KR20240033705A - A composition for improving anti-obesity and fatty liver - Google Patents

Abstract

The present invention is a treatment for obesity or fatty liver comprising GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by the following formula (1) as an active ingredient: Pharmaceutical compositions for prevention or treatment; Method for preventing or treating obesity or fatty liver using the composition; A food composition for preventing or improving obesity or fatty liver comprising GR113808 as an active ingredient; It relates to a quasi-drug composition or feed composition, and it has been confirmed that it can be usefully used to prevent, treat, or improve diseases related to metabolic syndrome, including suppressing obesity and improving fatty liver disease.
[Formula 1]

Description

Composition for improving anti-obesity and fatty liver {A composition for improving anti-obesity and fatty liver}

The present invention is a treatment for obesity or fatty liver comprising GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by the following formula (1) as an active ingredient: Pharmaceutical compositions for prevention or treatment; Method for preventing or treating obesity or fatty liver using the composition; A food composition for preventing or improving obesity or fatty liver comprising GR113808 as an active ingredient; It relates to a quasi-drug composition or feed composition.

[Formula 1]

Recently, in Korea, due to economic development and changes in eating habits, the incidence of metabolic syndrome-related diseases, including various diseases such as obesity, hyperlipidemia, hypertension, arteriosclerosis, hyperinsulinemia, diabetes, and liver disease, is rapidly increasing. In particular, the increase in animal food intake was found to be significant, and as a result of this change in Koreans' eating patterns, total fat intake and saturated fatty acid intake are increasing, raising concerns about health. The intake and type of dietary fat and the level of fatty acid intake are important determinants that affect blood lipid concentration, and such eating habits have been found to be associated with an increased risk of cardiovascular disease. Diseases related to metabolic syndrome may occur individually, but in general, they are closely related to each other and occur together with various symptoms.

According to the 2020 Korean cause of death statistics, heart disease and cerebrovascular disease are reported to be the 2nd and 4th causes of death in Koreans, respectively, and diabetes, liver disease, and hypertensive disease are also 6th, 8th, and 9th, respectively. As shown above, diseases related to metabolic syndrome account for most of the causes of death among teenagers. The mechanism of action in metabolic syndrome can be summarized as dyslipidemia, increased blood pressure, high blood sugar, hypercoagulable state, and inflammatory state. Dyslipidemia is characterized by high triglyceride and low high-density lipoprotein cholesterol.

In order to prevent or treat metabolic syndrome-related diseases, it is important to maintain normal concentrations of each component of blood lipids, which consists of neutral fat, cholesterol, phospholipids, and free fatty acids in vivo.

Meanwhile, serotonin is a substance that is receiving a lot of attention as a neurotransmitter, and its receptors show great differences in structure, signaling system, target of action, and function, and are broadly divided into seven groups. Among them, serotonin receptor 4 (5-HT ₄ ) regulates cognitive function and memory by controlling dopamine secretion in the central nervous system, is located in the atrium of the heart and controls heart rate, temporarily secretes aldosterone in the adrenal cortex, and stimulates the bladder detrusor muscle in the bladder. It serves to increase tension. It is also involved in the sensory, motor, and secretory functions of the gastrointestinal tract (Journal of the Korean Society of Gastrointestinal Exercise 2008;14:24-31).

GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) is a serotonin receptor 4 (5-HT ₄ , Serotonin Receptor 4) in the indole series. It is the first selective 5-HT ₄ antagonist with high affinity for 5-HT ₃ and low affinity for 5-HT 4 and the first commercially available radioligand for 5-HT ₄ binding studies. To date, the efficacy of GR113808 on depression or gastrointestinal motility has been reported (Korean registered patent 10-0469029), but nothing is known about its use in preventing or treating diseases related to metabolic syndrome.

