KR20240001048A - E. coli fimh mutants and uses thereof - Google Patents

Abstract

The present disclosure results in improved biochemical properties and immunogenicity. It relates to the design of E. coli mutated FimH polypeptides, compositions comprising such polypeptides, and uses thereof.

Description

this. E. coli FimH mutants and uses thereof {E. COLI FIMH MUTANTS AND USES THEREOF}

The present disclosure relates to mutated Escherichia coli FimH polypeptides and methods of using the same.

Urinary tract infections (UTIs) affect one in five women at least once in their lifetime and cause significant morbidity and mortality, placing a significant burden on healthcare systems. Several different bacteria can cause UTIs, but the most common cause (90-95% of cases) is the Gram-negative bacterium Escherichia coli ( E. coli ). Most of these. coli UTI is a uropathogenic coli (UPEC), which colonizes the gastrointestinal tract and migrates from the fecal flora to the urogenital tract, adhering to host urothelial cells and establishing a reservoir for ascending infection of the urinary tract. Adhesion is promoted by fimbria adhesins, including type 1 fimbria, which bind to mannosylated glycoproteins in the epithelial layer or are secreted into the urine. Type 1 fimbria are highly conserved among clinical UPEC isolates and are encoded by a gene cluster called fim, which consists of accessory proteins (FimC, FimD), various structural subunits (FimE, FimF, FimG), and an adduct called FimH. Code God. FimH is essential for all features of UTI infection in a mouse model that mimics aspects of human bladder infection (Hannan et al. PLoS Pathog. 2010 Aug 12;6(8):e1001042; doi: 10.1371/journal.ppat.1001042; Schwartz et al. Infect Immun. 2011 Oct;79(10):4250-9. doi: 10.1128/IAI.05339-11). Small molecule inhibitors that target FimH by mimicking mannosylated receptors further validate the role of FimH in UTI and show promise as therapeutic agents in animal models (Cusumano CK, et al. Sci Transl Med. 2011;3( 109):109ra115.doi:10.1126/scitranslmed.3003021). Additionally, FimH is E. coli human cystitis isolates are under positive selection (Chen SL, et al. Proc Natl Acad Sci US A. 2009 Dec 29;106(52):22439-44. doi: 10.1073/pnas.0902179106), and the positively selected residues are May affect toxicity in mouse models of cystitis (Schwartz, DJ et al. Proc Natl Acad Sci USA 110, 15530-15537, doi:10.1073/pnas.1315203110 (2013)).

FimH consists of two domains: a lectin binding domain (FimH _LD ) and a pilin domain, which are responsible for binding to mannosylated glycoproteins. The pilin domain serves to link FimH to other structural subunits of the pilus, such as FimG, through a mechanism called donor strand exchange (Le Trong, I et al., J. Struct Biol. 2010 Dec;172(3) :380-8.doi: 10.1016/j.jsb.2010.06.002). The FimH pilin domain forms an incomplete immunoglobulin fold, creating a groove that provides a binding site for the N-terminal β-strand of FimG, forming a strong intermolecular link between FimH and FimG. FimH _LD can be expressed in a soluble, stable form, but full-length FimH is unstable alone unless in complex with the chaperone FimC or complemented with a donor strand peptide of FimG in peptide form or as a fusion protein (Vetsch, M., et al. al. et al., Proc Natl Acad Sci US A. (2000) Jul 5;97(14):7709-14; Sauer MM, et al. Nat Commun. (2016) Mar 7;7:10738; Barnhart MM, et al. J Bacteriol. 2003 May;185(9):2723-30). The design and expression of a full-length FimH molecule by linking the FimG donor peptide to full-length FimH via a glycine-serine linker has been described previously (PCT International Publication No. WO2021/084429, published 6 May 2021) and designated FimH-DSG. do.

FimH _LD is believed to be a poor immunogen in terms of its ability to stimulate functional immunogenicity. Some studies suggest that binding antibody titers can be derived with FimH _LD with and without adjuvant, but functional neutralizing titers were observed only in the presence of adjuvant (PCT International Publication No. WO2021/084429, May 6, 2021 day open). Studies suggest that locking FimH in an open conformation with reduced affinity for mannoside ligands improves functional immunogenicity (Kisiela, DI et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013 ). Accordingly, there is a need in the art for novel FimH mutants with reduced affinity for mannoside ligands and improved biochemical properties resulting in improved functional immunogenicity compared to wild-type FimH.

The present disclosure results in improved biochemical properties and immunogenicity. It relates to the design of E. coli FimH mutated polypeptides, compositions comprising such polypeptides, and uses thereof. For example, in one aspect, the disclosure provides a mutated FimH polypeptide comprising at least one amino acid mutation relative to the amino acid sequence of a wild-type FimH polypeptide, wherein the mutation positions are F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129, It is selected from the group consisting of Q133, F144, V154, V155, V156, P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59.

In a further aspect, it is a mutated FimH polypeptide comprising at least one mutation selected from the group consisting of: F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; P26C; V27A; V27C; V28C; Q32C; N33C; L34C; L34N; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; L107C; Y108C; L109C; V112C; S113C; A115V; G116C; V118C; A119C; A119N; A119S; A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; V163I; and V185I, or any combination thereof. For example, mutated FimH polypeptides including mutations G15A and G16A. Additionally, mutated FimH polypeptides, including, for example, mutations P12C and A18C. Additionally, mutated FimH polypeptides, including, for example, mutations G14C and F144C. Additionally, mutated FimH polypeptides, including, for example, mutations P26C and V35C. Additionally, mutated FimH polypeptides, including, for example, mutations P26C and V154C. Additionally, mutated FimH polypeptides, including, for example, mutations P26C and V156C. Additionally, mutated FimH polypeptides, including, for example, mutations V27C and L34C. Additionally, mutated FimH polypeptides, including, for example, mutations V28C and N33C. Additionally, mutated FimH polypeptides, including, for example, mutations V28C and P157C. Additionally, mutated FimH polypeptides, including, for example, mutations Q32C and Y108C. Additionally, mutated FimH polypeptides, including, for example, mutations N33C and L109C. Additionally, mutated FimH polypeptides, including, for example, mutations N33C and P157C. Additionally, mutated FimH polypeptides, including, for example, mutations V35C and L107C. Additionally, mutated FimH polypeptides, including, for example, mutations V35C and L109C. Additionally, mutated FimH polypeptides, including, for example, mutations S62C and T86C. Additionally, mutated FimH polypeptides, including, for example, mutations S62C and L129C. Additionally, mutated FimH polypeptides, including, for example, mutations Y64C and L68C. Additionally, mutated FimH polypeptides, including, for example, mutations Y64C and A127C. Additionally, mutated FimH polypeptides, including, for example, mutations L68C and F71C. Additionally, mutated FimH polypeptides, including, for example, mutations V112C and T158C. Additionally, mutated FimH polypeptides, including, for example, mutations S113C and G116C. Additionally, mutated FimH polypeptides, including, for example, mutations S113C and T158C. Additionally, mutated FimH polypeptides, including, for example, mutations V118C and V156C. Additionally, mutated FimH polypeptides, including, for example, mutations A119C and V155C. Additionally, mutated FimH polypeptides, including, for example, mutations L34N and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34S and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34T and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34D and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34E and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34K and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations L34R and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119N and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119S and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119T and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119D and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119E and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119K and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations A119R and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G15A and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G16A and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G15P and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G16P and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G15A, G16A and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations G65A and V27A. Additionally, mutated FimH polypeptides, including, for example, mutations V27A and Q133K. Additionally, mutated FimH polypeptides, including, for example, mutations G15A, G16A, V27A and Q133K. Additionally, for example, a mutated FimH polypeptide comprising the sequence of any of SEQ ID NOs: 2-58 and 60-64. Additionally, for example, a mutated FimH polypeptide disclosed herein, wherein the polypeptide is isolated.

In a further example, the present disclosure provides a pharmaceutical composition comprising (i) a mutated FimH polypeptide as disclosed herein and (ii) a pharmaceutically acceptable carrier.

In a further example, the present disclosure provides an immunogenic composition comprising a mutated FimH polypeptide as disclosed herein. For example, the immunogenic composition further comprises at least one additional antigen, such as a polysaccharide, or glycoconjugate, or protein. Additionally, for example, the immunogenic composition further comprises at least one adjuvant.

In a further example, the present disclosure provides a nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence of a mutated FimH polypeptide as disclosed herein.

In a further example, the disclosure provides a mutated FimH polypeptide as disclosed herein, wherein the polypeptide is immunogenic.

The disclosure further provides recombinant mammalian cells comprising a polynucleotide encoding a mutated FimH polypeptide as disclosed herein.

The disclosure further provides a culture comprising a recombinant cell as disclosed herein, wherein the culture is at least 5 liters, at least 10 liters, at least 20 liters, at least 50 liters, at least 100 liters, at least 200 liters, at least 500 liters, at least 1000 liters, or at least 2000 liters.

The present disclosure includes culturing a recombinant mammalian cell as disclosed herein under suitable conditions, thereby expressing a polypeptide; A method of producing a mutated FimH polypeptide as disclosed herein is further provided, comprising harvesting the polypeptide.

The present disclosure addresses (i) extraintestinal pathogenic E. coli in a subject. E. coli, or (ii) extraintestinal pathogenic E. coli in the subject. A method of inducing production of opsonophagocytic and/or neutralizing antibodies specific for E. coli is further provided, wherein the method comprises administering to a subject an effective amount of a composition as disclosed herein. In one example, the subject is at risk of developing a urinary tract infection. In a further example, the subject is at risk of developing bacteremia. In a further example, the subject is at risk of developing sepsis. In another example, the subject is at risk of developing Crohn's disease.

The present disclosure includes administering to the mammal an effective amount of a composition as disclosed herein. A method for eliciting an immune response against E. coli is additionally provided. In one example, the immune response is lice. Opsonophagocytic and/or neutralizing antibodies against E. coli. In a further example, the immune response is lice. Protects mammals from coli infection.

The present disclosure further provides a method of preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject comprising administering to the subject an immunologically effective amount of a composition as disclosed herein.

Figures 1A-1B show circular dichroism spectra of FimH _LD and FimH-DSG mutants. Figure 1a shows a circular dichroism spectrum in the near-ultraviolet region, and Figure 1b shows a circular dichroism spectrum in the far-ultraviolet region.
Figure 2 shows the relative immunogenicity of FimH _LD mutants in a yeast mannan neutralization assay in PD3.
Figures 3A-3B show the immunogenicity of FimH _LD and FimH-DSG mutants in yeast mannan neutralization assays on PD2 (Figure 3A) and PD3 (Figure 3B).
Figure 4 is a diagram showing the major purification steps utilized for the isolation of wild-type and mutated forms of His-tagged FimH-DsG.
Figures 5A-5B show the purification profile of FimH-DSG WT. Figure 5a is the elution profile of FimH-DSG WT on a SP-Sepharose column and Figure 5b is SDS-PAGE analysis of the eluted fraction.
Figures 6A-6B show the purification profile of FimH-DSG G15A G16A V27A mutant. Figure 6a shows the elution profile of FimH-DSG G15A G16A V27A mutant on SP-Sepharose column, and Figure 6b shows SDS-PAGE analysis of the eluted fraction.
Figures 7A-7B show analytical SEC of FimH-DSG protein. The analytical SEC of FimH-DSG G15A G16A V27A is shown in Figure 7A, and the analytical SEC of wild-type FimH-DSG WT is shown in Figure 7B.
Figure 8 shows a schematic diagram of the FimH HMW complex formation mechanism.
Figure 9 shows the immunization schedule for non-human primates and subsequent challenge described in Example 21 herein.
Figure 10 shows FimH-DSG G15A G16A V27A mutant + tetravalent E. Shows elevation of O-antigen serotype-specific antibodies following vaccination of NHP with E. coli O-antigens (O1a, O2, O6 and O25b). Legend: Placebo (circles); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A + tetravalent O-antigen (triangle).
Figures 11A - 11B show that immunization with FimH-DSG G15A G16A V27A +/- 4plex O-antigen elicits a strong functional anti-FimH antibody response. Figure 11A shows the results of the direct Luminex FimH IgG assay, and Figure 11B shows the results. The results of the E. coli binding inhibition assay are shown. As used herein, the term “4plex” has the same meaning and is interchangeable with the term “tetravalent.”
Figure 12 shows reduced bacteriuria in vaccinated non-human primates (NHP) following challenge as described in Example 21. Legend: Placebo (circles); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A + tetravalent O-antigen (triangle); *p ≤ 0.007 compared to placebo group.
Figures 13A-13C are the biographies of infections in vaccinated NHPs after challenge with three groups: placebo, FimH-DSG G15A G16A V27A alone and FimH-DSG G15A G16A V27A + tetravalent O-antigen as described in Example 21. It shows that the marker is decreasing. Figure 13A shows quantification of MPO in urine, Figure 13B shows quantification of IL-8 in urine, and Figure 13C shows the percentage of animals with increased PMN in urine sediment. Legend: Placebo (circles); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A + tetravalent O-antigen (triangle).

sequence identifier

SEQ ID NO: 1 is wild type. The amino acid sequence for E. coli FimH _LD (FimHLD_WT) is presented.

SEQ ID NO: 2 is mutant E. The amino acid sequence for E. coli FimHLD_G65A_V27A is presented.

SEQ ID NO: 3 is mutant E. The amino acid sequence for E. coli FimHLD_F1I is presented.

SEQ ID NO: 4 is mutant E. The amino acid sequence for E. coli FimHLD_F1L is presented.

SEQ ID NO: 5 is mutant E. The amino acid sequence for E. coli FimHLD_F1V is presented.

SEQ ID NO: 6 is mutant E. The amino acid sequence for E. coli FimHLD_F1M is presented.

SEQ ID NO: 7 is mutant E. The amino acid sequence for E. coli FimHLD_F1Y is presented.

SEQ ID NO: 8 is mutant E. The amino acid sequence for E. coli FimHLD_F1W is presented.

SEQ ID NO: 9 is mutant E. The amino acid sequence for E. coli FimHLD_Q133K is presented.

SEQ ID NO: 10 is mutant E. The amino acid sequence for E. coli FimHLD_G15A is presented.

SEQ ID NO: 11 is mutant E. The amino acid sequence for E. coli FimHLD_G15P is presented.

SEQ ID NO: 12 is mutant E. The amino acid sequence for E. coli FimHLD_G16A is presented.

SEQ ID NO: 13 is mutant E. The amino acid sequence for E. coli FimHLD_G16P is presented.

SEQ ID NO: 14 is mutant E. The amino acid sequence for E. coli FimHLD_G15A_G16A is presented.

SEQ ID NO: 15 is mutant E. The amino acid sequence for E. coli FimHLD_R60P is presented.

SEQ ID NO: 16 is mutant E. The amino acid sequence for E. coli FimHLD_G65A is presented.

SEQ ID NO: 17 is mutant E. The amino acid sequence for E. coli FimHLD_P12C_A18C is presented.

SEQ ID NO: 18 is mutant E. The amino acid sequence for E. coli FimHLD_G14C_F144C is presented.

SEQ ID NO: 19 is mutant E. The amino acid sequence for E. coli FimHLD_P26C_V35C is presented.

SEQ ID NO: 20 is mutant E. The amino acid sequence for E. coli FimHLD_P26C_V154C is presented.

SEQ ID NO: 21 is mutant E. The amino acid sequence for E. coli FimHLD_P26C_V156C is presented.

SEQ ID NO: 22 is mutant E. The amino acid sequence for E. coli FimHLD_V27C_L34C is presented.

SEQ ID NO: 23 is mutant E. The amino acid sequence for E. coli FimHLD_V28C_N33C is presented.

SEQ ID NO: 24 is mutant E. The amino acid sequence for E. coli FimHLD_V28C_P157C is presented.

SEQ ID NO: 25 is mutant E. The amino acid sequence for E. coli FimHLD_Q32C_Y108C is presented.

SEQ ID NO: 26 is mutant E. The amino acid sequence for E. coli FimHLD_N33C_L109C is presented.

SEQ ID NO: 27 is mutant E. The amino acid sequence for E. coli FimHLD_N33C_P157C is presented.

SEQ ID NO: 28 is mutant E. The amino acid sequence for E. coli FimHLD_V35C_L107C is presented.

SEQ ID NO: 29 is mutant E. The amino acid sequence for E. coli FimHLD_V35C_L109C is presented.

SEQ ID NO: 30 is mutant E. The amino acid sequence for E. coli FimHLD_S62C_T86C is presented.

SEQ ID NO: 31 is mutant E. The amino acid sequence for E. coli FimHLD_S62C_L129C is presented.

SEQ ID NO: 32 is mutant E. The amino acid sequence for E. coli FimHLD_Y64C_L68C is presented.

SEQ ID NO: 33 is mutant E. The amino acid sequence for E. coli FimHLD_Y64C_A127C is presented.

SEQ ID NO: 34 is mutant E. The amino acid sequence for E. coli FimHLD_L68C_F71C is presented.

SEQ ID NO: 35 is mutant E. The amino acid sequence for E. coli FimHLD_V112C_T158C is presented.

SEQ ID NO: 36 is mutant E. The amino acid sequence for E. coli FimHLD_S113C_G116C is presented.

SEQ ID NO: 37 is mutant E. The amino acid sequence for E. coli FimHLD_S113C_T158C is presented.

SEQ ID NO: 38 is mutant E. The amino acid sequence for E. coli FimHLD_V118C_V156C is presented.

SEQ ID NO: 39 is mutant E. The amino acid sequence for E. coli FimHLD_A119C_V155C is presented.

SEQ ID NO: 40 is mutant E. The amino acid sequence for E. coli FimHLD_L34N_V27A is presented.

SEQ ID NO: 41 is mutant E. The amino acid sequence for E. coli FimHLD_L34S_V27A is presented.

SEQ ID NO: 42 is mutant E. The amino acid sequence for E. coli FimHLD_L34T_V27A is presented.

SEQ ID NO: 43 is mutant E. The amino acid sequence for E. coli FimHLD_A119N_V27A is presented.

SEQ ID NO: 44 is mutant E. The amino acid sequence for E. coli FimHLD_A119S_V27A is presented.

SEQ ID NO: 45 is mutant E. The amino acid sequence for E. coli FimHLD_A119T_V27A is presented.

SEQ ID NO: 46 is mutant E. The amino acid sequence for E. coli FimH-DSG_A115V is presented.

SEQ ID NO: 47 is mutant E. The amino acid sequence for E. coli FimH-DSG_V163I is presented.

SEQ ID NO: 48 is mutant E. The amino acid sequence for E. coli FimH-DSG_V185I is presented.

SEQ ID NO: 49 is mutant E. The amino acid sequence for E. coli FimH-DSG_DSG_V3I is presented.

SEQ ID NO: 50 is mutant E. The amino acid sequence for E. coli FimHLD_G15A_V27A is presented.

SEQ ID NO: 51 is mutant E. The amino acid sequence for E. coli FimHLD_G16A_V27A is presented.

SEQ ID NO: 52 is mutant E. The amino acid sequence for E. coli FimHLD_G15P_V27A is presented.

SEQ ID NO: 53 is mutant E. The amino acid sequence for E. coli FimHLD_G16P_V27A is presented.

SEQ ID NO: 54 is mutant E. The amino acid sequence for E. coli FimHLD_G15A_G16A_V27A is presented.

SEQ ID NO: 55 is mutant E. The amino acid sequence for E. coli FimHLD_V27A_R60P is presented.

SEQ ID NO: 56 is mutant E. The amino acid sequence for E. coli FimHLD_G65A_V27A is presented.

SEQ ID NO: 57 is mutant E. The amino acid sequence for E. coli FimHLD_V27A_Q133K is presented.

SEQ ID NO: 58 is mutant E. The amino acid sequence for E. coli FimHLD_G15A_G16A_V27A_Q133K is presented.

SEQ ID NO: 59 is a wild type E. coli comprising a donor strand FimG peptide linked via a linker. The amino acid sequence for full-length E. coli FimH (FimH-DSG_WT) is presented.

SEQ ID NO: 60 is mutant E. The amino acid sequence for E. coli FimH-DSG_V27A is presented.

SEQ ID NO: 61 is mutant E. The amino acid sequence for E. coli FimH-DSG_G15A_V27A is presented.

SEQ ID NO: 62 is mutant E. The amino acid sequence for E. coli FimH DSG_G15A_G16A_V27A is presented.

SEQ ID NO: 63 is mutant E. The amino acid sequence for E. coli FimH DSG_V27A_Q133K is presented.

SEQ ID NO: 64 is mutant E. The amino acid sequence for E. coli FimH DSG_G15A_G16A_V27A_Q133K is presented.

SEQ ID NO: 65 presents the amino acid sequence for the mouse Ig kappa signal peptide sequence.

SEQ ID NOs: 66 - 108 present amino acid and nucleic acid sequences for nanostructure-related polypeptides or fragments thereof.

SEQ ID NO: 109 - Primer for PCR.

SEQ ID NO: 110 - Primer for PCR.

SEQ ID NO: 111 - Probe for PCR.

SEQ ID NO: 112 presents the O25b 2401 WzzB amino acid sequence.

SEQ ID NO: 113 presents the O25a:K5:H1 WzzB amino acid sequence.

SEQ ID NO: 114 presents the O25a ETEC ATCC WzzB amino acid sequence.

SEQ ID NO: 115 presents the K12 W3110 WzzB amino acid sequence.

SEQ ID NO: 116 presents the Salmonella LT2 WzzB amino acid sequence.

SEQ ID NO: 117 presents the O25b 2401 FepE amino acid sequence.

SEQ ID NO: 118 presents the O25a:K5:H1 FepE amino acid sequence.

SEQ ID NO: 119 presents the O25a ETEC ATCC FepE amino acid sequence.

SEQ ID NO: 120 presents the O157 FepE amino acid sequence.

SEQ ID NO: 121 presents the Salmonella LT2 FepE amino acid sequence.

SEQ ID NO: 122 presents the primer sequence for LT2wzzB_S.

SEQ ID NO: 123 presents the primer sequence for LT2wzzB_AS.

SEQ ID NO: 124 presents the primer sequence for O25bFepE_S.

SEQ ID NO: 125 presents the primer sequence for O25bFepE_A.

SEQ ID NO: 126 presents the primer sequence for wzzB P1_S.

SEQ ID NO: 127 presents the primer sequence for wzzB P2_AS.

SEQ ID NO: 128 presents the primer sequence for wzzB P3_S.

SEQ ID NO: 129 presents the primer sequence for wzzB P4_AS.

SEQ ID NO: 130 presents the primer sequence for O157 FepE_S.

SEQ ID NO: 131 presents the primer sequence for O157 FepE_AS.

SEQ ID NO: 132 presents the primer sequence for pBAD33_adaptor_S.

SEQ ID NO: 133 presents the primer sequence for pBAD33_adaptor_AS.

SEQ ID NO: 134 presents the primer sequence for JUMPSTART_r.

SEQ ID NO: 135 presents the primer sequence for gnd_f.

SEQ ID NO: 136 presents the amino acid sequence for the human IgG receptor FcRn large subunit p51 signal peptide.

SEQ ID NO: 137 presents the amino acid sequence for the human IL10 protein signal peptide.

SEQ ID NO: 138 presents the amino acid sequence for the human respiratory syncytial virus A (strain A2) fusion glycoprotein F0 signal peptide.

SEQ ID NO: 139 presents the amino acid sequence for the influenza A hemagglutinin signal peptide.

SEQ ID NO: 140-147 presents SignalP 4.1 (DTU Bioinformatics) sequences from various species used for signal peptide prediction.

details

This disclosure is: E. coli FimH mutated polypeptides (mutants), compositions comprising FimH mutants, methods for producing and purifying FimH mutants, nucleic acids encoding FimH mutants, host cells comprising such nucleic acids, and compositions comprising FimH mutants. It relates to methods of using the composition.

Recitation of ranges of values herein merely serves as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., “such as”) provided herein is merely to further explain the disclosure and does not limit the scope of the claims. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the disclosure.

Several documents are cited throughout the text of this disclosure. Each document cited herein above or below (including all patents, patent applications, scientific publications, manufacturers' specifications, instructions, etc.) is hereby incorporated by reference in its entirety. Nothing herein should be construed as an admission that this disclosure is not entitled to antedate such disclosure.

Justice

As used herein, the term “about” means approximately or approximately, and in one embodiment, within the context of a numerical value or range set forth herein, ±20%, ±10%, ±20% of the numerical value or range recited or claimed. It means 5%, or ± 3%.

As used in the context of describing the disclosure (and especially in the context of the claims), singular terms and similar referents are to be construed to encompass both the singular and the plural, unless otherwise indicated herein or unless clearly contradictory from context. .

“Fragment” in relation to an amino acid sequence (peptide or protein) refers to a sequence that represents a portion of the amino acid sequence, i.e. an amino acid sequence shortened at the N-terminus and/or C-terminus. Fragments shortened at the C-terminus (N-terminal fragments) can be obtained, for example, by translation of a truncated open reading frame lacking the 3'-end of the open reading frame. A fragment shortened at the N-terminus (C-terminal fragment) lacks the 5'-end of the open reading frame, for example, as long as the truncated open reading frame contains the start codon, which is responsible for initiating translation. Obtainable by translation of a truncated open reading frame. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the amino acid residues from the amino acid sequence. The fragment of the amino acid sequence preferably comprises at least 6, especially at least 8, at least 12, at least 15, at least 20, at least 30, at least 50 or at least 100 consecutive amino acids from the amino acid sequence.

As used herein, the term “wild type” or “WT” or “native” refers to an amino acid sequence found in nature, including allelic variation. A wild-type amino acid sequence, peptide, or protein has an amino acid sequence that has not been intentionally modified.

As used herein, reference to a “variant”, or “mutant”, or “mutated” polypeptide of an amino acid sequence (peptide, protein or polypeptide) includes amino acid insertion variants/mutants, amino acid addition variants/mutants. , amino acid deletion variants/mutants and/or amino acid substitution variants/mutants. The term “variant” or “mutant” includes all mutants, splice variants, post-translationally modified variants, conformational, isoform, allelic variants, species variants and species homologs, especially those that occur naturally. The term “variant” or “mutant” includes, inter alia, fragments of amino acid sequences.

Amino acid insertion variants involve the insertion of a single or two or more amino acids in a specific amino acid sequence. For amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific sites in the amino acid sequence, but random insertions are also possible with appropriate screening of the resulting products. Amino acid addition variants include amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. The deletion can be anywhere in the protein. Amino acid deletion variants comprising deletions in the N-terminal and/or C-terminal ends of the protein are also referred to as N-terminal and/or C-terminal truncation variants. Amino acid substitution variants are characterized by the removal of at least one residue from the sequence and the insertion of another residue in its place. It is desirable to modify and/or replace amino acids at positions in the amino acid sequence that are not conserved between homologous proteins or peptides with others having similar properties. Preferably, the amino acid changes in peptide and protein variants are conservative amino acid changes, i.e. substitutions of similarly charged or uncharged amino acids. Conservative amino acid changes involve substitution of one of a family of amino acids related to their side chain. Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and Uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified together as aromatic amino acids. In one embodiment, conservative amino acid substitutions include substitutions within the following groups:

glycine, alanine;

Valine, isoleucine, leucine;

Aspartic acid, glutamic acid;

Asparagine, glutamine;

serine, threonine;

lysine, arginine; and

Phenylalanine, tyrosine.

Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of the given amino acid sequence is at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%. , 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. The degree of similarity or identity is preferably at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70% of the total length of the reference amino acid sequence. , at least about 80%, at least about 90%, or about 100% of the amino acid region. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, or at least about 140, at least about 160, at least about 180, or about 200 amino acids, and in some embodiments, consecutive amino acids. In some embodiments, the degree of similarity or identity is provided over the entire length of the reference amino acid sequence. Alignments to determine sequence similarity, preferably sequence identity, are performed using tools known in the art, preferably using the best sequence alignment, for example using Align, a standard set, preferably EMBOSS. This can be done using ::needle, matrix: Blosum62, gap opening 10.0, gap extension 0.5.

As used herein, “sequence similarity” refers to the percentage of amino acids that are identical or exhibit conservative amino acid substitutions. “Sequence identity” between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. “Sequence identity” between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

The terms “% identical,” “% identity,” or similar terms are intended to refer, inter alia, to the percentage of nucleotides or amino acids that are identical in an optimal alignment between the sequences being compared. The above percentages are purely statistical and the differences between two sequences may, but need not, be randomly distributed over the entire length of the sequences being compared. Comparison of two sequences is usually performed by comparing the sequences after optimal alignment over a segment or “comparison window” to identify local regions of corresponding sequences. Optimal alignment for comparison can be done manually or as described in Smith and Waterman, 1981, Ads App. Math. 2, 482], with the help of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443], with the help of the local homology algorithm [Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444], or with the help of a computer program using such algorithms (Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, WI, USA) It can be performed with the help of GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA). In some embodiments, the percent identity of two sequences can be determined from the National Center for Biotechnology Information (NCBI) website (e.g., blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq). Determined using available BLASTN or BLASTP algorithms. In some embodiments, the algorithm parameters used in the BLASTN algorithm on the NCBI website include: (i) the expected threshold is set to 10; (ii) word size set to 28; (iii) the maximum match in the query range is set to 0; (iv) match/mismatch score set to 1, -2; (v) gap cost is set linear; and (vi) filters for low-complexity regions are used. In some embodiments, the algorithm parameters used in the BLASTP algorithm on the NCBI website include: (i) the expected threshold is set to 10; (ii) word size set to 3; (iii) the maximum match in the query range is set to 0; (iv) matrix set to BLOSUM62; (v) Gap cost is set to Exist: 11 Extend: 1; and (vi) conditional composition score matrix adjustment.

Percent identity is obtained by determining the number of identical positions to which the sequences being compared correspond, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

In some embodiments, the degree of similarity or identity is provided for a region that is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total length of the reference sequence. do. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity may be at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, and in some embodiments, contiguous. Provided for nucleotides. In some embodiments, the degree of similarity or identity is provided over the entire length of the reference sequence.

The homologous amino acid sequence is according to the present disclosure at least 40%, especially at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and preferably at least 95%, at least 98 or at least 99 of the amino acid residues. % indicates identity. Amino acid sequence variants/mutants described herein can be readily prepared by those skilled in the art, for example, by recombinant DNA engineering. Manipulation of DNA sequences to produce peptides or proteins with substitutions, additions, insertions or deletions is described, for example, in Sambrook et al. (1989)] is described in detail. Additionally, the peptides and amino acid variants described herein can be readily prepared with the aid of known peptide synthesis techniques, such as, for example, solid phase synthesis and similar methods.

In one aspect, a fragment or variant/mutant of an amino acid sequence (peptide or protein) is preferably a “functional fragment” or “functional variant”. The term “functional fragment” or “functional variant/mutant” of an amino acid sequence refers to any fragment or variant/mutant that exhibits one or more functional properties that are identical or similar to those of the amino acid sequence from which it is derived (i.e., functionally equivalent). It's about. With respect to an antigen or antigenic sequence, one specific function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. As used herein, the term “functional fragment” or “functional variant/mutant” specifically refers to an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and one or more of the functions of the parent molecule or sequence. refers to a variant/mutant molecule or sequence comprising an amino acid sequence that is still capable of, for example, eliciting an immune response. In one aspect, modifications to the amino acid sequence of a parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence. In different embodiments, the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., the immunogenicity of the functional variant may be at least 50%, at least 60%, at least 70% of the parent molecule or sequence, It may be at least 80% or at least 90%. However, in other embodiments, the immunogenicity of a functional fragment or functional variant may be improved compared to the parent molecule or sequence.

As used herein, “isolated” means altered or removed from its natural state. For example, a nucleic acid or peptide that occurs naturally in a living animal is not “isolated,” but the same nucleic acid or peptide that has been partially or completely separated from its natural co-occurring material is “isolated.” Isolated nucleic acids or proteins may exist in substantially purified form or may exist in a non-natural environment, such as, for example, a host cell.

I. Lee. E. coli FimH polypeptide

Fimbria adhesins, including type 1 fimbria, bind to mannosylated glycoproteins in the epithelial layer or are secreted into the urine. Type 1 fimbria are highly conserved among clinical UPEC isolates and are encoded by a cluster of genes called fim, which consists of accessory proteins (FimC, FimD), various structural subunits (FimE, FimF, FimG), and an adduct called FimH. Code God. FimH consists of two domains: a lectin binding domain (FimH _LD ) and a pilin domain, which are responsible for binding to mannosylated glycoproteins. The pilin domain serves to link FimH to other structural subunits of the pilus, such as FimG, through a mechanism called donor strand exchange. The FimH pilin domain forms an incomplete immunoglobulin fold, creating a groove that provides a binding site for the N-terminal β-strand of FimG, forming a strong intermolecular link between FimH and FimG. Although FimH _LD can be expressed in a soluble, stable form, full-length FimH is unstable alone unless it is in complex with the chaperone FimC or complemented with a donor strand peptide of FimG in peptide form or as a fusion protein. Therefore, expression of a stable full-length FimH molecule is possible by linking the FimG donor peptide to the C-terminus of full-length FimH via a glycine-serine linker, which is designated FimH-DSG.

In one aspect, the disclosure provides mutated FimH polypeptides as shown in Table 1. These mutants provide mutations in the amino acid sequence relative to the amino acid sequence of the corresponding wild-type (WT) FimH polypeptide. In some aspects, such mutants are immunogenic to wild-type FimH protein or to bacteria expressing wild-type FimH polypeptides. In certain aspects, FimH mutants have certain beneficial characteristics, such as increased immunogenic properties compared to the corresponding wild-type FimH polypeptide.

As used herein, the term “FimH polypeptide” refers to the full-length wild type E. Any domain of the E. coli FimH polypeptide, full-length wild type E. Any combination of domains of the E. coli FimH polypeptide, or the full length E. E. coli FimH polypeptide, or any fragment thereof. For example, in one embodiment the present disclosure provides a mutated FimH polypeptide that is a mutated FimH _LD polypeptide or a FimH-DSG polypeptide. The present disclosure improves the functional immunogenicity and demonstrates reduced affinity for mannoside ligands (as confirmed by biochemical and biophysical analyses), demonstrating the evaluation of the neutralizing response of these mutants compared to wild-type FimH _LD . It relates to novel FimH _LD and FimH-DSG mutants with

Amino acid mutations introduced into the FimH mutant polypeptide may include amino acid substitutions, deletions, or additions. In some aspects, the only mutation in the amino acid sequence of a FimH polypeptide mutant is an amino acid substitution relative to the wild-type FimH protein.

