KR20240017999A - Recombinant Strain for Production of 2,3-Butanediol with High Efficiency - Google Patents

Abstract

The present invention relates to a recombinant strain for high-efficiency production of 2,3-BDO, and the gene encoding the outer membrane porin protein in the Klebsiella oxytoca strain is deleted or the expression of the gene This relates to a recombinant strain with improved 2,3-BDO production ability, which is reduced or suppressed.

Description

{Recombinant Strain for Production of 2,3-Butanediol with High Efficiency}

The present invention relates to a recombinant strain for high-efficiency production of 2,3-butanediol (2,3-BDO). Outer membrane porin in Klebsiella oxytoca strain. It relates to a recombinant strain with improved 2,3-BDO production ability in which the gene encoding the protein (porin) is deleted or the expression of the gene is reduced or suppressed, and a method for producing 2,3-BDO using the same.

Producing high value-added products using microorganisms is an environmentally friendly and industrially economical method (Priya, A., Lal, B. 2019. Efficient valorization of waste glycerol to 2,3-butanediol using Enterobacter cloacae TERI BD 18 as a biocatalyst. Fuel , 250, 292-305).

In addition, research on improving the ability of microorganisms to consume sugar used as a carbon source is a field of research necessary to produce target compounds with high efficiency. An effective method for this is the laboratory adaptive evolution technique. This is a strategy that induces microorganisms to acquire the desired traits by naturally acquiring genetic evolution to adapt to a given environment (Sandberg, T.E., Lloyd, C.J., Palsson, B.O., Feist, A.M. 2017. Laboratory evolution to alternating substrate environments yields Distinct phenotypic and genetic adaptive strategies. Applied and Environmental Microbiology, 83(13), e00410-17.)

In order to produce bio compounds more economically using microorganisms, it is necessary to reduce the cost of carbon sources, which account for a large portion of the process cost. Accordingly, efforts are being made to use saccharification liquid extracted from lignocellulosic biomass for microbial culture (Cha, JW, Jang, SH, Kim, YJ, Chang, YK, Jeong, KJ, 2020. Engineering of Klebsiella oxytoca for production of 2,3-butanediol using mixed sugars derived from lignocellulosic hydrolysates. GCB Bioenergy, 12, 275-286).

The lignocellulosic biomass saccharification solution includes carbon sources such as glucose, which can be basically used by most microorganisms, but also includes carbon sources such as xylose, mannose, and galactose (Bioresource Technology, 194, 247-255 and Journal of biotechnology, 237 , 13-17). Therefore, developing microorganisms that can effectively utilize not only glucose but also other carbon sources can greatly contribute to technology for economically producing bio compounds from inexpensive lignocellulosic biomass saccharification fluid.

Xylose is known to occupy a large proportion after glucose in saccharification solutions derived from various lignocellulosic biomass and is a representative pentose carbon source used to produce bio compounds (Nieves, L.M., Panyon, L.A., Wang, X. 2015. Engineering sugar utilization and microbial tolerance toward lignocellulose conversion. Frontiers in bioengineering and biotechnology, 3, 17.).

The present inventors have previously developed a strain showing excellent mixed sugar consumption ability by inserting a xylose transport gene from E. coli into the Klebsiella oxytoca genome and performing xylose-based laboratory adaptation evolution to utilize xylose more effectively. (Cha, J.W., Jang, S.H., Kim, Y.J., Chang, Y.K., Jeong, K.J., 2020. Engineering of Klebsiella oxytoca for production of 2,3-butanediol using mixed sugars derived from lignocellulosic hydrolysates. GCB Bioenergy, 12, 275- 286.).

Under this technical background, while trying to develop microorganisms with genetic mutations that can improve the sugar consumption ability of industrially important microorganisms, a gene encoding an outer membrane porin protein was discovered in Klebsiella oxytoca. Developing a recombinant strain with deletion or reduced or suppressed expression of the gene, confirming that the strain can grow rapidly on a biomass-derived mixed sugar base and produce 2,3-BDO with high efficiency, and the present invention was completed.

The purpose of the present invention is to provide a recombinant strain capable of producing 2,3-BDO with high efficiency.

The purpose of the present invention is to provide a method for producing 2,3-BDO with high efficiency through the above recombinant strain.

In order to achieve the above object, the present invention is a Klebsiella oxytoca strain into which a gene encoding a xylose transporter has been introduced, in which the gene encoding the outer membrane porin protein is deleted, or Provided is a recombinant strain with reduced or suppressed gene expression and improved 2,3-BDO production ability.

The present invention also relates to a method for producing 2,3-BDO comprising the following steps: (a) culturing the recombinant strain to produce 2,3-BDO; and (b) recovering the produced 2,3-BDO.

The recombinant strain according to the present invention is capable of rapid growth and highly efficient production of 2,3-BDO due to improved catabolism of mixed sugars derived from lignocellulosic biomass. The present invention has the advantage of being able to economically produce 2,3-BDO from lignocellulosic biomass, an inexpensive raw material, using recombinant Klebsiella oxytoca.