Against this background, the present inventors made research efforts to discover new uses for GR113808. As a result, when GR113808 was injected into mice induced to be obese by a high-fat diet, the mice experienced weight loss, decreased liver and adipose tissue size, and serum neutralization. The present invention was completed by confirming that it is effective in diseases related to metabolic syndrome, including anti-obesity and improving fatty liver disease, by reducing fat, suppressing the accumulation of neutral fat in the liver, and suppressing the expression of genes and proteins related to lipid synthesis. .

One object of the present invention is to prevent obesity or fatty liver comprising GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) as an active ingredient. Or to provide a pharmaceutical composition for treatment.

Another object of the present invention is to provide a method for preventing or treating obesity or fatty liver comprising administering the pharmaceutical composition to an entity other than a human.

Another object of the present invention is to treat obesity or fatty liver disease containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) as an active ingredient. To provide a food composition for preventing or improving.

Another object of the present invention is to treat obesity or fatty liver disease containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) as an active ingredient. To provide a quasi-drug composition for preventing or improving.

Another object of the present invention is to treat obesity or fatty liver disease containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) as an active ingredient. To provide a feed composition for preventing or improving.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

One aspect of the present invention for achieving the above object is GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3- represented by the following formula 1: Provides a pharmaceutical composition for the prevention or treatment of obesity or fatty liver containing carboxylate) as an active ingredient.

[Formula 1]

As the term of the present invention, "GR113808" is the first powerful selective 5-HT ₄ antagonist with high affinity for serotonin receptor 4 (5-HT ₄ , Serotonin Receptor 4), it is recognizable for other receptor types. It may have no affinity, and specifically, it shows a selectivity of more than 300 times for the 5-HT ₄ receptor compared to the 5-HT _1A , 5-HT _1B , 5-HT _2A , 5-HT _2C and 5-HT ₃ receptors. It can mean.

GR113808 of the present invention can be purchased commercially or manufactured and used, but is not limited thereto.

As used herein, the term “obesity” may mean a condition or disease with excessive body fat due to energy imbalance. Although the cause of obesity has not been clearly identified, it is generally recognized as overweight as a biological phenomenon caused by the interaction of complex genetic, metabolic, environmental, and behavioral factors. Medically, it is associated with a body mass index (BMI) of 30 or more (30% or more of standard body weight) or a BMI of 27 or more and other circulatory system diseases such as diabetes, hypertension, and hyperlipidemia. These cases are classified as obesity.

As used herein, the term “fatty liver” may refer to a phenomenon in which neutral fat appears to be abnormally deposited within liver cells, unlike in normal cases. A normal liver is composed of approximately 5% of fatty tissue, and neutral fat, fatty acids, phospholipids, cholesterol, and cholesterol esters are the main components of fat, but once fatty liver occurs, most of the components are replaced by neutral fat, and the amount of neutral fat If it is more than 5% of the liver weight, it is diagnosed as fatty liver. Fatty liver is caused by disorders of fat metabolism within hepatocytes or defects in the process of transporting excess fat, and is mainly caused by disorders of fat metabolism in the liver.

Most of the fat accumulated in fatty liver is triglyceride (TG), and in the present invention, the fatty liver is a group consisting of non-alcoholic fatty liver, alcoholic fatty liver, nutritional fatty liver, starvation fatty liver, non-obsessive fatty liver, and diabetic fatty liver. It may mean one or more selected from . Among these, it can be broadly divided into non-alcoholic fatty liver disease caused by obesity, diabetes, hyperlipidemia, drugs, etc., and alcoholic fatty liver disease caused by excessive drinking. The non-alcoholic fatty liver disease refers to a case of fatty liver disease without a history of alcohol consumption, and is known to be related to metabolic diseases such as obesity, diabetes, and hyperlipidemia. Non-alcoholic fatty liver disease includes not only fat accumulation within the liver, but also non-alcoholic steatohepatitis or end-stage fibrotic liver disease. Fatty liver is known to be mostly related to obesity, but it is also a disease that can occur in thin or normal people. This fact can also be supported by the report that 40% (32/81) of patients with fatty liver disease showed a normal body mass index (Nucl. Med. Mol. Imaging., 40, 243 ~ 248 (2006)). In particular, it has been reported that neutral fat acts as a major factor in the non-obese group (J. Clin. Gastroenterol., 40, 745 ~ 752 (2006)), and in patients with fatty liver, cholesterol and neutral fat levels are higher than those in the normal group. was statistically significantly higher, showing that in non-obese cases, there is a high correlation between fatty liver and neutral fat.