Table 1: FimH wild type and mutant sequences

The amino acid sequence of the wild-type FimH polypeptide is well known in the art. For example, the amino acid sequence of the FimHLD domain is provided herein as SEQ ID NO: 1. A full-length wild-type FimH polypeptide comprising a FimG donor peptide linked to the C-terminus of full-length FimH via a glycine-serine linker is provided herein as SEQ ID NO: 59. Nucleic acid sequences encoding these amino acid sequences are also well known in the art.

In one aspect of the disclosure, certain mutated FimH polypeptides result in locked, open confirmation that results in reduced affinity for mannoside ligands and leads to improved functional immunogenicity. Therefore, these FimH mutants are. It may be useful as an antigen in immunogenic compositions, such as vaccines against E. coli infection. Since wild-type FimH _LD is considered a poor immunogen in terms of its ability to stimulate functional immunogenicity, these FimH mutants may provide improved antigens for use in such immunogenic compositions.

In one aspect, as described in Example 1, FimH mutants were designed in an attempt to lock the FimH lectin domain in public confirmation to reduce affinity for mannoside ligands. Such mutants may contain at least 1, 2, 3, 4, 5 or more mutations. Mutations may include: naturally occurring amino acid substitutions common among urinary tract infection isolates (e.g. V27A); Substitutions on the ligand binding side of FimH _LD (e.g. at positions F1 and Q133); Glycine switch mutations in FimH _LD (such as at positions G15, G16 and G65); Introduction of a cysteine pair for disulfide bond stabilization in the FimH _LD (e.g. position pairs P12 - A18; G14 - F144; P26 - V35; P26 - V154; P26 - V156; V27 - L34; V28 - N33; V28 - P157; Q32 - Y108; N33 - L109; N33 - P157; V35 - L107; V35 - L109; S62 - T86; S62 - L129; Y64 - A127; L68 - F71; V112 - T158; S113 - T158; V118 - V 156; and/ or from A119 - V155); A non-polar to polar mutation in FimH _LD (e.g. at positions V27, L34, A119, or any combination thereof); Co-filling mutations at the pilin-lectin interface of FimH-DSG (e.g. at positions A115, V163, V185 or V3 within the DSG sequence); or any combination of types of mutations at the amino acid positions mentioned above. In another aspect, the disclosure provides FimH mutants as provided in SEQ ID NOs: 2-58 and 60-64, or any combination of the mutants mentioned in any of these sequences. In another aspect, the disclosure provides FimH mutants according to any of SEQ ID NOs: 23, 50, 51, 52, 53, 54, 60, and 62. In a further aspect, the disclosure provides FimH mutants according to SEQ ID NO:62.

In a further aspect, the disclosure provides any FimH mutant as provided in SEQ ID NOs: 2-58 and 60-64, wherein the mutant is isolated. For example, in one aspect the disclosure provides a FimH mutant according to any one of SEQ ID NOs: 23, 50, 51, 52, 53, 54, 60, and 62, wherein the FimH mutant is isolated. . In a further aspect, the disclosure provides a FimH mutant according to SEQ ID NO:62, wherein the FimH mutant is isolated.

Accordingly, in some specific aspects, the present disclosure provides FimH mutants comprising a combination of introduced mutations, wherein the mutant comprises a combination of mutations set forth in any of the mutants provided in Table 1 (i.e., sequence Identification numbers: from 2-58 and 60-64). Any combination of amino acid substitutions provided for each of the mutants in Table 1 can be made in the wild-type FimH polypeptide sequence to arrive at different FimH mutants. FimH mutants based on the native FimH polypeptide sequence of any other subtype or strain and comprising any combination of the mutations described herein are also within the scope of the present disclosure.

Additional aspects of the disclosure include any one of SEQ ID NOs: 1-64 and at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, polypeptides that are at least 98% identical, or at least 99% identical. In a preferred aspect, the polypeptide is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical. Another aspect of the invention is any one of SEQ ID NOs: 1-64 and at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80 %, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, polypeptides that are 97%, 98%, 99% or 99.9% identical. In a preferred aspect, the polypeptide is SEQ ID NO: 62 and at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82 %, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identical.

FimH mutants provided by the present disclosure can be made by routine methods known in the art, such as by expression in a recombinant host system using a suitable vector. Suitable recombinant host cells include, for example, insect cells, mammalian cells, avian cells, bacteria, and yeast cells. Examples of suitable insect cells include, for example, Sf9 cells, Sf21 cells, Tn5 cells, Schneider S2 cells, and High Five cells (from the parental Trichoplusia ni BTI-TN-5B1-4 cell line (Invitrogen)). derived clonal isolates). Examples of suitable mammalian cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (HEK293 or Expi 293 cells, typically transformed by sheared adenovirus type 5 DNA), NIH-3T3 cells, 293-T cells. , Vero cells, and HeLa cells. Suitable avian cells include, for example, chicken embryonic stem cells (e.g., EBx® cells), chicken embryo fibroblasts, chicken embryo germ cells, quail fibroblasts (e.g., ELL-O), and duck cells. . Suitable insect cell expression systems, such as the baculovirus-vector system, are known to those skilled in the art and are described, for example, in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987)]. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form, particularly from Invitrogen (San Diego, CA). Algal cell expression systems are also known to those skilled in the art and include, for example, U.S. Patent Nos. 5,340,740; 5,656,479; 5,830,510; 6,114,168; and 6,500,668. Similarly, bacterial and mammalian cell expression systems are also known in the art and are described, for example, in Yeast Genetic Engineering (Barr et al., eds., 1989) Butterworths, London.

A number of suitable vectors for the expression of recombinant proteins in insect or mammalian cells are well known and routine in the art. A suitable vector may contain multiple components, including but not limited to one or more of the following: an origin of replication; selectable marker gene; one or more expression control elements, such as transcription control elements (e.g., promoters, enhancers, terminators), and/or one or more translation signals; and a signal sequence or leader sequence for targeting the secretory pathway in the selected host cell (e.g., of mammalian origin or from a xenogeneic mammalian or non-mammalian species). For example, for expression in insect cells, suitable baculovirus expression vectors such as pFastBac (Invitrogen) are used to generate recombinant baculovirus particles. Baculovirus particles are amplified and used to infect insect cells to express recombinant proteins. For expression in mammalian cells, a vector is used that will drive expression of the construct in the desired mammalian host cell (e.g., Chinese hamster ovary cells).

FimH mutant polypeptides can be isolated using any suitable method. Methods for purifying FimH protein mutant polypeptides, for example, by immunoaffinity chromatography, are known in the art. Ruiz-Arguello et al., J. Gen. Virol., 85:3677-3687 (2004). Suitable methods for purifying proteins of interest are well known in the art, including precipitation and various types of chromatography such as hydrophobic interaction, ion exchange, affinity, chelation and size exclusion. Two or more of these or other suitable methods can be used to generate a suitable purification scheme. If desired, the FimH mutant polypeptide may contain a “tag” to facilitate purification, such as an epitope tag or a histidine (His) tag. Such tagged polypeptides can be conveniently isolated, for example, by chelation chromatography or affinity chromatography from conditioned media.

As used herein, the term “antigen” refers to a molecule that can be recognized by an antibody. Examples of antigens include polypeptides, peptides, lipids, polysaccharides, and nucleic acids containing antigenic determinants such as those recognized by immune cells.

II. Nucleic acids encoding FimH mutants

In another aspect, the disclosure provides nucleic acid molecules encoding FimH mutants as disclosed herein. These nucleic acid molecules include DNA, cDNA, and RNA sequences. In one embodiment, a nucleic acid molecule can be incorporated into a vector, such as an expression vector.

In one aspect, this. Nucleic acids encoding E. coli FimH mutated polypeptides or any fragments thereof are disclosed. One or more nucleic acid constructs encoding a FimH mutant polypeptide or fragment thereof can be used for genomic integration and subsequent expression of the polypeptide. For example, a single nucleic acid construct encoding a FimH mutant polypeptide or fragment thereof can be introduced into a host cell. Alternatively, the coding sequence for a polypeptide can be carried by two or more nucleic acid constructs, which are then introduced simultaneously or sequentially into the host cell.

For example, in one exemplary embodiment, the single nucleic acid construct is E. Encodes the lectin domain and pilin domain of E. coli FimH. In another exemplary embodiment, one nucleic acid construct encodes a lectin domain and the second nucleic acid construct is E. Encodes the pilin domain of E. coli FimH. In some aspects, genomic integration is achieved.

The nucleic acid construct may include genomic DNA or cDNA containing one or more introns. Some genes are expressed more efficiently when introns are present. In some aspects, the nucleic acid sequence is suitable for expression of an exogenous polypeptide in the mammalian cell.

In some aspects, the nucleic acid encoding the polypeptide or fragment thereof is codon optimized to increase the level of expression in any particular cell.

In some aspects, the nucleic acid construct is E. and a signal sequence encoding a peptide that directs secretion of a polypeptide or fragment thereof derived from E. coli. In some aspects, the nucleic acid is. Contains the native signal sequence of the polypeptide derived from E. coli FimH. this. In some aspects where the polypeptide or fragment thereof derived from E. coli comprises an endogenous signal sequence, the nucleic acid sequence encoding the signal sequence can be codon optimized to increase the level of expression of the protein in the host cell.

In some aspects, the signal sequence is any of the following lengths: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids in length. In some aspects, the signal sequence is 20 amino acids long. In some aspects, the signal sequence is 21 amino acids long.

In some aspects, when the polypeptide or fragment thereof comprises a signal sequence, the endogenous signal sequence naturally associated with the polypeptide is replaced with a signal sequence not associated with the wild-type polypeptide to improve the level of expression of the polypeptide or fragment thereof in cultured cells. can be replaced Accordingly, in some aspects, the nucleic acid is. It does not contain the native signal sequence of the polypeptide or fragment thereof derived from E. coli. In some aspects, the nucleic acid is. It does not contain the native signal sequence of the polypeptide derived from E. coli FimH. In some respects, this. A polypeptide or fragment thereof derived from E. coli can be expressed as a heterologous peptide, preferably E. coli. A signal sequence or other peptide having a specific cleavage site at the N-terminus of a mature protein or polypeptide or fragment thereof derived from E. coli. For example, this. Polypeptides or fragments thereof derived from E. coli FimH can be expressed as heterologous peptides (e.g., IgK signal sequences), which are preferably expressed in mature E. coli. It is a signal sequence or other peptide with a specific cleavage site at the N-terminus of the E. coli FimH protein. In a preferred aspect, the mature protein. The specific cleavage site at the N-terminus of E. coli FimH is a mature E. It occurs immediately before the initial phenylalanine residue in the E. coli FimH protein. The heterologous sequence selected is preferably one that is recognized and processed by the host cell (i.e., cleaved by a signal peptidase).

In a preferred aspect, the signal sequence is an IgK signal sequence. In some aspects, the nucleic acid encodes a polypeptide having the amino acid sequence set forth in any of SEQ ID NOs: 1-64. In some aspects, the nucleic acid encodes the amino acid sequence of SEQ ID NO: 23, 50, 51, 52, 53, 54, 60, 61, or 62. In some aspects, the nucleic acid encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO:62. In a preferred aspect, the signal sequence is a mouse IgK signal sequence.

Suitable mammalian expression vectors for producing FimH mutant polypeptides or fragments thereof are known in the art and may be commercially available, such as the pSecTag2 expression vector from Invitrogen™. An exemplary mouse Ig kappa signal peptide sequence includes the sequence ETDTLLLWVLLLWVPGSTG (SEQ ID NO: 65). In some aspects, the vector includes the pBudCE4.1 mammalian expression vector from Thermo Fisher. Additional exemplary and suitable vectors include the pcDNA™3.1 mammalian expression vector (Thermo Fisher).

In some aspects, the signal sequence does not include a hemagglutinin signal sequence.

In some aspects, the nucleic acid comprises the native signal sequence of a FimH polypeptide or fragment thereof. In some aspects, the signal sequence is not an IgK signal sequence. In some aspects, the signal sequence includes a hemagglutinin signal sequence.

In one aspect, disclosed herein are vectors containing coding sequences for FimH mutant polypeptides or fragments thereof. Exemplary vectors include plasmids that can replicate autonomously or that can replicate in mammalian cells. A typical expression vector contains suitable promoters, enhancers and terminators useful for controlling the expression of the coding sequence(s) in the expression construct. The vector may also contain a selection marker to provide a phenotypic trait for selection of transformed host cells (e.g., conferring resistance to antibiotics such as ampicillin or neomycin).

Suitable promoters are known in the art. Exemplary promoters include, for example, CMV promoter, adenovirus, EF1 a, GAPDH metallothionein promoter, SV-40 early promoter, SV-40 late promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter. Includes etc. Promoters can be constitutive or inducible. More than one vector may be used (e.g., one vector coding for all subunits or domains or fragments thereof, or multiple vectors coding for subunits or domains or fragments thereof together).

Internal ribosome entry site (IRES) and 2A peptide sequences can also be used. IRES and 2A peptides provide an alternative approach for co-expression of multiple sequences. IRES is a nucleotide sequence that allows translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. Usually, in eukaryotes, translation can be initiated only at the 5' end of the mRNA molecule. IRES elements allow expression of multiple genes from one transcript. IRES-based polycistronic vectors that express multiple proteins from a single transcript can reduce the escape of non-expressing clones from selection. The 2A peptide allows translation of multiple proteins in a single open reading frame into polyproteins, which are subsequently cleaved into individual proteins via a ribosome-skipping mechanism. 2A peptides can provide more balanced expression of multiple protein products. Exemplary IRES sequences include, for example, EV71 IRES, EMCV IRES, HCV IRES. In the case of genomic integration, integration can be site-specific or random. Site-specific recombination can be achieved by introducing homologous sequence(s) into the nucleic acid constructs described herein. These homologous sequences substantially match endogenous sequences at specific target sites in the host genome. Alternatively, random integration may be used. Sometimes, the expression level of a protein may vary depending on the site of integration. Therefore, it may be desirable to select multiple clones based on recombinant protein expression level to identify clones that achieve the desired expression level.

Exemplary nucleic acid constructs are further described in the drawings of PCT International Publication No. WO2021/084429, published May 6, 2021, which are incorporated herein by reference, e.g., Figures 2A-2T.

In one aspect, the nucleic acid sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, Encodes an amino acid sequence having at least 98%, at least 99% identity. In a preferred aspect, the nucleic acid sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or Encodes an amino acid sequence with at least 99% identity. In another aspect of the invention the nucleic acid sequence is any one of SEQ ID NOs: 1-64 and at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79 %, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, Encodes an amino acid sequence with 96%, 97%, 98%, 99% or 99.9% identity. In a preferred aspect, the nucleic acid sequence is SEQ ID NO: 62 and at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , encodes an amino acid sequence with 99% or 99.9% identity.

In certain aspects of the disclosure, the RNA is messenger RNA (mRNA), which is associated with an RNA transcript that encodes a peptide or protein. As established in the art, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide coding region and a 3' untranslated region (3'-UTR). In some embodiments, RNA is produced by in vitro transcription or chemical synthesis. In one embodiment, mRNA is produced by in vitro transcription using a DNA template where the DNA refers to a nucleic acid containing deoxyribonucleotides. In one aspect, the RNA described herein can have modified nucleosides. In some aspects, the RNA includes at least one (e.g., all) nucleosides modified in place of uridine.

In some embodiments, the composition or medical formulation described herein comprises RNA encoding an amino acid sequence comprising a FimH mutant polypeptide. Likewise, the methods described herein include administration of such RNA. One possible platform for use herein is based on antigen-encoding RNA vaccines to induce potent neutralizing antibodies and accompanying/concomitant T cell responses to achieve protective immunization, preferably with minimal vaccine doses. The RNA administered is preferably in vitro transcribed RNA. Three different RNA platforms are particularly preferred: unmodified uridine containing mRNA (uRNA), nucleoside modified mRNA (modRNA) and self-amplifying RNA (saRNA). In one particularly preferred aspect, the RNA is in vitro transcribed RNA.

III. host cell

In one aspect, the disclosure relates to cells in which a sequence encoding a FimH mutant polypeptide or fragment thereof is expressed in a mammalian host cell. In one embodiment, the polypeptide is transiently expressed in a host cell. In another embodiment, the polypeptide is stably integrated into the genome of a host cell and, when cultured under suitable conditions, express the polypeptide or fragment thereof. In a preferred embodiment, the polynucleotide sequence is expressed with high efficiency and genomic stability.

Suitable mammalian host cells are known in the art. Preferably, the host cells are suitable for producing proteins on an industrial manufacturing scale. Exemplary mammalian host cells include any of the following and derivatives thereof: Chinese hamster ovary (CHO) cells, COS cells (a cell line derived from monkey kidney (African green monkey), Vero cells, Hela cells, baby hamster kidney. (BHK) cells, human embryonic kidney (HEK) cells, NSO cells (murine myeloma cell line), and C127 cells (non-tumorigenic mouse cell line). Additional exemplary mammalian host cells include: mouse Sertoli (TM4), buffalo rat liver (BRL 3A), mouse mammary tumor (MMT), rat liver tumor (HTC), mouse myeloma (NSO), murine hybridoma (Sp2/0), mouse thymoma (EL4), Chinese hamster Ovary (CHO) and CHO cell derivatives, murine embryo (NIH/3T3, 3T3 Li), rat myocardium (H9c2), mouse myoblast (C2C12), and mouse kidney (miMCD-3). Additional examples of mammalian cell lines include NS0 /1, Sp2/0, Hep G2, PER.C6, COS-7, TM4, CV1, VERO-76, MDCK, BRL 3A, W138, MMT 060562, TR1, MRC5, and FS4.

Any cell susceptible to cell culture can be utilized according to the present invention. In some aspects, the cell is a mammalian cell. Non-limiting examples of mammalian cells that can be used in accordance with the present invention include: BALB/c mouse myeloma line (NSO/l, ECACC No: 85110503); human retinoblasts (PER.C6, CruCell, Leiden, Netherlands); Monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); Human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59, 1977); Baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells +/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216, 1980); mouse yophil cells (TM4, Mather, Biol. Reprod., 23:243-251, 1980); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1 587); human cervical carcinoma cells (HeLa, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); Buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); Mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., 383:44-68, 1982); MRC 5 cells; FS4 cells; and human hepatoma lineage (Hep G2). In some preferred embodiments, the cells are CHO cells. In some preferred aspects, the cells are GS-cells.

Additionally, any number of commercially and non-commercially available hybridoma cell lines may be utilized in accordance with the present invention. As used herein, the term “hybridoma” refers to a cell or progeny of cells resulting from a fusion of an immortalized cell and an antibody-producing cell. These resulting hybridomas are immortalized cells that produce antibodies. Individual cells used to generate hybridomas can be derived from any mammalian source, including but not limited to rat, pig, rabbit, sheep, pig, goat, and human. In some aspects, a hybridoma is a trioma cell line that is created when the progeny of a heterozygous myeloma syncytium, which is the product of a fusion between a human cell and a murine myeloma cell line, is subsequently fused with a plasma cell. In some aspects, a hybridoma is any immortalized hybrid cell line that produces an antibody, such as a quadroma (see, e.g., Milstein et al., Nature 537:3053 (1983)). Those skilled in the art will understand that hybridoma cell lines may have different nutritional requirements and/or require different culture conditions for optimal growth and may modify conditions as needed.

In some aspects, the cell comprises a first gene of interest, where the first gene of interest is chromosomally integrated. In some aspects, the first gene of interest comprises a reporter gene, a selection gene, a gene of interest (e.g., encoding a polypeptide or fragment thereof derived from E. coli), an accessory gene, or a combination thereof. In some aspects, genes of therapeutic interest include genes encoding difficult to express (DtE) proteins.

In some aspects, the first gene of interest is located between two distinct recombination target sites (RTS) in a site-specific integration (SSI) mammalian cell, where the two RTS are chromosomally integrated within the NL1 locus or the NL2 locus. do. See, for example, U.S. Patent Application Publication No. 20200002727 for a description of the NL1 locus, NL2 locus, NL3 locus, NL4 locus, NL5 locus, and NL6 locus. In some aspects, the first gene of interest is located within the NL1 locus. In some aspects, the cell comprises a second gene of interest, where the second gene of interest is chromosomally integrated. In some aspects, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest (such as a FimH mutant polypeptide or fragment thereof), an accessory gene, or a combination thereof. In some aspects, the gene of therapeutic interest includes a gene encoding the DtE protein. In some aspects, the second gene of interest is located between two RTS. In some aspects, the second gene of interest is located within the NL1 locus or the NL2 locus. In some aspects, the first gene of interest is located within the NL1 locus and the second gene of interest is located within the NL2 locus. In some aspects, the cell comprises a third gene of interest, where the third gene of interest is chromosomally-integrated. In some aspects, the third gene of interest includes a reporter gene, a selection gene, a gene of therapeutic interest (e.g., a polypeptide or fragment thereof derived from E. coli), an accessory gene, or a combination thereof. In some aspects, the gene of therapeutic interest includes a gene encoding the DtE protein. In some aspects, the third gene of interest is located between two RTS. In some aspects, the third gene of interest is located within the NL1 locus or the NL2 locus. In some aspects, the third gene of interest is located within a locus distinct from the NL1 locus and the NL2 locus. In some aspects, the first gene of interest, the second gene of interest, and the third gene of interest are within three separate loci. In some aspects, at least one of the first gene of interest, the second gene of interest, and the third gene of interest is within the NL1 locus, and at least one of the first gene of interest, the second gene of interest, and the third gene of interest are within the NL2 locus. In some aspects, the cell contains a site-specific recombinase gene. In some aspects, the site-specific recombinase gene is chromosomally integrated.

In another aspect, the disclosure provides a mammalian cell comprising at least four distinct RTSs, wherein the cell comprises: (a) at least two distinct RTSs chromosomally-integrated within the NL1 locus or the NL2 locus. RTS; (b) a first gene of interest integrated between at least two RTSs of (a), wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an accessory gene, or a combination thereof; and (c) a second gene of interest integrated within a second chromosomal locus distinct from the locus of (a), wherein the second gene of interest encodes a reporter gene, a DtE protein (e.g., a polypeptide or fragment thereof derived from E. coli). Includes genes, accessory genes, or combinations thereof. In some aspects, the disclosure provides a mammalian cell comprising at least four distinct RTSs, wherein the cell includes: (a) at least two distinct RTSs chromosomally-integrated within the Fer1L4 locus; (b) at least two distinct RTSs chromosomally integrated within the NL1 locus or the NL2 locus; (c) a first gene of interest chromosomally integrated within the Fer1L4 locus, wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an accessory gene, or a combination thereof; and (d) a second gene of interest chromosomally integrated within the NL1 locus or NL2 locus of (b), wherein the second gene of interest encodes a reporter gene, a DtE protein (e.g., a polypeptide or fragment thereof derived from E. coli). Contains genes, accessory genes, or combinations thereof.

In some aspects, the disclosure provides a mammalian cell comprising at least six distinct RTSs, wherein the cell comprises: (a) at least two distinct RTSs chromosomally-integrated within the Fer1L4 locus and 1 gene of interest; (b) at least two distinct RTS and a second gene of interest chromosomally-integrated within the NL1 locus; and (c) at least two distinct RTS and a third gene of interest chromosomally-integrated within the NL2 locus.

As used herein, the terms "in operably combination," "in operably sequence," and "operably linked" mean that nucleic acid molecules are produced that are capable of directing transcription of a given gene and/or synthesis of a desired protein molecule. Refers to the linking of nucleic acid sequences in a manner that makes it possible. The term also refers to the linking of amino acid sequences in a way that allows a functional protein to be produced. In some aspects, the gene of interest is operably linked to a promoter, wherein the gene of interest is chromosomally-integrated into the host cell. In some aspects, the gene of interest is operably linked to a heterologous promoter; Here the gene of interest is chromosomally integrated into the host cell. In some aspects, the accessory gene is operably linked to a promoter, wherein the accessory gene is chromosomally integrated into the host cell genome. In some aspects, the accessory gene is operably linked to a heterologous promoter; Here the accessory gene is chromosomally integrated into the host cell genome. In some aspects, the gene encoding the DtE protein is operably linked to a promoter, wherein the gene encoding the DtE protein is chromosomally integrated into the host cell genome. In some aspects, the gene encoding the DtE protein is operably linked to a heterologous promoter, wherein the gene encoding the DtE protein is chromosomally integrated into the host cell genome. In some aspects, the recombinase gene is operably linked to a promoter, wherein the recombinase gene is chromosomally integrated into the host cell. In some aspects, the recombinase gene is operably linked to a promoter, wherein the recombinase gene is not integrated into the host cell genome. In some aspects, the recombinase gene is operably linked to a heterologous promoter, wherein the recombinase gene is not chromosomally integrated into the host cell genome. In some aspects, the recombinase gene is operably linked to a heterologous promoter, wherein the recombinase gene is not chromosomally integrated into the host cell genome.

The term “chromosome-integrated” or “chromosomal integration” as used herein refers to the stable incorporation of a nucleic acid sequence into a chromosome of a host cell, such as a mammalian cell. That is, a nucleic acid sequence that is chromosomally integrated into the genomic DNA (gDNA) of a host cell, such as a mammalian cell. In some aspects, chromosome-integrated nucleic acid sequences are stable. In some aspects, the chromosome-integrated nucleic acid sequence is not located on a plasmid or vector. In some aspects, chromosome-integrated nucleic acid sequences are not excised. In some aspects, chromosomal integration is mediated by clustered regularly spaced short palindromic repeats (CRISPR) and the CRISPR associated protein (Cas) gene editing system (CRISPR/CAS).

IV. Compositions and Formulations

In one aspect, the disclosure includes a composition comprising at least one FimH mutant polypeptide or fragment thereof as described herein. In some aspects, the composition includes: It elicits an immune response comprising antibodies that can confer immunity to pathogenic strains of E. coli.

In some aspects, the composition includes a FimH mutant polypeptide as the only antigen. In some aspects, the composition does not include a conjugate.

In some aspects, the composition includes a FimH mutant polypeptide and at least one additional antigen. In some aspects, the composition comprises a FimH mutant polypeptide and an additional E. coli. Contains coli antigen. In some aspects, the composition comprises a FimH mutant polypeptide and E. Includes glycoconjugates from E. coli.

In some aspects, the composition comprises a FimH mutant polypeptide and E. Includes polypeptides derived from E. coli FimC or fragments thereof.

In one embodiment, the present disclosure provides FimH mutant polypeptides, and PCT International Publication No. WO2021/084429 (published May 6, 2021) and WO2020/039359 (published February 27, 2020) and US Publication No. US2020/ 0061177, published February 27, 2020, each of which is incorporated herein by reference in its entirety. In one aspect, the present disclosure provides a FimH mutant polypeptide; and compositions comprising a saccharide comprising a structure selected from any of the following: Formula O1 (e.g. Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g. , Formula O4:K52 and Formula O4:K6), Formula O5 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6) :K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b) , Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (for example , Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104 , Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155 , Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187, where n is It is an integer of 1 to 100, preferably 31 to 90.

In some embodiments, the composition includes any one of the saccharides disclosed herein. In a preferred embodiment, the composition comprises any one of the conjugates disclosed herein.

In some embodiments, the composition includes E. and at least one glycoconjugate from E. coli serotype O25, preferably serotype O25b. In one embodiment, the composition includes E. and at least one glycoconjugate from E. coli serotype O1, preferably serotype O1a. In one embodiment, the composition includes E. and at least one glycoconjugate from E. coli serotype O2. In one embodiment, the composition includes E. and at least one glycoconjugate from E. coli serotype O6.

In one embodiment, the composition includes: coli serotypes O25, O1, O2 and O6, preferably O25b, O1a, O2 and O6. In one embodiment, the composition includes: coli serotypes O25, O1, O2 and O6, preferably at least two glycoconjugates selected from any one of O25b, O1a, O2 and O6. In another embodiment, the composition has the following E. coli serotypes O25, O1, O2 and O6, preferably at least three glycoconjugates selected from any one of O25b, O1a, O2 and O6. In a further embodiment, the composition comprises: glycoconjugates from E. coli serotypes O25, O1, O2 and O6, preferably O25b, O1a, O2 and O6, respectively.

In a preferred embodiment, the glycoconjugates of either composition are individually conjugated to CRM ₁₉₇ . In another preferred embodiment, the glycoconjugates of either of the compositions are individually conjugated to SCP.

Accordingly, in some embodiments, the composition comprises a FimH mutant polypeptide, and at least one E. Contains O-antigens from E. coli serotypes. In a preferred embodiment, the composition comprises a FimH mutant polypeptide, and more than one E. Contains O-antigens from E. coli serotypes. For example, the composition may be divided into two different groups. E. coli serotype (or “v”, valence) to 12 different serotypes (12v). In one embodiment, the composition comprises a FimH mutant polypeptide, and O-antigens from three different serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and four different E. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and five different E. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and six different E. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and seven different E. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and eight different E. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and nine different E. coli. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide and 10 different E. coli. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises a FimH mutant polypeptide, and 11 different E. coli. Contains O-antigens from E. coli serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 12 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 13 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 14 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 15 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 16 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 17 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 18 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 19 different serotypes. In one embodiment, the composition comprises FimH mutant polypeptides and O-antigens from 20 different serotypes.

Preferably, this. The number of coli saccharides can range from 1 serotype (or “v”, valence) to 26 different serotypes (26v). In one embodiment there is one serotype. In one embodiment there are two different serotypes. In one embodiment there are three different serotypes. In one embodiment there are four different serotypes. In one embodiment there are five different serotypes. In one embodiment there are six different serotypes. In one embodiment there are 7 different serotypes. In one embodiment there are eight different serotypes. In one embodiment there are 9 different serotypes. In one embodiment there are 10 different serotypes. In one embodiment there are 11 different serotypes. In one embodiment there are 12 different serotypes. In one embodiment there are 13 different serotypes. In one embodiment there are 14 different serotypes. In one embodiment there are 15 different serotypes. In one embodiment there are 16 different serotypes. In one embodiment there are 17 different serotypes. In one embodiment there are 18 different serotypes. In one embodiment there are 19 different serotypes. In one embodiment there are 20 different serotypes. In one embodiment there are 21 different serotypes. In one embodiment there are 22 different serotypes. In one embodiment there are 23 different serotypes. In one embodiment there are 24 different serotypes. In one embodiment there are 25 different serotypes. In one embodiment there are 26 different serotypes. The saccharide is conjugated to a carrier protein to form a glycoconjugate as described herein.

In one aspect, the composition comprises a FimH mutant polypeptide; and at least one louse. A glycoconjugate comprising an O-antigen from an E. coli serogroup, wherein the O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide; and more than 1 tooth. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and two different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide, and three different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and four different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and five different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and six different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and seven different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and eight different E. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and nine different E. coli. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and 10 different E. coli. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide, and 11 different E. coli. and O-antigens from E. coli serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-antigens from 12 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 13 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 14 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 15 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 16 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 17 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 18 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 19 different serotypes, where each O-antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH mutant polypeptide and O-antigens from 20 different serotypes, where each O-antigen is conjugated to a carrier protein.

In another aspect, the composition includes at least one lice. Contains O-polysaccharides from E. coli serotypes. In a preferred embodiment, the composition contains more than one lice. Contains O-polysaccharides from E. coli serotypes. For example, the composition may be divided into two different groups. E. coli serotypes to 12 different E. coli serotypes. O-polysaccharides from E. coli serotypes. In one embodiment, the composition contains three different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating four different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating five different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating six different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating seven different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating eight different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating 9 different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating 10 different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition is suitable for treating 11 different lice. Contains O-polysaccharides from E. coli serotypes. In one embodiment, the composition includes O-polysaccharides from 12 different serotypes. In one embodiment, the composition includes O-polysaccharides from 13 different serotypes. In one embodiment, the composition includes O-polysaccharides from 14 different serotypes. In one embodiment, the composition includes O-polysaccharides from 15 different serotypes. In one embodiment, the composition includes O-polysaccharides from 16 different serotypes. In one embodiment, the composition includes O-polysaccharides from 17 different serotypes. In one embodiment, the composition includes O-polysaccharides from 18 different serotypes. In one embodiment, the composition includes O-polysaccharides from 19 different serotypes. In one embodiment, the composition includes O-polysaccharides from 20 different serotypes.

In a preferred embodiment, the composition contains at least one lice. and an O-polysaccharide from an E. coli serotype, wherein the O-polysaccharide is conjugated to a carrier protein. In a preferred embodiment, the composition contains more than one lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. For example, the composition may be divided into two different groups. E. coli serotypes to 12 different E. coli serotypes. O-polysaccharides from E. coli serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition contains three different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating four different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating five different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating six different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating seven different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating eight different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating 9 different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating 10 different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition is suitable for treating 11 different lice. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 12 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 13 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 14 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 15 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 16 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 17 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 18 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 19 different serotypes, where each O-polysaccharide is conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 20 different serotypes, where each O-polysaccharide is conjugated to a carrier protein.

In a most preferred embodiment, the composition contains at least one lice. It comprises an O-polysaccharide from an E. coli serotype, wherein the O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In a preferred embodiment, the composition contains more than one lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. For example, the composition may be divided into two different groups. E. coli serotypes to 12 different E. coli serotypes. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide includes an O-antigen and a core saccharide. In one embodiment, the composition contains three different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating four different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating five different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating six different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating seven different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating eight different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating 9 different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating 10 different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition is suitable for treating 11 different lice. It comprises O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide comprises an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 12 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 13 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 14 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 15 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 16 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 17 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 18 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 19 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In one embodiment, the composition comprises O-polysaccharides from 20 different serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, wherein the O-polysaccharide is an O-antigen and a core Contains saccharides. In a preferred embodiment, the carrier protein is CRM ₁₉₇ .

In another preferred embodiment, the composition comprises a FimH mutant polypeptide, and an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide has the formula O25a where n is at least 30 and a core saccharide Includes. In a preferred embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O25b where n is at least 40 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O1a where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O2 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O6 where n is at least 30 and a core saccharide.

In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O17 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O15 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O18A where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O75 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O4 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O16 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O13 where n is at least 30 and a core saccharide. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O7 where n is at least 30 and a core saccharide.

In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O8 where n is at least 30 and a core saccharide. In another embodiment, the O-polysaccharide comprises the formula O8, where n is 1-20, preferably 2-5, more preferably 3. In another embodiment, the composition further comprises an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O9 where n is at least 30 and a core saccharide. In another embodiment, the O-polysaccharide comprises the formula O9, where n is 1-20, preferably 4-8, more preferably 5. In another embodiment, the O-polysaccharide comprises the formula O9a, where n is 1-20, preferably 4-8, more preferably 5.