Figure 1 shows the cell growth and xylem of the CHA156 strain with the ompC gene deleted in the CHA004 strain compared to CHA004 and CHA006 using the CHA004 strain introduced with a foreign xylose transport gene ( xylE ) and the CHA006 strain introduced with an additional laboratory adaptive evolution technique. These are the results of loss consumption and 2,3-BDO production. (a): Cell growth results in CHA004, CHA006, and CHA156. (b): Results of xylose consumption in CHA004, CHA006, and CHA156. (c): 2,3-BDO production results in CHA004, CHA006, and CHA156.
Figure 2 shows the cell growth, glucose consumption ability, and 2,3-BDO production results of the CHA156 strain compared to CHA004 and CHA006. (a): Cell growth results in CHA004, CHA006, and CHA156. (b): Results of glucose consumption in CHA004, CHA006, and CHA156. (c): 2,3-BDO production results in CHA004, CHA006, and CHA156.
Figure 3 shows the cell growth, mannose consumption ability, and 2,3-BDO production results of the CHA156 strain compared to CHA004 and CHA006. (a): Cell growth results in CHA004, CHA006, and CHA156. (b): Mannose consumption results in CHA004, CHA006, and CHA156. (c): 2,3-BDO production results in CHA004, CHA006, and CHA156.
Figure 4 shows the cell growth, galactose consumption ability, and 2,3-BDO production results of the CHA156 strain compared to CHA004 and CHA006. (a): Cell growth results in CHA004, CHA006, and CHA156. (b): Results of galactose consumption in CHA004, CHA006, and CHA156. (c): 2,3-BDO production results in CHA004, CHA006, and CHA156.
Figure 5 shows the analysis results of mrkJ and mrkA transcript amounts in strains CHA004 and CHA006. (a): This is the result of comparing the transcription level of mrkJ due to a single nucleotide sequence mutation on the mrkJ promoter identified in CHA006 with that of CHA004. (b): This is the result of comparing the transcription level of mrkA , a gene involved in biofilm formation, with CHA004.
Figure 6 shows the results of confirming the transcription level of mrkJ according to a single nucleotide sequence mutation on the mrkJ promoter at the plasmid level. (a): It is a model of a recombinant plasmid constructed based on the pBAD33 plasmid (pBAD33-P _{wild type} - mrkJ and pBAD33-P _{evolved type} - mrkJ ) with an mrkJ expression system containing the wild type sequence and the evolved sequence respectively. (b): This is the result of comparing the mrkJ transcript amounts of CHA268 and CHA269 by transforming two types of recombinant plasmids into the CHA004 strain.
Figure 7 shows the results of comparing the biofilm formation of strains CHA264, CHA268, CHA269, and CHA267 with different expression levels of mrkJ .
Figure 8 shows cell growth in a medium containing pine lignocellulosic biomass saccharification solution compared to the CHA269 strain transformed with the pBAD33-P _{evolved type} - mrkJ in the CHA156 strain and the CHA270 strain transformed with the empty vector pBAD33 in the CHA156 strain. It is a result.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

In the present invention, microorganisms with ompC deletion and impaired biofilm formation can be used to discover and improve industrially useful microorganisms by improving the catabolism of mixed sugars derived from lignocellulosic biomass and producing 2,3-BDO with high efficiency. was confirmed. More specifically, it was confirmed that high-speed growth and high-efficiency production of 2,3-BDO based on biomass-derived mixed sugars were possible through deletion of ompC and inhibition of biofilm formation in Klebsiella oxytoca.

Therefore, in one aspect of the present invention, in a Klebsiella oxytoca strain into which a gene encoding a xylose transporter has been introduced, the gene encoding an outer membrane porin protein is deleted, or the gene It relates to a recombinant strain with improved 2,3-BDO production ability in which the expression of is reduced or suppressed.

In an embodiment of the present invention, Klebsiella oxytoca KCTC 1686 △ mgsA ::P _{BBa_J23118} - xylE (CHA004) in which the xylose transport gene xylE derived from E. coli was introduced into the sugar metabolism inhibition gene mgsA position to improve xylose consumption ability ) As a result of identifying the genetic cause of improved glucose consumption and cell growth in the strain through laboratory adaptive evolution techniques, it was found that there was a frameshift caused by a deletion of the gene sequence on the ompC gene, which encodes the outer membrane porin protein. A single nucleotide sequence change was identified on the mrkJ promoter of the cyclic-di-GMP phosphodiesterase coding gene.

Based on this, the gene encoding the xylose transporter may be the xylE gene. The gene xylE encoding the xylose transporter may include the sequence of SEQ ID NO: 1. The gene encoding the xylose transporter may be derived from E. coli, but is not limited thereto.