In the present invention, obesity or fatty liver may mean a disease related to metabolic syndrome.

The term “metabolic syndrome-related disease” refers to a variety of diseases caused by problems with metabolism, and is also called metabolic disease or metabolic disease. The metabolic syndrome-related diseases of the present invention include without limitation diseases that can be treated or prevented using GR113808 as an active ingredient, but specifically include diseases selected from the group consisting of obesity, high blood pressure, fatty liver, diabetes, dyslipidemia, hyperlipidemia, and arteriosclerosis. It may be one or more diseases.

The term "prevention" of the present invention refers to any action in which symptoms of diseases related to metabolic syndrome are improved or beneficially changed by administration of a composition containing GR113808 as an active ingredient.

As used herein, the term “treatment” refers to any action that suppresses or delays metabolic syndrome-related diseases by administering a composition containing GR113808 as an active ingredient.

The term "pharmaceutical composition" of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents commonly used in the preparation thereof, and the carriers include non-naturally occurring carriers. can do. Specific examples of the carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline. Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used, but are not limited thereto.

In addition, the pharmaceutical composition can be manufactured into tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories according to conventional methods. It may have any one dosage form selected from the group consisting of oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and the solid preparation may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. there is. Additionally, in addition to simple excipients, lubricants such as magnesium stearate, talc, etc. may be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives can be used. can be used Preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, or suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurel, glycerogelatin, etc. may be used, but are not limited thereto.

The content of GR113808 in the pharmaceutical composition of the present invention can be appropriately adjusted depending on the symptoms, progress, patient condition, etc. of the disease, and may be, for example, 0.0001 to 99.9% by weight or 0.001 to 50% by weight based on the total weight of the composition. However, it is not limited to this.

In one embodiment of the present invention, when GR113808 was injected into mice in which obesity was induced by a high-fat diet, effects such as weight loss, liver and fat (white adipose tissue, WAT) tissue size reduction, and serum triglyceride reduction effects were confirmed. (Figures 1 to 3).

In addition, in one embodiment of the present invention, triglycerides in the liver of high-fat diet mice injected with GR113808 are reduced, and transcription factors and proteins important for fatty acid absorption, such as PPARγ, CD36, Mogat, FABP1, and fatty acid production, are reduced. It was confirmed that GR113808 suppresses the accumulation of neutral fat in the liver and suppresses the expression of genes and proteins related to lipid synthesis by reducing the enzymes SREBP1c, FAS, and SCD-1 (Figures 4 to 7).

These results suggest that GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) may be used to prevent, treat, or treat diseases related to metabolic syndrome, including fatty liver disease. This suggests that it can be useful for improvement.

Another aspect of the present invention for achieving the above object provides a method for preventing or treating obesity or fatty liver comprising administering the pharmaceutical composition to an entity other than a human.

The pharmaceutical composition, obesity, fatty liver, prevention or treatment are as described above.

The term "individual" in the present invention refers to all animals, such as rats and livestock, including humans, that have or may develop diseases related to metabolic syndrome. Specifically, it may be not only humans but also mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats that require prevention or treatment of symptoms similar to the above diseases, but is not limited thereto.

The term "administration" of the present invention means introducing the composition of the present invention to a patient by any appropriate method, and the composition may be administered through any general route as long as it can reach the target tissue.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the subject, age, sex, activity of the drug, It can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the field of medicine.