In some embodiments, the O-polysaccharide is selected from any of Formula O20ab, Formula O20ac, Formula O52, Formula O97, and Formula O101, where n is 1-20, preferably 4-8, more preferably It's 5.

As described above, the composition may include any combination of FimH mutant polypeptides and conjugated O-polysaccharides (antigens). In one exemplary embodiment, the composition includes a polysaccharide comprising the formula O25b, a polysaccharide comprising the formula O1a, a polysaccharide comprising the formula O2, and a polysaccharide comprising the formula O6. More specifically, for example, the composition comprises: (i) an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O25b (where n is at least 30) and a core saccharide. ; (ii) an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O1a (where n is at least 30) and a core saccharide; (iii) an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O2 where n is at least 30 and a core saccharide; and (iv) an O-polysaccharide conjugated to CRM ₁₉₇ , wherein the O-polysaccharide comprises the formula O6 where n is at least 30 and a core saccharide.

In one embodiment, the composition comprises a FimH mutant polypeptide, and any E. and at least one O-polysaccharide derived from an E. coli serotype, wherein the serotype is not O25a. For example, in one embodiment, the composition does not include a saccharide comprising the formula O25a. Such compositions include, for example, O-polysaccharides comprising the formula O25b, O-polysaccharides comprising the formula O1a, O-polysaccharides comprising the formula O2, and O-polysaccharides comprising the formula O6. May include rides.

In one embodiment, the composition comprises a FimH mutant polypeptide and two different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and three different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and four different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and five different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and six different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and seven different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and eight different E. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and nine different E. coli. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide and 10 different E. coli. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and 11 different E. coli. O-polysaccharides from E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharides include an O-antigen and a core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 12 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 13 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 14 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 15 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 16 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 17 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 18 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 19 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide. In one embodiment, the composition comprises a FimH mutant polypeptide, and O-polysaccharides from 20 different serotypes, wherein each O-polysaccharide is conjugated to CRM ₁₉₇ , wherein the O-polysaccharide contains O-antigen and core saccharide.

In one aspect, the invention provides a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide has the formula O25b, where n is 15 ± It is 2. In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O25b, where n is 17 ± It is 2. In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O25b, where n is 55 ± It is 2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide has the formula O25b, where n is 51 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide has the formula O25b, where n is 30 It is an integer greater than or equal to n, and preferably n is an integer from 31 to 100. In one embodiment, the saccharide is E. E. coli R1 core further comprises a saccharide moiety. In another embodiment, the saccharide is E. It further comprises an E. coli K12 core saccharide moiety. In another embodiment, the saccharide further comprises a KDO moiety. Preferably, the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is made by single end joining joining. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one aspect, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies have a concentration of at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, 0.4 pg/ml, or 0.5 pg/ml, as determined by an ELISA assay. At a concentration of ml. Can bind to E. coli serotype O25b polysaccharide. Therefore, a comparison of the OPA activity of sera before and after immunization with the immunogenic composition of the invention can be performed and compared to their response to serotype O25b to assess the potential increase in responders. In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O25b. In one embodiment, the immunogenic composition elicits functional antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O25b. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Increase the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O25b. In one embodiment, the immunogenic composition kills E. coli in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. A titer of at least 1:8 against E. coli serotype O25b is obtained. In one embodiment, the immunogenic composition of the invention kills E. coli in at least 60%, 70%, 80% or at least 90% of subjects as determined by an in vitro opsonic phagocytic killing assay. A titer of at least 1:8 against E. coli serotype O25b is obtained. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O25b. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases OPA titers in human subjects against E. coli serotype O25b.

In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O1a, wherein n is greater than 30. is an integer, and preferably n is an integer of 31 to 100. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O1a, where n is 39 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O1a, where n is 13 ± 2 am. In one embodiment, the saccharide is E. E. coli R1 core further comprises a saccharide moiety. In one embodiment, the saccharide further comprises a KDO moiety. Preferably, the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is made by single end joining joining. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, 0.4 pg/ml, or 0.5 pg as determined by an ELISA assay. At a concentration of /ml. Can bind to E. coli serotype O1a polysaccharide. Therefore, a comparison of the OPA activity of sera before and after immunization with the immunogenic composition of the invention can be performed and compared to their response to serotype O1a to assess the potential increase in responders. In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O1a. In one embodiment, the immunogenic composition elicits functional antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O1a. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Increase the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O1a. In one embodiment, the immunogenic composition kills E. coli in at least 50% of the subjects as determined by an in vitro opsonophagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O1a. In one embodiment, the immunogenic composition of the invention kills E. coli in at least 60%, 70%, 80% or at least 90% of subjects as determined by an in vitro opsonic phagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O1a. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O1a. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases OPA titers in human subjects against E. coli serotype O1a.

In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O2, where n is 30 It is an integer greater than or equal to n, and preferably n is an integer from 31 to 100. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O2, where n is 43 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O2, where n is 47 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O2, where n is 17 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O2, where n is 18 It is ±2. In one embodiment, the saccharide is E. E. coli R1 core further comprises a saccharide moiety. In another embodiment, the saccharide is E. E. coli R4 core further comprises a saccharide moiety. In another embodiment, the saccharide further comprises a KDO moiety. Preferably, the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is made by single end joining joining. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, 0.4 pg/ml, or 0.5 pg as determined by an ELISA assay. At a concentration of /ml. Can bind to E. coli serotype O2 polysaccharide. Therefore, a comparison of the OPA activity of sera before and after immunization with the immunogenic composition of the invention can be performed and compared to their response to serotype O2 to assess the potential increase in responders. In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O2. In one embodiment, the immunogenic composition elicits functional antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O2. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Increase the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O2. In one embodiment, the immunogenic composition kills E. coli in at least 50% of the subjects as determined by an in vitro opsonophagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O2. In one embodiment, the immunogenic composition of the invention kills E. coli in at least 60%, 70%, 80% or at least 90% of subjects as determined by an in vitro opsonic phagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O2. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O2. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases OPA titers in human subjects against E. coli serotype O2.

In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O6, wherein n is greater than 30. is an integer, and preferably n is an integer of 31 to 100. In one aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O6, where n is 42 ± It is 2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O6, where n is 50 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O6, where n is 17 It is ±2. In another aspect, the invention relates to a composition comprising a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises the formula O6, where n is 18 It is ±2. In one embodiment, the saccharide is E. E. coli R1 core further comprises a saccharide moiety. In one embodiment, the saccharide further comprises a KDO moiety. Preferably, the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is made by single end joining joining. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, 0.4 pg/ml, or 0.5 pg as determined by an ELISA assay. At a concentration of /ml. Can bind to E. coli serotype O6 polysaccharide. Therefore, a comparison of the OPA activity of sera before and after immunization with the immunogenic composition of the invention can be performed and compared to their response to serotype O6 to assess the potential increase in responders. In one embodiment, the immunogenic composition elicits IgG antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O6. In one embodiment, the immunogenic composition elicits functional antibodies in a human, wherein the antibodies are directed against E. coli as determined by an in vitro opsonophagocytic assay. It can kill E. coli serotype O6. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Increase the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O6. In one embodiment, the immunogenic composition kills E. coli in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O6. In one embodiment, the immunogenic composition of the invention kills E. coli in at least 60%, 70%, 80% or at least 90% of subjects as determined by an in vitro opsonic phagocytic killing assay. A titer of at least 1:8 is obtained against E. coli serotype O6. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases the proportion of responders (i.e., individuals with sera with a titer of at least 1:8 as determined by in vitro OPA) to E. coli serotype O6. In one embodiment, the immunogenic composition of the invention is compared to a pre-immunized population. Significantly increases OPA titers in human subjects against E. coli serotype O6.

In one aspect, the composition comprises a conjugate comprising a FimH mutant polypeptide and a saccharide covalently linked to a carrier protein, wherein the saccharide comprises a structure selected from any of the following: Formula O1 (e.g. For example, Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4:K52 and Formula O4:K6), Formula O5 (e.g., Formula O5ab and Formula O5ac (strains 180/C3)), Formula O6 (e.g. Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 ( For example, Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g. Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96 , Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147 , Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187, where n is an integer from 1 to 100, preferably from 31 to 90. In one embodiment, the saccharide is E. E. coli R1 core further comprises a saccharide moiety. In one embodiment, the saccharide is E. E. coli R2 core further comprises a saccharide moiety. In one embodiment, the saccharide is E. E. coli R3 core further comprises a saccharide moiety. In another embodiment, the saccharide is E. E. coli R4 core further comprises a saccharide moiety. In one embodiment, the saccharide is E. It further comprises an E. coli K12 core saccharide moiety. In another embodiment, the saccharide further comprises a KDO moiety. Preferably, the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is made by single end joining joining. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent. In one embodiment, the composition contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, further comprising 22, 23, 24, 25, 26, 27, 28 or 29 additional conjugates up to 30 additional conjugates, each conjugate comprising a saccharide covalently bound to a carrier protein, wherein Rides include structures selected from any of the above formulas.

A. Saccharide

1. Saccharides and O-polysaccharides

In one embodiment, the saccharide is produced by expression (but not necessarily overexpression) of a different Wzz protein (e.g., WzzB) to control the size of the saccharide.

As used herein, the term "saccharide" refers to two or more single sugar moieties covalently linked to form a single sugar moiety or monosaccharide unit, as well as disaccharides, oligosaccharides and polysaccharides. or a combination of monosaccharide units. Saccharides can be linear or branched.

In one embodiment, the saccharide is produced in recombinant Gram-negative bacteria. In one embodiment, the saccharide is recombinant E. Produced in coli cells. In one embodiment, the saccharide is produced in recombinant Salmonella cells. Exemplary bacteria include: coli O25K5H1, E. coli BD559, E. coli GAR2831, E. coli GAR865, E. coli GAR868, E. coli GAR869, E. coli GAR872, E. coli GAR878, E. coli GAR896, E. coli GAR1902, E. E. coli O25a ETC NR-5, E. E. coli O157:H7:K-, Salmonella enterica serovar Typhimurium strain LT2, E. E. coli GAR2401, Salmonella enterica serovar Enteritidis CVD 1943, Salmonella enterica serovar Typhimurium CVD 1925, Salmonella enterica serovar Paratyphi A CVD 1902, and Shigella flexneri CVD 1208S. . In one embodiment, the bacteria is E. It is not Coli GAR2401. This genetic approach to saccharide production allows efficient production of O-polysaccharide and O-antigen molecules as vaccine components.

As used herein, the term “wzz protein” refers to chain length determinant polypeptides such as, for example, wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzzl and wzz2. GenBank accession numbers for exemplary wzz gene sequences are AF011910 for E4991/76, AF011911 for F186, AF011912 for M70/1-1, AF011913 for 79/311, AF011914 for Bi7509-41, AF011915 for C664-1992, AF011916 for C258-94, AF011917 for C722-89, and AF011919 for EDL933. GenBank accession numbers for the G7 and Bi316-41 wzz gene sequences are U39305 and U39306, respectively. Additional GenBank accession numbers for exemplary wzz gene sequences are NP_459581 for Salmonella enterica subspecies Enterica serovar Typhimurium strain LT2 FepE; this. AIG66859 for E. coli O157:H7 strain EDL933 FepE; NP_461024 for Salmonella enterica subspecies Enterica serovar Typhimurium strain LT2 WzzB; this. NP_416531 for E. coli K-12 substrain MG1655 WzzB; this. For E. coli K-12 substrain MG1655 FepE, it is NP_415119. In a preferred aspect, the wzz family protein is any of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2, most preferably wzzB, and more preferably fepE.

Exemplary wzzB sequences include those set forth in SEQ ID NOs: 112-116. Exemplary FepE sequences include those set forth in SEQ ID NOs: 117-121.

In some aspects, modified saccharides (modified compared to the corresponding wild-type saccharides) are grown in Gram-negative bacteria by expressing (but not necessarily overexpressing) a wzz family protein (e.g., fepE) from Gram-negative bacteria. ), and/or switching off (i.e., repressing, deleting, eliminating) a second wzz gene (e.g., wzzB) to have an increased number of repeat units compared to the corresponding wild-type O-polysaccharide. It can be produced by producing high molecular weight saccharides such as lipopolysaccharide containing long O-antigen chains. For example, modified saccharides can be produced by expressing (but not necessarily overexpressing) wzz2 and switching off wzzl. Or, alternatively, modified saccharides can be produced by expressing (but not necessarily overexpressing) wzz/fepE and switching off wzzB. In another embodiment, modified saccharides can be produced by expressing (but not necessarily overexpressing) wzzB but switching off wzz/fepE. In another embodiment, modified saccharides can be produced by expressing fepE. Preferably, the wzz family proteins are derived from a strain that is heterologous to the host cell. Methods for determining the length of a saccharide are known in the art. These methods include, but are not limited to, nuclear magnetic resonance, mass spectrometry, and size exclusion chromatography. Methods for producing high molecular weight saccharides described herein, such as lipopolysaccharides containing medium or long O-antigen chains, are described in PCT International Publication No. WO2020/039359 and corresponding US Publication No. US2020/0061177, respectively. It is incorporated herein by reference in its entirety.

In some embodiments, the saccharide is SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, Any one of SEQ ID NO: 119, SEQ ID NO: 120 and SEQ ID NO: 121 and at least 30%, 50%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99 It is produced by expressing wzz family proteins with amino acid sequences with % or 100% sequence identity. In one embodiment, the wzz family protein is SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118. , SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121. Preferably, the wzz family protein is at least 30%, 50%, 70%, 75% of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116. , has 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity. In some embodiments, the saccharide has an amino acid sequence that has at least 30%, 50%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the fepE protein. It is produced by expressing a protein with .

In one aspect, the invention relates to expressing a wzz family protein, preferably fepE, in a Gram-negative bacterium, resulting in an increase of at least 1, 2, 3, 4 or 5 repeat units compared to the corresponding wild-type O-polysaccharide. It relates to a saccharide produced by producing a high molecular weight saccharide containing a medium or long O-antigen chain. In one aspect, the invention provides a method for producing high molecular weight saccharides containing medium or long O-antigen chains with an increase of at least 1, 2, 3, 4 or 5 repeat units compared to the corresponding wild-type O-antigen. It relates to saccharides produced by Gram-negative bacteria in culture expressing (but not necessarily overexpressing) a wzz family protein (e.g., wzzB) from Gram-negative bacteria. See the descriptions of O-polysaccharides and O-antigens below for additional exemplary saccharides with an increased number of repeat units compared to the corresponding wild-type saccharide. The desired chain length is one that produces improved or maximum immunogenicity in the context of a given vaccine construct.

In another embodiment, the saccharide comprises any of the formulas selected from Table A, wherein the number of repeat units in the saccharide, n, is 1, 2, 3 greater than the number of repeat units in the corresponding wild-type O-polysaccharide. , 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 , 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 , 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more repeat units It's bigger than that. Preferably, the saccharide has at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 compared to the corresponding wild-type O-polysaccharide. , 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 repeat units. Methods for determining the length of a saccharide are known in the art. These methods include nuclear magnetic resonance, mass spectrometry, and size exclusion chromatography.

In a preferred embodiment, the invention provides recombinant E. relates to a saccharide produced in an E. coli host cell, wherein the gene for the endogenous wzz O-antigen length regulator (e.g., wzzB) is deleted, and the recombinant E. coli. replaced by a (second) wzz gene from a Gram-negative bacterium heterologous to the E. coli host cell (e.g. Salmonella fepE), containing a high molecular weight saccharide such as lipopolysaccharide containing a medium or long O-antigen chain. Create a ride In some embodiments, recombinant E. The E. coli host cell contains the wzz gene from Salmonella, preferably Salmonella enterica.

In one embodiment, the host cell contains a heterologous gene for a wzz family protein as a stably maintained plasmid vector. In another embodiment, the host cell comprises a heterologous gene for a wzz family protein as an integrated gene in the chromosomal DNA of the host cell. this. Method for stably expressing plasmid vectors in E. coli host cells and heterologous genes in E. coli. Methods for integration into the chromosome of an E. coli host cell are known in the art. In one embodiment, the host cell contains the heterologous gene for the O-antigen as a stably maintained plasmid vector. In another embodiment, the host cell comprises a heterologous gene for the O-antigen as an integrated gene in the chromosomal DNA of the host cell. this. Methods for stably expressing plasmid vectors in E. coli host cells and Salmonella host cells are known in the art. This is a heterologous gene. Methods for integration into the chromosomes of E. coli host cells and Salmonella host cells are known in the art.

In one aspect, the recombinant host cells are cultured in medium containing a carbon source. this. Carbon sources for E. coli cultivation are known in the art. Exemplary carbon sources include sugar alcohols, polyols, aldol sugars, or keto sugars (arabinose, cellobiose, fructose, glucose, glycerol, inositol, lactose, maltose, mannitol, mannose, rhamnose, raffinose, sorbitol, sorbose, (including but not limited to sucrose, trehalose, pyruvate, succinate, and methylamine). In a preferred embodiment, the medium comprises glucose. In some embodiments, the medium includes polyols or aldol sugars as carbon sources, such as mannitol, inositol, sorbose, glycerol, sorbitol, lactose, and arabinose. All carbon sources can be added to the medium before the start of the culture, or they can be added stepwise or continuously during the culture.

Exemplary culture media for recombinant host cells include KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O , Na ₂ MoO ₄ -2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O. contains elements. Preferably, the medium contains KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O, Na ₂ MoO Contains ₄ -2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O.

The media used herein may be solid or liquid, synthetic (i.e. artificial) or natural, and may contain sufficient nutrients for the culture of the recombinant host cells. Preferably, the medium is a liquid medium.

In some embodiments, the medium may further comprise suitable inorganic salts. In some embodiments, the medium may additionally include trace nutrients. In some embodiments, the medium may further include growth factors. In some embodiments, the medium may further include additional carbon sources. In some embodiments, the medium may further comprise suitable mineral salts, trace nutrients, growth factors, and supplemental carbon sources. this. Suitable inorganic salts, trace nutrients, growth factors and supplemental carbon sources for E. coli cultures are known in the art.

In some embodiments, the medium may include suitable additional ingredients, such as peptone, N-Z amines, enzymatic soy hydrolyzate, additional yeast extract, malt extract, supplemental carbon sources, and various vitamins. In some embodiments, the medium does not include such additional components, such as peptone, N-Z amines, enzymatic soy hydrolyzate, additional yeast extract, malt extract, supplemental carbon source, and various vitamins.

Illustrative examples of suitable supplemental carbon sources include other carbohydrates such as glucose, fructose, mannitol, starch or starch hydrolyzate, cellulose hydrolyzate and molasses; Organic acids such as acetic acid, propionic acid, lactic acid, formic acid, malic acid, citric acid and fumaric acid; and alcohols such as glycerol, inositol, mannitol, and sorbitol.

In some embodiments, the medium further comprises a nitrogen source. this. Suitable nitrogen sources for E. coli cultivation are known in the art. Illustrative examples of suitable nitrogen sources include ammonia, including ammonia gas and aqueous ammonia; Ammonium salts of inorganic or organic acids, such as ammonium chloride, ammonium nitrate, ammonium phosphate, ammonium sulfate and ammonium acetate; urea; Nitrates or nitrites, and amino acids in pure or crude preparations, meat extracts, peptone, fish meal, fish hydrolysate, corn steep liquor, casein hydrolyzate, soy cake hydrolyzate, yeast extract, dried yeast, ethanol-yeast distillate, soy flour. , cottonseed meal, and other nitrogen-containing materials.

In some embodiments, the medium includes an inorganic salt. Illustrative examples of suitable inorganic salts include, but are not limited to, salts of potassium, calcium, sodium, magnesium, manganese, iron, cobalt, zinc, copper, molybdenum, tungsten and other trace elements, and phosphoric acid.

In some embodiments, the medium includes appropriate growth factors. Illustrative examples of suitable micronutrients, growth factors, etc. include coenzyme A, pantothenic acid, pyridoxine-HCl, biotin, thiamine, riboflavin, flavin mononucleotide, flavin adenine dinucleotide, DL-6,8-thioctic acid, folic acid, vitamins. B12, other vitamins, amino acids such as cysteine and hydroxyproline, bases such as adenine, uracil, guanine, thymine and cytosine, sodium thiosulfate, p- or r-aminobenzoic acid, niacinamide, nitriloacetate, etc. (pure or as a partially purified compound or as present in natural substances). The amount can be determined empirically by a person skilled in the art according to methods and techniques known in the art.

In another embodiment, the modified saccharides described herein (compared to the corresponding wild-type saccharides) are produced synthetically, for example in vitro. Synthetic production or synthesis of saccharides can facilitate avoidance of cost- and time-intensive production processes. In one embodiment, the saccharide is synthesized synthetically, for example, by using a sequential glycosylation strategy or a combination of sequential glycosylation and [3+2] block synthesis strategy from a suitably protected monosaccharide intermediate. For example, thioglycosides and glycosyl trichloroacetimidate derivatives can be used as glycosyl donors in glycosylation. In one embodiment, the saccharide synthesized synthetically in vitro has the same structure as the saccharide produced by recombinant means, such as by engineering the wzz family proteins described above.

Saccharides produced (by recombinant or synthetic means) are, for example, E. Any E. coli serotype. Contains structures derived from E. coli serotypes: O1 (e.g., O1A, O1B, and O1C), O2, O3, O4 (e.g., O4:K52 and O4:K6), O5 (e.g., O5ab and O5ac (strain 180/C3)), O6 (e.g., O6:K2; K13; K15 and O6:K54), O7, O8, O9, O10, O11, O12, O13, O14, O15, O16, O17 , O18 (e.g., O18A, O18ac, O18A1, O18B, and O18B1), O19, O20, O21, O22, O23 (e.g., O23A), O24, O25 (e.g., O25a and O25b), O26 , O27, O28, O29, O30, O32, O33, O34, O35, O36, O37, O38, O39, O40, O41, O42, O43, O44, O45 (e.g., O45 and O45rel), O46, O48, O49, O50, O51, O52, O53, O54, O55, O56, O57, O58, O59, O60, O61, O62, 62D1, O63, O64, O65, O66, O68, O69, O70, O71, O73 (e.g. For example, O73 (strain 73-1)), O74, O75, O76, O77, O78, O79, O80, O81, O82, O83, O84, O85, O86, O87, O88, O89, O90, O91, O92, O93 , O95, O96, O97, O98, O99, O100, O101, O102, O103, O104, O105, O106, O107, O108, O109, O110, 0111, O112, O113, O114, O115, O116, O117, O118, O119 , O120, O121, O123, O124, O125, O126, O127, O128, O129, O130, O131, O132, O133, O134, O135, O136, O137, O138, O139, O140, O141, O142, O143, O144, O1 45 , O146, O147, O148, O149, O150, O151, O152, O153, O154, O155, O156, O157, O158, O159, O160, O161, O162, O163, O164, O165, O166, O167, O168, O169, O1 70 , O171, O172, O173, O174, O175, O176, O177, O178, O179, O180, O181, O182, O183, O184, O185, O186 and O187.

Individual polysaccharides are typically subjected to, for example, dialysis, concentration operations, diafiltration operations, tangential flow filtration, precipitation, elution, centrifugation, precipitation, ultrafiltration, depth filtration, and/or column chromatography (ion exchange chromatography). , multimode ion exchange chromatography, DEAE, and hydrophobic interaction chromatography) (enriched with respect to the amount of polysaccharide-protein conjugates). Preferably, the polysaccharide is purified through a method comprising tangential flow filtration.

The purified polysaccharide is activated (e.g., chemically activated) to render it reactive (e.g., directly to a carrier protein or via a linker such as an eTEC spacer) and then reacted with the polysaccharide as further described herein. It can be incorporated into the glycoconjugate of the invention.

In one preferred embodiment, the saccharide of the invention is E. It is derived from E. coli serotype, where the serotype is O25a. In another preferred embodiment, the serotype is O25b. In another preferred embodiment, the serotype is O1A. In another preferred embodiment, the serotype is O2. In another preferred embodiment, the serotype is O6. In another preferred embodiment, the serotype is O17. In another preferred embodiment, the serotype is O15. In another preferred embodiment, the serotype is O18A. In another preferred embodiment, the serotype is O75. In another preferred embodiment, the serotype is O4. In another preferred embodiment, the serotype is O16. In another preferred embodiment, the serotype is O13. In another preferred embodiment, the serotype is O7. In another preferred embodiment, the serotype is O8. In another preferred embodiment, the serotype is O9.

As used herein, reference to any of the serotypes listed above refers to a serotype that contains repeat unit structures (O-units, as described below) known in the art and is unique to the corresponding serotype. do. For example, the term “O25a” serotype (also known in the art as serotype “O25”) refers to the serotype comprising the formula O25 as shown in Table A. As another example, the term “O25b” serotype refers to the serotype comprising the formula O25b as shown in Table A.

As used herein, unless otherwise specified, for example, the term "O18" refers to generically including Formula O18A, Formula O18ac, Formula 18A1, Formula O18B and Formula O18B1. They are referred to generically herein.

As used herein, the term "O1" refers generically to formula names according to Table A, such as any of Formula O1A, Formula O1A1, Formula O1B and Formula O1C (each of which is shown in Table A). refers to including species of the formula containing O1". Accordingly, “O1 serotype” collectively refers to serotypes comprising any of Formula O1A, Formula O1A1, Formula O1B, and Formula O1C.

As used herein, the term “O6” refers collectively to the formula O6:K2; K13; K15; and O6:K54 (each of which is shown in Table A). Accordingly, “O6 serotypes” are collectively referred to by the formula O6:K2; K13; K15; and O6:K54.

Other examples of terms that refer generically to species whose formulas include generic terms in their formula names according to Table A include “O4”, “O5”, “O18”, and “O45”.

As used herein, the term “O2” refers to the formula O2 shown in Table A. The term “O2 O-antigen” refers to a saccharide comprising the formula O2 as shown in Table A.

As used herein, reference to an O-antigen from a serotype listed above refers to a saccharide comprising the formula labeled with the corresponding serotype name. For example, the term “O25B O-antigen” refers to a saccharide comprising the formula O25B as shown in Table A.

As another example, the term "O1 O-antigen" collectively refers to saccharides that include formulas containing the term "O1", such as Formula O1A, Formula O1A1, Formula O1B, and Formula O1C (each of which is shown in Table A). refers to a ride.

As another example, the term “O6 O-antigen” refers generically to the formula O6:K2; Formula O6:K13; Refers to saccharides comprising a formula containing the term “O6”, such as Formula O6:K15 and Formula O6:K54 (each of which is shown in Table A).

As used herein, the term “O-polysaccharide” refers to any structure comprising an O-antigen, unless the structure comprises whole cells or lipid A. For example, in one embodiment, the O-polysaccharide comprises lipopolysaccharide, wherein lipid A is not bound. Steps to remove lipid A are known in the art and include, for example, heat treatment with acid addition. An exemplary process includes treatment with 1% acetic acid at 100° C. for 90 minutes. This process is combined with a process to isolate the removed lipid A. An exemplary process for isolating lipid A includes ultracentrifugation.

In one embodiment, O-polysaccharide refers to a structure comprised of O-antigens, in which case O-polysaccharide is synonymous with the term O-antigen. In one preferred embodiment, O-polysaccharide refers to a structure comprising repeating units of O-antigens without a core saccharide. Accordingly, in one embodiment, the O-polysaccharide is E. It does not contain the E. coli R1 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R2 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R3 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R4 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli K12 core moiety. In another preferred embodiment, O-polysaccharide refers to a structure comprising an O-antigen and a core saccharide. In another embodiment, O-polysaccharide refers to a structure comprising an O-antigen, a core saccharide, and a KDO moiety.

Methods for purifying O-polysaccharides, including core oligosaccharides, from LPS are known in the art. For example, after purification of LPS, the purified LPS can be hydrolyzed by heating in 1% (v/v) acetic acid at 100 °C for 90 min, followed by ultracentrifugation at 142,000 x g at 4 °C for 5 h. . The supernatant containing O-polysaccharide is freeze-dried and stored at 4°C. In certain embodiments, deletion of capsule synthesis genes is described, allowing simple purification of O-polysaccharides.

O-polysaccharide can be isolated by methods including, but not limited to, mild acid hydrolysis to remove lipid A from LPS. Other embodiments may include the use of hydrazine as an agent for preparing O-polysaccharides. Preparation of LPS can be accomplished by methods known in the art.

In certain embodiments, O-polysaccharides purified from wild-type, modified, or attenuated Gram-negative bacterial strains expressing (but not necessarily overexpressing) a Wzz protein (e.g., wzzB) are used in a conjugate vaccine. provided for. In a preferred embodiment, the O-polysaccharide chain is purified from a Gram-negative bacterial strain expressing (but not necessarily overexpressing) the wzz protein for use as a vaccine antigen as a conjugate or complex vaccine.

In one embodiment, the O-polysaccharide is about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10x, 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 21x, 22x, 23x, 24x, 25x, 26x , 27 times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, 38 times, 39 times, 40 times, 41 times, 42 times, 43 2x, 44x, 45x, 46x, 47x, 48x, 49x, 50x, 51x, 52x, 53x, 54x, 55x, 56x, 57x, 58x, 59x, 60x, 61x, 62x, 63x, 64x, 65x, 66x, 67x, 68x, 69x, 70x, 71x, 72x, 73x, 74x, 75x, 76x , 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 It has a molecular weight increased by 2-fold, 94-fold, 95-fold, 96-fold, 97-fold, 98-fold, 99-fold, 100-fold or more. In a preferred embodiment, the O-polysaccharide has a molecular weight increased by at least 1-fold and up to 5-fold compared to the corresponding wild-type O-polysaccharide. In another embodiment, the O-polysaccharide has a molecular weight increased by at least 2-fold and up to 4-fold compared to the corresponding wild-type O-polysaccharide. An increase in the molecular weight of the O-polysaccharide compared to the corresponding wild-type O-polysaccharide is preferably associated with an increase in the number of O-antigen repeat units. In one embodiment, the increase in molecular weight of the O-polysaccharide is due to the wzz family proteins.

In one embodiment, the O-polysaccharide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 compared to the corresponding wild-type O-polysaccharide. , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 , 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 , 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 kDa or more. In one embodiment, the O-polysaccharide of the invention has a molecular weight increased by at least 1 and up to 200 kDa compared to the corresponding wild-type O-polysaccharide. In one embodiment, the molecular weight is increased by at least 5 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 12 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 15 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 18 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 21 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 22 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 30 and up to 200 kDa. In one embodiment, the molecular weight is increased by at least 1 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 5 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 12 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 15 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 100 kDa. In one embodiment, the molecular weight is increased by at least 1 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 5 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 12 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 15 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 18 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 30 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 90 kDa. In one embodiment, the molecular weight is increased by at least 12 and up to 85 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 75 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 70 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 60 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 50 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 49 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 48 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 47 kDa. In one embodiment, the molecular weight is increased by at least 10 and up to 46 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 45 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 44 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 43 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 42 kDa. In one embodiment, the molecular weight is increased by at least 20 and up to 41 kDa. This increase in the molecular weight of the O-polysaccharide compared to the corresponding wild-type O-polysaccharide is preferably associated with an increase in the number of O-antigen repeat units. In one embodiment, the increase in molecular weight of the O-polysaccharide is due to the wzz family proteins.

In another embodiment, the O-polysaccharide comprises any of the formulas selected from Table A, wherein the number of repeat units in the O-polysaccharide, n, is the number of repeat units in the corresponding wild-type O-polysaccharide. See 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 larger by one or more repeat units. Preferably, the saccharide has at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 compared to the corresponding wild-type O-polysaccharide. , 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 repeat units.

2. O-antigen

The O-antigen is part of lipopolysaccharide (LPS) in the outer membrane of Gram-negative bacteria. O-antigens are located on the cell surface and are variable cellular components. The variability of the O-antigen provides the basis for serotyping of Gram-negative bacteria. Currently this. The E. coli serotyping scheme includes O-polysaccharides 1 to 181.

O-antigens contain oligosaccharide repeat units (O-units), whose wild-type structure usually contains 2 to 8 residues from a wide range of sugars. This is exemplary. The O-units of the E. coli O-antigen are listed in Table A and PCT International Publication No. WO2021/084429, published May 6, 2021, which is incorporated herein by reference in its entirety. In some embodiments, the disclosure provides at least one FimH mutant polypeptide and a and compositions comprising at least one of the O-antigens.

In one embodiment, the saccharide of the invention may be one oligosaccharide unit. In one embodiment, the saccharide of the invention is one repeating oligosaccharide unit of the relevant serotype. In this embodiment, the saccharide has a structure selected from any of Formula O1a, Formula O2, Formula O6, Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O25b, Formula O52, Formula O97, and Formula O101. It can be included. In a further embodiment, the saccharide may comprise a structure selected from any of Formula O1a, Formula O2, Formula O6, and Formula O25b.

In one embodiment, the saccharide of the invention may be an oligosaccharide. Oligosaccharides have a small number of repeat units (typically 5-15 repeat units) and are typically derived synthetically or by hydrolysis of polysaccharides. In this embodiment, the saccharide has a structure selected from any of Formula O1a, Formula O2, Formula O6, Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O25b, Formula O52, Formula O97, and Formula O101. It can be included. In a further embodiment, the saccharide may comprise a structure selected from any of Formula O1a, Formula O2, Formula O6, and Formula O25b.

Preferably, both the saccharides of the invention and the saccharides in the immunogenic compositions of the invention are polysaccharides. High molecular weight polysaccharides can induce specific antibody immune responses due to the epitopes present on the antigen surface. Isolation and purification of high molecular weight polysaccharides are preferably contemplated for use in the conjugates, compositions, and methods of the present invention.

In some embodiments, the number of repeating O units within each individual O-antigen polymer (and therefore the length and molecular weight of the polymer chain) depends on the wzz chain length regulator, an inner membrane protein. Different wzz proteins confer a wide range of modal lengths (4 to >100 repeat units). The term “modal length” refers to the number of repeating O-units. Gram-negative bacteria often have two different Wzz proteins that give them two distinct Oag modal chain lengths (one longer and one shorter). Expression (but not necessarily overexpression) of wzz family proteins (e.g., wzzB) in Gram-negative bacteria allows manipulation of O-antigen length, shifting or biasing bacterial production of O-antigens of specific length ranges; It can improve the production of high-yield high molecular weight lipopolysaccharide. In one embodiment, “short” modal length, as used herein, refers to a small number of repeating O-units, e.g., 1-20. In one embodiment, “long” modal length, as used herein, refers to a number of repeating O-units greater than 20 and up to 40. In one embodiment, “very long” modal length, as used herein, refers to greater than 40 repeating O-units.