[SEQ ID NO: 1]

ATGAATACCCAGTATAATTCCAGTTATATATTTTCGATTACCTTAGTCGCTACATTAGGTGGTTTATTATTTGGCTACGACACCGCCGTTATTTCCGGTACTGTTGAGTCACTCAATACCGTCTTTGTTGCTCCACAAAACTTAAGTGAATCCGCTGCCAACTCCCTGTTAGGGTTTTGCGTGGCCAGCGCTCTGATTGGTTGCATCATCGGCGGTGCCCTCGGTGGTTATTGCAGTAACCGCTTCGGTCGTCGTGATTCACTTA AGATTGCTGCTGTCCTGTTTTTTATTTCTGGTGTAGGTTCTGCCTGGCCAGAACTTGGTTTTACCTCTATAAACCCGGACAACACTGTGCCTGTTTATCTGGCAGGTTATGTCCCGGAATTTGTTATTTATCGCATTATTGGCGGTATTGGCGTTGGTTTAGCCTCAATGCTCTCGCCAATGTATATTGCGGAACTGGCTCCAGCTCATATTCGCGGGAAACTGGTCTCTTTTAACCAGTTTGCGATTATTTTCGGGCAACTTTTAGT TTACTGCGTAAAACTATTTTATTGCCCGTTCCGGTGATGCCAGCTGGCTGAATACTGACGGCTGGCGTTATATGTTTGCCTCGGAATGTATCCCTGCACTGCTGTTCTTAATGCTGCTGTATACCGTGCCAGAAAGTCCTCGCTGCTGATGTCGCGCGGCAAGCAAGAACAGGCGGAAGGTATCCTGCGCAAAATTATGGGCAACACGCTTGCAACTCAGGCAGTACAGGAAATTAAACACTCCCTGGATCATGGCCGCAAAAAA ACCGGTGGTCGTCTGCTGATGTTTGGCGTGGGCGTGATTGTAATCGGCGTAATGCTCTCCATCTTCCAGCAATTTGTCGGCATCAAATGTGGTGCTGTACTACGCGCCGGAAGTGTTCAAAACGCTGGGGGGCCAGCACGGATATCGCGCTGTTGCAGACCATTATTGTCGGAGTTATCAACCTCACCTTCACCGTTCTGGCAATTATGACGGTGGATAAATTTGGTCGTAAGCCACTGCAAATTATCGGCGCACTCGGAATGG CAATCGGTATGTTTAGCCTCGGTACCGCGTTTTACACTCAGGCACCGGGTATTGTGGCGCTACTGTCGATGCTGTTCTATGTTGCCGCCTTTGCCATGTCCTGGGGTCCGGTATGCTGGGTACTGCTGTCGGAAATCTTCCCGAATGCTATTCGTGGTAAAGCGCTGGCAATCGCGGTGGCGGCCCAGTGGCTGGCGAACTACTTCGTCTCCTGGACCTTCCCGATGATGGACAAAAACTCCTGGCTGGTGGCATTTCCACA ACGGTTTCTCCTACTGGATTTACGGTTGTATGGGCGTTCTGGCAGCACTGTTTATGTGGAAATTTGTCCCGGAAACCAAAGGTAAAACCCTTGAGGAGCTGGAAGCGCTCTGGGAACCGGAAACGAAGAAAACACAACAAACTGCTACGCTGTAA

The gene encoding the xylose transporter may be introduced into the sugar metabolism inhibition gene mgsA in Klebsiella oxytoca. The sugar metabolism inhibition gene mgsA may include the sequence of SEQ ID NO: 2. By introducing the gene xylE encoding a xylose transporter into the position of the sugar metabolism inhibition gene mgsA having the sequence of SEQ ID NO: 2, the sugar metabolism inhibition gene mgsA having the sequence of SEQ ID NO: 2 can be deleted.

[SEQ ID NO: 2]

ATGGAACTAACAACACGTACCTTGCCAGCACGCAAGCATATTGCGCTGGTTGCTCACGATCACTGTAAAGATATGCTGATGAAGTGGGTCGAGCGCCACCAGCCATTGCTGGCGCAACACACGCTCTCGGCGACAGGAACGACCGGAAATCTGGTGTCACGCGCAACCGGGCTGGAGGTGCATGCGATGCTGAGTGGTCCCATGGGCGGCGACCAGCAGGTGGGTGCGCTGATTTCAGAAGGTAAAATCGATGTATTGATTGATT TTTTTCTGGGATCCGCTAAATGCCGTGCCGCACGACCCGGATGTTAAAGCGTTATTACGTTTGGCGACGGTATGGAATATTCCCGTCGCCACCAATGTCTCAACCGCCGACTTTATTATCCAGTCCCCGCACTTCAGCGACCCCGTTGATATCCTGATCCCTGATTATCAGCGCTACCTTGCAGAGCGTCTGAAAATAA

The gene encoding the outer membrane porin may be ompC . The ompC gene may include the sequence of SEQ ID NO: 3. The ompC gene may be deleted, or expression of the gene may be reduced or suppressed.