The pharmaceutical composition can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. Additionally, it can be administered single or multiple times. Considering all of the above-mentioned factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

In addition, the pharmaceutical composition can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method, and the dosage is determined by the patient's condition and weight, and the degree of the disease. , it varies depending on the drug form, administration route and time, but can be appropriately selected by a person skilled in the art. As a specific example, it can generally be administered once or several times a day, but the preferred dosage can be appropriately selected by a person skilled in the art depending on the individual's condition and weight, degree of disease, drug form, administration route and period. .

Another aspect of the present invention for achieving the above object is GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole- represented by the following formula 1: Provides a food composition for preventing or improving obesity or fatty liver containing 3-carboxylate) as an active ingredient.

[Formula 1]

The GR113808, obesity, fatty liver or prevention is as described above.

As used herein, the term “improvement” refers to any action that results in at least a reduction in the severity of symptoms or parameters associated with the condition being treated by administration of a composition comprising GR113808.

As used herein, “food” refers to meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, and alcoholic beverages. , vitamin complexes, health functional foods, and health foods, etc., and include all foods in the conventional sense.

The above health functional food (health functional food) is the same term as food for special health use (FoSHU), and is a medicine that is processed to efficiently exhibit bioregulatory functions in addition to nutritional supply, and has high medical effects. It means food.

Here, 'function' means controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes, such as physiological effects. The above-mentioned health food refers to food that has a more active health maintenance or promotion effect compared to general food, and health supplement food refers to food for the purpose of health supplementation. In some cases, the terms health functional food, health food, and health supplement may be used interchangeably. Specifically, the health functional food is a food manufactured by adding GR113808 to food materials such as beverages, teas, spices, gum, and confectionery, or by encapsulating, powdering, or suspending it, and has specific health effects when consumed. It can mean coming.

The food of the present invention can be manufactured by methods commonly used in the art, and can be manufactured by adding raw materials and ingredients commonly added in the art.

In addition, the food composition can be manufactured without limitation in various forms as long as it is a formulation recognized as a food.

In addition, the food composition may further include a foodologically acceptable carrier. The type of carrier is not particularly limited, and any carrier commonly used in the art can be used.

Additionally, the food composition may contain additional ingredients that are commonly used in food compositions to improve odor, taste, and vision. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. Additionally, minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and chromium (Cr); and amino acids such as lysine, tryptophan, cysteine, and valine.

In addition, the food composition contains preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder, high bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxide) roxitoluene (BHT), etc.), colorants (tar color, etc.), coloring agents (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG monosodium glutamate, etc.), sweeteners (dulcine, cyclemate, saccharin) , sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, D-potassium hydrogen tartrate, etc.), strengtheners, emulsifiers, thickeners (grease), coating agents, gum base agents, anti-foam agents, solvents, improvers, etc. May contain food additives. The additives can be selected according to the type of food and used in an appropriate amount.

Another aspect of the present invention for achieving the above object is GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole- represented by the following formula 1: Provides a quasi-drug composition for preventing or improving obesity or fatty liver containing 3-carboxylate) as an active ingredient.

[Formula 1]

The GR113808, obesity, fatty liver, prevention or improvement is as described above.

As used herein, the term "quasi-drug" refers to articles used for the purpose of diagnosing, treating, mitigating, treating, or preventing diseases in humans or animals that are not instruments, machines, or devices and that have a pharmacological effect on the structure and function of humans or animals. refers to goods used for the purpose of giving, excluding those that are not instruments, machines or devices.

In the present invention, the quasi-drug composition may have the effect of preventing or improving diseases related to metabolic syndrome, but is not limited thereto.

In addition to the above ingredients, the quasi-drug composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.

The “pharmaceutically acceptable carrier” may refer to a carrier, excipient, or diluent that does not irritate living organisms and does not inhibit the biological activity and properties of the injected compound, and specifically, non-naturally carriers. occurring carrier). The type of carrier that can be used in the present invention is not particularly limited, and any carrier commonly used in the art and pharmaceutically acceptable can be used. Non-limiting examples of the carrier include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, etc. These may be used alone or in combination of two or more types.