In one embodiment, the saccharide produced has at least 10 repeat units, 15 repeat units, 20 repeat units, 25 repeat units, 30 repeat units, 35 repeat units compared to the corresponding wild-type O-polysaccharide. unit, 40 repeat units, 45 repeat units, 50 repeat units, 55 repeat units, 60 repeat units, 65 repeat units, 70 repeat units, 75 repeat units, 80 repeat units, 85 repeats units, in increments of 90 repeat units, 95 repeat units, or 100 repeat units.

In another embodiment, the saccharide of the invention has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 compared to the corresponding wild-type O-polysaccharide. , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 , 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 , 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more repeat units. Preferably, the saccharide has at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 compared to the corresponding wild-type O-polysaccharide. , 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 repeat units. For example, see Table 21. Methods for determining the length of a saccharide are known in the art. These methods include nuclear magnetic resonance, mass spectrometry, and size exclusion chromatography as described in Example 13.

Methods for determining the number of repeat units in a saccharide are also known in the art. For example, the number of repeat units (or "n" in the formula) can be used to determine the molecular weight of the polysaccharide (excluding the molecular weight of the core saccharide or KDO residues) by dividing the molecular weight of the repeat units (i.e., the equivalent shown for example in Table 1). The molecular weight of a structure in a formula, which can be calculated by dividing by the molecular weight of each monosaccharide in the formula, can theoretically be calculated as the sum of the molecular weights. The molecular weight of each monosaccharide within a formula is known in the art. For example, the molecular weight of the repeat unit of formula O25b is approximately 862 Da. For example, the molecular weight of the repeat unit of formula O1a is approximately 845 Da. For example, the molecular weight of the repeat unit of formula O2 is approximately 829 Da. For example, the molecular weight of the repeat unit of formula O6 is approximately 893 Da. When determining the number of repeat units in the conjugate, the carrier protein molecular weight and protein:polysaccharide ratio are included in the calculation. As defined herein, “n” refers to the number of repeat units (indicated in parentheses in Table 1) within a polysaccharide molecule. As is known in the art, in biological macromolecules, repeating structures may be interspersed with regions of incomplete repeats, for example, missing branches. Additionally, it is known in the art that polysaccharides isolated and purified from natural sources such as bacteria can be heterogeneous in size and branching. In this case, n may represent the mean or median value of n for the molecules of the population.

In one embodiment, the O-polysaccharide has an increase in at least one repeat unit of O-antigen compared to the corresponding wild-type O-polysaccharide. The repeating units of the O-antigen are shown in Table 1. In one embodiment, the O-polysaccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 , 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , contains 96, 97, 98, 99, 100 or more total repeat units. Preferably, the saccharide has a total of at least 3 and up to 80 repeat units. In another embodiment, the O-polysaccharide has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 compared to the corresponding wild-type O-polysaccharide. , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 , 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 , 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more repeat units.

In one embodiment, the saccharide comprises an O-antigen, wherein the O-antigen formula (e.g., in any of the formulas shown in Table 1 (see also FIGS. 9A-9C and 10A-10B)) n is at least 1, 2, 3, 4, 5, 10, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 , 38, 39, 40, and up to 200, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 81, 80, 79, 78, 77 , 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, or an integer of 50. The range can be defined by combining an arbitrary minimum value and an arbitrary maximum value. Exemplary ranges include, for example, at least 1 and at most 1000; at least 10 and up to 500; and at least 20 and at most 80, preferably at most 90. In one preferred embodiment, n is at least 31 and at most 90. In a preferred embodiment, n is 40 to 90, more preferably 60 to 85.

In one embodiment, the saccharide comprises an O-antigen, where n in either of the O-antigen formulas is at least 1 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 5 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 10 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 25 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 50 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 75 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 100 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 125 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 150 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 175 and at most 200. In one embodiment, n in either of the O-antigen formulas is at least 1 and at most 100. In one embodiment, n in either of the O-antigen formulas is at least 5 and at most 100. In one embodiment, n in either of the O-antigen formulas is at least 10 and at most 100. In one embodiment, n in either of the O-antigen formulas is at least 25 and at most 100. In one embodiment, n in either of the O-antigen formulas is at least 50 and at most 100. In one embodiment, n in either of the O-antigen formulas is at least 75 and at most 100. In one embodiment, n in either O-antigen formula is at least 1 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 5 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 10 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 20 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 25 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 30 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 40 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 50 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 30 and at most 90. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 85. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 75. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 70. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 60. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 50. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 49. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 48. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 47. In one embodiment, n in either of the O-antigen formulas is at least 35 and at most 46. In one embodiment, n in either of the O-antigen formulas is at least 36 and at most 45. In one embodiment, n in either of the O-antigen formulas is at least 37 and at most 44. In one embodiment, n in either of the O-antigen formulas is at least 38 and at most 43. In one embodiment, n in either of the O-antigen formulas is at least 39 and at most 42. In one embodiment, n in either of the O-antigen formulas is at least 39 and at most 41.

For example, in one embodiment, n in the saccharide is 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90, most preferably 40. In another embodiment, n is at least 35 and at most 60. For example, in one embodiment, n is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54. , 55, 56, 57, 58, 59 and 60, preferably 50. In another preferred embodiment, n is at least 55 and at most 75. For example, in one embodiment, n is 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68 or 69, most preferably 60.

The saccharide structure can be determined by methods and tools known in the art, such as, for example, NMR, including 1D, 1H and/or 13C, 2D TOCSY, DQF-COZY, NOESY and/or HMQC.

In some embodiments, the polysaccharide purified prior to conjugation has a molecular weight between 5 kDa and 400 kDa. In other such embodiments, the saccharide is 10 kDa to 400 kDa; 5 kDa to 400 kDa; 5 kDa to 300 kDa; 5 kDa to 200 kDa; 5 kDa to 150 kDa; 10 kDa to 100 kDa; 10 kDa to 75 kDa; 10 kDa to 60 kDa; 10 kDa to 40 kDa; 10 kDa to 100 kDa; 10 kDa and 200 kDa; 15 kDa to 150 kDa; 12 kDa to 120 kDa; 12 kDa to 75 kDa; 12 kDa to 50 kDa; 12 to 60 kDa; 35 kDa to 75 kDa; 40 kDa to 60 kDa; 35 kDa to 60 kDa; 20 kDa to 60 kDa; 12 kDa to 20 kDa; or has a molecular weight of 20 kDa to 50 kDa. In a further embodiment, the polysaccharide is 7 kDa to 15 kDa; 8 kDa to 16 kDa; 9 kDa to 25 kDa; 10 kDa to 100; 10 kDa to 60 kDa; 10 kDa to 70 kDa; 10 kDa to 160 kDa; 15 kDa to 600 kDa; 20 kDa to 1000 kDa; 20 kDa to 600 kDa; 20 kDa to 400 kDa; 30 kDa to 1,000 Kda; 30 kDa to 60 kDa; It has a molecular weight of 30 kDa to 50 kDa or 5 kDa to 60 kDa. Any pan-digit integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

As used herein, the term “molecular weight” of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) combined with multiple angle laser light scattering detector (MALLS). do.

Polysaccharides may shrink slightly in size during normal purification procedures. Additionally, as described herein, polysaccharides may undergo sizing techniques prior to conjugation. Mechanical or chemical sizing may be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high pressure homogenizing shear. The molecular weight ranges mentioned above refer to polysaccharides that have been purified prior to conjugation (eg, prior to activation).

Table A: This. E. coli serogroup/serotype and O-unit moiety

† β-D-6dmanHep2Ac is 2-O-acetyl-6-deoxy-β-D-manno-heptopyranosyl.

‡ β-D-Xulf is β-D-threo-pentofuranosyl.

3. Core oligosaccharides

The core oligosaccharide is wild type. In E. coli LPS, lipids A and O-antigens are located between the external regions. More specifically, the core oligosaccharide is wild-type E. In E. coli, it is part of a polysaccharide that contains the linkage between the O-antigen and lipid A. This bond involves a ketosidic bond between the hemiketal function of the innermost 3-deoxy-d-manno-oct-2-ulosonic acid (KDO)) residue and the hydroxyl group of the GlcNAc-residue of lipid A. do. The core oligosaccharide region is wild-type E. It shows a high degree of similarity among E. coli strains. It usually contains a limited number of sugars. The core oligosaccharide includes an inner core region and an outer core region.

More specifically, the inner core is mainly composed of L-glycero-D-manno-heptose (heptose) and KDO residues. The inner core is highly preserved. KDO moieties include the formula KDO:

The outer region of the core oligosaccharide shows more variation than the inner core region, and the differences in this region are as follows. Distinguish between five chemical types of E. coli: R1, R2, R3, R4 and K-12. The generalized structures of the carbohydrate backbones of the five known chemical types of outer core oligosaccharides are well known in the art. HepII is the last residue of the inner core oligosaccharide. All outer core oligosaccharides share a structural theme of having a (hexose) ₃ carbohydrate backbone and 2 side chain residues, but the order of the hexoses within the backbone and the nature, position and linkage of the side chain residues can all differ. The structures for the R1 and R4 outer core oligosaccharides are highly similar, differing only in a single β-linked residue.

Wild type. The core oligosaccharides of E. coli are classified in the art into five different chemical types based on the structure of the distal oligosaccharides: coli R1, E. coli R2, E. coli R3, E. coli R4, and E. coli K12.

In a preferred embodiment, the compositions described herein comprise a glycoconjugate comprising a core oligosaccharide wherein an O-polysaccharide is linked to an O-antigen. In one embodiment, the composition comprises core E. coli chemical type E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. Induce an immune response against at least one of E. coli K12. In another embodiment, the composition includes at least two cores. Induces an immune response against E. coli chemotypes. In another embodiment, the composition has at least three cores. Induces an immune response against E. coli chemotypes. In another embodiment, the composition has at least 4 cores. Induces an immune response against E. coli chemotypes. In another embodiment, the composition has 5 cores. Induces an immune response against all E. coli chemotypes.

In another preferred embodiment, the compositions described herein comprise a glycoconjugate in which the O-polysaccharide does not include a core oligosaccharide bound to the O-antigen. In one embodiment, such compositions are core E. coli chemical type E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. Induce an immune response against at least one of E. coli K12.

this. E. coli serotypes can be characterized according to one of five chemical types. Table B lists exemplary serotypes characterized by chemotype. Serotypes in bold represent the serotypes most commonly associated with the indicated core chemotype. Accordingly, in a preferred embodiment, the composition comprises core E. coli chemical type E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. Inducing an immune response against at least one of E. coli K12, which corresponds to each. Includes an immune response against any one of the E. coli serotypes.

Table B: Core chemotypes and associated species. coli serotype

In some embodiments, the composition is of the R1 formula (e.g., Formula O25a, Formula O6, Formula O2, Formula O1, Formula O75, Formula O4, Formula O16, Formula O8, Formula O18, Formula O9, Formula O13, Formula O20 , selected from saccharides having the formula O21, formula O91 and formula O163), where n is 1 to 100. In some embodiments, the saccharide in the composition is E. It further comprises an E. coli R1 core moiety.

In some embodiments, the composition is of the R1 formula (e.g., Formula O25a, Formula O6, Formula O2, Formula O1, Formula O75, Formula O4, Formula O16, Formula O18, Formula O13, Formula O20, Formula O21, Formula O91 and saccharides having the formula O163), wherein n is 1 to 100, preferably 31 to 100, preferably 31 to 90, more preferably Preferably it is 35 to 90, most preferably 35 to 65. In some embodiments, the saccharide in the composition is a saccharide. It further comprises an E. coli R1 core moiety.

In some embodiments, the composition comprises a structure derived from a serotype having the R2 formula (e.g., selected from saccharides having Formula O21, Formula O44, Formula O11, Formula O89, Formula O162, and Formula O9) and saccharides, where n is 1 to 100, preferably 31 to 100, preferably 31 to 90, more preferably 35 to 90, and most preferably 35 to 65. In some embodiments, the saccharide in the composition is E. It further comprises an E. coli R2 core moiety.

In some embodiments, the composition is selected from a saccharide having the R3 formula (e.g., Formula O25b, Formula O15, Formula O153, Formula O21, Formula O17, Formula O11, Formula O159, Formula O22, Formula O86, and Formula O93 ), wherein n is 1 to 100, preferably 31 to 100, preferably 31 to 90, more preferably 35 to 90, most preferably is 35 to 65. In some embodiments, the saccharide in the composition is E. It further comprises an E. coli R3 core moiety.

In some embodiments, the composition comprises a structure derived from a serotype having the R4 formula (e.g., selected from saccharides having Formula O2, Formula O1, Formula O86, Formula O7, Formula O102, Formula O160, and Formula O166) wherein n is 1 to 100, preferably 31 to 100, preferably 31 to 90, more preferably 35 to 90, and most preferably 35 to 65. In some embodiments, the saccharide in the composition is E. It further comprises an E. coli R4 core moiety.

In some embodiments, the composition comprises a saccharide comprising a structure derived from a serotype having the K-12 chemical type (e.g., selected from a saccharide having the formula O25b and a saccharide having the formula O16), Here, n is 1 to 1000, preferably 31 to 100, preferably 31 to 90, more preferably 35 to 90, and most preferably 35 to 65. In some embodiments, the saccharide in the composition is E. It further comprises an E. coli K-12 core moiety.

In some embodiments, the saccharide comprises a core saccharide. Accordingly, in one embodiment, the O-polysaccharide is E. It further comprises an E. coli R1 core moiety. In another embodiment, the O-polysaccharide is E. It further comprises an E. coli R2 core moiety. In another embodiment, the O-polysaccharide is E. It further comprises an E. coli R3 core moiety. In another embodiment, the O-polysaccharide is E. It further comprises an E. coli R4 core moiety. In another embodiment, the O-polysaccharide is E. It further comprises an E. coli K12 core moiety.

In some embodiments, the saccharide does not include a core saccharide. Accordingly, in one embodiment, the O-polysaccharide is E. It does not contain the E. coli R1 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R2 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R3 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli R4 core moiety. In another embodiment, the O-polysaccharide is E. Does not contain the E. coli K12 core moiety.

4. Conjugated O-antigen

Chemical linking of the O-antigen or, preferably, the O-polysaccharide to a protein carrier can improve the immunogenicity of the O-antigen or O-polysaccharide. However, the variability of polymer size presents a practical problem in production. In commercial use, the size of the saccharide can affect compatibility with various conjugate synthesis strategies, product uniformity, and conjugate immunogenicity. Controlling the expression of Wzz family protein chain length regulators through manipulation of the O-antigen synthesis pathway. Allows production of O-antigen chains of desired length in a variety of Gram-negative bacterial strains, including E. coli.

In one embodiment, the purified saccharide is chemically activated to produce activated saccharide that can react with a carrier protein. Upon activation, each saccharide is separately conjugated to a carrier protein to form a conjugate, or glycoconjugate. As used herein, the term “glycoconjugate” refers to a saccharide covalently linked to a carrier protein. In one embodiment the saccharide is linked directly to the carrier protein. In another embodiment, the saccharide is linked to the protein through a spacer/linker.

Conjugates can be prepared by binding a carrier to the O-antigen at one or multiple sites along the O-antigen, or by activating at least one residue of the core oligosaccharide.

In one embodiment, each saccharide is conjugated to the same carrier protein.

If the protein carrier is the same for two or more saccharides in the composition, the saccharide may be conjugated to the same molecule of the carrier protein (e.g., a carrier molecule having two or more different saccharides conjugated thereto).

In a preferred embodiment, the saccharides are each individually conjugated to a different molecule of the protein carrier (each molecule of the protein carrier has only one type of saccharide conjugated to it). In this embodiment, the saccharide is said to be individually conjugated to a carrier protein.

Chemical activation of the saccharide and subsequent conjugation to a carrier protein can be achieved by the activation and conjugation methods disclosed herein. After conjugation of the polysaccharide to the carrier protein, the glycoconjugate is purified (enriched with respect to the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration/diafiltration operations, precipitation/elution, column chromatography, and depth filtration. After purifying the individual glycoconjugates, they are combined to formulate the immunogenic composition of the present invention.

a. activate. The invention further relates to activated polysaccharides resulting from any of the embodiments described herein, wherein the polysaccharide has been activated with a chemical reagent to generate reactive groups for conjugation to a linker or carrier protein. In some embodiments, the saccharides of the invention are activated prior to conjugation to a carrier protein. In some embodiments, the degree of activation does not significantly reduce the molecular weight of the polysaccharide. For example, in some embodiments, the degree of activation does not cleave the polysaccharide backbone. In some embodiments, the degree of activation does not significantly affect the degree of conjugation as measured by the number of modified lysine residues in a carrier protein (as determined by amino acid analysis), such as CRM ₁₉₇ . For example, in some embodiments, the degree of activation is the lysine residues modified in the carrier protein (as determined by amino acid analysis) compared to the number of lysine residues modified in the carrier protein of the conjugate with a reference polysaccharide at the same degree of activation. It does not significantly increase the number of residues by a factor of 3. In some embodiments, the degree of activation does not increase the level of unconjugated free saccharide. In some embodiments, the degree of activation does not reduce the optimal saccharide/protein ratio.

In some embodiments, the activated saccharide has a percent activation, wherein the number of moles of thiol per saccharide repeat unit of the activated saccharide is 1 to 100%, such as, for example, 2 to 80%, 2 to 50%, 3 to 30%, and 4 to 25%. The level of activation is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16 %, 17%, 18%, 19%, ≥ 20%, ≥ 30%, ≥ 40%, ≥ 50%, ≥ 60%, ≥ 70%, ≥ 80%, or ≥ 90%, or about 100%. Preferably, the degree of activation is at most 50%, more preferably at most 25%. In one embodiment, the degree of activation is up to 20%. The range can be defined by combining an arbitrary minimum value and an arbitrary maximum value.

In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylamino pyridinium tetrafluoroborate (CDAP) to form cyanate ester. The activated polysaccharide is then coupled directly or via spacer (linker) groups to amino groups on the carrier protein (preferably CRM ₁₉₇ or tetanus toxoid).

For example, spacers can be maleimide-activated carrier proteins (e.g. using N-[Y-maleimidobutyroxy]succinimide ester (GMBS)) or haloacetylated carrier proteins (e.g. lyophilized N-succinimidyl bromoacetate (SBA; SIB), N-succinimidyl (4-iodoacetyl) aminobenzoate (SIAB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoate (sulfosuccinimidyl) to the carrier via a thioether linkage obtained after reaction with -SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]propionate (SBAP)). It may be cystamine or cysteamine to provide a thiolated polysaccharide to which it can be coupled. In one embodiment, a cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexane diamine or adipic acid dihydrazide (ADH) and the amino-derivatized saccharide is coupled via a carboxyl group on the protein carrier. It is conjugated to a carrier protein (e.g. CRM ₁₉₇ ) using carbodiimide (e.g. EDAC or EDC) chemistry.

Other suitable techniques for conjugation use carbodiimides, hydrazides, activated esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. The conjugation may include a carbonyl linker that may be formed by reaction of CDI with a free hydroxyl group of the saccharide, which then reacts with a protein to form a carbamate linkage. This involves reduction of the anomeric terminus to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and a CDI carbamate intermediate. can be coupled to amino groups on proteins (CDI chemistry).

b. Molecular Weight. In some embodiments, the glycoconjugate comprises a saccharide having a molecular weight between 10 kDa and 2,000 kDa. In other embodiments, the saccharide has a molecular weight between 50 kDa and 1,000 kDa. In other embodiments, the saccharide has a molecular weight between 70 kDa and 900 kDa. In other embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In other embodiments, the saccharide has a molecular weight between 200 kDa and 600 kDa. In a further embodiment, the saccharide is between 100 kDa and 1000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800 kDa; 150 kDa to 700 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 200 kDa to 1,000 kDa; 200 kDa to 900 kDa; 200 kDa to 800 kDa; 200 kDa to 700 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 200 kDa to 300; 250 kDa to 1,000 kDa; 250 kDa to 900 kDa; 250 kDa to 800 kDa; 250 kDa to 700 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 1,000 kDa; 300 kDa to 900 kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; It has a molecular weight of 500 kDa to 600 kDa. In one embodiment, glycoconjugates having this molecular weight are produced by single-end conjugation. In another embodiment, glycoconjugates having this molecular weight are produced by reductive amination chemistry (RAC) prepared in aqueous buffer. Any pan-digit integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

In some embodiments, the glycoconjugate of the invention has a molecular weight of between 400 kDa and 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or has a molecular weight of 3,000 kDa to 5,000 kDa. In other embodiments, the glycoconjugate has a molecular weight between 500 kDa and 10,000 kDa. In other embodiments, the glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In another embodiment, the glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa. In a further embodiment, the glycoconjugate of the invention has a molecular weight of between 200 kDa and 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa; 750 kDa to 7,500 kDa; 750 kDa to 6,000 kDa; 750 kDa to 5,000 kDa; 750 kDa to 4,000 kDa; 750 kDa to 3,000 kDa; 750 kDa to 2,000 kDa; 750 kDa to 1,500 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 12,500 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 6,000 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or has a molecular weight of 2,000 kDa to 3,000 kDa. In one embodiment, glycoconjugates having this molecular weight are produced by eTEC conjugation described herein. In another embodiment, glycoconjugates having this molecular weight are produced by reductive amination chemistry (RAC). In another embodiment, glycoconjugates having this molecular weight are produced by reductive amination chemistry (RAC) prepared in DMSO.

In a further embodiment, the glycoconjugate of the invention has a molecular weight of between 1,000 kDa and 20,000 kDa; 1,000 kDa to 15,000 kDa; 2,000 kDa to 10,000 kDa; 2000 kDa to 7,500 kDa; 2,000 kDa to 5,000 kDa; 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or has a molecular weight of 5,000 kDa to 7,000 kDa. In one embodiment, glycoconjugates having this molecular weight are produced by reductive amination chemistry (RAC). In another embodiment, glycoconjugates having this molecular weight are produced by reductive amination chemistry (RAC) prepared in DMSO. In another embodiment, glycoconjugates having such molecular weights are produced by eTEC conjugation as described herein.

In a further embodiment, the glycoconjugate of the invention has a molecular weight of between 5,000 kDa and 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; It has a molecular weight of 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa.

The molecular weight of the glycoconjugate can be measured by SEC-MALLS. Any pan-digit integer within any of the above ranges is contemplated as an embodiment of the present disclosure. Glycoconjugates of the invention can also be characterized by the ratio of saccharide to carrier protein (weight/weight). In some embodiments, the ratio (w/w) of polysaccharide to carrier protein in the glycoconjugate is 0.5 to 3 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the ratio of saccharide to carrier protein (w/w) is 0.5 to 2.0, 0.5 to 1.5, 0.8 to 1.2, 0.5 to 1.0, 1.0 to 1.5 or 1.0 to 2.0. In a further embodiment, the ratio of saccharide to carrier protein (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of polysaccharide to carrier protein in the conjugate is 0.9 to 1.1. In some such embodiments, the carrier protein is CRM197.

Glycoconjugates can also be characterized by their molecular size distribution (Kd). Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugate. Size exclusion chromatography (SEC) is used on a gravity-fed column to profile the molecular size distribution of the conjugate. Large molecules excluded from pores in the medium elute faster than small molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically by saccharide assay. For determination of Kd, the column is calibrated to establish the fraction in which molecules are completely excluded (V0), (Kd=0), and the fraction showing maximum retention (Vi), (Kd=1). The fraction (Ve) reached for a specified sample property is related to Kd by the expression Kd = (Ve - Vo)/ (Vi - V0).

c. Free saccharide. Glycoconjugates and immunogenic compositions of the invention may include free saccharides that are not covalently conjugated to a carrier protein but are nonetheless present in the glycoconjugate composition. Free saccharides can be non-covalently associated with (i.e., non-covalently bound to, adsorbed to, or captured by) a glycoconjugate. In a preferred embodiment, the glycoconjugate comprises at most 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises less than about 25% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises up to about 20% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises up to about 15% free polysaccharide compared to the total amount of polysaccharide. In another preferred embodiment, the glycoconjugate is present in an amount of up to about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% free polysaccharide. In a preferred embodiment the glycoconjugate comprises less than about 8% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises up to about 6% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises up to about 5% free polysaccharide compared to the total amount of polysaccharide.

d. Covalent linkage. In other embodiments, the conjugate contains every 5 to 10 saccharide repeat units; Every 2 to 7 saccharide repeat units; Every 3 to 8 saccharide repeat units; Every 4 to 9 saccharide repeat units; Every 6 to 11 saccharide repeat units; Every 7 to 12 saccharide repeat units; Every 8 to 13 saccharide repeat units; Every 9 to 14 saccharide repeat units; Every 10 to 15 saccharide repeat units; every 2 to 6 saccharide repeat units, every 3 to 7 saccharide repeat units; Every 4 to 8 saccharide repeat units; Every 6 to 10 saccharide repeat units; Every 7 to 11 saccharide repeat units; Every 8 to 12 saccharide repeat units; Every 9 to 13 saccharide repeat units; Every 10 to 14 saccharide repeat units; Every 10 to 20 saccharide repeat units; It comprises at least one covalent linkage between the carrier protein and the saccharide for every 4 to 25 saccharide repeat units or for every 2 to 25 saccharide repeat units. In a frequent embodiment, the carrier protein is CRM197. In another embodiment, the at least one linkage between the carrier protein and the saccharide is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 of the polysaccharide. Occurs every 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units. In one embodiment, the carrier protein is CRM197. Any pan-digit integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

e. Lysine residue. Another way to characterize the glycoconjugates of the invention is by the number of lysine residues in the carrier protein (e.g., CRM ₁₉₇ ) that are conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). will be. Evidence for lysine modification of the carrier protein due to covalent linkage to a polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation results in a reduction in the number of lysine residues recovered compared to the carrier protein starting material used to generate the conjugate material. In a preferred embodiment, the degree of conjugation of the glycoconjugate of the invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15 or 10 to 12. In one embodiment, the degree of conjugation of the glycoconjugates of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, It's about 14 or about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugate of the invention is 4 to 7. In some such embodiments, the carrier protein is CRM ₁₉₇ .

The frequency of attachment of saccharide chains to lysines on the carrier protein is another parameter for characterizing the glycoconjugates of the invention. For example, in some embodiments, at least one covalent linkage between the carrier protein and the polysaccharide for every four saccharide repeat units of the polysaccharide. In another embodiment, the covalent linkage between the carrier protein and the polysaccharide occurs at least once for every 10 saccharide repeat units of the polysaccharide. In another embodiment, the covalent linkage between the carrier protein and the polysaccharide occurs at least once for every 15 saccharide repeat units of the polysaccharide. In a further embodiment, the covalent linkage between the carrier protein and the polysaccharide occurs at least once for every 25 saccharide repeat units of the polysaccharide.

f. O-acetylation. In some embodiments, the saccharides of the invention are O-acetylated. In some embodiments, the glycoconjugate is 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 75-100%, 80-100%, Includes saccharides with a degree of O acetylation of 100%, 90-100%, 50-90%, 60-90%, 70-90% or 80-90%. In other embodiments, the degree of O acetylation is ≥ 10%, ≥ 20%, ≥ 30%, ≥ 40%, ≥ 50%, ≥ 60%, ≥ 70%, ≥ 80%, or ≥ 90%, or about 100%. %am. % O-acetylation refers to the percentage of a given saccharide relative to 100% (where each repeat unit is fully acetylated relative to its acetylated structure).

In some embodiments, the glycoconjugate is prepared by reductive amination. In some embodiments, the glycoconjugate is a single-end-linked saccharide, wherein the saccharide is covalently linked directly to a carrier protein. In some embodiments, the glycoconjugate is covalently linked to a carrier protein via a (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC) spacer.

g. Reductive amination. In one embodiment, the saccharide is conjugated to a carrier protein by reductive amination (e.g., U.S. Patent Application Publication Nos. 2006/0228380, 2007/0231340, 2007/0184071 and 2007/0184072, WO 2006/110381, WO 2008/079653 , and described in WO 2008/143709).

Reductive amination involves (1) oxidation of the saccharide, and (2) reduction of the activated saccharide and carrier protein to form the conjugate. Before oxidation, saccharides are optionally hydrolyzed. Mechanical or chemical hydrolysis may be used. Chemical hydrolysis can be performed using acetic acid.

The oxidation step may include reaction with periodate. As used herein, the term “periodate” refers to both periodic salt and periodic acid. The term also includes both metaperiodate (IO4-) and orthoperiodate (IO65-) and various salts of periodate (e.g., sodium periodate and potassium periodate). . In one embodiment the polysaccharide is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NalO4). In another embodiment the polysaccharide is oxidized in the presence of orthoperiodate salt, preferably in the presence of periodic acid.

In one embodiment, the oxidizing agent is a nitroxyl or nitroxide radical compound, such as a piperidine-N-oxy or pyrrolidine-N-oxy compound, that is stable in the presence of an oxidizing agent that selectively oxidizes primary hydroxyls. In the above reaction, the actual oxidizing agent is the N-oxoammonium salt in the catalytic cycle. In one aspect, the stable nitroxyl or nitroxide radical compound is a piperidine-N-oxy or pyrrolidine-N-oxy compound. In one aspect, the stable nitroxyl or nitroxide radical compound is TEMPO (2,2,6,6-tetramethyl-1-piperidinyloxy) or PROXYL (2,2,5,5-tetramethyl-1 -pyrrolidinyloxy) moiety. In one aspect, the stable nitroxyl radical compound is TEMPO or a derivative thereof. In one aspect, the oxidizing agent is a molecule bearing an N-halo moiety. In one aspect, the oxidizing agent is N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, dichloroisocyanuric acid, 1,3,5-trichloro-1,3,5- Triazinine-2,4,6-trione, dibromoisocyanuric acid, 1,3,5-tribromo-1,3,5-triazine-2,4,6-trione, diiodoisocyanurate selected from either nuric acid and 1,3,5-triiodo-1,3,5-triazinine-2,4,6-trione. Preferably the oxidizing agent is N-chlorosuccinimide.

After the oxidation step of the saccharide, the saccharide is said to be activated, hereinafter referred to as “activated”. Activated saccharide and carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment the activated saccharide and carrier protein are co-lyophilised. In another embodiment the activated polysaccharide and carrier protein are lyophilized independently.

In one embodiment, lyophilization occurs in the presence of non-reducing sugars, possible non-reducing sugars including sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinite.

The next step in the conjugation process is to reduce the activated saccharide and the carrier protein using a reducing agent to form the conjugate (so-called reductive amination). Suitable reducing agents are cyanoborohydrides such as sodium cyanoborohydride, sodium triacetoxyborohydride or sodium or zinc borohydrides (in the presence of Bronsted or Lewis acids), amine boranes such as pyridine borane, 2-Picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe'PrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB), borane-pyridine, or borohydride exchange resin. In one embodiment the reducing agent is sodium cyanoborohydride.

In one embodiment, the reduction reaction is carried out in an aqueous solvent (e.g., PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bisin or HEPB selected from, pH 6.0 to 8.5, 7.0 to 8.0, or 7.0 to 7.5), and in another embodiment the reaction is performed in an aprotic solvent. In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvents can be used to reconstitute lyophilized activated polysaccharides and carrier proteins.

At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped using a suitable capping agent. In one embodiment this capping agent is sodium borohydride (NaBH4). After conjugation (reduction reaction and optionally capping), the glycoconjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration/diafiltration operations, tangential flow filtration precipitation/elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration. The glycoconjugate may be purified by diafiltration and/or ion exchange chromatography and/or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment the glycoconjugate is sterile filtered.

In a preferred embodiment, it is selected from any one of O25b, O1a, O2 and O6. Glycoconjugates from E. coli serotypes are prepared by reductive amination. In a preferred embodiment, E. Glycoconjugates from E. coli serotypes O25b, O1a, O2 and O6 are prepared by reductive amination.

In one aspect, the invention relates to a conjugate comprising a carrier protein, for example CRM197, linked to a saccharide of the formula O25B,

Here, n is any integer greater than or equal to 1. In a preferred embodiment, n is at least 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and at most 200, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 60, 59, It is an integer of 58, 57, 56, 55, 54, 53, 52, 51, or 50. The range can be defined by combining an arbitrary minimum value and an arbitrary maximum value. Exemplary ranges include, for example, at least 1 and at most 1000; at least 10 and up to 500; and at least 20 and at most 80. In one preferred embodiment, n is at least 31 and at most 90, more preferably 40 to 90, and most preferably 60 to 85.

In another aspect, the invention relates to a conjugate comprising a carrier protein, for example CRM197, linked to a saccharide having any of the following structures shown in Table A, where n is an integer greater than or equal to 1.

Without wishing to be bound by theory or mechanism, in some embodiments, stable conjugates are believed to require a level of saccharide antigen modification balanced with preserving the structural integrity of important immunogenic epitopes of the antigen.

h. Activation and formation of aldehydes. In some embodiments, the saccharides of the invention are activated resulting in the formation of an aldehyde. In these embodiments where the saccharide is activated, the percent activation (%) (or degree of oxidation (DO)) refers to the moles of saccharide repeat units per mole of aldehyde of the activated polysaccharide. For example, in some embodiments, the saccharide is activated by periodate oxidation of adjacent diols on repeat units of the polysaccharide, resulting in the formation of an aldehyde. Varying the molar equivalent (meq) of sodium periodate to the saccharide repeat unit and the temperature during oxidation results in varying levels of degree of oxidation (DO).

Saccharide and aldehyde concentrations are typically determined by colorimetric assays. An alternative reagent is the TEMPO (2,2,6,6-tetramethylpiperidine 1-oxyl radical)-N-chlorosuccinimide (NCS) combination, which results in the formation of an aldehyde from the primary alcohol group.

In some embodiments, the activated saccharide has a degree of oxidation, wherein the moles of saccharide repeat units per mole of aldehyde of the activated saccharide are 1-100, such as, e.g., 2-80, 2-50, 3. -30, and 4-25. The degree of activation is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, ≥ 20, ≥ 30, ≥ 40 , ≥ 50, ≥ 60, ≥ 70, ≥ 80, or ≥ 90, or about 100. Preferably, the degree of oxidation (DO) is at least 5 and at most 50, more preferably at least 10 and at most 25. In one embodiment, the degree of activation is at least 10 and at most 25. The range can be defined by combining an arbitrary minimum value and an arbitrary maximum value. The degree of oxidation value can be expressed as percent activation (%). For example, in one embodiment, a DO value of 10 refers to 1 activated saccharide repeat unit out of a total of 10 saccharide repeat units in the activated saccharide, in which case a DO value of 10 corresponds to 10% activation. can be displayed.

