KR20240026763A - Method for enhancing growth of Haematococcus lacustris using ultrasonic stimulation - Google Patents

Abstract

The present invention relates to a method for promoting the growth of Haematococcus lacustris using ultrasonic stimulation. Specifically, the present invention relates to a method for promoting cell growth of microalgae comprising treating microalgae with low-frequency and low-power ultrasound; and It relates to a method for mass producing biomass or astaxanthin from microalgae with accelerated cell growth, which includes treating microalgae with low-frequency and low-power ultrasound and culturing them. The method for promoting the growth of Haematococcus lacustris using ultrasonic stimulation according to the present invention improves nutrient transport by forming micropores in the cell wall of the microalgae Haematococcus lacustris through short-term ultrasonic treatment. can improve cell density, chlorophyll content, and yield of astaxanthin. Therefore, when using the optimal ultrasonic stimulation conditions established in the present invention, high value-added industrial materials such as biomass and astaxanthin can be efficiently mass-produced from microalgae.

Description

Method for enhancing growth of Haematococcus lacustris using ultrasonic stimulation}

The present invention relates to a method for promoting the growth of Haematococcus lacustris using ultrasound stimulation.

Microalgae can convert light and minerals into energy and carbon compounds through photosynthesis and cellular metabolism. They are promising as raw materials for next-generation biomass production because their photosynthetic efficiency and productivity relative to area are much higher than those of higher plants, and they are easy to artificially culture, so they can be cultivated without seasonal restrictions. Moreover, some microalgae can biosynthesize industrially valuable natural high-value substances.

Astaxanthin, one of the high value-added substances derived from microalgae, shows various physiological activities such as antioxidant, anti-inflammatory, anti-diabetic, and anti-cancer. In particular, astaxanthin has the highest antioxidant activity among natural compounds and is completely non-toxic when taken orally, so it has effects such as protecting eyes and skin from ultraviolet rays, preventing cranial nerve degeneration diseases, strengthening immune function, and preventing cardiovascular diseases. The demand for astaxanthin is steadily increasing in various industrial fields such as pharmaceuticals, cosmetics, and feed.

Astaxanthin is largely obtained through chemical synthesis or extraction from krill, yeast, and microalgae. However, synthetic astaxanthin is free astaxanthin, which is very unstable to light and temperature and shows low physiological activity. In addition, krill-derived astaxanthin has problems of low quality due to its high ash and chitin content and high refining costs. In addition, yeast-derived astaxanthin is in the 3R, 3’R form of astaxanthin and has very low bioavailability. On the other hand, astaxanthin derived from microalgae can be obtained in the form of ester astaxanthin, which has high light and heat stability, and has the highest bioavailability because it is in the 3S, 3’S form of astaxanthin. Therefore, astaxanthin derived from microalgae is most suitable for industrial use.

Meanwhile, Haematococcus sp., a freshwater unicellular green algae, is one of the most industrially promising microalgae capable of producing large amounts of astaxanthin. Haematococcus can accumulate carotenoids up to 5% of the cell dry weight, of which astaxanthin content amounts to about 90%. The life cycle of Haematococcus is strictly divided into the vegetative stage, when photosynthesis and cell division are active, and the mature stage, when astaxanthin accumulates. It is known to initiate astaxanthin biosynthesis to remove oxygen radicals in the body under stress conditions. there is. Therefore, to maximize astaxanthin productivity, both effective cell growth promotion and stress stimulation must be considered.

Most of the technologies to increase the productivity of Haematococcus studied so far have only focused on stress stimulation to induce astaxanthin biosynthesis, and research on methods to promote cell growth of Haematococcus is insufficient. . Promoting cell growth can improve biomass productivity, increase cell density, and shorten the culture time to reach maximum cell density, thereby saving the cost and time spent on cultivating Haematococcus, thereby increasing economic efficiency. Because it can be improved, it is necessary to develop a technology that can enhance the growth of Haematococcus rather than just a technology for inducing astaxanthin biosynthesis.

Korean registered patent 10-2167513

Accordingly, the present inventors completed the present invention by establishing optimal low-power ultrasonic treatment conditions that can effectively promote the growth of Haematococcus lacustris and at the same time improve the productivity of primary and secondary metabolites.

