzle is maintained at 23°C to 27°C, for example 25°C. The oil flow rate (flow rate) of the cell-spheroid production composition is 2.0 μL/min to 4.5 μL/min, for example, 3.8 μL/min. The moving speed of the nozzle is 4.0 mm/s to 6.0 mm/s, for example 5.0 mm/s.

Unlike the existing technology of placing already formed cell-spheroids on the groove structure of the strut, in this step, the composition for producing cell-spheroids in a state before the spheroids are formed is placed in the place where the cell-spheroids are desired to be formed, That is, it is placed on the groove structure of the strut. Therefore, this step can improve the disadvantage of existing technologies in which cell-spheroids are lost or damaged in the 3D bioprinting process.

The cell-spheroid production composition includes endothelial cells, such as HUVEC, inside mineral oil.

The volume of the droplet is between 0.01 μL and 0.05 μL, such as 0.05 μL.

Step (c): repeating steps (a) and (b) above.

This step is a step of repeating steps (a) and (b) described above.

The repetition includes forming a strut having a groove structure by extruding the bioink of step (a) onto the cell-spheroid production composition arranged in the form of a droplet of step (b) at least once, at least twice. , at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 10 times, at least 20 times, at least 50 times, at least 100 times, at least 200 times, at least 300 times, at least 400 times, or at least 500 times. It can be.

The repetition can be performed until the hybrid 3D cell structure is manufactured to a desired size, such as 6 × 6 × 0.5 mm ³ dimension.

After step (c) described above, (d) may further include culturing under conditions of 37°C and 5% CO ₂ for 3 to 28 days. In step (d), cell-spheroids are formed.

Compared to using the hybrid 3D cell construct formed by the preparation method according to the present invention, the bioink comprising 1.2 × 10 ⁷ cells/mL of hASC, 50 mg/mL of BdECM and 200 mg/mL of β-TCP Control cells formed by repeating the process of forming a strut by printing and then placing ^0.8 The constructs exhibit low angiogenic and osteogenic activities.

Since the method for producing a hybrid 3D cell structure of the present invention uses a composition for producing cell-spheroids, which is another aspect of the present invention, redundant content is used to avoid excessive complexity of the description in the present specification, and the Omit the description.

According to yet another aspect of the present invention, the present invention provides a hybrid vascularized artificial bone tissue comprising:

(i) Struts containing demineralized and decellularized bone tissue-derived extracellular matrix, β-TCP, and stem cells; and

(ii) oil droplets containing endothelial cells;

The strut includes a groove structure, and the oil droplet is disposed on the groove structure.

In one embodiment of the present invention, the stem cells are mesenchymal stem cells. The mesenchymal stem cells are adipose-derived stem cells, but are not limited thereto. The adipose-derived stem cells may be human adipose-derived stem cells (hASC).

In one embodiment of the present invention, the vascular endothelial cells are umbilical vein vascular endothelial cells, but are not limited thereto. The umbilical vein endothelial cells may be human umbilical vein endothelial cells (HUVEC).

The present inventors confirmed that the hybrid vascularized artificial tissue exhibited excellent angiogenic and osteogenic activities both in vitro and in vivo .

Since the hybrid vascularized artificial bone tissue of the present invention is manufactured by the method for manufacturing a hybrid 3D cell structure, which is another aspect of the present invention, using a composition for producing a cell-spheroid, which is another aspect of the present invention, the excessive amount described in the present specification is used. To avoid complexity, duplicate content is used and its description is omitted.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a composition for producing a cell-spheroid containing oil and cells.

(b) The present invention provides a hybrid three-dimensional cell construct.

(c) The present invention provides a method for manufacturing a hybrid 3D cell structure.

(d) The present invention provides a hybrid vascularized artificial bone tissue.

(b) When using the composition for producing cell-spheroids containing the oil and cells of the present invention, it contains cell-spheroids whose size and position can be precisely controlled while preventing loss and damage of the cell-spheroids. Since it is possible to manufacture a hybrid cell structure, it can be usefully used to manufacture complex tissues containing various tissues such as blood vessels and nerves as well as vascularized bone tissue.

Figure 1 shows a schematic diagram of manufacturing a cell structure containing cell-spheroids using cell-containing mineral oil and hybrid bioprinting technology.
Figure 2 is a schematic diagram of the 3D cell-aggregation process for forming cell-spheroids using mineral oil, and the cells-spheroids formed using this are cells formed by the agarose microwell process, which is a conventional cell-spheroid formation method. -Represents the results of comparative evaluation with spheroids.
Figure 3 shows the results of analysis of cell-spheroid size control according to mineral oil flow rate and nozzle movement speed.
Figure 4 shows the results of in situ fabrication of a hybrid structure containing cell-spheroids using hybrid bioprinting technology.
Figure 5 shows the in vitro blood vessel formation and bone tissue formation effects of the hybrid structure containing cell-spheroids.
Figure 6 shows the in vivo effects of hybrid structures containing cell-spheroids on new bone, blood vessel formation, and mature bone formation.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Preparation Example 1: Preparation of cell-loaded bioink

1-1. Human adipose-derived stem cell (hASC) culture

Human adipose-derived stem cells (hASC; human adipose stem cell; Lonza) were grown in DMEM-L (Dulbecco's Modified Eagle's Medium-low glucose; Sigma-Aldrich), 10% FBS (fetal bovine serum; BioWest), and 1% penicillin-streptomycin. Growth medium (GM) consisting of (Thermo-Fisher Scientific) was used as a culture medium and cultured at 37°C and 5% CO ₂ conditions. Culture medium was changed every 2 days.