In some embodiments, the conjugate prepared by reductive amination chemistry comprises a carrier protein and a saccharide, wherein the saccharide comprises a structure selected from any of the following: Formula O1 (e.g., Formula O1A, Formula O1B and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O10 O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A ), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g. Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98 , Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149 , Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187. In some embodiments, the saccharide in the conjugate has a formula where n is an integer from 1 to 1000, 5 to 1000, preferably 31 to 100 or 31 to 90, more preferably 35 to 90, most preferably 35 to 65. Includes.

i. Single-end linked conjugate. In some embodiments, the conjugate is a single-end-linked saccharide, wherein the saccharide is covalently attached to a carrier protein at one end of the saccharide. In some embodiments, the single-end-linked conjugated polysaccharide has a terminal saccharide. For example, a conjugate is single-end linked when one of the ends of the polysaccharide (the terminal saccharide residue) is covalently attached to a carrier protein. In some embodiments, the conjugate is single-end linked when the terminal saccharide residue of the polysaccharide is covalently attached to the carrier protein via a linker. Such linkers include, for example, cystamine linker (A1), 3,3'-dithio-bis(propanoic acid dihydrazide) linker (A4), and 2,2'-dithio-N,N'-bis( ethane-2,1-diyl)bis(2-(aminooxy)acetamide) linker (A6).

In some embodiments, the saccharide is conjugated to a carrier protein via a 3-deoxy-d-manno-oct-2-ulosonic acid (KDO) moiety to form a single-end linked conjugate.

In some embodiments, the conjugate is preferably not a bioconjugate. The term “bioconjugate” refers to a conjugate between a protein (e.g., a carrier protein) and an antigen, e.g., an O antigen (e.g., O25B) produced in a host cell background, wherein the host cell machinery binds the antigen to Linked to a protein (e.g. N-linked). Glycoconjugates include bioconjugates, as well as sugar antigens (e.g., oligo- and poly-conjugates) prepared by means that do not require preparation of the conjugate in a host cell, e.g., conjugation by chemical linkage of proteins and saccharides. Saccharide)-protein conjugates.

j. Thiol activated saccharide. In some embodiments, the saccharides of the invention are thiol activated. In these embodiments where the saccharide is thiol activated, the percent activation (%) refers to the moles of thiol per saccharide repeat unit of the activated polysaccharide. Saccharide and thiol concentrations are typically determined by Ellman's assay for quantification of sulfhydryls. For example, in some embodiments, the saccharide involves activation of 2-keto-3-deoxyoctanoic acid (KDO) using a disulfide amine linker. In some embodiments, the saccharide is covalently linked to a carrier protein through a divalent heterobifunctional linker (also referred to herein as a “spacer”). The linker preferably provides a thioether bond between the saccharide and the carrier protein, resulting in a glycoconjugate referred to herein as a “thioether glycoconjugate.” In some embodiments, the linker further provides carbamate and amide linkages, for example, (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC).

In some embodiments, the single-end linked conjugate comprises a carrier protein and a saccharide, wherein the saccharide comprises a structure selected from any of the following: Formula O1 (e.g., Formula O1A, Formula O1B, and Formula O1C ), Formula O2, Formula O3, Formula O4 (e.g. Formula O4:K52 and Formula O4:K6), Formula O5 (e.g. Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g. For example, Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17 , Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24 , Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38 , Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52 , Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g., Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116 , Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167 , Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, formula O185, formula O186 and formula O187. In some embodiments, the saccharide in the conjugate comprises a formula where n is an integer from 1 to 1000, 5 to 1000, preferably 31 to 100, more preferably 35 to 90, and most preferably 35 to 65.

For example, in one embodiment, the single-end linked conjugate comprises a saccharide and a carrier protein having a structure selected from Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O52, Formula O97, and Formula O101. And, where n is an integer from 1 to 10.

5. eTEC conjugate

In one aspect, the present invention provides a method of E. coli as described above, generally covalently conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Glycoconjugates comprising saccharides derived from E. coli (e.g., as described in US Patent 9517274 and International Patent Application Publication WO2014027302, incorporated herein by reference in their entirety), and immunogenicity comprising such glycoconjugates It relates to compositions and methods of making and using such glycoconjugates and immunogenic compositions. The glycoconjugate comprises a saccharide covalently conjugated to a carrier protein through one or more eTEC spacers, wherein the saccharide is covalently conjugated to an eTEC spacer through a carbamate linkage, and wherein the carrier protein has an amide linkage. It is covalently bonded to the eTEC spacer. The eTEC spacer contains seven linear atoms (i.e. -C(O)NH(CH2)2SCH2C(O)-) and provides stable thioether and amide bonds between the saccharide and the carrier protein.

The eTEC linked glycoconjugates of the present invention can be represented by the general formula (I):

Here the atoms containing the eTEC spacer are contained in the central box.

In the glycoconjugate of the present invention, the saccharide may be polysaccharide or oligosaccharide.

The carrier proteins incorporated in the glycoconjugates of the invention are generally selected from the group of carrier proteins suitable for this purpose, as further described herein or known to those skilled in the art. In certain embodiments, the carrier protein is CRM197.

In another aspect, the present invention provides a method of preparing a glycoconjugate comprising a saccharide described herein conjugated to a carrier protein via an eTEC spacer, comprising: a) reacting the saccharide with a carbonic acid derivative in an organic solvent; , generating activated saccharide; b) reacting the activated saccharide with cystamine or cysteamine or a salt thereof to produce a thiolated saccharide; c) reacting the thiolated saccharide with a reducing agent to produce an activated thiolated saccharide comprising at least one free sulfhydryl moiety; d) reacting the activated thiolated saccharide with an activated carrier protein comprising at least one α-haloacetamide group to produce a thiolated saccharide-carrier protein conjugate; and e) a thiolated saccharide-carrier protein conjugate comprising: (i) a first capping reagent capable of capping the unconjugated α-haloacetamide group of the activated carrier protein; and/or (ii) reacting with a second capping reagent capable of capping the unconjugated free sulfhydryl moieties of the activated thiolated saccharide; thereby generating an eTEC linked glycoconjugate.

In a frequent embodiment, the carbonic acid derivative is 1,1'-carbonyl-di-(1,2,4-triazole) (CDT) or 1,1'-carbonyldiimidazole (CDI). Preferably, the carbonic acid derivative is CDT and the organic solvent is a polar aprotic solvent such as dimethylsulfoxide (DMSO). In a preferred embodiment, the thiolated saccharide is produced by reaction of an activated saccharide with a bifunctional symmetric thioalkylamine reagent, cystamine or a salt thereof. Alternatively, thiolated saccharides can be formed by reaction of activated saccharides with cysteamine or salts thereof. The eTEC linked glycoconjugate produced by the method of the present invention can be represented by the general formula (I).

In a frequent embodiment, the first capping reagent is N-acetyl-L-cysteine, which reacts with an unconjugated α-haloacetamide group on a lysine residue of the carrier protein and covalently bonds to the activated lysine residue via a thioether linkage. It forms an S-carboxymethylcysteine (CMC) residue linked to.

In another embodiment, the second capping reagent is iodoacetamide (IAA), which reacts with the unconjugated free sulfhydryl groups of the activated thiolated saccharide to provide the capped thioacetamide. Frequently, step e) involves capping with both a first capping reagent and a second capping reagent. In certain embodiments, step e) comprises capping with N-acetyl-L-cysteine as the first capping reagent and IAA as the second capping reagent.

In some embodiments, capping step e) further comprises reaction with a reducing agent, such as DTT, TCEP or mercaptoethanol, after reaction with the first and/or second capping reagent.

The eTEC linked glycoconjugates and immunogenic compositions of the invention may comprise free sulfhydryl moieties. In some cases, activated thiolated saccharides formed by the methods provided herein will contain multiple free sulfhydryl residues, some of which may not undergo covalent conjugation to the carrier protein during the conjugation step. . These residual free sulfhydryl residues are capped by reaction with a thiol-reactive capping reagent, such as iodoacetamide (IAA), to cap the potentially reactive functional group. Other thiol-reactive capping reagents, such as maleimide containing reagents, are also contemplated.

Additionally, the eTEC linked glycoconjugates and immunogenic compositions of the invention may include residual unconjugated carrier proteins, which may include activated carrier proteins that have undergone modifications during the capping process step.

In some embodiments, step d) further comprises providing an activated carrier protein comprising one or more α-haloacetamide groups prior to reacting the activated thiolated saccharide with the activated carrier protein. In frequent embodiments, the activated carrier protein comprises one or more α-bromoacetamide groups.

In another aspect, the invention provides an eTEC linked glycoconjugate comprising a saccharide described herein conjugated to a carrier protein via an eTEC spacer, produced according to any of the methods disclosed herein.

In some embodiments, the carrier protein is CRM197, and the covalent linkage between CRM197 and the polysaccharide through an eTEC spacer occurs at least once for every 4, 10, 15, or 25 saccharide repeat units of the polysaccharide.

For each aspect of the invention, in certain embodiments of the methods and compositions described herein, the eTEC linked glycoconjugate is a saccharide described herein, such as E. Contains saccharides derived from coli.

In another aspect, the present invention provides a method of preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject comprising administering to the subject an immunologically effective amount of an immunogenic composition of the present invention, wherein said immunogenic composition The raw composition includes an eTEC linked glycoconjugate comprising the saccharide described herein. In some embodiments, the saccharide is E. It is derived from coli.

In some embodiments, the eTEC linked glycoconjugate comprises a carrier protein and a saccharide, wherein the saccharide comprises a structure selected from any of the following: Formula O1 (e.g., Formula O1A, Formula O1B, and Formula O1C ), Formula O2, Formula O3, Formula O4 (e.g. Formula O4:K52 and Formula O4:K6), Formula O5 (e.g. Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g. For example, Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17 , Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24 , Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38 , Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52 , Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g., Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116 , Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167 , Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, formula O185, formula O186 and formula O187. In some embodiments, the saccharide in the conjugate comprises a formula where n is an integer from 1 to 1000, 5 to 1000, preferably 31 to 100, more preferably 35 to 90, and most preferably 35 to 65.

The number of lysine residues in the carrier protein that are conjugated to a saccharide can be characterized as the range of lysines conjugated. For example, in some embodiments of the immunogenic composition, CRM197 may comprise 4 to 16 of 39 lysine residues covalently linked to a saccharide. Another way to express this parameter is that between about 10% and about 41% of the CRM197 lysines are covalently linked to saccharides. In other embodiments, CRM197 may comprise 2 to 20 of 39 lysine residues covalently linked to a saccharide. Another way to express this parameter is that about 5% to about 50% of the CRM197 lysines are covalently linked to saccharides.

In frequent embodiments, the carrier protein is CRM ₁₉₇ , and the covalent linkage between CRM ₁₉₇ and the polysaccharide through an eTEC spacer occurs at least once for every 4, 10, 15 or 25 saccharide repeat units of the polysaccharide. do.

In other embodiments, the conjugate contains every 5 to 10 saccharide repeat units; Every 2 to 7 saccharide repeat units; Every 3 to 8 saccharide repeat units; Every 4 to 9 saccharide repeat units; Every 6 to 11 saccharide repeat units; Every 7 to 12 saccharide repeat units; Every 8 to 13 saccharide repeat units; Every 9 to 14 saccharide repeat units; Every 10 to 15 saccharide repeat units; every 2 to 6 saccharide repeat units, every 3 to 7 saccharide repeat units; Every 4 to 8 saccharide repeat units; Every 6 to 10 saccharide repeat units; Every 7 to 11 saccharide repeat units; Every 8 to 12 saccharide repeat units; Every 9 to 13 saccharide repeat units; Every 10 to 14 saccharide repeat units; Every 10 to 20 saccharide repeat units; or at least one covalent linkage between the carrier protein and the saccharide for every 4 to 25 saccharide repeat units.

In another embodiment, the at least one linkage between the carrier protein and the saccharide is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 of the polysaccharide. Occurs every 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units.

6. Carrier protein

The component of the glycoconjugate of the present invention is a carrier protein to which saccharide is conjugated. The terms “protein carrier” or “carrier protein” or “carrier” may be used interchangeably herein. The carrier protein must be modifiable according to standard conjugation procedures.

One component of the conjugate is a carrier protein to which O-polysaccharide is conjugated. In one embodiment, the conjugate comprises a carrier protein conjugated to a core oligosaccharide of O-polysaccharide. In one embodiment, the conjugate comprises a carrier protein conjugated to the O-antigen of an O-polysaccharide.

The terms “protein carrier” or “carrier protein” or “carrier” may be used interchangeably herein. The carrier protein must be modifiable according to standard conjugation procedures.

In a preferred embodiment, the carrier protein of the conjugate is TT, DT, DT mutant (e.g. CRM197), H. Influenza protein D, PhtX, PhtD, PhtDE fusions (especially those described in WO 01/98334 and WO 03/54007), translated pneumolysin, PorB, N19 protein, PspA, OMPC, C. is independently selected from either toxin A or B of D. difficile and PsaA. In one embodiment, the carrier protein of the conjugate of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the conjugate of the invention is TT (tetanus toxoid). In another embodiment, the carrier protein of the conjugate of the invention is PD (Haemophilus influenzae protein D - see for example EP 0 594 610 B). In some embodiments, the carrier protein comprises poly(L-lysine) (PLL).

In a preferred embodiment, the saccharide is conjugated to the CRM197 protein. The CRM197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM197 is produced by C. diphtheriae infected with the non-toxigenic phage β197tox- generated by nitrosoguanidine mutagenesis of toxogenic corynephage beta. The CRM197 protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution (glycine to glutamic acid) in the mature protein and eliminates the toxic properties of diphtheria toxin. CRM197 protein is a safe and effective T-cell dependent carrier for saccharides.

Accordingly, in some embodiments, the conjugate of the invention comprises CRM ₁₉₇ as a carrier protein, wherein the saccharide is covalently linked to CRM ₁₉₇ .

In a preferred embodiment, the carrier protein of the glycoconjugate is DT (diphtheria toxin), TT (tetanus toxoid) or fragment C of TT, CRM197 (a non-toxic but antigenically identical variant of diphtheria toxin), other DT mutants (such as CRM176, CRM228, CRM 45 (Uchida et al. J. Biol. Chem. 218; 3838-3844, 1973), CRM9, CRM45, CRM102, CRM103 or CRM107; and Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc, 1992; mutations or deletions of Glu-148 to Asp, Gln or Ser and/or Ala 158 to Giy and other mutations disclosed in US 4709017 or US 4950740; at least one residue Lys 516, Lys 526, mutations at Phe 530 and/or Lys 534 and other mutations disclosed in US 5917017 or US 6455673; or fragments disclosed in US 5843711), pneumococcal pneumolysin containing ply translated in some manner (Kuo et al (1995 ) Infect lmmun 63;2706-13), e.g. dPLY-GMBS (WO 04081515, PCT/EP2005/010258) or dPLY-formol, PhtX, e.g. PhtA, PhtB, PhtD, PhtE (PhtA, PhtB, PhtD or The sequence of PhtE is disclosed in WO 00/37105 or WO 00/39299) and fusions of Pht proteins, such as PhtDE fusion, PhtBE fusion, Pht AE (WO 01/98334, WO 03/54007, WO2009/000826), OMPC (meningococcal outer membrane protein - usually derived from N. meningitidis serogroup B - EP0372501), PorB (from N. meningitidis), PD (Haemophilus influenzae protein D - see e.g. EP 0 594 610 B ), or their immunological functional equivalents, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471 177), cytokines, lymphokines, growth factor or hormone (WO 91/01146), an artificial protein containing multiple human CD4+ T cell epitopes from various pathogen-derived antigens (Falugi et al (2001) Eur J Immunol 31; 3816-3824), such as N19 protein (Baraldoi et al (2004) Infect lmmun 72; 4884-7), pneumococcal surface protein PspA (WO 02/091998), iron uptake protein (WO 01/72337), C. Difficile toxin A or B (WO 00/61761), transferrin binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (especially its non-toxic mutants (e.g. substitution at glutamic acid 553) It is selected from the group consisting of exotoxin A (Uchida Cameron DM, RJ Collier. 1987. J. Bacteriol. 169:4967-4971)) and other proteins such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine Serum albumin (BSA) or purified protein derivative of tuberculin (PPD) can also be used as carrier protein.Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., International Patent Application No. WO 2004/ 083251), E. coli LT, E. coli ST, and exotoxin A from Pseudomonas aeruginosa.

In some embodiments, the carrier protein is, for example, CRM197, diphtheria toxin fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or Pseudomonas toxoid. Exotoxin A from Aeruginosa; blood. Aeruginosa detoxified exotoxin A (EPA), maltose binding protein (MBP), flagellin, S. aureus hemolysin A, coagulation factor A, coagulation factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its translated variants, seeds. Jejuni ( C. jejuni ) AcrA, Mr. It is selected from either Jejuni natural glycoprotein and Streptococcal C5a peptidase (SCP). In one embodiment, the carrier protein is detoxified Pseudomonas exotoxin (EPA). In another embodiment, the carrier protein is not detoxified Pseudomonas exotoxin (EPA). In one embodiment, the carrier protein is flagellin. In another embodiment, the carrier protein is not flagellin.

In a preferred embodiment, the carrier protein of the glycoconjugate is TT, DT, DT mutant (e.g. CRM197), H. Influenza protein D, PhtX, PhtD, PhtDE fusions (especially those described in WO 01/98334 and WO 03/54007), translated pneumolysin, PorB, N19 protein, PspA, OMPC, C. is independently selected from the group consisting of toxin A or B of D. difficile and PsaA. In one embodiment, the carrier protein of the glycoconjugate of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is TT (tetanus toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (Haemophilus influenzae protein D - see for example EP 0 594 610 B).

In a preferred embodiment, the capsular saccharide of the invention is conjugated to the CRM197 protein. The CRM197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM197 is produced by C. diphtheriae infected with the non-toxigenic phage β197tox- generated by nitrosoguanidine mutagenesis of toxogenic corynephage beta (Uchida, T. et al. 1971, Nature New Biology 233: 8-11). The CRM197 protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution (glycine to glutamic acid) in the mature protein and eliminates the toxic properties of diphtheria toxin. CRM197 protein is a safe and effective T-cell dependent carrier for saccharides. Additional details about CRM197 and its production can be found, for example, in US 5,614,382.

Accordingly, in a frequent embodiment, the glycoconjugate of the invention comprises CRM197 as a carrier protein, wherein the capsular polysaccharide is covalently linked to CRM197.

In a further embodiment, the carrier protein of the glycoconjugate is SCP (Streptococcal C5a peptidase). All human isolates of β-hemolytic streptococci produce the highly conserved cell wall protein SCP (Streptococcal C5a peptidase), which specifically inactivates C5a. The scp gene encodes a polypeptide containing 1,134 to 1,181 amino acids (Brown et al., PNAS, 2005, vol. 102, no. 51 pages 18391-18396). The first 31 residues are the export signal pre-sequence and are removed upon passage through the cytoplasmic membrane. The next 68 residues serve as pro-sequences and must be removed to produce active SCP. The next 10 residues can be removed without loss of protease activity. At the other end are four consecutive 17-residue motifs starting with Lys-1034, followed by cell sorting and cell wall attachment signals. This combined signal consists of a 20-residue hydrophilic sequence containing the LPTTND sequence, a 17-residue hydrophobic sequence, and a short basic carboxyl terminus.

SCP can be divided into domains (see Figure 1b in Brown et al., PNAS, 2005, vol. 102, no. 51 pages 18391-18396). These domains include the Pre/Pro domain (containing the export signal pre-sequence (typically the first 31 residues) and the pro-sequence (typically the next 68 residues)), the protease domain (split into two parts (protease part 1 ( protease domain part 2 (typically residues 89-333/334) and protease domain part 2 (typically residues 467/468-583/584), protease-associating domain (PA domain) (typically residues 333/334-467/468), 3 Canine fibronectin type III (Fn) domain (Fn1, typically residues 583/584-712/713; Fn2, typically residues 712/713-928/929/930; typically Fn3, residues 929/930-1029/1030/ 1031) and a cell wall anchor domain (usually residues 1029/1030/1031 at the C-terminus).

In one embodiment, the carrier protein of the glycoconjugate of the invention is SCP from GBS (SCPB). An example of SCPB is provided in SEQ ID NO: 3 of WO97/26008. See also SEQ ID NO: 3 of WO00/34487.

In another embodiment, the carrier protein of the glycoconjugate of the invention is SCP from GAS (SCPA). Examples of SCPA can be found in WO97/26008 in SEQ ID NO: 1 and SEQ ID NO: 2. See also SEQ ID NOs: 1, 2 and 23 of WO00/34487.

In a further embodiment, the carrier protein of the glycoconjugate of the invention is SCP as set forth in SEQ ID NO: 150 or 151 of WO2014/136064.

B. Adjuvant

In some aspects, the immunogenic compositions disclosed herein may further include at least 1, 2, or 3 adjuvants. The term “adjuvant” refers to a compound or mixture that enhances the immune response to an antigen. The antigen may act primarily as a delivery system, primarily as an immune modulator, or may have strong features of both. Suitable adjuvants include those suitable for use in mammals, including humans.

Examples of known suitable delivery-system type adjuvants that can be used in humans include alum (e.g. aluminum phosphate, aluminum sulfate or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w/v) Squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)), water-in-oil emulsions such as montanides, and poly(D,L-lactide- co-glycolide) (PLG) including, but not limited to, microparticles or nanoparticles.

In one aspect, the immunogenic compositions disclosed herein include an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a further aspect, the immunogenic compositions disclosed herein include aluminum phosphate or aluminum hydroxide as an adjuvant. In one aspect, the immunogenic composition disclosed herein comprises 0.1 mg/mL to 1 mg/mL or 0.2 mg/mL to 0.3 mg/mL of elemental aluminum in the form of aluminum phosphate. In one aspect, the immunogenic composition disclosed herein comprises about 0.25 mg/mL of elemental aluminum in the form of aluminum phosphate.

Examples of known suitable immune modulating type adjuvants that can be used in humans include saponin extract from the bark of the Aquila tree (QS21, Quil A), TLR4 agonists such as MPL (monophosphoryl lipid A), 3DMPL (3-O -Deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as various interleukins (e.g., IL-2, IL-12) or GM-CSF, AS01, etc. .

Examples of known suitable immune modulating type adjuvants with both delivery and immune modulating characteristics that can be used in humans include ISCOMS (see, e.g., Sjoelander et al. (1998) J. Leukocyte Biol. 64:713; WO 90/03184, WO 96/11711, WO 00/48630, WO 98/36772, WO 00/41720, WO 2006/134423 and WO 2007/026190), or GLA-EM, a combination of a TLR4 agonist and an oil-in-water emulsion. Including, but not limited to.

For veterinary applications, including but not limited to animal testing, complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl- D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl -D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A, referred to as MTP-PE) ), and RIBI, which contains three components extracted from bacteria in a 2% squalene/Tween 80 emulsion: monophosphoryl lipid A, trehalose dimycolate, and cell wall skeleton (MPL+TDM+CWS).

Additional exemplary adjuvants to enhance the effectiveness of the immunogenic compositions disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (including other specific immunostimulants such as muramyl peptide (see below) or (with or without bacterial cell wall components), such as, for example, (a) SAF containing 10% squalane, 0.4% Tween 80, 5% pluronic-blocking polymer L121, and thr-MDP, microfluidized as a submicron emulsion; vortexed to produce a larger particle size emulsion, and (b) 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and RIBI™ Adjuvant System (RAS) containing cell wall skeleton (CWS), (Ribi Immunochem, Hamilton, MT, USA), preferably MPL+CWS (DETOX™); (2) Saponin adjuvants, such as QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA, USA), ABISCO® (Isconova, Sweden), or iso ISCOMATRIX® (Commonwealth Serum Laboratories, Australia) (may be used) or particles produced therefrom, such as ISCOM (immunostimulatory complex) (ISCOMS may be free of additional detergents) ) (e.g. WO 00/07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) Cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99/44636)) , interferons (eg, gamma interferon), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) (see e.g. GB2220211, EP0689454) (see e.g. WO 00/56358); (6) Combinations of 3dMPL with, for example, QS21 and/or oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99/52549); (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (e.g. WO 01/21207) or at least one further nonionic surfactant, such as polyoxyethylene alkyl ether in combination with octoxynol or ester surfactants (e.g. WO 01/21152); (9) Saponins and immunostimulatory oligonucleotides (e.g. CpG oligonucleotides) (e.g. WO 00/62800); (10) Particles of immunostimulants and metal salts (see, for example, WO 00/23105); (11) saponin and oil-in-water emulsions (e.g. WO 99/11241); (12) saponin (e.g. QS21)+3dMPL+IM2 (optionally+sterol) (e.g. WO 98/57659); (13) Other substances that act as immunostimulants to enhance the efficacy of the composition. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-Acetylmuramyl-L-alanyl-D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethyl Amine MTP-PE) and the like.

In another embodiment, the adjuvant is liposomal Quillaja Saponaria-21 (QS21) comprising 5.1 mg/mL QS-21, 5 mM succinate, 60 mM NaCl, 0.1% PS80, pH 5.6. It's a formulation. In a further embodiment, the adjuvant is 15 mM phosphate buffer, pH 6.1, 4 mg/mL 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 mg/mL cholesterol, 0.2 mg /mL Liposomal Monophosphoryl Lipid A (MPLA, synthetic, PHAD®, Avanti) formulation containing MPLA (Lot 00714551-0018-2XLipoMPL) (with liposomal particle size of 71 nm as determined by dynamic light scattering) am. In yet a further embodiment, the adjuvant is 15 mM phosphate buffer, pH 6.1, 4 mg/mL DOPC, 1 mg/mL cholesterol, 0.2 mg/mL MPLA, and 0.2 mg/mL QS-21 (Lot 00714551-0018- 2XlipoMQ) (with a particle size of 75 nm for MPLA-QS21 liposomes determined by dynamic light scattering).

In a further aspect of the disclosure, the immunogenic composition as disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore these terms are used interchangeably unless otherwise indicated. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation status of a CpG immunostimulatory motif generally refers to the cytosine residue of the dinucleotide. Immunostimulatory oligonucleotides containing at least one unmethylated CpG dinucleotide contain a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond and via binding to Toll-like receptor 9 (TLR-9). It is an oligonucleotide that activates the immune system. In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9 but not as strongly as if the CpG motif(s) were unmethylated. CpG immunostimulatory oligonucleotides may contain one or more palindromic structures, which in turn may contain CpG dinucleotides. CpG oligonucleotides are described in US Pat. No. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.

Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C and P and are described in more detail in WO 2010/125480 on page 3, line 22 to page 12, line 36. The methods of the present disclosure include the use of these different classes of CpG immunostimulatory oligonucleotides.

V. Purification and production methods

In one aspect, the disclosure relates to methods of producing FimH mutated polypeptides. Such methods may include, for example, culturing mammalian cells under suitable conditions, thereby expressing the Fim H mutant polypeptide. The method may further include harvesting the polypeptide from the culture. The process may further include purifying the polypeptide.

In some aspects, the method produces FimH mutant polypeptides at a yield of about 0.1 g/L to 0.5 g/L. In some aspects, the yield of the FimH mutated polypeptide is at least about 1 mg/L, at least about 2 mg/L, at least about 3 mg/L, at least about 4 mg/L, at least about 5 mg/L, or at least about 6 mg. /L, at least about 7 mg/L, at least about 8 mg/L, at least about 9 mg/L, at least about 10 mg/L, at least about 11 mg/L, at least about 12 mg/L, at least about 13 mg/L L, at least about 14 mg/L, at least about 15 mg/L, at least about 16 mg/L, at least about 17 mg/L, at least about 18 mg/L, at least about 19 mg/L, at least about 20 mg/L , at least about 25 mg/L, at least about 30 mg/L, at least about 35 mg/L, at least about 40 mg/L, at least about 45 mg/L, at least about 50 mg/L, at least about 55 mg/L, At least about 60 mg/L, at least about 65 mg/L, at least about 70 mg/L, at least about 75 mg/L, at least about 80 mg/L, at least about 85 mg/L, at least about 90 mg/L, at least About 95 mg/L, or at least about 100 mg/L.

In some aspects, cell cultures suitable for the present disclosure are fed-batch cultures. As used herein, the term “fed-batch culture” refers to a cell culture method in which additional components are provided to the culture at a time or times after the start of the culture process. These provided components typically include nutritional components for cells that are depleted during the culture process. Fed-batch culture is typically stopped at some point and the cells and/or components in the medium are harvested and optionally isolated. In some aspects, fed-batch culture includes basal medium supplemented with feed medium.

In some aspects, cells may be grown in batch or fed-batch culture, where the culture is terminated after sufficient expression of the polypeptide, after which the expressed polypeptide is harvested and optionally isolated. In some aspects, cells may be grown in perfusion culture, wherein the culture is not terminated and new nutrients and other components are periodically or continuously added to the culture, during which the expressed polypeptides are periodically or continuously harvested. .

In some aspects, the expression level or activity of the FimH mutant polypeptide is determined by, for example, E. at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, compared to expression of the FimH mutant polypeptide in a bacterial cell, such as an E. coli host cell. It is increased by at least 60 times, at least 70 times, at least 75 times, at least 80 times, at least 90 times, and at least 100 times.

In some aspects, cells can be grown in small-scale reaction vessels to form cell cultures ranging in volume from a few milliliters to several liters. In some aspects, the cells may be grown in a large-scale commercial bioreactor to form a cell culture, wherein the cell culture is approximately at least 1 liter to 10, 100, 250, 500, 1,000, 2,500, 5,000, 8,000, 10,000. , a volume of 12,000 liters or more, or any volume in between. In some embodiments, the cell culture size is 10 L to 5000 L, 10 L to 10,000 L, 10 L to 20,000 L, 10 L to 50,000 L, 40 L to 50,000 L, 100 L to 50,000 L, 500 L to 50,000 L. L, 1000 L to 50,000 L, 2000 L to 50,000 L, 3000 L to 50,000 L, 4000 L to 50,000 L, 4500 L to 50,000 L, 1000 L to 10,000 L, 1000 L to 20,000 L, 1000 L to 25 ,000 L, It may range from 1000 L to 30,000 L, 15 L to 2000 L, 40 L to 1000 L, 100 L to 500 L, 200 L to 400 L, or any integer in between.

The temperature of a cell culture is primarily determined by the temperature range at which the cell culture remains viable, the temperature range at which high levels of polypeptides are produced, the temperature at which production or accumulation of metabolic waste is minimized, and/or those deemed important by the expert. or may be selected based on any combination of other factors. As one non-limiting example, CHO cells grow well and produce high levels of proteins or polypeptides at approximately 37°C. In general, most mammalian cells are capable of growing well and/or producing high levels of proteins or polypeptides within the range of about 25°C to 42°C, although the methods taught by the present disclosure are not limited to these temperatures. No. Certain mammalian cells are capable of growing well and/or producing high levels of proteins or polypeptides within the range of about 35°C to 40°C. In certain aspects, the cell culture is heated to 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C at least once during the cell culture process. , 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C.

As used herein, the terms “culture” and “cell culture” refer to a population of cells suspended in medium under conditions suitable for survival and/or growth of the population of cells. As will be apparent to those skilled in the art, in some aspects these terms as used herein refer to a combination comprising a cell population and the medium in which the population is suspended. In some aspects, the cells of the cell culture include mammalian cells.

In some aspects, cells can be grown in one of a variety of chemically defined media, where the components of the media are known and controlled. In some aspects, cells may be grown in complex media where not all components of the media are known and/or controlled. Chemically defined growth media for mammalian cell culture have been extensively developed and published over the past several decades. Since all components of the defined medium are well characterized, the defined medium does not contain complex additives such as serum or hydrolysates. Initial media formulations were developed to allow cell growth and maintenance of viability with little or no concern for protein production. More recently, media formulations have been developed with the express purpose of supporting highly productive recombinant protein producing cell cultures. Such media are preferred for use in the methods of the present invention. These media generally contain large amounts of nutrients and especially amino acids to support the growth and/or maintenance of cells at high densities. If necessary, these media may be modified by those skilled in the art for use in the methods of the present invention. For example, one of ordinary skill in the art can reduce the amount of phenylalanine, tyrosine, tryptophan and/or methionine in these media for use as basal media or feed media in methods as disclosed herein.

Since not all components of complex media are well characterized, complex media may contain additives such as simple and/or complex carbon sources, simple and/or complex nitrogen sources, and serum, among other things. In some aspects, complex media suitable for the present invention contain additives, such as hydrolysates, in addition to other components of the defined media as described herein. In some aspects, a defined medium typically contains approximately 50 chemical entities at known concentrations in water. Most of these also contain one or more well-characterized proteins, such as insulin, IGF-1, transferrin or BSA, but others do not require protein components and are therefore referred to as protein-free defined media. The typical chemical composition of a medium falls into five broad categories: amino acids, vitamins, mineral salts, trace elements, and other categories that defy neat categorization.

Cell culture media may optionally be supplemented with supplemental components. As used herein, the term “supplementary ingredients” includes hormones and/or other growth factors, certain ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (usually refers to ingredients that enhance growth and/or survival above a minimum rate, including, but not limited to, inorganic compounds present at very low final concentrations), amino acids, lipids, and/or glucose or other energy sources. In some aspects, supplemental components may be added to the initial cell culture. In some aspects, supplemental components may be added after the start of cell culture. Typically, trace elements refer to various inorganic salts contained at micromolar or lower levels. For example, commonly included trace elements are zinc, selenium, copper, etc. In some aspects, iron (ferrous or ferric salt) may be included as a trace element in the initial cell culture medium at micromolar concentrations. Manganese is also frequently included in trace elements as a divalent cation (MnCl2 or MnSO4) in the nanomolar to micromolar concentration range. A number of less common trace elements are usually added in nanomolar concentrations.

In some aspects, the medium used in the methods of the invention may be used in cell culture, for example, 1 x 106 cells/mL, 5 x 106 cells/mL, 1 x 107 cells/mL, 5 x 107 cells/mL, 1 It is a suitable medium to support high cell densities such as mL or 5X108 cells/mL. In some aspects, the cell culture is a fed-batch culture of mammalian cells, preferably a fed-batch culture of CHO cells.