Therefore, the purpose of the present invention is to provide a method for promoting cell growth of microalgae, which includes treating microalgae with low-frequency and low-power ultrasound.

Another object of the present invention is to provide a method for mass producing biomass or astaxanthin from microalgae with promoted cell growth, which includes treating microalgae with low-frequency and low-power ultrasound and culturing them.

In order to achieve the above object, the present invention provides a method of promoting cell growth of microalgae, comprising treating microalgae with low-frequency and low-power ultrasound.

In one embodiment of the present invention, the ultrasonic treatment step may be performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, an ultrasonic treatment cycle of 3 to 15 days, and an ultrasonic treatment time of 5 minutes.

In one embodiment of the present invention, the ultrasonic treatment step may be performed at a low frequency of 40 kHz, a low power of 20 W, an ultrasonic treatment cycle of 15 days, and an ultrasonic treatment time of 5 minutes.

In one embodiment of the present invention, the ultrasonic treatment may improve the transport of nutrients by forming micropores in the cell walls of microalgae.

In one embodiment of the present invention, the ultrasonic treatment at low frequency and low power increases the cell density of microalgae; Increased chlorophyll content; and increased astaxanthin yield; It may have an effect.

In one embodiment of the present invention, the microalgae may be Haematococcus lacustris .

The present invention also provides a method for mass producing biomass or astaxanthin from microalgae with promoted cell growth, which includes treating microalgae with low-frequency and low-power ultrasound and culturing them.

In one embodiment of the present invention, the ultrasonic treatment step may be performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, an ultrasonic treatment cycle of 3 to 15 days, and an ultrasonic treatment time of 5 minutes.

In one embodiment of the present invention, the microalgae may be Haematococcus lacustris .

The method for promoting the growth of Haematococcus lacustris using ultrasonic stimulation according to the present invention improves nutrient transport by forming micropores in the cell wall of the microalgae Haematococcus lacustris through short-term ultrasonic treatment. can improve cell density, chlorophyll content, and yield of astaxanthin. Therefore, when using the optimal ultrasonic stimulation conditions established in the present invention, high value-added industrial materials such as biomass and astaxanthin can be efficiently mass-produced from microalgae.

Figure 1 is a schematic diagram showing the process of inducing growth promotion of Haematococcus lacustris using ultrasound stimulation according to the present invention.
Figure 2 is a graph showing (a) change in cell density, (b) change in chlorophyll content, and (c) change in astaxanthin yield of Haematococcus lacustris in response to ultrasound stimulation of various outputs.
Figure 3 is a graph showing (a) change in cell density, (b) change in chlorophyll content, and (c) change in astaxanthin yield of Haematococcus lacustris for various sonication cycles.
Figure 4 shows photographs observing the cell morphology of Haematococcus lacustris in response to (a) ultrasound stimulation at various outputs and (b) various sonication cycles.
Figure 5 shows a photograph of changes in cell surface structure of Haematococcus lacustris depending on ultrasound stimulation observed using a transmission electron microscope.
Figure 6 shows the results of analyzing the relative mRNA expression levels of genes related to cell growth and antioxidants in Haematococcus lacustris by ultrasound stimulation. minD and transporter are a septum site-determining protein and a septum site-determining protein related to nutrient transport, respectively. Corresponds to nitrate/nitrite transporter, and SOD and CAT correspond to superoxide dismutase and catalase, respectively, related to cellular stress.
Figure 7 is a graph showing (a) the change in total nitrogen and (b) the change in total phosphorus content in the Haematococcus lacustris culture medium depending on the presence or absence of ultrasound stimulation.

The present invention is a technology that has developed a method that can effectively promote the growth of microalgae, and can improve nutrient transport into Haematococcus lacustris and improve cell density through short-term ultrasound stimulation. It is characterized by identifying the optimal ultrasonic treatment conditions for promoting the growth of microalgae, which can enhance the production of useful industrial materials such as biomass and astaxanthin.

In the biological industry, ultrasonic treatment is a widely used method for the purpose of cell disruption, particle pulverization, and homogenization to extract useful components within cells.

Meanwhile, in the present invention, ultrasonic treatment was applied as a method to promote cell growth of microalgae capable of producing useful substances, and optimal ultrasonic treatment conditions were established.