1-2. Preparation of BdECM

1-2-1. demineralization

To prepare bone-specific bioink, bone tissue was isolated from the hind limbs of Yorkshire pigs, crushed into bone powder, and then processed with DPBS (Dulbecco's phosphate-buffered salin; BioWest) and deionized water (DW). Washed three times. The bone powder was treated with 0.5 M HCl (Sigma-Aldrich) at 27°C for 5 hours with stirring to remove minerals. After removing the remaining solution, the demineralized bone powder was washed at least three times with DW. The lipids remaining in the bone powder were removed by treatment with a solution containing chloroform and methanol in a 1:1 ratio for 1 hour. Then, it was washed five times with methanol and DW, and then the demineralized bone matrix (DBM) was stored at -80°C until decellularization.

1-2-2. decellularization

To remove cells, freeze-dried DBM was placed in 0.05% trypsin-0.02% EDTA (trypsin-ethylenediamine tetra-acetic acid; TE) solution and incubated at 37°C for 2 hours. After removing the TE solution, the DBM powder was washed three times with DW and soaked in 70% ethanol for 1 day. Then, the powder was washed three times with DW, freeze-dried, and stored at -80°C until solubilization.

1-2-3. Solubilization

Freeze-dried, decellularized tissues were digested with pepsin solution (0.1% w/v in 0.5 M acetic acid; Sigma-Aldrich) for 2 hours at room temperature. The solution was dialyzed at 4°C for 3 days (1000 kDa molecular cut-off, Spectrum Chemical Manufacturing). The dialyzed soluble bone dECM was freeze-dried and stored at -80°C until the next experiment. This was referred to as BdECM (porcine bone-derived decellularized extracellular matrix).

1-3. Preparation of BdECM hydrogels

The BdECM obtained in Preparation Example 1-2 was dissolved in DW and then mixed with 10×DMEM (Dulbecco’s Modified Eagle’s Medium; Sigma-Aldrich) at a ratio of 1:1 to prepare a BdECM hydrogel.

1-4. Preparation of hASC-loaded bioink

hASC-loading by mixing β-TCP (β-tricalcium phosphate) with the BdECM hydrogel obtained from Preparation Example 1-3 and 1.2 × 10 ⁷ cells/mL of hASCs cultured by the method described in Preparation Example 1-1 Bioink was prepared. The final concentrations of BdECM and β-TCP were 50 mg/mL and 200 mg/mL, respectively. The hASC-loaded bioink was cultured at 37°C and 5% CO ₂ using the GM described in Preparation Example 1-1 as a culture medium, and the culture medium was changed every 2 days.

Preparation Example 2: Preparation of cell-spheroid using mineral oil

The present inventors attempted to manufacture cell-spheroids that can be instantly and simply incorporated into the existing bioprinting process. To obtain these cell-spheroids, we developed a spontaneous three-dimensional cell aggregation process in which droplets of endothelial cell (EC) mixture in mineral oil are released into a hydrogel or confined structure. did.

2-1. Human umbilical vein endothelial cell (HUVEC) culture

Human umbilical vein endothelial cells (HUVEC; Lonza) were cultured using EGM ^TM -2 endothelial SingleQuots ^TM kit (Lonza) and EBM ^TM -2 (Lonza) supplemented with 1% penicillin-streptomycin as culture medium. It was cultured at 37°C and 5% CO ₂ conditions. Culture medium was changed every 2 days.

2-2. Preparation of cell-spheroids from BdECM hydrogels

1.2 × 10 ⁷ cells/mL of HUVECs cultured by the method described in Preparation Example 2-1 were added to mineral oil (Sigma-Aldrich). Put 5 wt% of the BdECM hydrogel obtained from Preparation Example 1 in a 48-well plate, and add about 0.05 μL of mineral oil containing 0.5 × 10 ⁷ cells/mL to 3.0 × 10 ⁷ cells/mL of HUVEC using a micropipette. (Gilson) and loaded onto BdECM hydrogel. For cell culture, GM was used as a culture medium and changed every two days.

As shown in the upper part of Figure 2A, HUVEC-containing mineral oil droplets were embedded in the BdECM hydrogel, and the three-dimensional (3D) cell aggregation process occurred due to the hydrostatic pressure of the hydrogel. could be formed stably. In the cell-containing oil droplets, the cells were distributed as a droplet-like monolayer in the initial state ( in situ ), but after 72 hours, the cells completely aggregated and formed spheroids.

Since the cells in the mineral oil droplets moved during culture to form a solid sphere shape and maintained the sphere shape for 72 hours, the present inventors used a drop culture technology to produce conventional cell-spheroids through a biofabrication process using mineral oil droplets. It was confirmed that cell-spheroids could be successfully obtained within 72 hours of cell culture, similar to the hanging drop technique.

Preparation Example 3: Production of cell structure containing cell-spheroids using hybrid bioprinting technology

A bioprinting process was performed to produce the cell structure. A 3D bioprinting system (DTR3-2210 T-SG; DASA Robot) consisting of an AD3000C dispenser (Ugin-tech) and a dual-barrel equipped with two nozzles was used at controlled temperature. The barrel and nozzle were maintained at 25°C and the printing plate was maintained at 37°C.

The present inventors developed the following novel biofabrication method in which bioprinted struts and cell-spheroids can be easily combined to obtain a hybrid cell structure that regenerates vascularized bone tissue.