The composition containing a pharmaceutically acceptable carrier may be in various oral or parenteral formulations, but is preferably an oral formulation, but is not limited thereto. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Specifically, solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include the compound with at least one excipient, such as starch, calcium carbonate, sucrose, and lactose. It can be prepared by mixing , gelatin, etc. Additionally, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, wethepsol, macrogol, Tween 61, cacao, laurin, glycerogelatin, etc. can be used.

The quasi-drug composition of the present invention may include, but is not limited to, disinfectant cleaner, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug are commonly known in the technical field. It can be appropriately selected from the techniques.

Another aspect of the present invention for achieving the above object is GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole- represented by the following formula 1: Provides a feed composition for preventing or improving obesity or fatty liver comprising 3-carboxylate) as an active ingredient.

[Formula 1]

The GR113808, obesity, fatty liver, prevention or improvement is as described above.

As used herein, the term "feed" means any natural or artificial diet, meal, etc., or a component of the meal, for or suitable for eating, ingestion, and digestion by animals.

The type of feed is not particularly limited, and feed commonly used in the art can be used. Non-limiting examples of the feed include plant feed such as grains, roots and fruits, food processing by-products, algae, fiber, pharmaceutical by-products, oils and fats, starches, gourds or grain by-products; Examples include animal feeds such as proteins, inorganic substances, fats and oils, mineral oils, oils and fats, single-cell proteins, zooplanktons or foods. These may be used alone or in combination of two or more types.

The composition containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) according to the present invention was used in mice induced with obesity by high-fat diet. It has the effect of reducing weight, reducing liver and adipose tissue, reducing serum neutral fat, suppressing accumulation of neutral fat in liver tissue, and suppressing the expression of factors related to lipid synthesis, preventing and treating diseases related to metabolic syndrome, including suppressing obesity and improving fatty liver. Alternatively, it can be useful for improvement, so it can be used as medicine and health functional food.

Figure 1 is a graph showing body weight change in experimental animals following GR113808 administration.
Figure 2 is a graph showing changes in tissue size and weight according to administration of GR113808 in experimental animals.
Figure 3 is a graph measuring serum triglyceride (TG) and high-density lipoprotein (HDL) concentrations according to GR113808 administration in experimental animals.
Figure 4 shows the results of H&E staining of liver tissue after administration of GR113808 to experimental animals.
Figure 5 is a graph showing the change in neutral fat concentration in liver tissue according to administration of GR113808 in experimental animals.
Figure 6 shows the Western blot results of factors related to fatty acid absorption and production according to administration of GR113808 in experimental animals.
Figure 7 shows real-time PCR results of factors related to fatty acid absorption and production following GR113808 administration in experimental animals.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples.

Example 1. Experimental animals

High-fat diet (D12492) (60% fat, 20% carbohydrate, 20% protein, 5.24 kcal/g) and normal diet (D12450K) (10% fat, 70% carbohydrate, 20% protein, 3.85 kcal) used in the present invention. /g) Mice were purchased from Research Diets (New Brunswick, NJ, USA) and were allowed to consume water and food ad libitum.

After a certain period of adaptation, all experimental animals were divided into four groups: normal diet group (SCD), normal diet-GR113808 administration group (SCD + GR113808), high-fat diet group (HFD), and high-fat diet-GR113808 administration group (HFD + GR113808). They were divided into 10 animals and raised separately for 13 weeks. During the breeding period, GR113808 was administered to each experimental diet group by intraperitoneal injection at a dose of 1 mg/kg/30 μl three times a week (Monday, Wednesday, Friday) for 12 weeks. All animal testing procedures were approved by the Gachon University Animal Testing Ethics Committee, and animals were bred and tested in accordance with the committee's animal testing handling regulations.