According to one embodiment of the present invention, in order to identify ultrasonic treatment conditions that can maximize cell growth of the microalgae, Haematococcus lacustris, which belongs to freshwater unicellular green algae, various ultrasonic output conditions and frequencies are used. , treatment cycle, and treatment time, changes in cell density, chlorophyll content, and astaxanthin yield of microalgae were analyzed.

As a result, when performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, an ultrasonic treatment cycle of 3 to 15 days, and an ultrasonic treatment time of 5 minutes, Haematococcus lacustris was significantly reduced compared to the group that was not treated with ultrasonic waves. Cell density, chlorophyll content, and astaxanthin yield were all found to increase, and in particular, the effect was found to be highest under the low frequency of 40 kHz, low power of 20 W, sonication cycle of 15 days, and sonication of 5 minutes.

Therefore, the present invention can provide a method of promoting cell growth of microalgae, which includes treating microalgae with low-frequency and low-power ultrasound.

The ultrasonic treatment step can be performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, an ultrasonic treatment cycle of 3 to 15 days, and an ultrasonic treatment time of 5 minutes, preferably at a low frequency of 40 kHz, low power of 20 W, and 15 min. It can be performed with a sonication cycle of one day and a short sonication time of 5 minutes.

In addition, the ultrasonic treatment can be performed using any ultrasonic equipment used in the industry, and the ultrasonic device can be either a tank type or a tip type. A water tank type is preferable because power can be applied evenly to the entire area.

In the ultrasonic treatment according to the present invention, it is preferable to use a frequency range of 20 to 40 kHz. If the ultrasonic treatment is performed at a frequency of less than 20 kHz, the cell growth effect of microalgae cannot be shown. On the other hand, if the ultrasonic treatment is performed at a frequency of less than 20 kHz, the cell growth effect of microalgae cannot be shown. There is a problem that excessive stress may be caused to the cells when treated in the cell, which may inhibit cell division or physically destroy the cells. Therefore, it is preferable to process in the above frequency range, and more preferably at a frequency of 40 kHz.

Additionally, the output of ultrasonic waves can be processed in the range of 20~80W.

If the ultrasonic output is less than 20W, the effects of microalgae cell growth, chlorophyll content enhancement, and astaxanthin content cannot be shown. On the other hand, if it exceeds 80W, too much stimulation is given to the cells, resulting in cell death or destruction. It can be.

Therefore, the output of ultrasonic waves can be performed in the range of 20 to 80 W, and preferably 20 W.

In addition, sonication can be performed with a treatment time of only 5 minutes per cycle. If sonication is performed for less than 5 minutes, appropriate micropores will not be formed in the cell wall, whereas if sonication is performed for more than 5 minutes, appropriate micropores will not be formed in the cell wall. Doing so may cause cells to be shattered.

The sonication cycle can be performed from 3 to 15 days. If sonication is performed with a cycle of less than 3 days, there is a risk that the effect of promoting the growth of microalgae will be insufficient. On the other hand, if it exceeds 15 days, the cells may die. there is. Therefore, it is desirable to perform ultrasonic treatment every 3 to 15 days, and more preferably every 15 days.

If treated with an ultrasonic cycle for 15 days, cell damage caused by ultrasonic treatment can be sufficiently recovered, and cell growth, chlorophyll content, and astaxanthin content of microalgae can be most effectively promoted.

The ultrasonic treatment conditions according to the present invention can promote the growth of microalgae through only one ultrasonic treatment per ultrasonic treatment cycle, rather than continuous ultrasonic treatment throughout the cultivation period, and at the same time, can promote the growth of microalgae and astaxanthin in the microalgae. It can increase the tin content very effectively.

Furthermore, the present inventors conducted an experiment to determine the effect on microalgae when ultrasonic stimulation was applied under the conditions of the present invention.

As a result of transmission electron microscopy, it was confirmed that micropores were formed in the cell wall of Haematococcus lacustris treated with ultrasound under the conditions of the present invention, unlike the control group that was not treated with ultrasound. However, no damage was caused to the inner layer of the cell wall.

These results showed that the ultrasonic treatment conditions of the present invention allow the formation of micropores in the cell walls of microalgae, allowing nutrients in the culture medium to be easily transported into the microalgae, thereby inducing the growth of microalgae more effectively.