3-1. Bioprinting of BdECM/β-TCP/hASC bioink

BdECM/β-TCP/hASC bioink was printed at a printing speed of 5 mm/s and pneumatic pressure of 90 kPa in a 25G nozzle. As a result of printing, groove-shaped BdECM/β-TCP/hASC struts were formed. The groove shape is a concave structure formed by printing at least two struts parallel to each other or crossing each other at various angles, such as 30° (degree), 60°, 90°, etc.

3-2. Placement of HUVEC-containing mineral oil droplets onto BdECM/β-TCP/hASC struts.

HUVEC-containing mineral oil droplets were printed at a printing speed of 5 mm/s and an oil flow rate of 3.8 μL/min in a 30G nozzle and placed on the grooved shape of the strut obtained in Preparation Example 3-1 above.

3-3. Bioprinting of BdECM/β-TCP/hASC struts onto HUVEC-containing mineral oil droplets.

As described in Preparation Example 3-2 above, The BdECM/β-TCP/hASC strut was bioprinted again by the method described in Preparation Example 3-1 above onto the HUVEC-containing mineral oil droplet placed on the grooved shape of the BdECM/β-TCP/hASC strut.

3-4. Completion of 3D cell construct

The 3D cell structure was completed by repeating the processes of Preparation Example 3-1 to Preparation Example 3-3 several times. Endothelial cell (EC)-spheroids are formed over time from HUVEC-containing mineral oil droplets placed on the BdECM/β-TCP/hASC struts of the cellular construct.

Comparative Example 1: Conventional cell-spheroid using agarose micro-well (microwell)

Conventional EC (endothelial cell) spheroids with a diameter of approximately 200 μm are called Cells . It was manufactured using a non-adherent agarose mold according to the instructions described in 2021 (Horder H et al. Cells. 2021; 10: 803.). An agarose mold was obtained by dissolving 2% agarose (Invitrogen) in DPBS. HUVECs with ^2.56

Comparative Example 2: Control cell construct

To prepare control cell constructs, 0.8 × 10 ⁷ cells/mL of HUVECs and 1.2 × 10 ⁷ cells/mL of hASCs were incubated with 50 mg/mL of BdECM and 200 mg/mL of β-spheroids without formation of cell-spheroids. Mixed with TCP. The conditions for printing bioink were the same as in Preparation Example 1 described above. Control cells were also cultured at 37°C and 5% CO ₂ using GM as a culture medium, and GM was replaced every 2 days.

Example 1: Comparative evaluation of cell-spheroid formation by the 3D cell aggregation process of the present invention and the conventional agarose mold process

In this example, the characteristics of cell-spheroids formed by the novel 3D cell aggregation process were compared and evaluated compared to the existing agarose mold process.

1-1. Confirmation of cell survival within cell-spheroids

1-1-1. How to Check for Cell Viability

In order to investigate cell survival of cell-spheroids, HUVECs were cultured for 3 days using the method described in Preparation Example 2 (3D cell-aggregation process) or the method described in Comparative Example 1 (conventional microwell process) to produce cells. -Spheroids were formed. Each cell-spheroid was stained with 0.15 mM calcein AM (Invitrogen) and 2 mM ethidium homodimer-1 (Invitrogen). Fluorescence images were obtained using an LSM 700 confocal microscope (Carl Zeiss). When stained with Calcein AM and show green fluorescence, the cell is alive. When stained with ethidium homodimer-1 and show red fluorescence, the cell is dying or dead. The results are shown at the bottom of A in Figure 2.

1-1-2. Cell survival observation results

As shown at the bottom of Figure 2A, most of the cells in the cell-spheroid formed by the two processes showed green fluorescence and almost no red fluorescence, confirming that the cells were equally alive in both cases.

1-2. Morphological evaluation of cell-spheroids

1-2-1. Cell staining method

To observe the morphology of cell-spheroids, nuclei were stained with DAPI (diamidino-2-phenylindole; Invitrogen), and F-actin was stained with Alexa Fluor 594-conjugated phalloidin (Invitrogen). Briefly explaining the staining method, cells were fixed in 10% NBF (neutral buffered formalin; Sigma-Aldrich) for 30 minutes and permeabilized in 0.1% Triton X-100 (Sigma-Aldrich) for 10 minutes at 37°C. The cells were treated with a staining solution containing DAPI and phalloidin, each diluted 1:100 with DPBS, for 1 hour at 37°C. The staining results were obtained through a confocal microscope, with blue fluorescence for the nucleus and red fluorescence for F-actin. The cells were treated with a staining solution containing DAPI and phalloidin, each diluted 1:100 with DPBS, for 1 hour at 37°C. The staining results were obtained through a confocal microscope, with blue fluorescence for the nucleus and red fluorescence for F-actin.

In addition, the expression of Ve-Cadherin, which is known to be located at the intercellular border of endothelial cells, was confirmed through immunofluorescence staining to investigate the morphology of cell-spheroids. Briefly, cells were fixed in 10% NBF (neutral buffered formalin; Sigma-Aldrich) for 1 hour, blocked in 2% BSA (bovine serum albumin; Sigma-Aldrich) for 2 hours, and then incubated with 2% Triton. Permeabilized for 2 hours in X-100 (Sigma-Aldrich). Then, it was treated with 5 μg/mL anti-mouse Ve-cadherin primary antibody (Invitrogen) overnight at 4°C, followed by Alexa Fluor 488-conjugated anti-mouse secondary antibody (1:1 in DPBS). Diluted to 50; Invitrogen) was treated for 1 hour. Then, counterstained with 5 μM DAPI in DPBS and fluorescence images were obtained by confocal microscopy. The results are shown at the bottom of A in Figure 2.