Example 2. Obesity prevention effect

The average weight of mice in each group was made as similar as possible, and body weight was measured once a week at a regular time.

The body weight changes of the normal diet group (SCD), SCD + GR113808 administration group, high-fat diet group (HFD), and HFD + GR113808 administration group over 13 weeks are shown in Table 1 below.

process Weight change (g) Normal diet (SCD) 6.8 SCD+GR113808 3.6 High-fat diet (HFD) 26.4 HFD+GR113808 12.4

As shown in Table 1 and Figure 1, the body weight of the high-fat diet group (HFD) after 13 weeks rapidly increased to about 3.8 times more than that of the normal diet group (SCD), and the HFD + administered GR113808 along with the high-fat diet The body weight of mice in the GR113808 group increased compared to the normal diet group (SCD), but was significantly decreased compared to the high-fat diet group (HFD) (*** p<0.001 ).

Through this, the excellent obesity prevention effect of GR113808 was confirmed.

Example 3. Effect of improving fatty liver

After a total of 13 weeks of experiment, the mice were sacrificed, blood was collected, and liver and fat tissue (wat) were removed. The collected blood was immediately centrifuged at 3,000 rpm for 5 minutes, then serum was separated and used as an analysis sample.

Example 3-1. Liver and adipose tissue weight analysis

As a result of comparing the sizes of the liver and adipose tissue extracted from the high-fat diet group (HFD) and the HFD + GR113808 administration group, it was confirmed that the size of the HFD + GR113808 administration group was significantly reduced, as shown in Figure 2.

In addition, as a result of measuring the weight of liver and adipose tissue in four groups including the normal diet group (SCD), the high-fat diet group (HFD) increased approximately twice as much as the normal diet group (SCD) in both tissues, which is due to the excess weight due to the high-fat diet. It was predicted that fat accumulated in the liver, causing the liver to become enlarged. On the other hand, it was confirmed that the SCD + GR113808 and HFD + GR113808 administration groups each showed a significant decrease compared to the experimental diet group that did not administer GR113808.

The liver and adipose tissue weights of the normal diet group (SCD), SCD + GR113808 administration group, high-fat diet group (HFD), and HFD + GR113808 administration group are shown in Table 2 below.

process Liver weight (g) Adipose tissue weight (g) Normal diet (SCD) 1.35 0.85 SCD+GR113808 0.98 0.68 High-fat diet (HFD) 2.51 2.15 HFD+GR113808 1.5 1.18

Through this, it was confirmed that GR113808 is effective in preventing, treating, and improving metabolic syndrome, including improving obesity and fatty liver, by showing the effect of reducing fat accumulation in the liver and adipose tissue caused by a high-fat diet.

Example 3-2. Blood lipid content analysis

To measure triglyceride (serum TG) and high-density lipoprotein (serum HDL) concentrations using the serum separated above, an automatic hematology analyzer from the Reflotron System (Roche Diagnostics, Germany) was used.

As a result, as shown in Figure 3, it was confirmed that the concentration of serum triglyceride (TG) increased rapidly in the high-fat diet group (HFD) compared to the normal diet group (SCD), and the HFD + GR113808 administration group was compared to the high-fat diet group. It was confirmed that it decreased significantly compared to (HFD), lowering to a level similar to that of the normal diet group (SCD). On the other hand, in the case of high-density lipoprotein (serum HDL), administration of GR113808 did not show a significant increase in both the normal diet group (SCD) and the high-fat diet group (HFD).

Example 3-3. Analysis of lipid accumulation in liver tissue - 1

The liver extracted above was fixed in a 10% paraformaldehyde solution overnight, made into a paraffin block, and sections cut to a thickness of 7 μm were placed on slides and stained with hematoxylin and eosin.

As a result, as shown in Figure 4, fatty liver was formed in the high-fat diet group (HFD), but in the group injected with GR113808 while feeding the high-fat diet, fatty liver was confirmed to be improved to the level of the normal diet group compared to the HFD group.