[SEQ ID NO: 3]

ATGAAAGTTAAAGTACTGTCCCTCCTGGTACCGGCACTGCTGGTAGCAGGCGCAGCGAATGCGGCTGAAGTCTATAACAAAGATGGCAACAAATTAGATCTGTACGGTAAAATCGACGGTCTGCACTATTTCTCTGACGACAAATCTTCCGATGGCGACCAGACCTACATGCGTCTGGGCATCAAAGGCGAAACTCAGATCAACGACCAGCTGACCGGTTACGGCCAGTGGGAATACAACGTTCAGGCTAACAACACCGAGA GCTCCAGCGATCAGGCGTGGACTCGTCTGGCATTTGCTGGTCTGAAATTCGGCGACGCGGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTCTACGACGTAACTTCCTGGACTGACGTTCTGCCGGAATTCGGCGGCGACACCTACGGTTCTGACAACTTCCTGCAGTCTCGCGCTAACGGGCGTGGCAACCTACCGTAACTCTGACTTCTTCGGTCTGGTTGACGGCCTGAACTTTGCTCTGCAGTATCAGGGTAA AAACGGCAGCGTAAGCGGCGAAGGTACTTCCCCGACCAACAACGGTCGTGGCGCTCTGAAACAGAACGGCGACGGTTACGGCACCTCTCTGACCTATGATATCTACGACGGTATCAGCGCTGGTTTCGCGTACTCTCACTCCAAACGTAATGGCGATCAGAATAACCTGTCCAAAGGTCGTGGTGACAACGCTGAAACCTACACCGGTGCCTGAAATATGACGCCAACAACATCTACCTGGCGACTCAGTACACCCAGACCT ATAAATGCTACTCGTTTCAGGCGGTAGCGGTGATTCTGACTCCATCAGCGGTTTTGCTAACAAAGCGCAGAACTTCGAAGTGGTTGCTCAGTACCAGTTCGACTTCGGTCTGCGTCCGTCCGTGGCTTACCTGCAGTCCAAAGGTAAAGACATCGAAGGTTTCGGCGATCAGGATCTGCTGAAATATGTTGATGTAGGCGCGACCTACTACTTCAACAAAAACATGTCCACCTACGTTGACTACAAAATCAACCTGCTGGACGACAACG AGTTTACCCGTCGTGCCGGTATCTCTACCGACGACATCGTTGCACTGGGCCTGGTTTACCAGTTCTAA

In addition, the recombinant strain according to the present invention may be one in which a gene encoding cyclic-di-GMP phosphodiesterase is overexpressed to inhibit biofilm formation.

The cyclic-di-GMP phosphodiesterase coding gene may be mrkJ . mrkJ is a gene encoding cyclic-di-GMP phosphodiesterase and has the function of hydrolyzing cyclic-di-GMP, a messenger used for signal transmission in various bacteria. Cyclic-di-GMP is involved in cellular functions such as biofilm formation, surface adaptation, virulence, and cell cycle progression. Overexpression of cyclic-di-GMP phosphodiesterase can reduce intracellular cyclic-di-GMP concentration.

The cyclic-di-GMP phosphodiesterase coding gene mrkJ may include the sequence of SEQ ID NO: 4.

[SEQ ID NO: 4]

ATGTTAAAGAACAGTGTGAAATAGAATCCTGCAGGTTTTGTTTTAGAACCATCTTACAAAAAAGATGGTTCTATTCATTCTTGGGAAATTCTCACGAAAAGTGTTAAAAAAAAAGAACGCTAATGATTATCATGCTAATGAAGGTCTTTTTTGCTTCAGTTCGCTAAGCGATAAAGAAAAAATCGATGTGTTTAAGAGACAGATATTGACAATTGAAAAGCTTGATGCATCAAAATTGAAGTTCAAGCCCAGTTTCGTTGAATGT TGACAGTCTTATTAGCGATTGTATTTTGAACGATAAATATATTGGTGATTACTTAAAAAACCAAAAAAACATTGCTTTTGAGATTAACGAGTATTTTCATGAATTCAATACTAAATGCTGTATGGTTGACTTAAAGTGTCTTTCAAAATTGTGTCCAGTATGGCTGGATGATTTTGGAAGGGGGCTTAACAAGTTTAACAATTATTGATATGTTTAATTTTGAATGTATAAAAATTGATAAGATTATTTCTGGGAAATACAGAGTGAGAGCGAATT CTTTAAAAGAATAAATAAAATAAAATCATACTGCAATTTCGTGATTGTTGAGGGAGTTGAGACAATAGAACAAAAAAATAAAGTACATTCTGTTGTTGATTGCGCTTGCCAGGGAAGGTTGTGGATGAGTGATTACTATTATGTTGAGATTCACCACCACCACCACCACTAATAG

Whole genome analysis was performed using laboratory adaptive evolution techniques to determine the genetic cause of improved glucose consumption and cell growth, and a single nucleotide sequence change was identified on the mrkJ promoter.