In another embodiment of the present invention, total RNA is extracted from Haematococcus lacustris stimulated under the sonication conditions of the present invention and from Haematococcus lacustris not treated with sonication, followed by cell growth and nutrient transport. And the expression changes of oxidative stress-related genes were analyzed.

As a result, the expression of genes related to cell growth, nutrient transport, and oxidative stress were found to be increased due to ultrasound stimulation. In particular, the degree of increased expression of genes was found to be higher for genes related to cell growth and nutrient transport than for oxidative stress-related genes. appear. These results mean that the ultrasonic treatment conditions according to the present invention have a greater effect on cell growth and nutrient transport enhancement effects than on stress-inducing effects.

In the present invention, the microalgae for inducing cell growth through ultrasonic treatment may be Haematococcus sp. microalgae, and preferably Haematococcus lacustris .

In addition, the present invention can provide a method for mass producing biomass or astaxanthin from microalgae with promoted cell growth, which includes treating microalgae with low-frequency and low-power ultrasound and culturing them.

As described above, when microalgae are cultured by applying the sonication conditions for cell growth promotion established in the present invention, cell growth of the microalgae can be promoted, and biomass or astaxan within the microalgae can be promoted. It can enhance the production and accumulation of tin, ultimately enabling mass production of useful substances such as biomass or astaxanthin.

The ultrasonic treatment step can be performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, an ultrasonic treatment cycle of 3 to 15 days, and an ultrasonic treatment time of 5 minutes, preferably at a low frequency of 0 kHz, low power of 20 W, and 15 min. It can be performed with a sonication cycle of one day and a sonication time of 5 minutes.

In this way, when microalgae are stimulated under the ultrasonic treatment conditions according to the present invention, cell growth of microalgae can be effectively promoted without causing excessive stress on the microalgae, and at the same time, productivity of biomass or astaxanthin from microalgae can be increased. It can be improved.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrating the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Culture of Haematococcus lacustris

Haematococcus lacustris microalgae were cultured using OHM (Optimal Haematococcus Medium) medium. The composition of the medium is 0.41 g of KNO ₃ , 0.03 g of Na ₂ HPO ₄ , 0.246 g of MgSO ₄ ·7H ₂ O, 0.11 g of CaCl ₂ ·2H ₂ O, 2.62 g of Fe(III)-citrate·H ₂ O per 1 L of distilled water. mg, CoCl ₂ ·6H ₂ O 0.011 mg, CuSO ₄ ·5H ₂ O 0.012 mg, Cr ₂ O ₃ 0.075 mg, MnCl ₂ ·4H ₂ O 0.98 mg, Na ₂ MoO ₄ ·2H ₂ O 0.12 mg, SeO ₂ 0.005 mg, Biotin 25μg, Thiamine 17.5μg, and vitamin B ₁₂ 15μg. Before culturing, the medium was sterilized at 121°C for 20 minutes using a high-pressure sterilizer, and the culture was performed at 25°C under white light of 50 μmol m ^-2 s ^-1 and aeration of 0.2 vvm.

<Example 2>

Establishment of optimal sonication conditions to enhance cell growth of Haematococcus lacustris

<2-1> Check optimal ultrasonic output conditions

In order to determine the optimal sonication conditions that can maximize cell growth enhancement of Haematococcus lacustris, Haematococcus lacustris was first cultured under different ultrasound output conditions. Specifically, the initial cell concentration was set at 5 × 10 ⁴ cell mL ^-1 of vegetative stage cells, and first, in order to establish the optimal output conditions of ultrasound, an ultrasonic generator 2000 was used to produce 20, 40, 60 cells, respectively. Ultrasonic waves were applied at an output of 80 W. At this time, the ultrasonic frequency was set to 40 kHz, the treatment cycle was set to 15 days, and the treatment time was set to 5 minutes. In addition, the distance between the cells and the ultrasonic vibrator was set to 10 cm, and 10 L of water at 25°C was used as the medium. Afterwards, cell density was analyzed from Haematococcus lacustris cultured under each sonication condition, and total chlorophyll content and astaxanthin content were analyzed.

The degree of cell growth through cell density analysis was directly counted using a microscope and a hemocytometer, and the appearance of cells was determined by photographing more than 100 randomly selected cells using a microscope.