In some aspects, the cell culture medium includes phenylalanine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes tyrosine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes tryptophan at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes methionine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes leucine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes serine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes threonine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes glycine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or two of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Contain at a concentration of 0.5 to 1 mM. In some aspects, the cell culture medium includes phenylalanine and tyrosine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes phenylalanine and tryptophan at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes phenylalanine and methionine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes tyrosine and tryptophan at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes tyrosine and methionine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium includes tryptophan and methionine at a concentration of less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or three of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Contain at a concentration of 0.5 to 1 mM. In some aspects, the cell culture medium includes phenylalanine, tyrosine, and tryptophan at a concentration of less than 2 mM, less than 1 mM, 0.1 to 2 mM, 0.1 to 1 mM, 0.5 to 1.5 mM, or 0.5 to 1 mM. In some aspects, the cell culture medium includes phenylalanine, tyrosine, and methionine at a concentration of less than 2 mM, less than 1 mM, 0.1 to 2 mM, 0.1 to 1 mM, 0.5 to 1.5 mM, or 0.5 to 1 mM. In some aspects, the cell culture medium includes phenylalanine, tryptophan, and methionine at a concentration of less than 2 mM, less than 1 mM, 0.1 to 2 mM, 0.1 to 1 mM, 0.5 to 1.5 mM, or 0.5 to 1 mM. In some aspects, the cell culture medium includes tyrosine, tryptophan, and methionine at concentrations of less than 2 mM, less than 1 mM, 0.1 to 2 mM, 0.1 to 1 mM, 0.5 to 1.5 mM, or 0.5 to 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or Contain at a concentration of 0.5 to 1 mM.

In some aspects, the cell culture medium includes phenylalanine, tyrosine, tryptophan, and methionine at a concentration of less than 2 mM, less than 1 mM, 0.1 to 2 mM, 0.1 to 1 mM, 0.5 to 1.5 mM, or 0.5 to 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or Contain at a concentration of 0.5 to 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 6 of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Contain at a concentration of 0.5 to 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 7 of phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Contain at a concentration of 0.5 to 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, 0.1 to 2mM, 0.1 to 1mM, 0.5 to 1.5mM, or 0.5 to 1mM of phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Contains at a concentration of mM. In some aspects, the cell culture medium contains at least 1, 2, 3, 4, 5, 6, 7 of glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine. , 8, 9, 10, 11, 12 or 13, at a concentration of 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably greater than 2mM. In some aspects, the cell culture medium contains at least five of the following: glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2mM, 3mM, 4mM, 5mM. , 10mM, 15mM, preferably more than 2mM. In some aspects, the cell culture medium contains glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2mM, 3mM, 4mM, 5mM, 10mM, It further comprises at a concentration of more than 15mM, preferably more than 2mM. In some aspects, the cell culture medium contains at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 of valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2 mM. , 3mM, 4mM, 5mM, 10mM, 15mM, preferably more than 2mM. In some aspects, the cell culture medium contains at least five of the following: valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate, and asparagine, preferably 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably Additionally, it may be included at a concentration greater than 2mM. In some aspects, the cell culture medium contains valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably 2mM. It is additionally included in excess concentration. In some aspects, the cell culture medium includes serine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium includes valine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium includes cysteine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium includes isoleucine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium includes leucine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium is for use in a method as disclosed herein. In some aspects, the cell culture medium is used as a base medium in a method as disclosed herein. In some aspects, the cell culture medium is used as a feed medium in a method as disclosed herein.

The methods of the present disclosure can be used with any cell culture method suitable for the desired process (e.g., production of recombinant proteins). As a non-limiting example, cells can be grown in batch or fed-batch culture, where the culture is terminated after sufficient expression of the recombinant protein (e.g., antibody), and the expressed protein is then harvested. Alternatively, as another non-limiting example, cells may be grown in batch-refeeding, wherein the culture is not terminated and new nutrients and other components are added periodically or continuously to the culture, during which time the expression The recombinant protein is harvested periodically or continuously. Other suitable methods (e.g., spin-tube culture) are known in the art and may be used to practice the invention.

Cells can be grown in any convenient volume chosen by the expert. For example, cells can be grown in small-scale reaction vessels ranging in volume from a few milliliters to several liters. Alternatively, the cells may have a volume of approximately at least 1 liter to 10, 50, 100, 250, 500, 1000, 2500, 5000, 8000, 10,000, 12,000, 15000, 20000 or 25000 liters or more, or anywhere in between. Can be grown in large-scale commercial bioreactors in a range of volumes.

The temperature of the cell culture will be selected primarily based on the temperature range over which the cell culture remains viable, and the temperature range over which high levels of the desired product (e.g., recombinant protein) are produced. In general, most mammalian cells can grow well and produce the desired product (e.g., a recombinant protein) within a range of about 25°C to 42°C, but the methods taught by the present disclosure do not extend to these temperatures. Not limited. Certain mammalian cells can grow well and produce the desired product (e.g., recombinant protein or antibody) within a range of about 35°C to 40°C. In certain aspects, the cell culture is heated to 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C at least once during the cell culture process. , 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C. A person of ordinary skill in the art will be able to select the appropriate temperature or temperatures to grow the cells depending on the particular needs of the cells and the expert's specific production requirements. Cells can be grown for any amount of time depending on the needs of the specialist and the requirements of the cells themselves. In some embodiments, cells are grown at 37°C. In some aspects, cells are grown at 36.5°C.

In some aspects, cells may be grown during the initial growth phase (or growth phase) for more or less time depending on the needs of the practitioner and the requirements of the cells themselves. In some aspects, cells are grown for a period of time sufficient to achieve a predefined cell density. In some aspects, cells are grown for a period sufficient to achieve a cell density that is a given percentage of the maximum cell density that the cells would ultimately reach if allowed to grow undisturbed. For example, cells can be grown at 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or It can be grown for a period sufficient to achieve a desired viable cell density of 99 percent. In some aspects, the cells are grown at a cell density of 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, It grows until it does not increase by more than 2% or 1%. In some aspects, cells are grown until cell density does not increase by more than 5% per culture day.

In some aspects, cells are allowed to grow for a defined period of time. For example, depending on the starting concentration of the cell culture, the temperature at which the cells are grown, and the intrinsic growth rate of the cells, cells may grow to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11. , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more days, preferably 4 to 10 days. In some cases, cells may be allowed to grow for more than one month. The practitioner will be able to select the duration of the initial growth phase depending on the protein production requirements and the needs of the cell itself.

Cell cultures may be agitated or shaken during the initial culture steps to increase oxygenation and dispersion of nutrients into the cells. In accordance with the present invention, those skilled in the art will understand that it may be advantageous to control or regulate certain internal conditions of the bioreactor during the initial growth phase, including but not limited to pH, temperature, oxygenation, etc. will be.

At the end of the initial growth phase, at least one of the culture conditions can be shifted such that a second set of culture conditions is applied and a metabolic shift occurs in the culture. Metabolic shifts can be achieved, for example, by changing the temperature, pH, osmolality or chemical inductance level of the cell culture. In one non-limiting embodiment, culture conditions are shifted by shifting the temperature of the culture. However, as is known in the art, temperature shift is not the only mechanism by which appropriate metabolic shift can be achieved. For example, such metabolic shifts can also be achieved by shifting other culture conditions, including but not limited to pH, osmolality, and sodium butyrate levels. The timing of culture transfer will be determined by one skilled in the art based on protein production requirements or the needs of the cells themselves.

When shifting the temperature of a culture, the temperature shift can be relatively gradual. For example, a temperature change may take hours or days to complete. Alternatively, the temperature shift may be relatively rapid. For example, a temperature change can be completed within a few hours. Given appropriate production and control equipment, which is standard in commercial large-scale production of polypeptides or proteins, the temperature change can even be completed in less than an hour.

In some aspects, once the conditions of the cell culture have been shifted as discussed above, the cell culture is transferred to a second set of cultures that are conducive to the survival and viability of the cell culture and suitable for expression of the desired polypeptide or protein at a commercially appropriate level. conditions are maintained for subsequent production steps.

As discussed above, a culture can be shifted by shifting one or more of a number of culture conditions including, but not limited to, temperature, pH, osmolality, and sodium butyrate level. In some aspects, the temperature of the culture is shifted. According to this embodiment, during the subsequent production phase, the culture is maintained at a temperature or temperature range that is lower than the temperature or temperature range of the initial growth phase. As discussed above, multiple distinct temperature shifts can be used to increase cell density or viability or to increase expression of recombinant proteins.

As used herein, the term “titer” refers to the total amount of recombinantly expressed protein produced by cell culture, e.g., in a given amount of medium volume. Titers are typically expressed in grams of protein per liter of medium.

In some aspects, cell growth is increased by at least 5%, 10%, 15%, 20% or 25% compared to a control culture. In some aspects, cell growth is increased by at least 10% compared to control cultures. In some aspects, cell growth is increased by at least 20% compared to control cultures.

In some aspects, productivity is determined by titer and/or volumetric productivity.

In some aspects, productivity is determined by titer. In some aspects, productivity is increased by at least 5%, 10%, 15%, 20% or 25% compared to a control culture. In some aspects, productivity is increased by at least 10% compared to control cultures. In some aspects, productivity is increased by at least 20% compared to control cultures.

refine

In some aspects, methods of producing FimH mutant polypeptides include isolating and/or purifying the polypeptide. In some aspects, the expressed polypeptide is secreted into the medium so that cells and other solids can be removed by centrifugation and/or filtration. In a preferred embodiment, the polypeptide or fragment thereof is soluble.

FimH mutated polypeptides produced according to the methods described herein can be harvested from host cells and isolated using any suitable method, generally known in the art (see, e.g., Ruiz-Arguello et al. ., J. Gen. Virol., 85:3677-3687 (2004)]). Suitable methods for purifying polypeptides include precipitation and various types of chromatography (such as hydrophobic interaction, ion exchange, affinity, chelation, and size exclusion), all of which are known in the art. A suitable purification scheme may include two or more of these or other suitable methods. In some aspects, one or more of the polypeptides may include a “tag” to facilitate purification or detection. Examples include, for example, His tags (bind to metal ions, e.g. hexahistidine), antibodies, maltose-binding protein (MBP) (bind to amylose), glutathione-S-transferase (GST) (bind to glutathione) ), FLAG tag (binds to anti-flag antibody), Strep tag (binds to streptavidin or its derivatives). Such tagged polypeptides can be conveniently isolated, for example, by chelation chromatography or affinity chromatography from conditioned media. Optionally, the tag sequence can be cleaved after purification. In one aspect, the FimH mutant polypeptide does not include a purification tag.

In one aspect, FimH mutant polypeptides can be isolated by first obtaining cell culture supernatants and then subjecting the supernatants to both ultrafiltration and diafiltration methods. Such filtration methods are known to those skilled in the art. After ultrafiltration and diafiltration, the resulting cell-free solution is then subjected to a chromatography step, for example Ni-NTA chromatography using a nickel affinity resin. This step may be followed by dialysis, which may then be followed by cation exchange chromatography, such as an SP column. The use of an acidic pH (e.g., less than about 6.0, less than about 5.5, less than about 5.0, less than about 4.5, about 4.4, about 4.3, about 4.2, about 4.1 or about 4.0 or less) during purification on SP-Sepharose. It may be desirable under certain conditions.

this. Although specific strains of E. coli may be mentioned herein, E. It should be understood that polypeptides or fragments thereof derived from E. coli are not limited to specific strains unless specified.

VI. Use of the composition

In one aspect, the disclosure provides a FimH mutant polypeptide, a nucleic acid encoding such a mutant, a vector for expressing such a mutant, the use of a composition comprising such a mutant or nucleic acid as a medicament, or the use of a composition comprising such a mutant or nucleic acid in a subject. Elicit an immune response against E. coli infection. Provided is use in the manufacture of a medicament for preventing coli infection.

In another aspect, the disclosure relates to a subject, such as a human, comprising administering to the subject an effective amount of a FimH mutant polypeptide, a nucleic acid molecule encoding a FimH mutant polypeptide, or a composition comprising a FimH mutant polypeptide or nucleic acid molecule. From this. A method for eliciting an immune response against E. coli is provided. The present disclosure also includes administering to the subject an effective amount of a FimH mutant polypeptide, a nucleic acid encoding a FimH mutant polypeptide, or a pharmaceutical composition, such as a vaccine, comprising a vector expressing the FimH mutant polypeptide. . Provides methods for preventing coli infection. In some specific aspects, the pharmaceutical composition comprises a FimH mutant polypeptide as disclosed herein. In some aspects of the methods provided herein, the subject is a human.

In another aspect, the present disclosure provides a method for treating extraintestinal pathogenic E. coli in a subject. E. coli or induce an immune response against extraintestinal pathogenic E. coli in the subject. A method of inducing the production of opsonophagocytic and/or neutralizing antibodies specific for E. coli is provided, wherein the method comprises administering an effective amount of any composition described herein, such as a composition comprising a FimH mutant polypeptide as described herein. It includes administering to the subject. In a further aspect of this method, the subject is at risk of developing a urinary tract infection and/or at risk of developing bacteremia and/or at risk of developing sepsis.

In a further aspect, the disclosure includes administering to the mammal an effective amount of any of the compositions described herein. A method for eliciting an immune response against E. coli is provided. For example, in one aspect the immune response is . Opsonophagocytic and/or neutralizing antibodies against E. coli. In a further aspect, the immune response is . Protects mammals from coli infection.

In a further aspect, the disclosure provides a method of preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject comprising administering to the subject an immunologically effective amount of any of the compositions described herein.

In the methods of the present disclosure, the composition can be administered to a subject with or without administration of an adjuvant. The effective amount administered to the subject is . The amount is sufficient to elicit an immune response against E. coli antigens, such as FimH protein. Subjects that may be selected for treatment include: Because of exposure or possible exposure to E. coli, lice. Includes subjects at risk of developing a coli infection, such as subjects at risk of developing a urinary tract infection, and/or subjects at risk of developing bacteremia, and/or subjects at risk of developing sepsis.

As used herein, “subject” means a mammal, preferably a human. In one embodiment, the subject has a urinary tract infection, cholecystitis, cholangitis, diarrhea, hemolytic uremic syndrome, neonatal meningitis, urosepsis, intra-abdominal infection, meningitis, complicated pneumonia, wound infection, post-prostate biopsy-related infection, neonatal/infant sepsis. , neutropenic fever, and other bloodstream infections; is at risk of any one of a condition selected from the group consisting of pneumonia, bacteremia, and sepsis.

Administration of compositions provided by the present disclosure, such as pharmaceutical compositions, can be performed using standard routes of administration. Non-limiting embodiments include parenteral administration, such as intradermal, intramuscular, subcutaneous, transdermal, mucosal, or oral administration.

The total dose of composition provided to a subject during a single administration may vary as known to the skilled artisan.

It is also possible to provide one or more booster doses of one or more immunogenic compositions. If boosting vaccination is performed, typically such boosting vaccination will be administered to the same subject at a time between 1 week and 10 years, preferably between 2 weeks and 6 months, after the composition was first administered to the subject (such (sometimes referred to as “priming vaccination”). In an alternative boosting regimen, it is also possible to administer a different vector, for example one or more adenoviruses, or another vector, such as modified vaccinia virus of Ankara (MVA), or DNA, or protein to the subject after priming vaccination. possible. The immunogenic compositions provided by the present disclosure can be used in conjunction with one or more other immunogenic compositions.

Dosage of Composition

Dosage regimens may be adjusted to provide the optimal desired response. For example, a single dose of the mutated FimH polypeptide may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the exigencies of the situation. there is. It should be noted that dosage values may vary depending on the type and severity of the condition to be alleviated and may include single or multiple doses. For any particular subject, the specific dosage regimen should be adjusted over time according to individual needs and the professional judgment of the person administering or supervising administration of the composition, and the dosage ranges set forth herein are merely It is further to be understood that these are exemplary and are not intended to limit the scope or practice of the claimed compositions.

In some aspects, the amount of FimH mutant polypeptide in the composition can range from about 10 μg to about 300 μg of each protein antigen. In some aspects, the amount of FimH mutant polypeptide in the composition can range from about 20 μg to about 200 μg of each protein antigen.

The amount of glycoconjugate(s) in each dose is selected as the amount that induces an immunoprotective response without significant adverse side effects in a typical vaccine. This amount will vary depending on the specific immunogen used and how it is presented.

The amount of a particular glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharide for that conjugate (conjugated and unconjugated). For example, a glycoconjugate with 20% free polysaccharide will have about 80 g of conjugated polysaccharide and about 20 g of unconjugated polysaccharide in a 100 g polysaccharide dose. The amount of glycoconjugate is this. It may vary depending on the coli serotype. Saccharide concentration can be determined by the uronic acid assay.

The “immunogenic amount” of the different polysaccharide components in the immunogenic composition can vary, each being about 1.0 g, about 2.0 g, about 3.0 g, about 4.0 g, about 5.0 g, about 6.0 g, about 7.0 g. , about 8.0 g, about 9.0 g, about 10.0 g, about 15.0 g, about 20.0 g, about 30.0 g, about 40.0 pg, about 50.0 pg, about 60.0 pg, about 70.0 pg, about 80.0 pg, about 90.0 pg, or It may comprise about 100.0 g of any particular polysaccharide antigen. Generally, each dose will comprise 0.1 g to 100 g, especially 0.5 g to 20 g, more particularly 1 g to 10 g, and even more especially 2 g to 5 g of polysaccharide for a given serotype. Any pan-digit integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In one embodiment, each dose is 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9 g, 10 g, 15 g or 20 g of poly for a given serotype. It will contain saccharides.

VII. Combination with saccharides and/or polypeptides or fragments thereof derived from Klebsiella pneumoniae

Klebsiella pneumoniae ( K. pneumoniae ) is a Gram-negative pathogen known to cause urinary tract infections, bacteremia, and sepsis. Multi-drug resistance K. Pneumoniae infection is a cause of increasing mortality in at-risk and vulnerable populations. O-antigen serotypes are highly prevalent among strains causing invasive diseases worldwide, and derived O-antigen glycoconjugates are attractive as vaccine antigens.

In one aspect, any of the compositions disclosed herein comprise at least one selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. of K. It may further include at least one saccharide that is a serotype of Pneumoniae or derived therefrom. In a preferred embodiment, any composition disclosed herein comprises K. A polypeptide derived from Pneumoniae type I fimbria protein or an immunogenic fragment thereof; or k. A polypeptide derived from Pneumoniae type III fimbria protein or an immunogenic fragment thereof; or K selected from a combination thereof. It may further include polypeptides derived from pneumoniae.

As known in the art, K. Pneumoniae O1 and O2 O-antigens and their corresponding v1 and v2 subtypes are polymeric galactans that differ in the structure of their repeat units. K. Pneumoniae O1 and O2 antigens contain homopolymeric galactose units (or galactans). K. The Pneumoniae O1 and O2 antigens each contain a D-galactan I unit (sometimes referred to as an O2a repeat unit), but the O1 antigen differs in that the O1 antigen has a D-galactan II cap structure. D-galactan III (d-Gal-III) is a variant of D-galactan I. Structures of primary galactans I and III, which define two distinct serotype O2 subtypes, O2v1 and O2v2; and the structures of the derived chimeras resulting from capping with galactan II, generating subtypes O1v1 and O1v2, as described in Kelly SD, et al. J Biol Chem 2019; 294:10863-76]; and [Clarke BR, et al. J Biol Chem 2018; 293:4666-79].

In some embodiments, K. The saccharide derived from Pneumoniae O1 comprises the repeating unit of [→3)-β-D-Galf -(1→3)-α-D-Galp-(1→]. In some embodiments, The saccharide derived from K. pneumoniae O1 comprises the repeating unit [→3)-α-D- Galp-(1→3)-β-D-Galp-(1→]. Some embodiments In K. pneumoniae , the saccharide derived from O1 is a repeat unit of [→3)-β-D-Galf -(1→3)-α-D-Galp-(1→], and [→3 )-α-D- Galp-(1→3)-β-D-Galp-(1→]. In some embodiments, the saccharide derived from K. pneumoniae O1 is [ →3)-β-D-Galp -(1→3)-[α-D-Galp-(1→4)]-α-D-Galp-(1→] Contains the repeating unit (D-Gal -III repeat unit) (Kol O., et al. (1992) Carbohydr. Res. 236, 339-344; Whitfield C., et al. (1991) J. Bacteriol. 173, 1420-1431) .

In some embodiments, K. The saccharide derived from Pneumoniae O2 contains the repeating unit [→3)-α-D-Galp-(1→3)-β-D-Galf-(1→] (K. pneumoniae In some embodiments, the saccharide derived from K. pneumoniae O2 is [→3)-β-D-GlcpNAc-(1→5)-β-D. -Galf-(1→] (which may be an element of the K. pneumoniae serotype O2c antigen). In some embodiments, the saccharide derived from K. pneumoniae O2 is ( 1→4)-linked Galp residues (which may be elements of the K. pneumoniae O2afg antigen) modify the O2a repeat unit by side chain addition. In some embodiments, from K. pneumoniae O2 The derived saccharide involves modification of the O2a repeat unit by side chain addition of a (1→2)-linked Galp residue (which may be an element of the K. pneumoniae O2aeh antigen) (Whitfield C., et al (1992) J. Bacteriol. 174, 4913-4919).

Without being bound by mechanisms or theories, K. The O-antigen polysaccharide structures of pneumoniae serotypes O3 and O5, respectively. It is disclosed in the related art that the structure is identical to that of E. coli serotypes O9a (formula O9a) and O8 (formula O8).

In some embodiments, K. The saccharide derived from pneumoniae O4 contains the repeating unit [→4)-α-D-Galp-(1→2)-β-D-Ribf-(1→)]. In some embodiments, K. Saccharide derived from pneumoniae O7 is [→2-a-L-Rhap-(1→2)-β-D-Ribf- (1→3)-α-L-Rhap-(1→3)-α -L-Rhap-(1→]. In some embodiments, the saccharide derived from the K. pneumoniae O8 serotype comprises the same repeat unit structure as K. pneumoniae O2a. However, it is non-stoichiometrically O-acetylated.In some embodiments, the saccharide derived from the K. pneumoniae O12 serotype is [α-Rhap-(1 →3)-β-GlcpNAc] disaccharide. Contains repeat units of ride repeat units.

In one aspect, the present invention provides this. A polypeptide derived from E. coli FimH or a fragment thereof; and at least one K selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. and compositions comprising at least one saccharide of or derived from a pneumoniae serotype. In some embodiments, the composition comprises a saccharide that is or is derived from one or more of serotypes O1, O2, O3, and O5, or a combination thereof. In some embodiments, the composition comprises saccharides that are or are derived from each of serotypes O1, O2, O3, and O5.

In another aspect, the invention provides at least one K selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. At least one saccharide of or derived from a serovar Pneumoniae; And this having a structure selected from any one of the following. Includes compositions comprising saccharides derived from the E. coli O-antigen: Formula O1 (e.g., Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4: K52 and formula O4:K6), formula O5 (e.g. formula O5ab and formula O5ac (strain 180/C3)), formula O6 (e.g. formula O6:K2; K13; K15 and formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g. Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44 , Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58 , Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g., Formula O73 ( Strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123 , Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173 , Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187, where n is from 1 to 100. It is an integer. In some embodiments, the composition comprises K. Saccharides that are or are derived from one or more of pneumoniae serotypes O1, O2, O3 and O5, or a combination thereof. In some embodiments, the composition comprises K. pneumoniae serotypes O1, O2, O3 and O5, respectively, or saccharides derived therefrom. In some embodiments, the composition is E. coli having the formula O9. Contains a saccharide derived from the E. coli O-antigen and K. Pneumoniae does not contain saccharides derived from serotype O3. In some embodiments, the composition is E. coli having the formula O8. Contains a saccharide derived from the E. coli O-antigen and K. pneumoniae does not contain saccharides derived from serotype O5.

In another aspect, the present invention provides this. A polypeptide derived from E. coli FimH or a fragment thereof; At least one K selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. At least one saccharide of or derived from a serovar Pneumoniae; and a saccharide having a structure selected from any of the following: Formula O1 (e.g. Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g. Formula O4:K52 and Formula O4:K6), Formula O5 (e.g. Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g. Formula O6:K2; K13; K15 and Formula O6: K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g. Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43 , Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57 , Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g., Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121 , Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172 , Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187, where n is 1 It is an integer of 100 to 100, preferably 31 to 90. In some embodiments, the composition is E. coli having the formula O9. Contains a saccharide derived from the E. coli O-antigen and K. Pneumoniae does not contain saccharides derived from serotype O3. In some embodiments, the composition is E. coli having the formula O8. Contains a saccharide derived from the E. coli O-antigen and K. pneumoniae does not contain saccharides derived from serotype O5.

In some embodiments, the composition comprises any one of K. selected from the group consisting of O1, O2, O3, and O5. It contains at least one saccharide derived from the type Pneumoniae.

In some embodiments, the composition comprises K. and at least one saccharide derived from Pneumoniae type O1. In one aspect of this embodiment, K. Pneumoniae O-antigens are selected from subtype v1 (O1v1) or subtype v2 (O1v2). In one aspect of this embodiment, K. Pneumoniae O-antigens are selected from subtype v1 (O1v1) and subtype v2 (O1v2). In some embodiments, the composition comprises K. It contains at least one saccharide derived from pneumoniae type O2. In one aspect of this embodiment, K. Pneumoniae O-antigens are selected from subtype v1 (O2v1) or subtype v2 (O2v2). In one aspect of this embodiment, K. Pneumoniae O-antigens are selected from subtype v1 (O2v1) and subtype v2 (O2v2). On another note, K. The pneumoniae O-antigen is selected from the group consisting of: a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 (O2v1) ), and d) serotype O2 subtype v2 (O2v2). In one aspect of this embodiment, K. The Pneumoniae O-antigen is subtype v1 (O1v1). In one aspect of this embodiment, K. The Pneumoniae O-antigen is subtype v2 (O1v2). In one aspect of this embodiment, K. The Pneumoniae O-antigen is subtype v1 (O2v1). In one aspect of this embodiment, K. The Pneumoniae O-antigen is subtype v2 (O2v2). In another aspect of this embodiment, the composition comprises 1, 2, 3 or 4 K. selected from the group consisting of: pneumoniae contains O-antigens: a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 (O2v1), and d) Serotype O2 subtype v2 (O2v2). In some embodiments, the composition comprises K. K. pneumoniae, wherein the first saccharide is selected from the group consisting of O1, O2, O3 and O5. Derived from any of the Pneumoniae types; The second saccharide is selected from the group consisting of O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. Derived from one of the Pneumoniae types. For example, in some embodiments, the composition comprises K. At least one saccharide derived from Pneumoniae type O1 and K. It contains at least one saccharide derived from pneumoniae type O2. In a preferred embodiment, K. A saccharide derived from Pneumoniae is conjugated to a carrier protein; this. Saccharides derived from E. coli are conjugated to a carrier protein.

In another aspect, the present invention provides this. A polypeptide derived from E. coli FimH or a fragment thereof; And any one K selected from the group consisting of O1, O2, O3 and O5. and a composition comprising at least one saccharide derived from a type Pneumoniae.

In another aspect, the present invention provides any one K selected from the group consisting of O1, O2, O3 and O5. At least one saccharide derived from the Pneumoniae type; And this having a structure selected from any one of the following. At least one saccharide derived from E. coli: Formula O1 (e.g., Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4:K52 and Formula O4) :K6), Formula O5 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18 O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 ( For example, Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g. Formula O73 (strain 73-1 )), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89 , Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141 , Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187. In some embodiments, the composition is E. coli having the formula O9. Contains a saccharide derived from the E. coli O-antigen and K. Pneumoniae does not contain saccharides derived from serotype O3. In some embodiments, the composition is E. coli having the formula O8. Contains a saccharide derived from the E. coli O-antigen and K. pneumoniae does not contain saccharides derived from serotype O5.

In some embodiments, the composition comprises K. At least one saccharide derived from Pneumoniae type O1; and having a structure selected from the group consisting of Formula O8 and Formula O9. and at least one saccharide derived from E. coli. In another embodiment, the composition is K. At least one saccharide derived from Pneumoniae type O2; and having a structure selected from the group consisting of Formula O8 and Formula O9. and at least one saccharide derived from E. coli. In another embodiment, the composition is K. At least one saccharide derived from Pneumoniae type O1; K. At least one saccharide derived from Pneumoniae type O2; and having a structure selected from the group consisting of Formula O8 and Formula O9. and at least one saccharide derived from E. coli.

In one embodiment, the present invention provides a subject with E. coli. K. to a subject, comprising administering an immunologically effective amount of an immunogenic composition comprising at least one glycoconjugate from E. coli serotype O8 or O9. Provided is a method of inducing an immune response against pneumoniae, wherein the immunogenic composition is K. pneumoniae does not contain glycoconjugates from serotypes O5 or O3. In one aspect, the composition has the formula O8. Contains a saccharide derived from the E. coli O-antigen and K. pneumoniae does not contain saccharides derived from serotype O5. In another aspect, the composition has the formula O9. Contains a saccharide derived from the E. coli O-antigen and K. Pneumoniae does not contain saccharides derived from serotype O3.

In another embodiment, the invention provides a method for administering to a subject K. pneumoniae in a subject, comprising administering an immunologically effective amount of an immunogenic composition comprising at least one glycoconjugate from serotype O5 or O3, or a variant thereof. A method of inducing an immune response against E. coli is provided, wherein the immunogenic composition is E. coli. It does not contain glycoconjugates from E. coli serotypes O8 or O9. In one aspect, the composition includes K. pneumoniae contains a saccharide derived from serotype O5 and has the formula O8. It does not contain saccharides derived from the E. coli O-antigen. In another aspect, the composition is K. pneumoniae contains a saccharide derived from serotype O3 and has the formula O9. It does not contain saccharides derived from the E. coli O-antigen.

In some embodiments, the composition comprises at least one K selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. At least one saccharide of or derived from a serovar Pneumoniae; Having a structure selected from the group consisting of formula O8 and formula O9. and at least one saccharide derived from E. coli. In some embodiments, the composition comprises at least one K selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 and O12. At least one saccharide of or derived from a serovar Pneumoniae; Having a structure selected from the group consisting of Formula O1A, Formula O1B, Formula O2, Formula O6 and Formula O25B. and at least one saccharide derived from E. coli.

In some embodiments, the composition comprises K. K. selected from polypeptides derived from Pneumoniae type I fimbria proteins. polypeptides or immunogenic fragments thereof derived from pneumoniae; or k. It further includes a polypeptide derived from Pneumoniae type III fimbria protein, or an immunogenic fragment thereof, or a combination thereof. The sequences of these polypeptides are known in the art.

VIII. nanoparticles

In another aspect, 1) nanostructures; and 2) at least one fimbria polypeptide antigen or fragment thereof. Preferably, the fimbria polypeptide or fragment thereof is E. It is derived from E. coli fimbria H (fimH). In a preferred embodiment, the fimbria polypeptide is selected from any one of the fimbria polypeptides described above. For example, the fimbria polypeptide may comprise any one amino acid sequence selected from SEQ ID NOs: 1-65.

In some embodiments, the antigen is fused or conjugated to the outside of the nanostructure to stimulate the development of an adaptive immune response against the indicated epitope. In some embodiments, the immunogenic complex further comprises an adjuvant or other immunomodulatory compound attached to the exterior and/or encapsulated within the cage to help tailor the type of immune response generated to each pathogen.

In some embodiments, the nanostructure comprises a single assembly comprising a plurality of identical first nanostructure-related polypeptides.

In an alternative embodiment, the nanostructure comprises a plurality of assemblies comprising a plurality of identical first nanostructure-related polypeptides and a plurality of second assemblies, each second assembly comprising a plurality of identical second nanostructure-related polypeptides. Contains polypeptides.

A variety of nanostructure platforms can be used to create the immunogenic compositions described herein. In some embodiments, the nanostructures used are formed by multiple copies of a single subunit. In some embodiments, the nanostructures used are formed by multiple copies of multiple different subunits.

Nanostructures typically have a ball-like shape and/or are rotationally symmetric (e.g., with 3-fold and 5-fold axes), such as the icosahedral structure exemplified herein.

In some embodiments, the antigen is presented on self-assembling nanoparticles, such as self-assembling nanostructures derived from ferritin (FR), E2p, Qβ, and I3-01. E2p is a redesigned variant of dihydrolipoyl acyltransferase from Bacillus stearothermophilus . I3-01 is an engineered protein that can self-assemble into ultrastable nanoparticles. The sequences of the subunits of these proteins are known in the art. In a first aspect, the nanostructure is at least 75% identical over its length to an amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NO: 66-105 and comprises an amino acid sequence that is identical at at least one identified interfacial position. Structure-related polypeptides are disclosed herein. Nanostructure-related polypeptides can be used, for example, to prepare nanostructures. Nanostructure-related polypeptides are designed for their ability to self-assemble in pairs to form nanostructures, such as icosahedral nanostructures.

In some embodiments, the nanostructure comprises: (a) a plurality of first assemblies, each first assembly comprising a plurality of identical first nanostructure-related polypeptides, wherein the first nanostructure-related polypeptide includes the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NO: 66-105; and (b) a plurality of second assemblies, each second assembly comprising a plurality of identical second nanostructure-related polypeptides, wherein the second nanostructure-related polypeptide is from the group consisting of SEQ ID NO: 66-105. Comprising the amino acid sequence of the selected nanostructure-related polypeptide, wherein the second nanostructure-related polypeptide is different from the first nanostructure-related polypeptide; Here, the plurality of first assemblies interact with the plurality of second assemblies through non-covalent bonds to form a nanostructure.

The nanostructure includes a symmetrically repeating, non-native, non-covalent polypeptide-polypeptide interface that orients the first and second assemblies into a nanostructure such as having icosahedral symmetry.

SEQ ID NO: 66-105 provides the amino acid sequence of an exemplary nanostructure-related polypeptide. The number of interfacial residues for the exemplary nanostructure-related polypeptides of SEQ ID NO: 66-105 ranges from 4-13 residues. In various embodiments, the nanostructure-related polypeptide comprises the amino acid sequence of the nanostructure-related polypeptide selected from the group consisting of SEQ ID NOs: 66-105 and at least 75%, 80%, 85%, 90%, 91% over its length. %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% equal and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, It contains identical amino acid sequences at 12 or 13 identified interfacial positions (depending on the number of interfacial residues for a given nanostructure-related polypeptide). In another embodiment, the nanostructure-related polypeptide comprises the amino acid sequence of the nanostructure-related polypeptide selected from the group consisting of SEQ ID NOs: 66-105 and at least 75%, 80%, 85%, 90%, 91% over its length. %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical and at least 20%, 25%, 33%, 40%, 50%, 60% of identified interface locations , contains 70%, 75%, 80%, 90% or 100% identical amino acid sequences. In a further embodiment, the nanostructure-related polypeptide comprises a nanostructure-related polypeptide having the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOs: 66-105.

In one non-limiting embodiment, the nanostructure-related polypeptide can be modified to facilitate covalent linkage to the “cargo” of interest. In one non-limiting example, the nanostructure-related polypeptide is such that the nanostructure of the nanostructure-related polypeptide provides a scaffold to provide a large number of antigens for delivery as a vaccine to generate an improved immune response, It can be modified to facilitate linkage to one or more antigens of interest (such as by introduction of various cysteine residues at defined positions).