1-2-2. Cell staining results

As shown at the bottom of Figure 2A, since the cell-spheroids formed by the two processes showed similar F-actin and Ve-cadherin expression patterns, it was confirmed that the two cell-spheroids showed similar cell morphologies.

In addition, as a result of measurement using a confocal microscope, the diameter size of the cell-spheroid formed by the 3D cell aggregation process according to the present invention was about 206.1 ± 11.3 μm, and the cell-spheroid formed by the microwell process using a conventional agarose mold was about 206.1 ± 11.3 μm. The diameter size of the spheroids was approximately 203.0 ± 4.2 μm, and the sizes of the spheroids were also similar.

1-3. Evaluation of cell content within cell-spheroids

1-3-1. Cell Count Method - MTT Assay

Next, to measure the cell content, i.e. the number of cells, in the cell-spheroid, MTT (3-(4,5-dimethylthiazol-2-yl)-2, 5- using Cell Proliferation Kit I (Boehringer Mannheim) diphenyltetrazolium bromide) analysis was performed. Each cell-spheroid was washed three times with DPBS and then treated with MTT solution at 37°C for 4 hours to induce the production of purple formazan crystals from metabolically active cells. Then, sodium dodecyl sulfate (SDS)-containing solubilization solution was added to dissolve the crystals. The OD (optical density) value of the solution in which the crystals were dissolved was measured at 570 nm using a microplate reader (Epoch ^TM ; BioTek). The results were expressed as mean ± SD (standard deviation) and shown in B of Figure 2.

1-3-2. Cell count measurement results

As shown in Figure 2B, there was no statistically significant difference between the number of cells per cell-spheroid formed by the conventional microwell process and the 3D cell aggregation process according to the present invention.

1-4. Evaluation of growth factors secreted by cell-spheroids

The growth factor secretion amount of a single cell in a single layer showing a similar cell density to the cell-spheroid formed by the two processes and the two cell-spheroids were compared.

1-4-1. ELISA analysis method

To confirm growth factor secretion ability, ELISA (enzyme-linked immunosorbent assay) analysis was performed on VEGF (human vascular endothelial growth factor; Invitrogen) and MBP-2 (bone morphogenic protein 2; Antigenix). A single layer of HUVEC cells and cell-spheroids formed by two processes were treated with 1 mL of serum-free DMEM-L for 1 day at 37°C and CO ₂ conditions. Using an ELISA plate, the OD value was measured at 450 nm using a microplate in conditioned media, and the OD value of a standard with known concentration was also measured to determine the VEGF and BMP-2 concentrations by extrapolation. The results are shown in Figure 2C and D.

1-4-2. ELISA analysis results

As shown in Figure 2 C and D, compared to the cell-spheroids formed by the two processes, the secretion amounts (pg) of VEGF and BMP-2 per 10 ³ cells from a single cell in a single layer were all statistically significant. It was quite low. However, there was no significant difference in the secretion amount of VEGF, which induces osteogenesis of stem cells, and BMP-2, which induces angiogenesis, between the two cell-spheroids formed by the two processes.

1-5. sintering

The present inventors found that cell-spheroids formed by a novel 3D cell aggregation process using mineral oil were compared to cell-spheroids formed by a microwell process using an agarose mold, which is one of the conventional cell-spheroid methods. , confirming that there was no significant difference in the shape of the spheroid, the number of cells within the spheroid, and secretion of growth factors, demonstrating that cell-spheroids can be successfully formed when using a novel 3D cell aggregation process using mineral oil. Confirmed.

Example 2: Cell-Spheroid Size Control

In general, the size of cell-spheroids affects angiogenesis efficiency, so in order to find factors that control cell-spheroid size, the present inventors used HUVECs under the bioprinting conditions described in Preparation Example 3-2. -The flow rate and nozzle moving speed of the mineral oil-containing droplets were varied, and then the size of the cell-spheroids formed after culturing for 3 days was examined.

2-1. Cell-spheroid size control according to the flow rate of mineral oil

The nozzle movement speed, that is, the printing speed, was fixed at 5.0 mm/s, and HUVEC-containing mineral oil droplets were prepared by varying the flow rate of mineral oil at 1.1 μL/min, 2.3 μL/min, and 3.8 μL/min. As a result, the size, shape, and number of cells within the spheroid were observed under a confocal microscope after staining with calcein AM (green fluorescence, cells are alive) and ethidium homodimer-1 (red fluorescence, cells are dead). Alternatively, it was confirmed by staining with DAPI (blue) and F-actin (red) and then observing with a confocal microscope. The results are shown in Figure 3A and B.

As shown in Figure 3A, it was confirmed that the size of the formed cell-spheroid increased as the flow rate of mineral oil was increased to 1.1 μL/min, 2.3 μL/min, and 3.8 μL/min, Figure 3 As shown in B, it was confirmed that the number of cells per spheroid increased.

2-2. Cell-spheroid size control according to nozzle movement speed

Next, the flow rate of mineral oil was fixed at 3.8 μL/min, and the moving speed of the nozzle, i.e., the printing speed, was varied at 4.0 mm/s, 5.0 mm/s, 7.5 mm/s, and 10.0 mm/s to produce HUVEC-containing Mineral oil droplets were prepared. The size, shape, and number of cells within the spheroid were then stained with calcein AM (green fluorescence, cells alive) and ethidium homodimer-1 (red fluorescence, cells dead) and observed under a confocal microscope. Alternatively, it was confirmed by staining with DAPI (blue) and F-actin (red) and then observing with a confocal microscope. The results are shown in Figure 3C and D.