Additionally, the pigment content was measured using a spectrophotometer. For pigment analysis, cells were harvested by centrifugation at 13,000 rpm for 10 minutes, washed twice with distilled water, and disrupted using 90% acetone and a bead beater. Afterwards, the supernatant was separated by centrifugation at 13,000 rpm for 1 minute, and the optical density was measured at 474, 646, and 663 nm. Chlorophyll a (Chl a), chlorophyll b (Chl b), total chlorophyll content and astaxanthin yield (mg L ^-1 ) were calculated using the following equations:

Chlorophyll a (Chl a) = 12.21 × OD ₆₆₃ - 2.81 × OD ₆₄₆

Chlorophyll b (Chl b) = 20.13 × OD ₆₄₆ - 5.03 × OD ₆₆₃

Total chlorophyll content = Chl a + Chl b

Astaxanthin yield = (OD ₄₇₄ - 0.0831) / 0.1426

As a result of the analysis, as shown in the results of Figure 2, the most effective ultrasonic power condition for cell growth and chlorophyll production of Haematococcus lacustris was confirmed to be a low power of 20W, and the group treated with ultrasonic waves under the 20W power condition had no ultrasound power. It was found to show improved cell growth (cell density) of 78.64% compared to the untreated group, and not only cell growth but also chlorophyll production was found to be superior compared to 40W, 60W, and 80W.

<2-2> Check the optimal ultrasonic treatment cycle

In order to determine the effect of the sonication cycle on the growth of Haematococcus lacustris, the power of ultrasound was set to 20W, which is the optimal condition confirmed in <2-1>, and the sonication cycle was 3 days and 9 days, respectively. , ultrasound was performed for 15 days.

As a result of the analysis, as shown in Figure 3, the most effective cycle for cell growth, chlorophyll production, and astaxanthin production of Haematococcus lacustris was found to be 15 days. The 15th day of ultrasound cycle confirmed in the present invention showed the highest cell density and increased content of chlorophyll and astaxanthin compared to the 3rd and 9th days. Cell density and total chlorophyll content were found to increase by 50.00% and 39.01%, respectively, compared to the control group, and as cell density increased, astaxanthin yield also increased to 14.33%.

Meanwhile, cells exposed to ultrasonic treatment for a long period of time may cause irreversible cell damage, and the activity of intracellular enzymes may be lost or reduced, resulting in loss of cell activity. In this regard, the optimal ultrasonic treatment conditions of the present invention can promote the growth of Haematococcus lacustris and simultaneously increase the production of useful substances such as astaxanthin with only one ultrasonic treatment per 15 days under low power conditions. there is.

Through these results, the present inventors found that the optimal ultrasonic treatment conditions to promote the growth of Haematococcus lacustris are 40 kHz frequency, 20 W output, 5 minutes treatment time, and 1 treatment cycle per 15 days. I was able to.

<Example 3>

Analysis of the effect of sonication on the ultrastructure of Haematococcus lacustris cells

The present inventors observed changes in the cell walls of microalgae using a transmission electron microscope when treated with optimal ultrasonic stimulation conditions that can promote the growth of Haematococcus lacustris identified in the present invention. For this purpose, Haematococcus lacustris cells were fixed using 2.5% glutaraldehyde for 3 hours at 25°C. After washing with PBS (phosphate buffered saline) buffer, the cells were post-fixed with osmium tetroxide, dehydrated using ethanol and acetone, and embedded in Epon 812. Semi-circular sections were obtained using a Leica Ultracut UCT microtome and observed with a transmission electron microscope at 60kV.

As a result of the analysis, W1, W7, and trilaminar sheets (W2, W4, W6) constituting the cell wall of Haematococcus lacustris were observed. By the ultrasonic treatment of the present invention, the inner W2 layer was completely destroyed. Without damage, small cracks were consistently observed in the W4 and W6 layers. That is, it was confirmed that micropores were formed in the cell wall of Haematococcus lacustris due to small cracks in the W4 and W6 layers (see Figure 5).

These results show that the ultrasonic treatment conditions established in the present invention do not induce cell disruption of Haematococcus lacustris, but form micropores in the cell wall while maintaining the cell wall structure, thereby facilitating the transport of nutrients into the microalgae. It was found that the cell growth of Haematococcus lacustris could be promoted by doing so.