In some embodiments, some or all native cysteine residues present in the nanostructure-related polypeptide but not intended for use in conjugation may be mutated to other amino acids to facilitate conjugation at defined positions. In another non-limiting embodiment, the nanostructure-related polypeptide may be modified by linkage (covalently or non-covalently) with a moiety to help facilitate “endosomal escape.” For applications that involve delivering a molecule of interest to a target cell, such as targeted delivery, a critical step may be escape from the endosome (a membrane-bound organelle that is the point of entry for the delivery vehicle into the cell). Endosomes mature into lysosomes and degrade their contents. Therefore, unless the delivery vehicle somehow “escapes” from the endosome before reaching the lysosome, it will degrade and not perform its function. There are a variety of lipids or organic polymers that disrupt the endosome and allow escape into the cytosol. Therefore, in this embodiment, the nanostructure-related polypeptide can be modified, for example, by introducing monomers of such lipids or organic polymers or cysteine residues that will allow chemical conjugation to the resulting assembly surface. In another non-limiting example, a nanostructure-related polypeptide can be modified, for example, by introducing a cysteine residue that will allow chemical conjugation of a fluorophore or other imaging agent that will allow visualization of the nanostructure in vitro or in vivo. .

Surface amino acid residues on nanostructure-related polypeptides can be mutated to improve the stability or solubility of protein subunits or assembled nanostructures. As known to those skilled in the art, if a nanostructure-related polypeptide has significant sequence homology to an existing protein family, multiple sequence alignment of other proteins from that family may be necessary to determine protein stability and/or It can be used to guide the selection of amino acid mutations at non-conserved positions that can increase solubility, a process referred to as consensus protein design (9).

Surface amino acid residues on nanostructure-related polypeptides can be mutated to positively charged (Arg, Lys) or negatively charged (Asp, Glu) amino acids to impart an overall positive or overall negative charge to the protein surface. In one non-limiting embodiment, surface amino acid residues on the nanostructure-related polypeptide can be mutated to impart a high net charge to the interior surface of the self-assembling nanostructure. These nanostructures can then be used to package or encapsulate cargo molecules with opposite net charges due to electrostatic interactions between the nanostructure internal surfaces and the cargo molecules. In one non-limiting embodiment, surface amino acid residues on the nanostructure-related polypeptide may be mutated to primarily arginine or lysine residues to impart a net positive charge to the interior surface of the self-assembling nanostructure. The solution containing the nanostructure-related polypeptide is then conjugated with a nucleic acid cargo molecule, such as dsDNA, ssDNA, dsRNA, ssRNA, cDNA, miRNA., siRNA, shRNA, piRNA, or Can be mixed in the presence of other nucleic acids. These nanostructures can be used, for example, to protect, deliver or concentrate nucleic acids.

In one embodiment, the nanostructure has icosahedral symmetry. In this embodiment, the nanostructure may comprise 60 copies of a first nanostructure-related polypeptide and 60 copies of a second nanostructure-related polypeptide. In one such embodiment, the number of identical first nanostructure-related polypeptides in each first assembly is different than the number of identical second nanostructure-related polypeptides in each second assembly. For example, in one embodiment, the nanostructure includes 12 first assemblies and 20 second assemblies; In this embodiment, each first assembly may comprise, for example, five copies of the same first nanostructure-related polypeptide, and each second assembly may comprise, for example, five copies of the same second nanostructure-related polypeptide. Can contain 3 copies. In another embodiment, the nanostructure includes 12 first assemblies and 30 second assemblies; In this embodiment, each first assembly may comprise, for example, five copies of the same first nanostructure-related polypeptide, and each second assembly may comprise, for example, five copies of the same second nanostructure-related polypeptide. May contain 2 copies. In a further embodiment, the nanostructure comprises 20 first assemblies and 30 second assemblies; In this embodiment, each first assembly may comprise, for example, three copies of the same first nanostructure-related polypeptide, and each second assembly may comprise, for example, three copies of the same second nanostructure-related polypeptide. May contain 2 copies. All of these embodiments can form synthetic nanomaterials with regular icosahedral symmetry.

Example

In order that the present disclosure may be better understood, the following examples are presented. These examples are for illustrative purposes only and should not be construed as limiting the scope of the disclosure in any way.

Example 1: Antigen Design

Mutations of FimH _LD or FimH-DSG were designed to lock the FimH lectin domain in an open conformation with the goal of improving functional immunogenicity. The mutations were of different classes listed in Tables 2-9 below. Amino acid sequences for various mutated FimH polypeptides are shown in Table 1.

Table 2: Wild-type FimH _LD construct containing introduction of naturally occurring amino acid substitutions common in UTI clinical isolates.

Table 3: Substitutions in the ligand binding site of FimH _LD

Table 4: Glycine switch mutations in FimH _LD

Table 5: Cysteine pairs for disulfide bond stabilization in FimH _LD

Table 6: Non-polar to polar mutations in FimH _LD

Table 7: Co-charge mutations at the pilin-lectin interface of FimH-DSG

Table 8: Combination of representative mutations in FimH _LD

Table 9: Combination of representative mutations in FimH-DSG

Example 2: Antigen Expression and Purification

DNA encoding FimH _LD and FimH-DSG mutants were cloned into pcDNA3.1 containing the mouse IgK signal peptide and expressed in Expi293™ cells as previously described (PCT International Publication No. WO2021/084429, May 5, 2021 (released on the 6th of March). For protein characterization and immunogenicity studies, proteins were isolated using nickel affinity resin and size exclusion chromatography as described in PCT International Publication No. WO2021/084429 (published May 6, 2021).

Example 3: Fluorescence polarization assay

To determine the dissociation constants of FimH mutants toward mannoside ligands, fluorescein conjugated to mannoside ligands with high affinity for FimH was used as described in Rabbani et al. A fluorescence polarization assay was developed based on the method described in (J. Biol. Chem. 293:1835-1849 (2018)). FimH protein was titrated in 11-point triplicate in black flat-bottom 96-well polypropylene plates (Greiner) to a final volume of 50 μL in 20 mM HEPES pH 7.4, 150 mM NaCl, 0.05 mg/mL + BSA. Diluted at 0.05%. 50 μL of 0.7 nM fluorescein octylbiphenylmannopyranoside ligand in the same buffer was added to each well. Plates were incubated overnight at room temperature with shaking at 100 rpm. After 20-24 hours, the plates were read on a ClarioStar Plus plate reader with fluorescein excitation at 488 nm and emission at 530 nm.

Example 4: Thermal stability assay (ThermoFluor assay)

To determine the melting temperature of the isolated protein in the APO (unbound) form and in the presence of the ligand, a 384-well thermal stability assay using SYPRO Orange was developed. Association to proteins was analyzed using a mannoside compound (methyl α-D-mannopyranoside (Sigma M6882)) that mimics the natural ligand of FimH (mannose). FimH protein stock solution was prepared by diluting the protein to 4 μM in 40 mM Tris pH 8, 400 mM NaCl (assay buffer); SYPRO orange dye (Invitrogen S6650) was diluted 1:10 in assay buffer. 4 μM FimH mutants (5 μL) were mixed with 1:10 SYPRO orange dye (0.1 μL) and assay buffer or ligand plated in MicroAmp EnduraPlate Optical 384-well plates (Applied Biosystems). Biosystems) 4483285) was diluted in assay buffer (5 μL) for a final reaction volume of 10 μL. Plates were subjected to melting curve analysis on a QuantStudio 5 real-time PCR system (ThermoFisher) using a dissociation protocol from 20°C to 98°C at 0.05°C/sec. TAMRA was specified as target and reporter and ROX as manual reference (but not used in any analysis). Data were plotted as a Maxwell-Boltzmann distribution, with temperature (20°C to 98°C) charted on the X-axis and fluorescence from the TAMRA channel on the Y-axis (each temperature point represents a specific fluorescence for the TAMRA reporter. (read during the melting curve for which values are assigned here). A normalization algorithm was established to equalize fluorescence intensity between wells and samples, allowing the Y-axis of fluorescence to be compared from plate to plate on a scale from 0 (no fluorescence) to 1 (highest recorded fluorescence). This equation is shown below. Using the search function of Microsoft Excel (see below), a relative fluorescence (after normalization) value of 0.5 (indicating approximately half of the protein dissociated) was recorded, which correlated to the specific temperature. Therefore, this temperature, i.e. the taken melting temperature (T _m ) of the protein, was calculated. The shift in melting temperature (ΔT _m ) was calculated by subtracting the T _m of protein + ligand from the apo condition. T _m was structured from the plate layout using a pivot table in Microsoft Excel.

Equation for normalizing the TAMRA fluorescence signal:

Normalization value (0 to 1) =

Raw fluorescence value - minimum fluorescence value from the entire well (from 20°C to 98°C)

Maximum fluorescence value from entire well - Minimum fluorescence value from entire well

Excel search function to identify T _m (0.5 normalized fluorescence, or 50% protein melt):

= LOOKUP (0.5, start of normalized fluorescence value: end of value, $start of temperature value: $end of value)

Example 5: Confirmation of the conformational state of FimH mutants using FimH-specific neutralizing monoclonal antibodies

The conformational state of FimH mutants was confirmed using neutralizing monoclonal antibodies 299-3, 304-1, and 440-2 (developed in-house); 229-3 and 304-1 bind similar epitopes as MAbs 475 and 926 (Kisiela, D. I. et al. Proc Natl Acad Sci U S A 110, 19089-19094 (2013)), whereas 440-2 recognizes a different epitope and It appears to bind preferentially to FimHLD in the open conformational state. Variants that maintain structural integrity similar to the wild type are expected to bind to all antibodies. Octet HTX from ForteBio was used for all kinetic real-time biomolecular interaction experiments to measure antibody reactivity with each mutant. Experiments were performed at 30°C with 1000 rpm agitation in 96-well black plates containing 240 μL per well. The Ni-NTA biosensor was equilibrated in a buffer containing 1x PBS buffer (PBT) containing 0.5% BSA and 0.05% Tween 20, followed by His-tagged FimH mutant proteins at 5 μg/mL for 5 min. Allowed to load. FimH loaded biosensors were allowed to re-establish baseline in PBT for 3 minutes and then allowed to associate with antibodies from different bins at 5 μg/mL for 5 minutes. Octet data analysis software was used to analyze the kinetics of the association phase, and responses (nm shifts) were obtained (tabled).

Example 6: Circular dichroism spectroscopy

FimHLD and FimH- Far-ultraviolet (320-250 nm) and near-ultraviolet (260-200 nm) circular dichroism spectra were recorded for DSG mutants. For far ultraviolet rays, 1 mm cells were used, and for near ultraviolet rays, 10 mm cells were used. Proteins were diluted to 0.3 mg/mL in PBS and spectra were recorded at 20°C using cells with a 1 mm (far ultraviolet) or 10 mm (near ultraviolet) path length. Scans were performed at 100 nm/min, DIT was set to 1 s, bandwidth was set to 3 s, and data pitch was set to 0.1 nm. Sensitivity was set to standard. For near-ultraviolet measurements, 10 spectra were accumulated and averaged, and for far-ultraviolet measurements, 5 spectra were each accumulated and averaged. Spectra were manually background corrected using the CD spectrum resulting from a blank PBS run and EQ. Converted to average residue ellipticity using 1. where θMRE is the calculated average residue ellipticity, θEXP is the experimentally measured CD signal, MW is the protein molecular weight, N is the number of amino acid residues, C is the protein concentration (mg/mL), and l is the optical path. Length (cm).

EQ. One

Example 7: Animal Immunogenicity Study EC-1678

Six- to eight-week-old CD-1 mice were obtained from Charles River Laboratories. For each group, 20 animals were grown with 20 μg Quillaja saponaria-21 (QS-21) from 5.1 mg/mL QS-21 stock solution containing 5 mM succinate, 60 mM NaCl, 0.1% PS80, pH 5.6. 21) were immunized subcutaneously at 0, 4, and 8 weeks with 10 μg FimH protein mixed with .

Example 8: FimH whole cell neutralization assay

Fimbriae on mannosylated substrates. To assess the ability of sera from vaccinated animals to inhibit binding of E. coli, a whole cell neutralization assay using yeast mannan was used as described in PCT International Publication No. WO2021/084429 (published May 6, 2021). did.

Example 9: Purification of FimH-DSG WT and FimH-DSG G15A G16A V27A mutant from CHO cells

The protein was expressed in CHO cells as a secreted protein with a C-terminal His tag. Cell culture supernatants were harvested, and 1 M Tris pH 7.4 and 5 M NaCl were added to 20 and 150 mM final concentrations, respectively. The 5 kDa TFF cassette buffer was rinsed and equilibrated in 20mM Tris pH 7.5 containing 500mM NaCl and 40mM imidazole. The supernatant was concentrated 2-fold and diafiltered against 6 volumes of 20mM Tris pH 7.5, 500mM NaCl, 40mM imidazole. The retentate was collected and rinsed with 50-100 mL of 20mM Tris pH 7.5 500mM NaCl 40mM imidazole. The retentate was filtered and rinsed with a 0.2 μm bottle top filter. The XK26/20 column was packed with Ni-Sepharose 6 fast flow resin (Cytiva Life Sciences) and equilibrated with 5 column volumes of 20mM Tris pH 7.5 500mM NaCl 40mM imidazole. The retentate was applied at half the flow rate and washed until a stable baseline was reached (approximately 55 column volumes). Bound proteins were eluted with 20mM Tris, 500mM NaCl, 500mM imidazole, pH 7.5. Fractions containing the protein of interest were pooled and dialyzed in a 2 kDa dialysis cassette against 20 mM sodium acetate, pH 4.3, at 4°C in two buffer changes. Proteins were applied to a SP-Sepharose cation exchange column (Citiba Life Sciences) equilibrated with the same buffer. Material bound to the cation-exchange resin was eluted with a linear gradient of NaCl using 20 mM sodium acetate, pH 4.3, 1 M NaCl buffer. Fractions were pooled and dialyzed against TBS, pH 7.4.

Example 10: Analytical size exclusion chromatography (SEC) for FimH-DSG WT and FimH-DSG G15A G16A V27A mutant

Analytical SEC was performed using a Waters The injection volume was 10 μl and the flow rate was 0.5 mL/min.

Example 11: Analysis of monosaccharides by high pH anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD)

Aqueous samples of FimH-DSG wild type and FimH-DSG triple mutants (G15A, G16A, V27A) were digested in 2N trifluoroacetic acid at 120°C for 2 h. After this time the samples were evaporated to dryness under vacuum at 45°C for 6 hours. Samples were reconstituted in Milli-Q H ₂ O and evaluated by HPAEC-PAD on a DIONEX ICS 3000 ion chromatography system. A Dionex CarboPac PA1 column (4 x 250 mm) was used with isocratic elution using a mixture of H ₂ O and 200 mM NaOH. The monosaccharide composition was confirmed by comparing the retention time of the peak detected in the FimH sample with a solution of a known monosaccharide standard.

Example 12: Detection of O-antigen sugar moieties binding to FimH-DSG WT and FimH-DSG G15A G16A V27A mutant

Octet HTX from ForteBio was used for all kinetic real-time biomolecular interaction experiments to determine possible O-antigen interactions with FimH-DSG WT and FimH-DSG G15A G16A V27A mutant. Experiments were performed at 30°C with 1000 rpm agitation in 96-well black plates containing 240 μl per well. Ni-NTA biosensors were equilibrated in buffer containing 1x PBS buffer (PBT) containing 0.5% BSA and 0.05% Tween 20 and then incubated with His-tagged FimH-DSG WT or His-tagged FimH-DSG WT at 5 μg/ml for 5 min. The FimH-DSG G15A G16A V27A mutant was allowed to load. FimH-DSG WT or FimH-DSG G15A G16A V27A-loaded biosensors were allowed to re-establish baseline in PBT for 3 min, followed by 2x the O-antigen polysaccharide CRM conjugate, O9 or O25b or O1a or O2. Loading was allowed to titrate (200 - 3.125 μg/ml). An antigen-loaded biosensor without any polysaccharide was used as a reference. FimH and O-antigen titration The loaded biosensor was immersed in PBT for 3 minutes to establish a new baseline. Detection of O-antigen binding to the mutants was tested in the association step with 5 μg/mL O-antigen specific mAb for 5 min (MAb 601 for O9, MAb ECO-80-11 for O25b, and MAb ECO-80-11 for O1a). MAb ECO-48-2 and MAb ECO-172-13 for O2). Octet data analysis software was used for kinetic analysis of the reference subtracted association phase, and responses (nm shifts) were obtained (tabled).

Example 13: Protein expression and purification

FimH _LD and FimH-DSG mutants were expressed in Expi293 cells and isolated from supernatants by nickel affinity capture followed by size exclusion chromatography. Note that some mutants had poor expression levels and did not proceed to biochemical or biophysical evaluation (e.g. FimH _LD P26C V35C, N33C P157C, N33C L109C, V35C L107C, V35C L109C, S113C T158C). Mutants for which sufficient yields could be obtained were evaluated in thermal stability and ligand binding assays.

Example 14: Identification of FimH _LD and FimH-DSG mutants with improved thermal stability and reduced shift in melt temperature in the presence of mannoside ligands

The melting temperature of FimH mutant proteins was determined using the SYPRO Orange thermal shift-based differential scanning fluorometry assay, where T _m refers to the temperature at which 50% of the protein unfolds. Noncovalent ligands often stabilize protein targets upon specific binding, resulting in an increase in protein melting temperature. Therefore, the melting temperature was determined in the presence of methyl alpha-D-mannopyranoside, which is a derivative of alpha-D-mannose and has micromolar affinity for FimH (Bouckaert, J. et al. Mol Microbiol. 55, 441 -455 (2005)), the difference in melting temperature (ΔT _m ) of the protein in the presence of the ligand compared to the apo form was calculated.

Wild type (WT) FimH-DSG protein showed a significantly higher melting temperature and had a lower ΔT _m in the presence of ligand compared to FimH _LD WT (Table 10, Table 11). FimH-DSG WT had a melting temperature of 71.66°C, whereas the melting temperature of FimH _LD WT was significantly lower (61.54°C). In the presence of methyl alpha-D-mannopyranoside, the melting temperature of FimH _LD WT shifted by 10.99°C, whereas in the presence of the ligand the temperature for FimH-DSG shifted only by 2.13°C. This suggests that FimH _LD is more efficiently stabilized by the ligand compared to FimH-DSG, which may reflect reduced ligand binding by FimH-DSG.

The mutation affected the melting temperature of the FimH protein in the apo state and in the presence of ligand. The previously described FimH _LD lock mutant V27C L34C (Kisiela, DI et al. Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, VB et al. J Biol Chem 288, 24128-24139 (2013)) It showed a lower melting temperature (51.42°C) compared to wild-type FimH _LD (61.54°C), which was consistent with published data (Kisiela, DI et al. Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, V.B. et al. J Biol Chem 288, 24128-24139 (2013). Incubation of FimH _LD V27C L34C with methyl alpha-D-mannopyranoside increased the melting temperature by 7.27 °C compared to the apo form, suggesting that this mutant may be partially stabilized by the ligand and have residual ligand binding efficiency. It suggests that there is. In the context of FimH-DSG, the V27C L34C mutant is less thermostable compared to WT (T _m = 63.29°C) and the temperature shift in the presence of ligand is slightly reduced in the V27C L34C mutant compared to WT (ΔT _m = 1.29℃). Five of the six Phe1 FimH _LD mutants had reduced melting temperatures compared to WT FimH _LD except F1L, which had similar melting temperatures. In the presence of ligand, four of six FimH _LD Phe1 mutants showed small ΔTm, suggesting poor stabilization by the ligand. In contrast, the most conservative amino acid substitutions F1W and F1Y showed intermediate and comparable ΔT values, respectively, compared to Phe1 wild-type FimH _LD . Regarding overall thermal stability, the R60P reference mutant (previously described - Rabbani et al. J. Biol. Chem. 293:1835-1849 (2018); Rodriguez, VB et al. J Biol Chem 288, 24128-24139 ( 2013) and several novel mutants designed in-house had significantly increased melting temperatures compared to V27C L34C. Interestingly, FimH _LD V28C N33C (both sites have only one residue moved from the reference FimH _LD V27C L34C) had the highest melting temperature of any of the FimH _LD mutants (Tm = 65.77°C), with methyl alpha-D -had a ΔTm of 2.81°C in the presence of mannopyranoside, suggesting reduced affinity for the ligand. Mutations in the glycine loop region (G15A, G16A) of FimH _LD significantly increased the thermal stability compared to V27C L34C, and a very low shift in melting temperature was observed in the presence of the ligand. The glycine loop mutation also slightly increased the thermal stability of FimH-DSG, with no temperature shift observed in the ligand, together suggesting that FimH _LD and FimH-DSG mutants are not stabilized by the ligand and therefore have reduced binding efficiency compared to the wild type. It suggests that you can have it.

The sequence of FimH _LD WT is E. From E. coli UTI isolate J96 (Hull, RA et al., Infect Immun 33, 933-938 (1981)). V27A is a natural variant associated with virulent UTI isolates and isolates associated with Crohn's disease (Schwartz, DJ et al., Proc Natl Acad Sci USA 110, 15530-15537 (2013); Cespedes et al., Front Microbiol 8:639 (2017) ). Incorporation of V27A into FimH _LD slightly reduced the melting temperature of FimH _LD WT, and a smaller shift was observed for V27A in the presence of methyl alpha-D-mannopyranoside compared to WT. On the other hand, V27A was shown to have a stabilizing effect in the context of the glycine loop mutants G15A, G16A, G15P, and G16P in FimH _LD , all of which had a higher melting temperature in V27A compared to the case without this mutation; It had a ΔTm of <2°C in the presence of V27A compared to a maximum of 6.05°C without the mutation (G16P). Additionally, the FimH-DSG mutant containing V27A had slightly increased thermal stability and no detectable temperature shift in the presence of ligand. Together, this suggests that V27A has a stabilizing effect on the melting temperature of FimH and reduces ligand binding efficiency.

Several FimH _LD disulfide and nonpolar to polar residue mutants were expressed at low levels and exhibited poor thermostability or significant temperature shifts in the presence of mannoside compounds, suggesting that they retained ligand binding efficiency ( Table 12). These were tested in a single replicate and excluded from further analysis. Similarly, the thermal stability of several other FimH-DSG mutants was analyzed, two of which had improved thermal stability and reduced migration in the ligand (FimH-DSG V27A Q133K and FimH-DSG G15A G16A V27A Q133K) ( Table 13). The Q133K mutation is a previously described mutation in the binding pocket of FimH that abolishes ligand binding (Schwartz et al., Proc Natl Acad Sci USA 110:15530-15537 (2013)). These mutants were not analyzed further.

Table 10: Melting temperature of FimH _LD mutants in the apo state and in the presence of methyl alpha-D-mannopyranoside

Table 11: Melting temperature of FimH-DSG mutants in the apo state and in the presence of methyl alpha-D-mannopyranoside.

Table 12: Melting temperatures of FimH _LD mutants in the apo state and in the presence of methyl alpha-D-mannopyranoside, single copy.

Table 13: Melting temperatures of FimH-DSG mutants in the apo state and in the presence of methyl alpha-D-mannopyranoside, limited replication.

Example 15: Identification of FimH mutants with reduced affinity for mannoside ligands

The dissociation constants (K _d ) of FimH mutants for mannoside ligands were determined using a direct binding fluorescence polarization assay using fluorescein-conjugated octylbiphenylmannopyranoside (BPMP) ligand. The K _d values of the FimH _LD mutant compared to WT are shown in Table 14. FimH _LD WT and V27A showed similar high affinity for BPMP. Reference lock mutants FimH _LD V27C L34C (Kisiela, DI et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, VV et al., J Biol Chem 288:24128-24139 (2013)) Although it had a 91-fold lower affinity for the ligand compared to FimH _LD WT, FimH _LD R60P V27A (Rabbani et al., J Biol Chem 293:1835-1849 (2018)) had a 179-fold lower affinity. The mutants disclosed herein were compared to a reference locked mutant. No binding was detected for the glycine loop mutants FimH _LD G15A V27A, G15P V27A, G16P V27A and G16A G16A V27A, whereas G16A V27A had a 156-fold increase in K _d compared to WT. Both glycine loop mutations in combination with V27A showed significantly higher K _d than the glycine loop mutant alone, suggesting that V27A had little effect on the K _d of FimH _LD WT but had an uncertain stabilizing effect. Inclusion of V27A also further reduced the binding affinity of FimH _LD R60P.

Three novel disulfide lock mutants were tested in this assay, all of which had a slight reduction in ligand binding affinity compared to FimH _LD WT (33-43 fold lower affinity). FimH _LD mutants containing non-polar to polar mutations (A119T V27A, A119N V27A, L34T V27A, L34N V27A) had high affinity for BPMP, similar to FimH _LD WT. FimHLD F1 mutants showed poor binding except for F1Y, which had similar binding affinity to FimH _LD WT.

The ligand binding affinities of the FimH-DSG constructs are shown in Table 15. The K _d of FimH-DSG WT was more than 100- _fold higher than that of FimH _LD WT, again reflecting the different conformational states of the two forms of FimH. FimH-DSG V27A also had lower affinity compared to FimH-DSG WT. This is consistent with previous data showing that full-length FimH with A27 in complex with FimC and FimG has reduced binding affinity for mannoside compared to FimH V27 (Schwartz et al., Proc Natl Acad Sci USA 110:15530 -15537 (2013)). Introduction of the locking mutation V27C L34C into FimH-DSG reduced the affinity for BPMP by 2.5-fold, whereas the glycine loop mutant FimH-DSG G15A G16A V27A had a 28-fold lower affinity compared to FimH-DSG WT. K _d could not be calculated for FimH-DSG G15A V27A and FimH-DSG G16A V27A, suggesting that these mutants are unable to bind BPMP. Mutations designed to stabilize FimH-DSG in the open conformation through alteration of the pilin-lectin domain interface (A115I, V185I) improved binding affinity compared to FimH-DSG WT, as suggested by thermal stability data (as suggested by Example 14).

In summary, glycine loop mutants of FimH _LD or FimH-DSG proteins were identified to have very low binding affinity for BPMP. Based on these and heat stability data, glycine mutants were selected for evaluation in functional immunogenicity studies in mice.

Table 14: Binding K _d of FimH _LD mutants to octylbiphenylmannopyranoside ligands

Table 15: Binding K _d of FimH-DSG mutants to octylbiphenylmannopyranoside ligands

Example 16: Confirmation of the conformational state of FimH mutants by circular dichroism spectroscopy

FimH _LD and FimH-DSG mutants (Examples 14 and 15), which showed improved thermal stability and reduced binding affinity for mannoside ligands, were subjected to secondary and tertiary structure analysis by circular dichroism (CD). . Wild type and conformationally locked FimH _LD mutants have distinct tertiary CD profiles (Rabbani et al., J Biol Chem 293:1835-1849 (2018)). The secondary and tertiary structures of selected FimH _LD and FimH-DSG wild-type and mutant proteins were examined by far-UV CD (secondary structure) and near-UV CD (tertiary structure) (see Figure 1). The far-ultraviolet CD spectrum of FimH _LD is consistent with previously published data (Rabbani et al. J Biol Chem 293:1835-1849 (2018)), and the far-ultraviolet spectra of both FimH _LD and FimH-DSG show high beta- It is a characteristic of proteins with sheet content. FimH _LD V27C L34C had a slightly different far-ultraviolet spectrum compared to wild-type FimH _LD , as observed by others (Rabbani et al. J Biol Chem 293:1835-1849 (2018)), reflecting the open conformational state. . The secondary structure profile of the naturally occurring FimH _LD V27A mutant was also somewhat diverse. Overall, the secondary structure of FimH _LD or FimH-DSG mutants is highly similar to the wild-type protein (Figure 1), suggesting that the overall secondary structure is not altered in these mutants. The tertiary structure profile of the FimH _LD mutant is very similar to the in-house and published CD spectra of FimH _LD V27 L34C and V27A R60P, which are stabilized in the open conformational state (Rabbani et al. J Biol Chem 293:1835-1849 (2018)). The profiles of the mutants described here are also significantly different compared to wild-type FimH _LD or FimH _LD V27A. Together, these data suggest that the introduced mutations shift the conformation of FimHLD to an open conformation, whereas the FimH-DSG tertiary structure remains largely unchanged upon introduction of the conformation stabilizing mutations evaluated herein. .

Example 17: Characterization of FimH mutants using neutralizing monoclonal antibodies

The conformations of several selected FimH antigens were characterized by biolayer interferometry assays using lectin domain-specific monoclonal antibodies 299-3, 304-1, and 440-2. Competition experiments (not shown) demonstrated that antibodies 229-3 and 304-1 bind to similar ligand binding site epitopes as MAbs 475 and 926 (Kisiela et al., Proc Natl Acad Sci USA 110:19089-19094 (2013 )). Monoclonal antibody 440-2 binds different epitopes and appears to bind preferentially to FimH _LD in the open conformation. Antibodies 229-3 and 304-1 were able to recognize all FimH _LD (Table 16) and FimH-DSG (Table 17) variants, but had reduced binding to FimH _LD V27A. In contrast, responses to antibody 440-2 were higher for all FimH _LD or FimH-DSG mutants compared to WT or V27A. This is consistent with the CD spectroscopy profile shown in Figure 1, suggesting that the FimH _LD mutant is in an open conformation. The response to 440-2 was also increased in FimH-DSG WT, which, in combination with the overlapping CD spectroscopy profiles of FimH-DSG mutants and WT (Example 16), suggests that this protein is active regardless of the presence or absence of stabilizing mutations. This suggests that it is in an open conformational state.

Table 16: MAb binding to FimH _LD variants

Table 17: MAb binding to FimH-DSG variants

Example 18: FimH mutant neutralization data

To assess the relative immunogenicity of selected mutants, mice were vaccinated with FimH mutants. The potency of FimH mutants to elicit functional antibody titers was quantified using the whole cell yeast mannan neutralization assay described above and previously (PCT International Publication No. WO2021/084429, published May 6, 2021). Simply put, fimbriae. E. coli were incubated with serum and allowed to bind to yeast mannan-coated microtiter plates. The plate was washed and viable lice bound to the plate. The number of coli was detected using a luminescent probe. Serum neutralizing titers that inhibit binding of fimbriae bacteria to yeast mannan were determined from an 8-point two-fold dilution series of sera from vaccinated mice. Titer represents the reciprocal of the serum dilution at which 50% of bacteria remain bound to the plate. A summary of average titers and responses is shown in Table 18. Plots of individual mouse IC ₅₀ responses at 2 and 3 post-dose are shown in Figures 2 and 3.

Table 18: VAC-2020-PRL-EC-1678 FimH _LD and FimH-DSG mutant yeast mannan binding neutralization assay responder rate and GMT

Previous work (PCT International Publication No. WO2021/084429, published May 6, 2021) was performed on the previously described disulfide lock mutant FimH _LD V27C L34C (Kisiela et al., Proc Natl Acad Sci USA 110:19089-19094 (2013). )) did not improve functional immunogenicity compared to FimH _LD WT. The functional immunogenicity of the novel FimH _LD mutant and another previously described conformationally constrained mutant FimH _LD V27A R60P (Rabbani et al., J Biol Chem 293:1835-1849 (2018)) is shown directly in Figure 2. compared. Mutants FimH _LD G16A V27A, FimH _LD G15A G16A V27A and FimH _LD V27A R60P yielded a higher number of responders and higher titers (p value <0.05) than FimH _LD WT. Other mutations (G15A V27A, G16P V27A, V28C N33C) did not significantly improve functional immunogenicity, but high titers were observed for non-responding mice, and the number of responders in these groups was significantly higher than that of the FimH _LD WT group. It was similar to Therefore, several mutants designed to improve the functional immunogenicity of FimH _{LD by locking FimH LD in} the open conformation improved functional immunogenicity compared to FimH _LD WT. After vaccination with two doses of FimH _LD and FimH-DSG mutants, significantly more animals developed neutralizing titers in the group vaccinated with FimH-DSG compared to FimH _LD (Figure 3). This trend continued at post-dose 3, where 95%-100% of mice in groups vaccinated with FimH-DSG V27A, FimH-DSG G15A V27A and FimH-DSG G15A G16A V27A responded. IC50 geometric mean titers (GMT) were also significantly higher in all groups vaccinated with the FimH-DSG mutant at 3 post-dose. Similar FimH-DSG mutants (V27A, G15A V27A, G15A G16A V27A) produced higher GMT compared to the FimH _LD mutant (p value of <0.05).

Example 19: FimH-DSG G15A G16A V27A can be isolated to homogeneity without binding to host glycans

FimH-DSG WT and FimH-DSG G15A G16A V27A mutant proteins were expressed in CHO cells as secreted proteins containing a C-terminal His tag. Purification of the recombinant His-tagged form of FimH-DSG was performed as shown in Figure 4.

After ultrafiltration and diafiltration, the cell-free culture medium containing FimH-DSG WT was isolated on nickel affinity resin and subjected to cation exchange chromatography. The eluted peak was rather broad and showed several unique shoulders, suggesting possible heterogeneity of the FimH-DSG WT species (Figure 5). Interestingly, when the eluted fractions were analyzed by SDS-PAGE, only a single band corresponding to FimH-DSG WT was detected in each fraction.

During the purification process, FimH-DSG exhibited properties suggesting that it had poor solubility. In particular, the FimH-DSG WT Ni-Sepharose eluent always appeared cloudy by visual inspection. Shifting to acidic pH (4.3) for subsequent purification on SP-Sepharose resulted in clarification of the protein solution. However, the poor solubility and tendency for aggregation of the FimH-DSG WT preparation was again observed after transfer (dialysis) of the isolated protein into TBS, pH 7.4. This resulted in gradual loss of protein due to aggregation and precipitation. Although the protein concentration was reduced to typically 0.2 - 0.4 mg/mL at this point, removal of the precipitate by centrifugation did not terminate or slow down the aggregation process. Loss of protein due to aggregation could be controlled in the presence of 10% glycerol incorporated into the storage (TBS, pH 7.4) buffer. However, the presence of glycerol did not prevent the formation of HMW soluble aggregates, which was detected spectrophotometrically by monitoring light scattering at 350 nm.

When the same process was utilized for the isolation of the FimH-DSG G15A G16A V27A mutant, several differences were observed. First, these include that there is no sign of haziness upon elution of the protein from the Ni-Sepharose column. Second, the profile eluting from the SP-Sepharose column peak was not as broad as that observed for WT FimH-DSG (Figure 6). And finally, the FimH-DSG G15A G16A V27A mutant remained completely soluble after transfer to physiological pH buffer (TBS pH 7.4). At concentrations up to 5 - 6 mg/mL, the FimH-DSG G15A G16A V27A mutant did not show any signs of aggregation or precipitation.