Example 3-4. Analysis of lipid accumulation in liver tissue - 2

Hepatic triacylglyceride in liver tissue was measured using an ester colorimetric/fluorescence assay kit (Biovision, Mountain View, CA).

As a result, as shown in Figure 5, the concentration of neutral fat in the liver of the high-fat diet group (HFD) rapidly increased to about 4 times or more compared to the normal diet group (SCD), but the HFD + GR113808 administration group was compared to the high-fat diet group (HFD). It was confirmed that it was significantly reduced by half compared to the previous level.

Through this, it was confirmed that GR113808 can reduce lipid accumulation in the liver and exert a strong lipogenesis inhibitory effect.

Example 3-5. Analysis of gene expression related to fatty acid absorption and production in liver tissue-1

In addition, Western blot was performed to analyze the expression of genes related to lipogenesis in the liver tissue extracted above according to GR113808 treatment.

Specifically, the liver tissue was treated with RIPA (radioimmunoprecipitation assay) buffer (50mM Tris-Cl (pH7.5), 150mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50mM NaF, 2 It was ground with (mM Na ₃ VO ₄ , protease inhibitor) and then centrifuged at 14000 rpm for 10 minutes to analyze the amount of protein in the supernatant. Of these, 50 μg of protein was separated using 10% SDS-PAGE and transferred to a nitrocellulose membrane. Blocked with 5% BSA in PBST (PBS with 0.1% tween20) for 1 hour, added primary antibody overnight, washed 4 times, added secondary antibody, and incubated with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific product) and chemidoc system ( The level of gene expression was measured using (biorad product).

As a result, as shown in Figure 6, the expression level of PPARγ and CD36, which are important transcription factors for fatty acid absorption, and the expression level of SREBP1c, FAS, and SCD-1, which are fatty acid production transcription enzymes, in the HFD + GR113808 administration group compared to the high-fat diet (HFD) group. It was confirmed that was decreasing.

Example 3-6. Analysis of gene expression related to fatty acid absorption and production in liver tissue-2

In addition, real-time PCR was performed to analyze changes in gene expression related to fatty acid absorption and production following GR113808 treatment.

Specifically, total mRNA in liver tissue was extracted using NucleSpin RNA (Macherey-Hagel, Germany) Ehsms RNease Lipid. The cDNA library was synthesized using a kit (Qiagen, Valencia, CA, USA) and ReverTra Ace qPCR RT Master Mix (Toyobo, Japan). qPCR was performed using Thunderbird SYBR qPCR mix (Toyobo, Japan) on a Biorad CFX96 system (Bio-Rad, Hercules, CA).

Relative gene expression was calculated using the 2 ^-ΔΔCt method.

Additionally, the sequences of PCR primers used in the experiment are shown in Table 3 below.