As shown in Figure 3C, it can be confirmed that the size of the formed cell-spheroid decreased as the moving speed of the nozzle was increased to 4.0 mm/s, 5.0 mm/s, 7.5 mm/s, and 10.0 mm/s. As shown in Figure 3D, it was confirmed that the number of cells per spheroid also decreased.

2-3. Determine optimal mineral oil flow rate and nozzle movement speed

Next, we sought to confirm the optimal combination of mineral oil flow rate and nozzle movement speed by examining the cell-spheroid size formed according to the mineral oil flow rate and nozzle movement speed confirmed in Examples 2-1 and 2-2. The results are shown in Figure 3E.

As shown in the right bar of the graph shown in Figure 3E, when the color changes from blue to red as the spheroid diameter increases from 100 μm to 300 μm, the nozzle movement speed, which is the X-axis of the graph, is 4.0 mm/ s to 6.0 mm/s and the Y-axis of the graph, the mineral oil flow rate is located in the range of 2 μL/min to 4 μL/min, and the circular color of the coordinates is pink, indicating that in this case, obtaining the spheroid with the largest diameter is indicated. I was able to confirm.

In addition, as shown in the top legend of the graph shown in Figure 3E, in the case of a color gradient from pink to light blue, the droplets are stably placed on the strut, in the case of dark gray, the placed droplets overflow, and in the case of light gray In this case, the result was that droplet placement was omitted.

The present inventors measured the cell-sphere when the mineral oil flow rate was 2.3 μL/min and the nozzle moving speed was 4.0 mm/s, or when the mineral oil flow rate was 3.8 μL/min and the nozzle moving speed was 5.0 mm/s. It was confirmed that the diameter of the roid was the largest and that the droplets were stably placed on the strut.

Example 3: Evaluation of the properties of hybrid cell structures containing cell-spheroids

After repeatedly placing HUVEC-containing droplets on the hASC-containing strut prepared by the method described in Preparation Example 3 above, and culturing for 3 days, distribution of hASC and EC spheroids in the hybrid cell construct containing cell-spheroids was confirmed, and endothelial sprouting, which is the initial stage of new blood vessel formation, was confirmed depending on the culture time, and the pattern of cell-spheroids for each cell type was controlled or the cell-spheroid spacing was controlled, and then the spheroid was formed. The status was checked.

3-1. Distribution of hASC and EC spheroids in cellular constructs

In order to carefully follow the distribution of hASC and EC spheroids in the cell construct after bioprinting, cells were pre-stained using Cell-Tracker ^TM (Molecular Probes ^TM ) according to the manufacturer's protocol. Briefly, hASC and HUVEC were cultured by the method described in Preparation Example 1-1 and Preparation Example 2-1 above, and then incubated in the staining solution at 37°C for 30 minutes. After 3 days of culture, fluorescence images were obtained using a confocal microscope, with red fluorescence for hASC and green fluorescence for EC spheroids. In addition, the cell structures were stained with DAPI and Alexa Fluor 594-conjugated phalloidin to confirm the distribution of nuclei and cytoskeleton (F-actin) in the cell structures, and the results are shown in Figure 4A.

As shown in Figure 4A, as a result of culturing the hybrid cell construct containing cell-spheroids for 3 days, EC spheroids were evenly placed at regular intervals on the hASC-containing struts as in the first bioprinting process. The presence was differentiated by cell type and followed up.

3-2. Morphology of cell-spheroids according to culture period

Next, the present inventors confirmed the formation of spheroids in situ through confocal microscopy after staining with DAPI and Palloidin on days 1, 2, and 3 of culture of HUVEC-containing mineral oil droplets. Additionally, endothelial sprouting was observed in the spheroids on days 3, 7, and 11 of culture.

As shown in Figure 4B, as time passed from 1 day of culture to 3 days of culture, HUVECs contained in mineral oil aggregated together to form spheroids with a diameter of about 200 μm, and as time passed from 3 days of culture to 11 days of culture. Since F-actin was stained in a small branch-like shape extending from the spheroid according to the flow, it was confirmed that endothelial spouting had occurred.

3-3. Cell-spheroids made from different cell types and various patterns

In order to confirm whether it is possible to produce a cell structure containing cell-spheroids printed in various patterns for each cell type when using the bioprinting method according to the present invention, Cell-Tracker ^TM was used by the method described in Example 3-1 above. hASCs and HUVECs were pre-stained using (Molecular Probes ^TM ) according to the manufacturer's protocol, and then the same process as the bioprinting process described in Preparation Example 3 was performed except for the cell type and printing pattern. hASC-containing mineral oil droplets or HUVEC-containing mineral oil droplets were placed on struts not containing cells and cultured for 3 days. Afterwards, fluorescence images were obtained using a confocal microscope, with red fluorescence for hASC and green fluorescence for EC spheroids.

As shown in Figure 4C, it was confirmed that hASC spheroids and/or HUVEC spheroids bioprinted in various patterns were successfully formed on the struts. For example, looking at the bottom of Figure 4C, when hASC-containing mineral oil droplets were bioprinted in an 'S' pattern and then HUVEC-containing mineral oil droplets were bioprinted, the pattern was successfully designed for each cell type as shown in the fluorescence image. It was confirmed that it was bioprinted.