Overexpression of the cyclic-D-GMP phosphodiesterase coding gene may be achieved by replacing the promoter of the cyclic-D-GMP phosphodiesterase coding gene with a promoter in which a single nucleotide sequence is substituted, thereby controlling expression under the corresponding promoter. The promoter may include the sequence of SEQ ID NO: 5.

[SEQ ID NO: 5]

TTGCATGCCGAATAATTGAAGATGAAATGATTTATTTTCTTATGATGTTATACCTATAAATGTTTAAGATGGTTTATTATCGGCATTATCATCGCAGATAAATTTCTTCGGAACCTCAGACACCTTCTCAACTAACGTTTGATATCTGGCACTAAATTATTAGTATTTAATAACACATTGATTTTATTGTGATTTATAATGAAATCATGTTTCTATTTTTACCTTTCACTTCACTTCATTTTATTTGAATTACCGATCAATTTGTG GTGTGTGATAGGTTTCGCCTATTGTTCGATCATGATCGATCATTTTAAACTATTTCTCTTTCATTTATAATTATGACACGATTAGGAATATTCTTAGTTCCGGTGTTTTTTT

In the production of 2,3-BDO through microorganisms, 2,3-BDO can be produced through sugar fermentation. In order to increase the production of 2,3-BDO, the production of by-products during the metabolic process must be reduced and the production of by-products from substrates such as sugars can be removed in a short time. A metabolic engineering approach is needed to produce the maximum amount of 2,3-BDO.

Klebsiella oxytoca for the production of 2,3-BDO may have the accession number of KCTC 1686.

The present invention, in another aspect, relates to a process for the production of 2,3-BDO comprising the following steps:

(a) cultivating the recombinant strain to produce 2,3-BDO; and

(b) recovering the produced 2,3-BDO.

The recombinant strain can be cultured in a medium containing mixed sugars derived from lignocellulosic biomass.

The lignocellulosic biomass saccharification solution includes carbon sources such as glucose that can be used by most microorganisms, but may also include carbon sources such as xylose, mannose, and galactose.

Based on this, the recombinant strain can be cultured in a medium containing mixed sugars derived from lignocellulosic biomass, for example, sugars consisting of xylose, glucose, mannose, and galactose. According to a specific example of the present invention, it was confirmed that the strain according to the present invention can efficiently produce 2,3-BDO by having improved cell growth and sugar consumption activity in a medium containing xylose, glucose, mannose, and galactose. did.

In the present invention, "introducing" a gene means that if the peptide or protein produced by the gene is not present in the host microorganism, it is artificially expressed in the host microorganism to have the activity or function of the peptide or protein.

In the present invention, "deletion" refers to preventing the gene from being expressed or showing no activity or function even if expressed through a method of mutation, substitution, or deletion of some or all bases of the gene, including the peptide or It is a concept that encompasses the modification of a protein's activity or function to be weakened compared to its intrinsic activity or function.

In the present invention, in some genes, the endogenous promoter that regulates the expression of the gene is replaced with a specific expression promoter, thereby inducing overexpression of the gene, so that the activity or function of the peptide or protein produced by the gene is changed to the endogenous activity or function. It can be modified to enhance its function.

The term “intrinsic activity or function” used in the present invention refers to the activity or function possessed by enzymes, peptides, proteins, etc. that the original microorganism has in an unmodified state.

In the present invention, "modified to enhance the intrinsic activity or function" means that a gene showing activity or function is introduced, or the copy number of the gene is increased (for example, expression using a plasmid into which the gene is introduced), the gene The activity or function of the microorganism after the manipulation is increased compared to the activity of the microorganism before the manipulation, such as deletion of the expression repression regulator or modification of the expression control sequence, for example, use of an improved promoter. means a state of being

In the present invention, “replacement” of a gene or promoter means removing a conventional gene or promoter and newly introducing a different gene (e.g., a mutant gene, etc.) or a promoter with a different strength, and removing the conventional gene or promoter. This is a concept that encompasses not only deleting the gene or promoter, but also suppressing or reducing its function.

In the present invention, "overexpression" refers to expression at a higher level than the level at which the corresponding gene is expressed in the cell under normal conditions, which means replacing the promoter of the gene present in the genome with a strong promoter or cloning the gene into an expression vector. This concept includes increasing the expression level through cell transformation.

As used herein, “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable control sequence capable of expressing the DNA in a suitable host. Vectors can be plasmids, phage particles, or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vector, “plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. A typical plasmid vector that can be used for this purpose is (a) an origin of replication that allows efficient replication to contain several to hundreds of plasmid vectors per host cell, and (b) a selection site for host cells transformed with the plasmid vector. It has a structure that includes (c) an antibiotic resistance gene that allows the DNA fragment to be inserted, and (c) a restriction enzyme cut site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method. After ligation, the vector must be transformed into an appropriate host cell. Transformation can be easily achieved using the calcium chloride method or electroporation (Neumann, et al., EMBO J., 1:841, 1982).