<Example 4>

Analysis of expression changes in genes related to cell growth, nitrogen transport, or ROS scavenging in Haematococcus lacustris according to sonication

An experiment was performed to determine whether the sonication conditions established in the present invention change the expression levels of genes related to cell growth, nitrogen transport, or ROS scavenging in Haematococcus lacustris. For this purpose, total RNA was extracted from Haematococcus lacustris stimulated under the sonication conditions of the present invention and control cells that were not treated with sonication using the RNeasy Plant Mini Kit. Afterwards, cDNA was synthesized using the High-Capacity RNA-to-cDNA Kit, and the expression level of the corresponding gene was analyzed using the primers listed in the table below. RT-qPCR was performed with the StepOnePlus Real-Time PCR System and quantified using SYBR Select Master Mix according to the manufacturer's instructions. Additionally, 40 RT-PCR cycles were performed with initial PCR activation at 95°C for 5 minutes, denaturation at 95°C for 10 seconds, and annealing and extension reaction conditions at 60°C for 22 seconds. Here, the Actin gene was used as a reference, and each gene was analyzed at least twice. Data obtained from RT-PCR were analyzed using StepOne.

primer target gene Forward direction (5’->3’) Reverse direction (5’->3’) actin CACAAACTGGGAATGACATGG CAGTGGTGGTGAAGGAGTAG minD GGACATTGGCTTGAGGAATC TGACGTTGAGGATGCTGTTG transport GTTTGGGTGGGGATCATGT CGATGATGTTGTCCACTGTC SOD CAGACGTTCATCACAGTGT TGAGTGGTGCTGGTGTTGGT CAT TTTCTGCTGGATGATGTGGG AATAGGCTGCAAGGGGAAGA

As a result of the analysis, the mRNA levels of minD , a gene related to cell division, and nitrate/nitrite transport, a transporter involved in the movement of NO ₃ ^- into cells, were found to be significantly increased compared to the control group, and the levels of mRNA related to scavenging reactive oxygen species (ROS) were significantly increased compared to the control group. The mRNA levels of the genes SOD (superoxide dismutase) and CAT (catalase) were also found to increase compared to the control group. Specifically, compared to the control group, the mRNA levels of minD and nitrate/nitrite transport were found to increase by 85.54% and 58.92%, respectively, and SOD and CAT were found to increase by 10.10% and 16.55%, respectively. Meanwhile, the level of increase in the above genes compared to the control group showed a higher level of increase in the expression of genes related to cell growth due to nutrient absorption into cells and cell division compared to the increase in expression of oxidative stress-related genes (FIG. 6). In addition, the degree of nutrient (nitrogen and phosphorus) absorption of Haematococcus lacustris was monitored using an inductively coupled plasma spectrometer. As shown in Figure 7, H. lacustris stimulated by ultrasound absorbs nitrogen. It was found that wine nutrients are absorbed well.

These results mean that ultrasound stimulation according to the present invention can effectively promote cell growth of Haematococcus lacustris by inducing upregulation of genes related to cell growth and nutrient transport.

<Example 5>

Fatty acid analysis of Haematococcus lacustris by sonication.