3-4. Control of cell-spheroid spacing

Finally, the novel cell construct according to the present invention can be bioprinted by controlling the spacing of the cell-spheroid on the strut. The present inventors pre-stained hASCs and HUVECs using Cell-Tracker ^TM (Molecular Probes ^TM ) according to the manufacturer's protocol using the method described in Example 3-1, and then placed them on the hASC-containing struts. HUVEC-containing mineral oil droplets were placed at various spacings, 300 μm, 550 μm, 850 μm, 1,325 μm, 750 μm, and 500 μm, and then confirmed by confocal microscopy. The results are shown in Figure 4D.

As shown in Figure 4D, almost consistent with the designed spacing, green-fluorescent EC spheroids were placed on red-fluorescent hASC-containing struts at 304.4 μm, 549.6 μm, 844.8 μm, 1,324.6 μm, 752.6 μm, and 500.8 μm. It was confirmed that they were located at intervals.

The above results show that the novel cell structure according to the present invention can be adjusted to position the cell-spheroid at a desired location with an absolute error range of 0.4 μm to 5.2 μm at the designed distance.

Example 4: In vitro High blood vessel formation and bone tissue formation effects of the hybrid scaffold according to the present invention

4-1. Fabrication of scaffolds

To produce vascularized artificial bone tissue, a cell structure containing cell-spheroids was prepared by the method described in Preparation Examples 1, 2, and 3, and its schematic diagram is shown in A of Figure 5. The hASC/BdECM/β-TCP bioink prepared by the method described in Preparation Example 1 was bioprinted by the method described in Preparation Example 3. The struts were printed so that they were parallel to each other in the same layer and intersected with the struts of the lower layer in the next upper layer at 90°C, each strut size was 356.4 ± 52.1 μm, and the pore size between struts was 195.3 ± 30.4 μm. HUVEC-containing mineral oil droplets prepared by the method described in Preparation Example 2 were printed so that the struts intersect each other at 90° (degrees) and then placed in the formed depression (groove shape). Finally, the spheroid-containing cell structure according to the present invention was manufactured in the form of a scaffold with a size of 6 × 6 × 0.5 mm ³ , and this was referred to as the experimental group scaffold.

In the struts of the scaffold, approximately 4.5 g of BdECM was used per scaffold, β-TCP was approximately 18.2 g per scaffold, hASC was approximately 4.5 × ¹⁰ cells per scaffold, and HUVECs placed in the groove form between the struts were used. Approximately 3.0 × 10 ⁵ cells were used per scaffold.

A control cell structure was prepared as a scaffold with the same size of 6 × 6 × 0.5 mm ³ as the experimental group scaffold prepared in Example 4-1 by the method described in Comparative Example 2, and this was referred to as a control scaffold. Unlike the experimental group scaffolds, the control scaffolds did not form HUVEC cell-spheroids.

4-2. Size of struts and fores

To investigate the structure of the control and experimental group scaffolds, images were obtained using an optical microscope and a scanning electron microscope (SEM), and the results are shown in Figures 5B and C.

As shown in Figure 5B, there was no significant difference in the optical and SEM images of the control and experimental group scaffolds, and as shown in Figure 5C, the sizes of the struts and holes measured from the SEM images were also different for the two scaffolds. There was no significant difference between In addition, microfiber-like structures resulting from the fibrillated collagen composition of BdECM were observed in both scaffolds, and there was no statistically significant difference in fiber size.

4-3. cell proliferation

To compare the degree of cell proliferation in the scaffolds of the control and experimental groups, MTT analysis was performed by the method described in Example 1-3-1 above, and the results are shown in Figure 5D. As shown in Figure 5D, the experimental group scaffold containing cell-spheroids showed a statistically significantly higher OD value (570 nm) than the control scaffold without cell-spheroids, showing that the experimental group scaffold It was confirmed that higher cell proliferation occurred.

4-4. Evaluation of vascular and bone tissue formation of scaffold according to culture time

The two scaffolds were cultured for 14 and 28 days, and then blood vessel and bone tissue formation was evaluated through immunofluorescence staining and RT-qPCR.

4-4-1. Method for evaluating differentiation of hASC and HUVEC - immunofluorescence staining

To compare the degree to which hASC and HUVEC in the two scaffolds differentiated into blood vessels and bone tissue over culture time, images were obtained using a confocal microscope after staining for DAPI, Phalloidin, OPN (osteopontin), and CD31. The staining method for DAPI and Phalloidin was the same as the method described in Example 1-2-1, and the immunostaining for OPN and CD31 was the same as the staining method for Ve-cadherin described in Example 1-2-1. It was carried out properly. Immunostaining for OPN used 5 μg/mL anti-mouse OPN primary antibody (Invitrogen) and Alexa Fluor 488-conjugated anti-mouse secondary antibody (diluted 1:50 in DBPS; Invitrogen). , immunostaining for CD31 used 5 μg/mL anti-rabbit CD31 primary antibody (Invitrogen) and Alexa Fluor 594-conjugated anti-rabbit secondary antibody (diluted 1:50 in DBPS; Invitrogen). did. The immunostaining results are shown in Figure 5E. The area expressing OPN (OPN+) and the area expressing CD31 (CD31+) were measured using ImageJ software, and the results are shown in Figure 5F.

As shown in Figure 5E, after 14 days of culturing both scaffolds, Phalloidin was stained at a higher level in the experimental group scaffolds compared to the control group, confirming that F-actin was formed more dynamically in the experimental group scaffolds. In addition, after 28 days of culture, the percentage of areas expressing OPN and CD31 was found to be significantly higher in the experimental group scaffolds compared to the control group.