The promoter of the vector may be constitutive or inducible and may be further modified for the effect of the present invention. Additionally, the expression vector includes a selectable marker for selecting host cells containing the vector, and, in the case of an expression vector capable of replication, includes an origin of replication (Ori). Vectors can self-replicate or integrate into host genomic DNA. Preferably, the gene inserted into the vector and delivered is irreversibly fused into the genome of the host cell so that gene expression within the cell continues stably for a long period of time.

A base sequence is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. This may be a gene and regulatory sequence(s) linked in a way that allows gene expression when an appropriate molecule (e.g., transcriptional activation protein) is bound to the regulatory sequence(s). For example, the DNA for the pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a pre-protein that participates in secretion of the polypeptide; A promoter or enhancer is operably linked to the coding sequence if it affects transcription of the sequence; or the ribosome binding site is operably linked to the coding sequence when it affects transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence when positioned to facilitate translation. Generally, “operably linked” means that the linked DNA sequences are in contact and, in the case of a secreted leader, in contact and within reading frame. However, the enhancer need not be in contact. Linking of these sequences is accomplished by ligation at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker is used according to a conventional method.

As is well known in the art, to increase the level of expression of a transgene in a host cell, the gene must be operably linked to transcriptional and/or translational expression control sequences that are functional within the selected expression host. Preferably, the expression control sequence and/or the corresponding gene are included in a single recombinant vector that also contains a bacterial selection marker and a replication origin. When the host cell is a eukaryotic cell, the recombinant vector must further contain an expression marker useful in the eukaryotic expression host.

Host cells transformed by the above-described recombinant vector constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or by completing chromosomal integration.

Of course, it should be understood that not all vectors are equally functional in expressing the DNA sequence of the present invention. Likewise, not all hosts perform equally well for the same expression system. However, those skilled in the art can make an appropriate selection among various vectors, expression control sequences, and hosts without undue experimental burden and without departing from the scope of the present invention. For example, when choosing a vector, the host must be considered, because the vector must replicate within it. The copy number of the vector, the ability to control copy number and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In addition, the gene introduced in the present invention can be characterized as being introduced into the genome of the host cell and existing as a factor on the chromosome. For those skilled in the art to which the present invention pertains, it will be obvious that inserting the above gene into the genomic chromosome of a host cell will have the same effect as when introducing a recombinant vector into the host cell as described above.

In the present invention, specific gene names are described, but it will be apparent to those skilled in the art that the present invention is not limited to the corresponding genes.

The gene used in the present invention can be modified in various ways in the coding region within the range that does not change the amino acid sequence of the protein expressed from the coding region, and can be modified in a variety of ways without affecting the expression of the gene in parts other than the coding region. Modification or modification may be made, and such modified genes are also included within the scope of the present invention.

Accordingly, the present invention also includes polynucleotides having substantially the same base sequence as the gene and fragments of the gene. Substantially identical polynucleotide refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of sequence homology. The fragment of the gene also refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of the length of the fragment.

In addition, the amino acid sequence of the protein that is the expression product of the gene of the present invention can be obtained from various biological resources such as microorganisms to the extent that it does not affect the titer and activity of the enzyme, and proteins obtained from other biological resources can also be obtained. included within the scope of the present invention.

Accordingly, the present invention also includes polypeptides and fragments of such polypeptides having substantially the same amino acid sequence as the above proteins. Substantially identical polypeptide refers to a protein having the same function as that used in the present invention, regardless of amino acid sequence homology. The fragment of the polypeptide also refers to a protein having the same function as that used in the present invention, regardless of the length of the fragment.

Meanwhile, the gene name is also described for the gene introduced in the present invention, but the scope of protection of the present invention is not limited to the gene name, and the gene name is changed to the extent that a person skilled in the art can recognize that it has the same function as the gene. It is obvious that when a gene derived from another microorganism is introduced according to the technical features of the present invention, the corresponding recombinant strain may also fall within the scope of protection of the present invention.

Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, these examples and experimental examples are for illustrative purposes only and the scope of the present invention is not limited to these examples and experimental examples.