Name Primer Sequence sequence number PPARγ F: 5'-CCATTCACAAGAGCTGACCC-3'
R: 5'-AAGGTGGAGATGCAGGTTCT-3' One
2 CD36 F: 5'- TGCTCTCCCTTGATTCTGCT -3'
R: 5'- CTCCAAACACACAGCCAGGACT -3' 3
4 SREBP1c F: 5'- ATCGGCCGGAAGCTGTCGGGGTAGCGTC -3'
R: 5'- ACTGTCTTGGTTGTTGATGAGCTGGAGCAT -3' 5
6 FAS F: 5'- GATGACACCAGCTTTGCCAA -3'
R: 5'-CAGTGAGTTGAGGACCAGGT-3' 7
8 SCD-1 F: 5'-GCGATACACTCTGGTGCTCA-3'
R: 5'- TATTCTCCCGGGATTGAATG -3' 9
10 Mogat1 F: 5'- TTGACCCATGGTGCCAGTTT -3'
R: 5'- GTGGCAAGGCTACTCCCATT -3' 11
12 ACACA F: 5'- TGATTCTCAGTTCGGGCACT -3'
R: 5'-TCACCCCGAATAGACAGCTC-3' 13
14 Gpat1 F: 5'-CCACAGAGCTGGGAAAGGTT-3'
R: 5'- GTGCCTTGTGTGGCGTTTCAT -3' 15
16 Agpat1 F: 5'- GCGCAATGTCGAGAACATGA -3'
R: 5'-TCATTCCAAGCAGGTCGAGG-3' 17
18 FABP1 F: 5'- TGAAGGCAATAGGTCTGCCC -3'
R: 5'- GTCATGGTTTCCAGTTCGCA -3' 19
20 FABP2 F: 5'- CTTCGGGAACCACAGGTCTTC -3'
R: 5'- CATAGCAAGGCCTGTCCCATCA -3' 21
22 FATP5 F: 5'- AAAGCTGAAGGATGCCGTAA -3'
R: 5'-CCAACCCCAGAAACACACTC-3' 23
24 CPT1a F: 5'-AGGAGACAAGAACCCCAACA-3'
R: 5'-AACTGGCACTGCTTAGGGAT-3' 25
26 Acox1 F: 5'- TTTTCTTGAGACAGGGCCCA -3'
R: 5'-GTTCCAACTAGCCAGGCATG-3' 27
28 Acot1 F: 5'- CCCCATTGATTTTCCACTTG -3'
R: 5'-AGCACAACCACACTGAATGC-3' 29
30 PPARα F: 5'-CATGAACAAGGTCAAGGCCC-3'
R: 5'-TTCTCGGCCATACACAAGGT-3' 31
32

As a result, as shown in Figure 7, the transcription factors PPARγ, Mogat, CD36, FABP1, which are important transcription factors for fatty acid absorption, and fatty acid production transcription enzymes SREBP1c, FAS, and SCD, increased sharply in the high-fat diet group (HFD) compared to the normal diet group (SCD). It was confirmed that the expression of -1 was significantly reduced by GR113808 administration.

Taken together, these results suggest that GR113808 of the present invention can be useful in preventing, treating, or improving diseases related to metabolic syndrome, including suppressing obesity and improving fatty liver, and can be used as medicine and health functional food. It's a bar.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Claims (10)

For the prevention or treatment of obesity or fatty liver, containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by Chemical Formula 1 as an active ingredient. Pharmaceutical composition.
[Formula 1]
The pharmaceutical composition of claim 1, wherein GR113808 is an antagonist of 5-HT ₄ (Serotonin Receptor 4). The pharmaceutical composition of claim 1, wherein GR113808 reduces body weight, reduces liver and adipose tissue size, and reduces serum triglycerides. The pharmaceutical composition of claim 1, wherein GR113808 inhibits the accumulation of neutral fat in the liver and inhibits the expression of genes and proteins related to lipid synthesis. The pharmaceutical composition according to claim 1, wherein the fatty liver is one or more selected from the group consisting of non-alcoholic fatty liver, alcoholic fatty liver, nutritional fatty liver, starvation fatty liver, non-obsessive fatty liver, and diabetic fatty liver. A method for preventing or treating obesity or fatty liver comprising administering the composition of any one of claims 1 to 5 to an entity other than a human. For preventing or improving obesity or fatty liver, containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by Chemical Formula 1 as an active ingredient. Food composition.
[Formula 1]
For preventing or improving obesity or fatty liver, containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by Chemical Formula 1 as an active ingredient. Quasi-drug composition.
[Formula 1]
For preventing or improving obesity or fatty liver, containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by Chemical Formula 1 as an active ingredient. Feed composition.
[Formula 1]
A composition for inhibiting fatty acid absorption or production containing GR113808 ([1-[2-methylsulphonyl]amino]ethyl)-4-piperidinyl]methyl 1-methyl-1H-indole-3-carboxylate) represented by Formula 1 as an active ingredient. .
[Formula 1]