4-4-2. Confirmation of angiogenic factors and osteogenic gene expression - RT-qPCR

To confirm the expression levels of human angiogenic factor genes ( Vegf, Pecam1, and Vwf ) and osteogenic genes ( Alp, Bmp-2, Ocn, and Opn ) expressed in the two scaffolds according to the culture time, RT-qPCR (Quantitative) was performed. reverse transcription polymerase chain reaction) was performed and the 2 ^-ΔΔCT method was used.

Total RNA was isolated by treating cultured cells with TRIzol reagent (Sigma-Aldrich), and the purity and concentration of the isolated RNA were measured using a FLX800T spectrophotometer (Biotek). RNase and DNase were removed from the isolated RNA, and then cDNA was synthesized using ReverTraAce ^TM qPCR RT Master Mix (Toyobo Co., Ltd.). RT-qPCR was performed on the StepOnePlus PCR system (Applied Biosystems) using the synthesized cDNA, primer pairs listed in Table 1 below, and Thunderbird® qPCR mix (Toyobo Co., Ltd.), and CT (cycle threshold) values were measured. . The expression level of each gene was normalized by the CT value of Gapdh (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene, and the expression level of the corresponding gene was measured in the control scaffold after 7 days of culture using the 2 ^-ΔΔCT method. The gene expression of the control and experimental group scaffolds for each culture period was set to 1.0 and graphed as fold change. The results are shown in Figure 5G and H.

gene name bell Forward (F)/Reverse (R) Primer sequence (5’-3’) sequence number Gapdh Homo sapiens F CCATGGGGAAGGTGAAGGTC One R AGTGATGGCATGGACTGT 2 Pecam1 Homo sapiens F TGAGTGGTGGGCTCAGATTG 3 R TGAGTCTAGGTCGGGGAGTG 4 Vegf Homo sapiens F AGGCCAGCACATAGGAGAGA 5 R ACGCGAGTCTGTGTTTTTGC 6 Vwf Homo sapiens F ACACCTGCATTTGCCGAAAC 7 R ATGCGGAGGTCACCTTTCAG 8 Opn Homo sapiens F AAGTTTCGCAGACCTGACATC 9 R GGGCTGTCCAATCAGAAGG 10 Alp Homo sapiens F GGCACCTGCCTTACTAACTCC 11 R CTTGCCACGTTGGTGTTGA 12 Bmp-2 Homo sapiens F CAGACCACCGGTTGGAGA 13 R CCACTCGTTTCTGGTAGTTCTTC 14 Ocn Homo sapiens F TGAGAGCCCTCACACTCCTC 15 R ACCTTTGCTGGACTCTGCAC 16

Gapdh : glyceraldehyde-3-phosphate dehydrogenase; Pecam1 : platelet and endothelial cell adhesion molecule 1 (CD31); Vegf : vascular endothelial growth factor; Bmp-2 : bone-morphogenic protein 2; Cxcl12 : CXC motif chemokine ligand 12 (SDF-1); Vwf : von Willebrand factor; Opn : bone sialoprotein I ( Spp1 ); Alp : alkaline phosphatase; BMP-2 : bone morphogenic protein 2; Ocn : bone gamma-carboxyglutamate protein ( Bglap ).

As shown in Figure 5G, the expression level of angiogenic factor genes ( Vegf, Pecam1 , and Vwf ) was significantly higher in the experimental group scaffold according to the present invention compared to the control group, and as shown in Figure 5H, compared to the control group The expression levels of osteogenic genes ( Alp, Bmp-2, Ocn, and Opn ) were also significantly high in the experimental group scaffold according to the present invention.

4-5. sintering

From the above results, compared to the control scaffold, which is a conventional cell structure that does not contain cell-spheroids, the cells of the hybrid-scaffold, which is a cell structure containing cell-spheroids according to the present invention, have excellent blood vessel formation and bone tissue formation activities. It was confirmed in vitro that it represents . The present inventors conducted an experiment as shown in Example 5 below to confirm whether the hybrid scaffold, which shows excellent blood vessel and bone tissue formation activity in vitro , is also effective in vivo .

Example 5: In vivo Effect of the hybrid scaffold according to the present invention on vascularized bone tissue formation on the mastoid obliterated rat model

The present inventors used the experimental group hybrid scaffold, which is a cell structure containing cell-spheroids that exhibit high angiogenic and osteogenic tissue-forming activities in vitro, to determine whether it has a therapeutic effect by exhibiting high angiogenic and osteogenic tissue-forming activities in vivo. A mastoid obliterated rat model was created, and then the control and experimental group scaffolds prepared in Example 4 were implanted and the effect of forming new bone tissue was evaluated.

5-1. Construction of the apical process resection rat model

Twelve male SD rats (Sprague Dawley rats) weighing 200 g to 250 g were purchased from Samtakobio. Rats with healthy eardrums and normal Freyer's reflex were used in the experiment. The hair around the auricle (periauricular) was shaved with an electric clipper, and the area around the auricle was disinfected with povidone-iodine solution. To reduce pain and bleeding under general isoflurnae anesthesia, lidocaine (1:100,000) was administered topically to the skin around the auricle, and the skin around the auricle covering the bullae area was incised. The right tympanum was exposed to subcutaneous tissue with mosquito forceps, and blood was coagulated with a Bovie® pocket cautery (Pioneer Co.). The bone wall of the bulla cavity was opened with a drill and the remaining dust in the bulla cavity was removed with PBS. A control scaffold (n = 6) or an experimental group scaffold (n = 6) was implanted into the tympanic chamber. After mastoid obliteration, the round bone cavity was covered with a compressed sponge sheet (Johnson & Johnson Co.). The wound was closed using an auto-clipper. To prevent bacterial infection, the antibiotic ciprofloxacin was administered by intramuscular injection. A schematic diagram of the apical process resection and scaffold implantation surgery is shown in Figure 6A.