Example 1. Gene sequence changes formed through laboratory adaptive evolution techniques

In the present invention, in order to improve the xylose consumption ability, the Klebsiella oxytoca KCTC 1686 △ mgsA :: P _{BBa_J23118} - xylE (CHA004) strain in which the xylose transport gene xylE derived from E. coli was introduced into the sugar metabolism inhibition gene mgsA position. Additionally, adaptive laboratory evolution (ALE) was performed. Therefore, we developed the CHA004 ALE (CHA006) strain, which shows improved sugar consumption of glucose, xylose, mannose, and galactose from mixed sugars derived from lignocellulosic biomass and highly efficient 2,3-BDO production due to cell growth. Whole genome analysis was performed to determine the genetic causes of improved glucose consumption and cell growth using laboratory adaptive evolution techniques, and among several sequence changes, a frameshift due to a gene sequence deletion on the ompC gene and a frameshift on the mrkJ promoter were identified. Single nucleotide sequence changes were identified (Table 1). mrkJ is a gene encoding cyclic-di-GMP phosphodiesterase and has the function of hydrolyzing cyclic-di-GMP, a messenger used for signal transmission in various bacteria. Cyclic-di-GMP is involved in cellular functions such as biofilm formation, surface adaptation, virulence, and cell cycle progression. There are reports that overexpression of cyclic-di-GMP phosphodiesterase reduces intracellular cyclic-di-GMP concentration.

[Table 1]

[Table 2]

Example 2. ompC Verification of sugar consumption activity in gene-deleted strains

In the present invention, we sought to determine whether changes in two types of gene sequences had a beneficial effect on sugar consumption. CHA156 (CHA004 △ ompC ) was developed by removing ompC from the CHA004 strain genome. The initial cell density (Optical Density at 600 nm, OD ₆₀₀ ) of strains CHA004, CHA006, and CHA156 in medium containing 20 g/L of xylose, glucose, mannose, and galactose, and 100 μg/mL ampicillin in common, was 0.05. Flask culture was performed at 37°C and 200 rpm. In all culture conditions, the CHA156 strain showed inferior results compared to the CHA006 strain, but produced 2,3-BDO efficiently by having relatively improved cell growth and sugar consumption activity compared to the CHA004 strain. This showed that ompC deletion had a beneficial effect on the ability to consume four types of sugars (Figures 1-4).

Example 3. mrkJ Effect of a single nucleotide sequence change in the promoter mrkJ Transcription amount change

In the present invention, we attempted to determine whether the CHA006 strain, which has various nucleotide sequence changes, changes the transcription amount of mrkJ due to a single nucleotide sequence change on the mrkJ promoter through laboratory adaptive evolution techniques in the CHA004 strain. CHA004 and CHA006 strains were cultured in flasks at 30°C and 200 rpm with an initial cell density (Optical Density at 600 nm, OD ₆₀₀ ) of 0.05 in a medium containing xylose and 25 μg/mL kanamycin at a concentration of 20 g/L. carried out. After 6 hours of culture, the cells were harvested at OD ₆₀₀ = 2 and total mRNA was extracted. mrkA is a gene involved in type 3 fimbriae and biofilm formation. Quantitative real time polymerase chain reaction (qRT-PCR) was performed using primers that specifically bind to mrkJ , mrkA , and 16S rRNA listed in Table 3. The 16S rRNA gene was used as an internal control.

[Table 3]

Using the above method, the amount of mrkJ transcript was compared to the CHA004 strain. It was shown to be significantly increased by about 2.1 times in CHA006 (Figure 5a). The amount of mrkA transcript in CHA006 was reduced to about 0.2-fold compared to the CHA004 strain (Figure 5b). Therefore, the CHA006 strain was expected to form a lower biofilm than the CHA004 strain.

Example 4. Wild-type sequence mrkJ and the evolved sequence mrkJ Recombinant plasmid construction and recombinant plasmids mrkJ Comparison of transcription amount

In the present invention, the mrkJ gene expression system was constructed in the pBAD33 plasmid under the mrkJ promoter of the wild-type sequence and the mrkJ promoter of the evolved sequence in the CHA004 strain, and the effect of a single nucleotide sequence change at the plasmid level on the mrkJ transcription level was attempted. PCR product containing the mrkJ promoter and mrkJ gene sequence through polymerase chain reaction (PCR) from the Klebsiella oxytoca genome using primers F-native P-mrkJ and R-mrkJ-his-XbaI described in Table 4 below. got it The PCR product and pBAD33 shown in Table 5 below were digested with restriction enzymes Sph I and Xba I and then ligated.

[Table 4]

[Table 5]

In the present invention, a schematic diagram of the pBAD33 plasmid-based wild-type and evolved mrkJ expression systems is shown in Figure 6a. The recombinant plasmid was transformed into the CHA004 strain to develop CHA253 (CHA004 pBAD33-P _{wild type} - mrkJ ) and CHA257 (CHA004 pBAD33-P _{evolved type} - mrkJ ) strains. The transformed strain was cultured in a flask at 30°C and 200 rpm with an initial cell density of OD ₆₀₀ = 0.05 in a medium containing 20 g/L xylose and 25 μg/mL chloramphenicol. After 6 hours of culture, the cells were harvested at OD ₆₀₀ = 2 and total mRNA was extracted. Quantitative real time polymerase chain reaction (qRT-PCR) was performed using primers that specifically bind to mrkJ and 16S rRNA listed in Table 3. The 16S rRNA gene was used as an internal control.