Through the results of Example 3, it was confirmed that micropores were formed in the cell wall of Haematococcus lacustris under the ultrasonic treatment conditions of the present invention. Accordingly, the present inventors analyzed whether ultrasonic treatment caused changes in fatty acid composition, which is involved in the fluidity of cell walls. For this purpose, lipids were extracted from Haematococcus lacustris using methanol extraction. That is, Haematococcus lacustris biomass was centrifuged at 3,000g and freeze-dried. 50 mg of freeze-dried biomass was treated with 1 mL of DMSO at 70°C for 5 minutes and then extracted with 5 mL of methanol at 4°C for 1 hour. The mixture was centrifuged at 3,000 g, the supernatant was collected, and the pellet was re-extracted with methanol for 15 min at 4°C. A mixture was created by adding equal amounts of peroxide-free diethyl ether, n-hexane, and distilled water to the methanol extract. The mixture was shaken in a separatory funnel and centrifuged to collect the upper phase. The lower phase was acidified to pH 3~4 by adding acetic acid and re-extracted by adding equal amounts of peroxide-free diethyl ether and n-hexane. The collected upper phases were evaporated to dryness using nitrogen gas and maintained at -20°C. Lipid fractionation was performed using 1,000 mg silica cartridge Sep-Pack (SP). Separation of the lipid fraction consisted of (1) adsorbent conditioning using 30 mL of chloroform, (2) sample loading using 1 mL of chloroform/oil solution containing 20 mg of oil, (3) 15 mL of chloroform:acetic acid ( Elution of neutral lipids from the adsorbent bed using 9:1, v:v), (4) Elution and recovery of glycolipids using 20 mL of acetone:methanol (9:1, v:v), (5) Elution and recovery of glycolipids with 20 mL of methanol. A process of phospholipid elution and recovery was performed using , and each fraction was collected in a conical vial and evaporated to dryness using nitrogen gas. Approximately 25 to 30 mg of fractionated lipid was placed in a sealed flask and 2 mL of 10% KOH methanolic solution was added while vigorously stirring. After sealing the flask and purging the air with nitrogen, the flask was heated in a water bath at 80°C for 45 minutes. The non-saponifiable material was extracted using petroleum ether. The lower phase was treated with concentrated HCl and the free fatty acids were extracted with petroleum ether. The ether extract was dried under nitrogen gas, 1.5 mL of BF3 solution (10% in methanol solution) was added, and the sample was incubated at 80°C for 30 minutes. Finally, fatty acid methyl ester (FAME) was extracted with petroleum ether, evaporated to dryness under nitrogen gas, and chromatographic grade hexane was added to set the final volume to 100 μL. FAME was analyzed by gas chromatography using an Agilent 7890 GC-FID system, and high-purity hydrogen of 18 cm s ^-1 was used as the carrier gas. The GC oven was maintained at 140°C for 5 minutes, then the temperature was increased at 4°C per minute to 240°C and maintained isothermally for 15 minutes. The detection limit was 0.01%, and chromatography was analyzed using the TSBA6 database. FAME identification and quantification were performed using the Sherlock Microbial Identification System and Standard MIS Library Generation Software as described by MIDI.

As a result, as shown in Table 2, the lipid components of Haematococcus lacustris subjected to the ultrasonic treatment conditions of the present invention did not show any significant difference from the control group that was not treated with ultrasonic waves.

These results showed that the sonication conditions established in the present invention can effectively promote cell growth without significantly affecting the cell membrane fluidity of Haematococcus lacustris, and this cell growth Through promotion, it was found that useful substances such as astaxanthin can be efficiently mass-produced from Haematococcus lacustris.

A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention. So far, the present invention has been reviewed with a focus on its preferred embodiments. saw.

Claims (9)

A method of promoting cell growth of microalgae, comprising treating microalgae with low-frequency and low-power ultrasound. According to paragraph 1,
The ultrasonic treatment step is characterized in that it is performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, a sonication cycle of 3 to 15 days, and a sonication time of 5 minutes. A method of promoting cell growth of microalgae. According to paragraph 2,
A method of promoting cell growth of microalgae, characterized in that the ultrasonic treatment step is performed at a low frequency of 40 kHz, a low power of 20 W, an ultrasonic treatment cycle of 15 days, and an ultrasonic treatment time of 5 minutes. According to paragraph 1,
A method of promoting cell growth of microalgae, characterized in that the ultrasonic treatment improves the transport of nutrients by forming micropores in the cell walls of microalgae. According to paragraph 1,
The low-frequency and low-power ultrasonic treatment,
Increased cell density of microalgae;
Increased chlorophyll content; and
Increased astaxanthin yield; A method for promoting cell growth of microalgae, characterized in that it has an effect. According to paragraph 1,
A method of promoting cell growth of microalgae, characterized in that the microalgae is Haematococcus lacustris . A method for mass producing biomass or astaxanthin from microalgae whose cell growth is promoted, comprising treating microalgae with low-frequency and low-power ultrasound and culturing them. In clause 7,
The ultrasonic treatment step is characterized in that it is performed at a low frequency of 20 to 40 kHz, a low power of 20 to 80 W, a sonication cycle of 3 to 15 days, and a sonication time of 5 minutes. Method for mass producing mass or astaxanthin. In clause 7,
A method for mass producing biomass or astaxanthin from microalgae with promoted cell growth, characterized in that the microalgae is Haematococcus lacustris .