5-2. Effect of new bone tissue formation - Micro-CT

To observe whether new bone was formed or bone regeneration, rats were sacrificed 8 weeks after apical process excision surgery and transplantation, and confirmed using ex vivo micro-CT (micro-computerized tomography; SkyScan 1173; Bruker MicroCT NV). Anatomical specimens were fixed in 10% formalin through tympanic membrane perforation, and micro-CT was performed on the fixed samples using the Quantum GX μCT imaging system (PerkinElmer). X-ray parameters were used as described in the present inventors' previous study ( Int J Biol Macromol. 2021 Apr 15;176:479-489.). The resulting micro-CT image is shown in Figure 6B.

As shown in Figure 6B, newly developed bone structures in the tympanic cavity were observed when both types of scaffolds were implanted, and when the experimental group scaffold structure was implanted, bone formation was higher.

5-3. Effect of new bone tissue formation - histological evaluation

After micro-CT examination, H&E and MTS histological evaluation were performed. The bulla tissue was decalcified with 10% EDTA, dehydrated with ethanol and xylene, and embedded in paraffin. The paraffin block was cut to a thickness of 5 μm using a microtome (Leica). After deparaffinization, H&E staining (hematoxylin and eosin staining) and MTS analysis (Mason’s trichome assay) were performed according to standard protocols. The staining results are shown in Figure 6C, and the newly formed bone and mature bone areas were measured using ImageJ software and shown in Figures 6D and E.

As shown in Figure 6C, 8 weeks after scaffold implantation, the bone structures implanted in both groups were significantly decomposed, as indicated by NB (new bone), BV (blood vessel), and MB (matured bone). , it was confirmed that new bone, blood vessels, and mature bone were formed.

As shown in Figure 6D, when the control group scaffold was implanted, the area where new bone was formed was 46.2% and the area where mature bone was formed was 3.5%, whereas when the experimental group scaffold was implanted, the area where new bone was formed was 72.2%. %, and the area where mature bone was formed was 11.5%, which confirmed the statistically significantly improved bone formation effect in vivo .

Claims (20)

A composition for producing a cell-spheroid containing oil and cells. According to paragraph 1,
The oil is a composition for producing cell-spheroids, characterized in that it contains the cells therein. According to paragraph 1,
The oil is characterized in that it contains the cells inside at a cell density of 1.0×10 ⁶ cells/mL to 1.0×10 ⁸ cells/mL, a cell-spheroid production composition. According to paragraph 1,
A composition for producing cell-spheroids, characterized in that the cells self-assemble within the oil. According to paragraph 1,
The cell is a composition for producing a cell-spheroid, characterized in that the cell is a primary cell or a stem cell. According to clause 5,
The primary cell is an endothelial cell, or the stem cell is a mesenchymal stem cell (MSC). A composition for producing a cell-spheroid. According to paragraph 1,
The oil is a composition for producing cell-spheroids, characterized in that it is a mixture of hydrocarbons having a carbon number of C ₁₅ to C ₅₀ extracted through refining of crude oil. A hybrid three-dimensional cell construct comprising:
(i) strut containing extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells; and
(ii) the cell-spheroid production composition of any one of claims 1 to 7;
The strut includes a groove structure, the cell-spheroid production composition is in the form of a droplet, and the droplet is disposed on the groove structure, a hybrid 3D cell structure. The hybrid 3D cell structure according to claim 8, wherein the extracellular matrix is separated from bone. The hybrid 3D cell structure according to claim 8, wherein the stem cells are mesenchymal stem cells. The hybrid 3D cellular structure according to claim 8, wherein the struts are parallel or cross each other. The hybrid 3D cell structure according to claim 8, wherein the strut has a diameter of 150 μm to 600 μm. The hybrid 3D cell structure according to claim 8, characterized in that it has a pore size of 100 μm to 350 μm. Method for manufacturing hybrid 3D cell constructs comprising the following steps:
(a) extruding bioink containing extracellular matrix (ECM), β-TCP (β-tricalcium phosphate), and stem cells onto a printing plate to form a strut with a groove structure;
(b) placing the cell-spheroid production composition of any one of claims 1 to 7 in the form of a droplet on the groove structure of the strut in step (a); and
(c) repeating steps (a) and (b) above. The method of claim 14, wherein in step (a), the bio-ink is bioprinted at a printing speed of 3 mm/s to 7 mm/s. The method of claim 14, wherein in step (a), the bioink is bioprinted at a pneumatic pressure of 60 kPa to 120 kPa. The method of claim 14, wherein a cell structure having a layered structure is obtained by repeating the step (c). The method of claim 14, wherein after step (c), (d) further comprising culturing at 37°C and 5% CO ₂ for 3 to 28 days. Preparation of a hybrid 3D cell structure. method. The method of claim 18, wherein in step (d), cell-spheroids are formed. Hybrid vascularized artificial bone tissue comprising:
(i) Struts containing demineralized and decellularized bone tissue-derived extracellular matrix, β-TCP, and mesenchymal stem cells; and
(ii) oil droplets containing endothelial cells;
The strut includes a groove structure, and the oil droplet is disposed on the groove structure.