As a result of the above results, a single nucleotide sequence change on the plasmid-based mrkJ promoter increased the level of mrkJ transcription by about 3.6 times in the CHA257 strain compared to CHA253 (FIG. 6b).

Example 5. ompC fruition and mrkJ Verification of biofilm formation in overexpression strains

In the present invention, to confirm the degree of biofilm formation according to the mrkJ expression level in the ompC deleted strain, CHA268 and CHA269 strains were developed by transforming the CHA156 strain with pBAD33-P _{wild type} - mrkJ and pBAD33-P _{evolved type} - mrkJ , respectively. . And as a control, empty vector pBAD33 was introduced into CHA004 and CHA006 strains, respectively, to develop CHA264 and CHA267 strains. The transformed strains were cultured in tubes for 23 hours at 30°C and 200 rpm at an initial cell density of OD ₆₀₀ = 0.05 in a medium containing 20 g/L xylose and 25 μg/mL chloramphenicol. The biofilm formed on the tube wall was stained with 0.1% (v/v) crystal violet, dissolved in DMSO, and absorbance was measured at 595 nm. The results are shown in Figure 7. CHA267 showed significantly reduced biofilm formation compared to CHA264, and as shown in FIG. 6b, CHA269, which showed high expression of mrkJ due to a single nucleotide sequence change on a plasmid basis, showed significantly reduced biofilm formation than CHA268.

Example 6. ompC Deletion and plasmid based mrkJ Verification of cell growth and glucose consumption activity following overexpression

In the present invention, we sought to confirm cell growth, mixed sugar consumption ability, and 2,3-BDO productivity due to reduced biofilm formation in a medium containing lignocellulosic biomass saccharification solution. As a control, the CHA270 strain was developed by introducing the empty vector pBAD33 into the CHA156 strain. CHA269 and CHA270 strains were cultured in flasks at 37°C and 200 rpm for 13 hours at an initial cell density of OD ₆₀₀ = 0.05 in a medium containing 20 g/L pine saccharification solution, 100 μg/mL ampicillin, and 25 μg/mL chloramphenicol. carried out. As a result of observing cell growth (OD ₆₀₀ ) from suspended cells in culture, CHA269 showed higher cell growth than CHA270 (Figure 8). In addition, as shown in Table 6 below, CHA269 has higher maximum cell growth (Max. cell density), total sugar consumption rate, and 2,3-BDO productivity (2,3-Butanediol titer, yield, productivity) than CHA270. ) all showed improvement.

[Table 6]

Based on the above results, ompC deletion and plasmid-based mrkJ overexpression improved the consumption ability of mixed sugars derived from lignocellulosic biomass, enabling high-speed cell growth and high-efficiency production of 2,3-BDO.

The contents of the present invention have been described in detail above. The ompC deletion and mrkJ overexpression strains obtained in the present invention are expected to be universally used in various strain improvement studies. It is expected that it can be used in research to develop strains capable of high-speed cell growth and high-efficiency production of 2,3-BDO by improving the consumption ability of mixed sugars derived from lignocellulosic biomass.

As above, specific parts of the content of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. It will be obvious. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (12)

In a Klebsiella oxytoca strain into which a gene encoding a xylose transporter has been introduced, the gene encoding an outer membrane porin protein is deleted, or the expression of the gene is reduced or suppressed, Recombinant strain with improved 2,3-butanediol production ability. The recombinant strain according to claim 1, wherein the gene encoding the xylose transporter is an xylE gene derived from E. coli. The recombinant strain according to claim 1, wherein the gene encoding the xylose transporter is introduced into the mgsA position of the sugar metabolism inhibition gene in Klebsiella oxytoca. The recombinant strain according to claim 1, wherein the gene encoding the outer membrane porin is ompC . The recombinant strain according to claim 1, wherein the gene encoding cyclic-di-GMP phosphodiesterase is additionally overexpressed. The recombinant strain according to claim 5, wherein the cyclic-di-GMP phosphodiesterase coding gene is mrkJ . The recombinant strain according to claim 5, wherein the promoter of the cyclic-D-GMP phosphodiesterase coding gene is replaced with a promoter in which a single nucleotide sequence is substituted, thereby overexpressing the cyclic-D-GMP phosphodiesterase coding gene. The recombinant strain according to claim 7, wherein the promoter in which the single nucleotide sequence is substituted includes the sequence of SEQ ID NO: 5. The recombinant strain according to claim 1, wherein the Klebsiella oxytoca has an accession number of KCTC 1686. Method for producing 2,3-BDO comprising the following steps:
(a) cultivating the recombinant strain of any one of claims 1 to 9 to produce 2,3-BDO; and
(b) recovering the produced 2,3-BDO. The production method according to claim 10, wherein the recombinant strain is cultured in a medium containing mixed sugars derived from lignocellulosic biomass. The production method according to claim 11, wherein the mixed sugar derived from lignocellulosic biomass includes sugar composed of xylose, glucose, mannose, and galactose.