Analysis of the isolated FimH-DSG WT and FimH-DSG G15A G16A V27A mutants further revealed unique differences between these two variants of FimH-DSG. Analytical size exclusion chromatography (SEC) demonstrated that the FimH-DSG G15A G16A V27A mutant eluted as a single peak with a retention time consistent with its molecular weight. In contrast, the elution profile of wild-type FimH-DSG consisted of several peaks where the retention time of the main peak was shorter than that of the mutant shown in Figure 7. These data clearly demonstrate that FimH-DSG WT forms a high molecular mass complex detectable by SEC. The presence and aggregation tendency of the HMW complex formed by FimH-DSG WT could be linked to the functional activity of its N-terminal lectin-binding domain. We hypothesized that FimH-DSG WT binds to glycan molecule(s) released from the surface of host CHO cells during CHO fermentation and upon secretion into the culture medium. Due to the branched nature of the glycans, more than one copy of the FimH-DSG molecule could be accommodated by each glycan. Successive “decoration” of glycans by increasing the number of FimH-DSGs resulted in the formation of various HMW complexes, ultimately leading to loss of solubility and precipitation (see Figure 8). To test this hypothesis, isolated wild-type and mutant FimH-DSG (and FimH _LD ) species were subjected to high pH anion-exchange chromatography with pulsed amperometric (electrochemical) detection (HPAEC-PAD) analysis. . This method allows identification of oligosaccharides or glycans in a protein sample as well as providing information about the composition of these oligosaccharides. Briefly, acid hydrolysis was performed to release the monosaccharide, and then the peak was analyzed compared to a monosaccharide standard. The results of the HPAEC-PAD analysis revealed that the isolated FimH-DSG WT (glycosylated) and FimH _LD (not glycosylated, data not shown) preparations contained significant amounts of monosaccharides. A summary of the identified monosaccharides in FimH-DSG WT and FimH-DSG G15A G16A V27A mutant is shown in Table 19. The monosaccharide content in the FimH-DSG G15A G16A V27A mutant was significantly lower than that of FimH-DSG WT. Additionally, it is entirely possible that the low monosaccharide content detected represents the sugar moiety of the N-glycan predicted to modify N235.

Table 19: Normalized amount of monosaccharides detected by HPAEC-PAD (μg/mg protein) in the main peaks of various SP-Sepharose fractions from FimH-DSG WT and FimH-DSG G15A G16A V27A mutant.

Example 20: FimH _LD and FimH-DSG G15A G16A V27A mutants. Does not bind to E. coli O-antigen

this. The repeating units of E. coli O-antigens O8 and O9 are composed of polymannose residues. This raised the question of whether FimH can bind to the O-antigen conjugate in the FimH-O-antigen conjugate combination vaccine. Biolayer interferometry experiments determined whether FimH _LD WT could bind to free O9 polysaccharide or CRM-conjugated O9 polysaccharide, and FimH _LD G15A G16A was shown to have undetectable affinity for the mannoside ligand in binding assays. It was designed to test whether the V27A mutant could bind. O-antigen binding data are shown in Table 20. At high concentrations of free polysaccharide, a response was observed in FimH _LD WT. Higher responses were observed for CRM-conjugated polysaccharides. However, detectable binding was abolished with the mutant protein FimH _LD G15A G16A V27A. Similar experiments were set up for FimH-DSG, in which FimH-DSG WT or FimH-DSG G15A G16A V27A mutants bind to free or CRM-conjugated O-antigens of different serotypes (O9, O25b, O1a and O2). Ability was tested (Table 21). As expected from their mannoside ligand binding properties, the overall binding affinity of FimH-DSG WT was significantly lower than that of the corresponding FimH _LD variant. At the highest concentration of CRM conjugate, some titratable binding was observed with FimH-DSG WT, only slightly above the background level of binding seen for free polysaccharide. As in the FimH _LD G15A G16A V27A mutant, the FimH-DSG G15A G16A V27A protein did not bind free or CRM-conjugated polysaccharides. In conclusion, unlike the parental WT FimH _LD or WT FimH-DSG antigens, the derived G15A G16A V27A mutant fails to bind O-antigen, providing a potential route for the development of combined FimH and O-antigen vaccines. .

Table 20: FimH _LD G15A G16A V27A mutant does not bind free or CRM-conjugated O-antigen O9 polysaccharide

Table 21: FimH-DSG G15A G16A V27A mutant does not bind free or CRM-conjugated O-antigen polysaccharide

Example 21: Non-human primates vaccinated with FimH-DSG G15A G16A V27A mutant with and without O-antigen

A. Method

1. FimH IgG dLIA

Coupled to spectrally distinct MagPlex-C microspheres (Luminex). E. coli mutant fimbria antigen FimH-DSG G15A G16A V27A was diluted in blocking buffer to a concentration of 50,000 beads/mL for 1-2 hours at room temperature with shaking immediately before the first incubation of the assay. Appropriately diluted non-human primate serum samples, controls and reference standards, humanized in-house monoclonal antibody (FimH Y202) that binds to the pilin domain of FimH-DSG, while shaking the diluted microsphere mixture for overnight incubation at 2-8°C. was added to the assay plate containing. After washing the unbound components, purified R-phycoerythrin goat anti-human IgG, Fcγ fragment specific secondary antibody (Jackson ImmunoResearch Laboratories, 109-116-170) was added to the microsphere mixture and incubated with shaking at room temperature for 90 minutes. The magnitude of the fluorescent PE signal measured by the Luminex FLEXMAP 3D reader is directly proportional to the amount of anti-FimH-DSG IgG bound to the protein coupled microspheres. Data were analyzed using a custom SAS application that interpolates antigen-specific antibody concentrations (μg/mL) from median fluorescence intensity using a log/log linear regression model of the standard curve. A lower limit of quantitation (LLOQ) of 0.763 μg/mL was calculated from the standard curve bias.

2. Tetravalent O-Ag IgG dLIA

Of serotypes O25b, O1a, O2 and O6. Covalently conjugate E. coli long O-antigen polysaccharide to poly-L-lysine and couple the resulting conjugate to spectrally distinct MagPlex-C microspheres (Luminex) using a standard EDC/NHS mediated coupling protocol. It was ringed. Microspheres were incubated with serially diluted non-human primate serum samples, controls, and polyclonal standards for overnight incubation with shaking at 2-8°C. After washing, the bound serotype-specific IgG was incubated for 90 minutes with shaking at room temperature and then incubated with a PE-conjugated goat anti-human IgG, Fcγ fragment specific secondary antibody (Jackson ImmunoResearch Laboratories, 109-115). -098). Fluorescence was measured by a Luminex 200 reader for each of the four spectrally distinct regions and expressed as median fluorescence intensity. Standard curve plots of polyclonal standard titrations yielded linear slope profiles with arbitrary assignment of which the signal could be interpolated to serotype-specific antibody levels (U/mL).

3. Non-human primates (NHP)

Female cynomolgus macaques ( Macaca fasicularis ) were originally obtained from Charles River Laboratories (Houston, TX, USA) and then transferred to Pfizer (Pearl River, NY, USA) (age range: 4-5). aged, weight range: 3.1-5.9 kg). NHPs were housed in standard quad cages with water and food provided ad libitum. Animals were microchipped subcutaneously to monitor internal temperature. this. Only NHPs without coli infection were enrolled based on negative urine qPCR results (see Methods section 10 below).

4. Vaccination and blood collection

Cynomolgus macaques were treated with vehicle control (PBS, pH 6.2), monomeric fimbria antigen FimH-DSG G15A G16A V27A (50 μg/dose), or monomeric fimbria antigen FimH-DSG G15A G16A V27A (50 μg/dose). were immunized intramuscularly (0.55 mL) at weeks 0, 4, and 14 with a mixture of tetravalent O25b, O1a, O2, and O6 O-antigen polysaccharide conjugates (1 μg/dose) in combination with (dose). Vaccine antigens were adjuvanted with AS01b (50 μg of MPL and 50 μg of QS-21 per dose).

At weeks 0, 6 and 16, 10 mL of blood was collected via the femoral vein into one serum separator tube (BD vacutainer) using a 21 g safety needle/vacutainer. The collection tube was left at room temperature for 30 minutes and centrifuged at 3000 g for 10 minutes. The supernatant serum was collected, aliquoted, and stored at -80°C.

5. Lee. coli clinical isolates

One representative ST131 O25b clinical isolate was from UPEC strains collected as part of the Pfizer-sponsored Antimicrobial Testing Leadership and Surveillance (ATLAS) database maintained by the International Health Manage Association (IHMA) clinical lab. were selected based on age and origin of sample collection (PFEEC0578, male, 38 years, bladder origin). The strain carries a gene that codes for the production of a capsular polysaccharide of an unknown type.

6. UPEC strain stock preparation

E. coli by inoculating 12 mL of LB broth (Teknova, #L8198) and incubating overnight at 37°C with agitation at 275 rpm. E. coli stock was prepared. After 18 hours, 12 mL culture was diluted in 113 mL of LB broth in a 250 mL flask (Corning, #431407). Cultures were incubated at 37°C for 2-3 hours at ˜275 rpm until OD ₆₀₀ was 2.1-2.7. 25 mL of glycerol (80%, MP, #3055-044) was mixed into the culture. Aliquots of 5 mL were frozen at -80°C for long-term storage. The concentration of viable bacteria per vial was determined by plating serial dilutions of the stock on TSA plates (BD, BBL Trypticase Soy Agar (Soy Casein Digestion Agar) catalog # B21283X) and analyzed after 18 hours incubation at 30°C. .

7. Nonhuman primate model of cystitis

NHPs were anesthetized by intramuscular administration of a ketamine/dexdomitol mixture. To prevent bladder contamination from urethral catheterization, the anogenital area was wiped with sterile gauze soaked in sterile saline and/or disinfectant wipes containing benzalkonium chloride. A sterile 5 French red rubber catheter previously coated with Surgi Lube to prevent tissue irritation was gently introduced through the urethra into the bladder. The bladder then expelled any urine through natural flow or by suction using a syringe. A volume of 1 mL containing 10 ⁸ CFU of UPEC strain PFEEC0578 was administered directly into the bladder via catheter.

8. Animal monitoring after challenge infection

After challenge, animals were monitored twice daily for week 1 and once daily for subsequent weeks. NHPs were monitored up to 30 days after challenge. Monitoring included observation of the appearance of urinary output, changes in behavior or appetite, signs of pain/discomfort, and temperature measurements.

9. Urine collection through catheter placement

To allow collection of clean urine samples, the bladders of anesthetized NHPs were catheterized as described above. After catheter placement, the bladder drained urine either through natural flow or by suction using a syringe. When there was no urine in the bladder, 10 mL of saline was injected and suction through the catheter was repeated. All collected samples were immediately stored on ice.

10. DNA extraction

From up to three replicates of NHP urine samples. Extraction of E. coli DNA was performed using the Qiagen Minelute DNA extraction kit (Qiagen, Ref# 51306, quantities sometimes limited by sample volume collected). The manufacturer's blood and body fluid spin protocol was modified as follows: sample starting volume was increased to 500 μL (if sample volume allowed), buffer AL volume was increased to 500 μL, and proteinase K volume was increased to 500 μL. Increased to 50 μL, 50 μL of Molecular Grade Water (Corning Inc., Ref# 46-000-CM) warmed to 37° C. was used in place of Elution Buffer EB. Finally, after addition of 37°C molecular grade water, the spin column was incubated for 5 minutes at room temperature before the final spin.

11. Quantitative real-time PCR (qPCR)

Quantitative real-time PCR (qPCR) was used to evaluate the bacterial load of NHP urine samples. this. E. coli O25b serotype-specific DNA was prepared using the following primers: forward, TTGAAAGTGATGGTTTGGTAAGAAAT (SEQ ID NO: 109); Reverse, amplified by qPCR using TGCAGCACGTATGATAACTTCAAAG (SEQ ID NO: 110) and replication quantified using a Fam fluorescent reporter and a probe with the sequence AGGATATTTTACCCAGCAGTGCCCCGT (SEQ ID NO: 111).

The O25b serotype specific amplicon corresponds to part of the O25b serotype orf10 region. Primers and probes were custom designed, purchased lyophilized from Integrated DNA Technologies, and grown at a concentration of 100 nmol/mL in buffer TE (Corning Inc., Ref# 46-009-CM). It was reconstructed.

DNA samples from the DNA extraction procedure described above were assayed in 96 well Applied Biosystems MicroAmp Optical 96 well reaction plates (Applied Biosystems, Ref# N8010560). The qPCR reaction consisted of 12.5 μL Applied Biosystems 2X Taqman Fast Advanced Master Mix (Applied Biosystems, Ref# 4444554), 0.125 μL each reconstituted primer, 0.5 μL probe, and 1.75 μL molecular biology grade water. (Molecular Biology Grade Water) (Corning Inc., Ref# 46-000-CM), and 10 μL of sample per well in a total volume of 25 μl.

Reaction conditions for DNA amplification were 50°C for 2 minutes, followed by 95°C for 2 minutes, followed by 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds using an Applied Biosystems 7500 Real-Time-PCR System or an Applied Biosystems Quant. Runs were performed on a QuantStudio 6 real-time-PCR system (Applied Biosystems).

To enable quantification, a linear standard curve was developed. The same lice used in each challenge experiment (preparation described above). Aliquots of frozen stock of E. coli were diluted to 1x109 CFU/mL in sterile PBS (Corning, 21-040-CM). Perform subsequent serial dilutions to obtain concentrations of 1x10 ⁸ , 1x10 ⁷ , 1x10 ⁶ , 1x10 ⁵ , 1x10 ⁴ , 1000, 100, and 10 CFU/mL. A solution containing E. coli was produced. Serial dilutions were prepared in sterile PBS (Corning, 21-040-CM) or pooled twice filtered NHP urine was collected from subjects prior to inoculation. Dilutions in PBS and pooled twice filtered NHP urine were later found to be equivalent. The quantity of viable bacteria present in each dilution was determined by plating on TSA plates (BD, BBL Trypticase Soy Agar (Soy Casein Digest Agar) Cat.# B21283X). DNA extraction was performed for each serial dilution using the same method used to extract DNA from samples as described above. These qPCR standards were run in duplicate on all qPCR assay plates.

Linear regression analysis was performed using Applied Biosystems QuantStudio software. Statistical analysis determined that a standard curve was generated that behaved linearly between 100 and 1x10 ⁸ bacteria/mL. As a result, the lower limit of quantitation (LLOQ) was determined to be 100 bacteria/mL. In some cases, the samples reached the fluorescence threshold, but in cycles corresponding to quantities below the LLOQ, and in other cases, the fluorescence threshold was not reached at all (undetermined value). When either of these conditions occurs, the value is reported here as the value of LLOQ (100 bacteria/mL).

12. Myeloperoxidase (MPO) ELISA

Myeloperoxidase (MPO) was quantified in NHP urine using the Invitrogen Myeloperoxidase Instant ELISA Kit (Invitrogen, Ref# BMS2038INST). PIPES buffer was added to pure urine samples to a final concentration of 5% 0.5M PIPES buffer pH 6.8 (Alfa Aesar, Ref# J61786-AK). The sample was vortexed for 15 seconds and then diluted 1:1 with the sample diluent supplied by the manufacturer. Samples were assayed in duplicate and the manufacturer's instructions were followed for the remaining assays. At the final endpoint, color intensity at 450 nm was measured on a Spectramax Plus instrument (Molecular Devices). A standard curve was generated using the standards included in the assay kit. For the analysis, the lower standard of the assay kit (156.25 pg/mL) was understood as the lower limit of detection (LLOD). Companion software for Spectramax instruments (Softmax, Molecular Devices) allows extrapolation beyond lower standard values. The half value of the LLOD (78.125 pg/mL) was replaced by any value extrapolated below that value, or when any assay result fell completely below the limit of detection.

13. IL-8 Luminex assay

Interleukin-8 (IL-8) was assayed using the custom Bio-Rad IL-8 Human Cytokine Screening Panel Luminex Assay Kit (BioRad Laboratories Inc., REF# 17005177). It was measured using PIPES buffer was added to pure urine samples to a final concentration of 5% 0.5M PIPES buffer pH 6.8 (Alpha Asa, Ref# J61786-AK). Samples were vortexed for 15 seconds and then diluted 1:1 with 50% modified LXA-4 buffer (PBS 1X, 0.5% BSA, 0.025% sodium azide). Samples were assayed in duplicate and the manufacturer's instructions were followed for the remaining assays. Assay plates were read on a BioPlex 200 Luminex instrument (Biorad Laboratories Inc.). Standard curves were generated and sample concentrations were extrapolated from fluorescence intensity using the companion software “Bioplex Manager” of the Bioplex 200 Luminex instrument and the included standards from the assay kit. BioPlex Manager software determines the lower limit of quantification (LLOQ).

14. Total nucleated cell count and light microscopy analysis of urine sediment

Within 1 hour of collection, urine samples (500 μl to 1 mL) were fixed in formalin to a final concentration of 1% and sent to Pfizer (Groton, CT, USA) on ice overnight. Upon receipt, total nucleated cells (epithelial cells and polymorphonuclear cells) were counted using a hemocytometer. A total of approximately 300 μL was loaded into a Thermo Scientific Shandon EZ dual cell funnel (100 μL was loaded into one funnel and 200 μL was loaded into the other funnel). Samples were cytocentrifuged at 750 rpm for 5 minutes on Sandon dual cytoslide microscope coated glass slides using a Thermo Scientific Cytospin 4 cytocentrifuge. For samples with high cell counts, urine was first diluted 1:10 with 0.9% saline before cytocentrifugation. The cytoprep slides were then briefly methanol fixed and stained with Giemsa and My-Grunwald stains using a Sysmex SP-10 instrument. For each urine sample, one slide per urine sample was prepared in the 2 sample volumes listed above.

Cytospin slides containing concentrated, stained urine sediment were examined for the presence or absence of increased polymorphonuclear cells (PMNs, i.e. granulocytes with segmented or reorganized nuclei, usually composed of neutrophils but also including eosinophils and basophils). Evaluation was made by light microscopy. The absence of increased PMN cells was determined based on the observation of no PMNs or rare PMNs. The presence of increased PMNs was determined based on the observation of rare PMN abnormalities compared to the background epithelial cell population.

B. Results

1. Vaccination with FimH-DSG G15A G16A V27A mutants with and without O-antigen elicits potent total and neutralizing antibodies in non-human primates

Non-human primates were vaccinated with the FimH-DSG G15A G16A V27A mutant with or without tetravalent O-antigen conjugates (O25b, O6, O1a, O2) and AS01b adjuvant (Figure 9). In the FimH-DSG G15A G16A V27A and tetravalent O-antigen vaccinated groups, O-antigen serotype-specific antibody titers rose ~400-fold at 6 weeks post-vaccination (Figure 10 and Table 22). Total anti-FimH antibody titers were quantified using direct Luminex immunoassay (dLIA) (Figure 11A and Table 23). Animals in the placebo group had titers below the assay limit of quantification. In both vaccinated, titers rose after two doses and could be boosted with a third dose. Overall, titers were slightly lower in animals vaccinated with FimH-DSG G15A G16A V27A in combination with O-antigen compared to FimH-DSG G15A G16A V27A alone.

Table 22: O-antigen serotype-specific titers in non-human primates vaccinated with FimH-DSG G15A G16A V27A with tetravalent O-antigen

Table 23: FimH IgG geometric mean titers in non-human primates

This for yeast mannan. To evaluate the ability of anti-FimH antibodies to block binding of E. coli. Serum was evaluated in an E. coli binding inhibition assay (Figure 11B and Table 24). The average IC50 of sera from animals vaccinated with FimH-DSG G15A G16A V27A alone rose to 293.65 after dose 2 and 1698.39 after dose 3, while that of animals vaccinated with FimH-DSG G15A G16A V27A in combination with O-antigen The average IC ₅₀ was 480.12 after dose 2 and 756.45 after dose 3.

Table 24: This for non-human primate sera. Coli neutralization assay IC ₅₀

Together, these data show that FimH-DSG G15A G16A V27A elicits a robust antibody response in non-human primates and that combination with O-antigen results in high titers, although slightly lower than FimH alone.

2. Vaccination with FimH-DSG G15A G16A V27A mutant with and without O-antigen reduces bacteriuria and biomarkers of infection in a non-human primate model

Five weeks after the final boost, vaccinated and placebo-treated NHPs were inoculated via intravesical catheterization with 108 CFU of UPEC isolate PFEEC0578. Bacteriuria was monitored in catheter-collected urine over a 28-day period. In all placebo-treated animals, instillation of live bacteria induced high levels of bacteriuria on days 2 and 7 post-challenge (approximately geometric mean of 106 bacteria/mL urine). Compared to the placebo group, animals vaccinated with FimH-DSG G15A G16A V27A or FimH-DSG G15A G16A V27A + tetravalent O-antigen had a 300-fold or 1000-fold reduction in geometric mean bacteriuria on days 2 and 7 after infection, respectively. indicated.

At day 14, approximately 50% of placebo vaccinated animals still exhibited bacteriuria >105 bacteria/mL urine. Finally, most placebo NHPs cleared infection on days 21 and 28. In contrast, most FimH-DSG G15A G16A V27A or FimH-DSG G15A G16A V27A + tetravalent O-antigen vaccinated animals cleared infection by day 14 (Figure 12).

Next, various inflammatory biomarkers were monitored in the urine of challenge-infected NHPs. At day 7 post-challenge, all placebo-treated animals showed elevated levels of polymorphonuclear (PMN) cells in urine sediment as confirmed by cytological analysis. In contrast, less than 25% of FimH-DSG G15A G16A V27A vaccinated NHPs had increased levels of PMN cells in the urine sediment and no FimH-DSG G15A G16A V27A + tetravalent O-antigen immunized animals (Figure 13C ). At the same time, levels of myeloperoxidase (MPO) and interleukin 8 (IL-8) were measured in urine samples over a 7-day period. On day 2 post-challenge, both vaccinated groups showed a two-fold reduction in MPO levels (geometric mean of ∼200 pg/mL) compared to the placebo group (geometric mean of 470 pg/mL) (Figure 13A) .

Additionally, on days 2 and 7 post-infection, urine concentrations of IL-8 in FimH-DSG G15A G16A V27A vaccinated animals were lower than those measured in the urine of placebo-treated NHPs (of 54.2 pg/mL and 32.7 pg/mL, respectively). compared to the geometric mean) by approximately 10-fold and 5-fold, respectively (geometric mean of 5.9 pg/mL and 9.8 pg/mL). In a similar trend, urinary levels of IL-8 in NHPs immunized with FimH-DSG G15A G16A V27A in combination with O-antigen on days 2 and 7, respectively, were approximately 5% higher than the IL-8 concentrations observed in placebo-treated animals. decreased by two- and three-fold (geometric mean of 11.3 pg/mL) (Figure 13B).

C. Conclusion

The FimH-DSG G15A G16A V27A mutant induces high anti-FimH IgG titers in NHPs, which can be boosted with a third dose. Animals vaccinated with the combination of FimH-DSG G15A G16A V27A mutant and tetravalent O-antigen showed high O-antigen IgG titers.

FimH-DSG G15A G16A V27A elicits potent neutralizing antibodies in non-human primates. Combination with tetravalent O-antigens is similarly immunogenic.

FimH-DSG G15A G16A V27A mutants with or without tetravalent O-antigen reduce bacteriuria and biomarkers of infection in a urinary tract infection model in cynomolgus macaques.

The following items describe additional aspects of the disclosure:

C1. A mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of the wild-type FimH polypeptide, wherein the mutation positions are F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35. , R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129, Q133, F144, V154, V155, V156, P157, T158 , V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59.

C2. For item C1, F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; P26C; V27A; V27C; V28C; Q32C; N33C; L34C; L34N; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; L107C; Y108C; L109C; V112C; S113C; A115V; G116C; V118C; A119C; A119N; A119S; A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; V163I; and V185I, or any combination thereof.

C3. The mutated FimH polypeptide of item C2 comprising mutations G15A and G16A.

C4. The mutated FimH polypeptide of item C2 comprising mutations P12C and A18C.

C5. The mutated FimH polypeptide of item C2 comprising mutations G14C and F144C.

C6. The mutated FimH polypeptide of item C2 comprising mutations P26C and V35C.

C7. The mutated FimH polypeptide of item C2 comprising mutations P26C and V154C.

C8. The mutated FimH polypeptide of item C2 comprising mutations P26C and V156C.

C9. The mutated FimH polypeptide of item C2 comprising mutations V27C and L34C.

C10. The mutated FimH polypeptide of item C2 comprising mutations V28C and N33C.

C11. The mutated FimH polypeptide of item C2 comprising mutations V28C and P157C.

C12. The mutated FimH polypeptide of item C2 comprising mutations Q32C and Y108C.

C13. The mutated FimH polypeptide of item C2 comprising the mutations N33C and L109C.

C14. The mutated FimH polypeptide of item C2 comprising the mutations N33C and P157C.

C15. The mutated FimH polypeptide of item C2 comprising mutations V35C and L107C.

C16. The mutated FimH polypeptide of item C2 comprising mutations V35C and L109C.

C17. The mutated FimH polypeptide of item C2 comprising mutations S62C and T86C.

C18. The mutated FimH polypeptide of item C2 comprising mutations S62C and L129C.

C19. The mutated FimH polypeptide of item C2 comprising the mutations Y64C and L68C.

C20. The mutated FimH polypeptide of item C2 comprising the mutations Y64C and A127C.

C21. The mutated FimH polypeptide of item C2 comprising mutations L68C and F71C.

C22. The mutated FimH polypeptide of item C2 comprising mutations V112C and T158C.

C23. The mutated FimH polypeptide of item C2 comprising mutations S113C and G116C.

C24. The mutated FimH polypeptide of item C2 comprising mutations S113C and T158C.

C25. The mutated FimH polypeptide of item C2 comprising mutations V118C and V156C.

C26. The mutated FimH polypeptide of item C2 comprising mutations A119C and V155C.

C27. The mutated FimH polypeptide of item C2 comprising mutations L34N and V27A.

C28. The mutated FimH polypeptide of item C2 comprising mutations L34S and V27A.

C29. The mutated FimH polypeptide of item C2 comprising mutations L34T and V27A.

C30. The mutated FimH polypeptide of item C2 comprising mutations L34D and V27A.

C31. The mutated FimH polypeptide of item C2 comprising mutations L34E and V27A.

C32. The mutated FimH polypeptide of item C2 comprising mutations L34K and V27A.

C33. The mutated FimH polypeptide of item C2 comprising mutations L34R and V27A.

C34. The mutated FimH polypeptide of item C2 comprising mutations A119N and V27A.

C35. The mutated FimH polypeptide of item C2 comprising mutations A119S and V27A.

C36. The mutated FimH polypeptide of item C2 comprising mutations A119T and V27A.

C37. The mutated FimH polypeptide of item C2 comprising mutations A119D and V27A.

C38. The mutated FimH polypeptide of item C2 comprising mutations A119E and V27A.

C39. The mutated FimH polypeptide of item C2 comprising mutations A119K and V27A.

C40. The mutated FimH polypeptide of item C2 comprising mutations A119R and V27A.

C41. The mutated FimH polypeptide of item C2 comprising mutations G15A and V27A.

C42. The mutated FimH polypeptide of item C2 comprising mutations G16A and V27A.

C43. The mutated FimH polypeptide of item C2 comprising mutations G15P and V27A.

C44. The mutated FimH polypeptide of item C2 comprising mutations G16P and V27A.

C45. The mutated FimH polypeptide of item C2 comprising mutations G15A, G16A and V27A.

C46. The mutated FimH polypeptide of item C2 comprising mutations G65A and V27A.

C47. The mutated FimH polypeptide of item C2 comprising mutations V27A and Q133K.

C48. The mutated FimH polypeptide of item C2 comprising the mutations G15A, G16A, V27A and Q133K.

C49. The mutated FimH polypeptide of item C2 comprising the sequence of any one of SEQ ID NOs: 2-58 and 60-64.

C50. The mutated FimH polypeptide according to any one of items C1-C49, wherein the polypeptide is isolated.

C51. A pharmaceutical composition comprising (i) a mutated FimH polypeptide according to any one of clauses C1-C50 and (ii) a pharmaceutically acceptable carrier.

C52. An immunogenic composition comprising a mutated FimH polypeptide according to any one of items C1-C50.

C53. The immunogenic composition of item C52, further comprising at least one additional antigen.

C54. The immunogenic composition of item C53, wherein the at least one additional antigen is a saccharide, or polysaccharide, or glycoconjugate, or protein.

C55. The immunogenic composition of item C52, further comprising at least one adjuvant.

C56. A nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence of a mutated FimH polypeptide according to any one of items C1-C49.

C57. The mutated FimH polypeptide according to any one of items C1-C50, wherein the polypeptide is immunogenic.

C58. A recombinant mammalian cell comprising a polynucleotide encoding a mutated FimH polypeptide according to any one of items C1-C50.

C59. A culture comprising the recombinant cells of item C58, wherein the culture is at least 5 liters in size.

C60. culturing the recombinant mammalian cell according to item C58 under suitable conditions, thereby expressing the polypeptide; A method for producing a mutated FimH polypeptide according to any one of items C1-C50, comprising harvesting the polypeptide.

C61. (i) Extraintestinal pathogenic E. coli in the subject. E. coli, or (ii) extraintestinal pathogenic E. coli in the subject. 1. A method of inducing the production of opsonophagocytic and/or neutralizing antibodies specific for E. coli, wherein the method comprises administering to a subject an effective amount of a composition according to any one of items C51 to C55.

C62. The method of item C61, wherein the subject is at risk of developing a urinary tract infection.

C63. The method of item C61, wherein the subject is at risk of developing bacteremia.

C64. The method of item C61, wherein the subject is at risk of developing sepsis.

C65. E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C51-C55. Methods for eliciting an immune response against coli.

C66. The method of item C65, wherein the immune response is . A method comprising opsonophagocytic and/or neutralizing antibodies against E. coli.

C67. The method of item C65, wherein the immune response is . A method of protecting a mammal from coli infection.

C68. A method of preventing, treating or ameliorating a bacterial infection, disease or condition in a subject, comprising administering to the subject an immunologically effective amount of a composition according to any one of items C51-C55.

C69. The immunogenic composition of item C54, wherein the additional antigen is a saccharide comprising a structure selected from any of the following: Formula O1 (e.g. Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4:K52 and Formula O4:K6), Formula O5 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A , Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (e.g. Formula O73 (strain 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85 , Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137 , Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186 and Formula O187 , where n is an integer from 1 to 100.

C70. The method of item C69, wherein the saccharide has the formula O1 (e.g., Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4:K52 and Formula O4:K6), O5 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O10, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O21, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g. , Formula O25a and Formula O25b), Formula O26, Formula O28, Formula O44, Formula O45 (e.g. Formula O45 and Formula O45rel), Formula O55, Formula O56, Formula O58, Formula O64, Formula O69, Formula O73 (e.g. For example, Formula O73 (strain 73-1), Formula O75, Formula O77, Formula O78, Formula O86, Formula O88, Formula O90, Formula O98, Formula O104, Formula 0111, Formula O113, Formula O114, Formula O119, Formula O121, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O136, Formula O138, Formula O141, Formula O142, Formula O143, Formula O147, Formula O149, Formula O152, Formula O157, Formula O158, Formula O159, A structure selected from Formula O164, Formula O173, Formula 62D1, Formula O22, Formula O35, Formula O65, Formula O66, Formula O83, Formula O91, Formula O105, Formula O116, Formula O117, Formula O139, Formula O153, Formula O167, and Formula O172 An immunogenic composition comprising: where n is an integer from 31 to 100.

C71. Item C70, wherein the saccharide is of formula O1 (e.g. Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O3, Formula O4 (e.g. Formula O4:K52 and Formula O4:K6), Formula O1 O5 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula O7, Formula O10, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O21, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g. , Formula O25a and Formula O25b), Formula O26, Formula O28, Formula O44, Formula O45 (e.g. Formula O45 and Formula O45rel), Formula O55, Formula O56, Formula O58, Formula O64, Formula O69, Formula O73 (e.g. For example, Formula O73 (strain 73-1), Formula O75, Formula O77, Formula O78, Formula O86, Formula O88, Formula O90, Formula O98, Formula O104, Formula 0111, Formula O113, Formula O114, Formula O119, Formula O121, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O136, Formula O138, Formula O141, Formula O142, Formula O143, Formula O147, Formula O149, Formula O152, Formula O157, Formula O158, Formula O159, An immunogenic composition comprising a structure selected from Formula O164, Formula O173, and Formula 62D1, wherein n is an integer from 31 to 100.

C72. According to item C70, Formula O1 (e.g. Formula O1A, Formula O1B and Formula O1C), Formula O2, Formula O6 (e.g. Formula O6:K2; K13; K15 and Formula O6:K54), Formula O15, An immunogenic composition comprising a structure selected from Formula O16, Formula O21, Formula O25 (e.g., Formula O25a and Formula O25b), and Formula O75.

C73. The immunogenic composition according to item C70, comprising a structure selected from Formula O4, Formula O11, Formula O21 and Formula O75.

C74. The immunogenic composition of item C69, wherein the saccharide does not comprise a structure selected from Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O52, Formula O97 and Formula O101.

C75. The immunogenic composition of item C69, wherein the saccharide does not comprise a structure selected from formula O12.

C76. The immunogenic composition of item C72, wherein the saccharide is produced by expressing a wzz family protein in Gram-negative bacteria to produce the saccharide.

C77. The immunogenic composition of item C76, wherein the wzz family protein is selected from the group consisting of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2.

C78. The immunogenic composition of item C76, wherein the wzz family protein is wzzB.

C79. The immunogenic composition of item C76, wherein the wzz family protein is fepE.

C80. The immunogenic composition of item C76, wherein the wzz family proteins are wzzB and fepE.

C81. The immunogenic composition of item C76, wherein the wzz family protein is from Salmonella enterica.

C82. The immunogenic composition of item C76, wherein the wzz family protein comprises a sequence selected from any of the following: SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, sequence SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120 and SEQ ID NO: 121.

C83. The sequence of item C76, wherein the wzz family protein has at least 90% sequence identity to any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116. An immunogenic composition comprising a.

C84. The method of item C76, wherein the wzz family protein comprises a sequence selected from any one of SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121. Original composition.

C85. The immunogenic composition of item C69, wherein the saccharide is synthetically synthesized.

C86. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition further comprising an E. coli R1 moiety.

C87. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition further comprising an E. coli R2 moiety.

C88. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition further comprising an E. coli R3 moiety.

C89. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition further comprising an E. coli R4 moiety.

C90. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition further comprising an E. coli K-12 moiety.

C91. The immunogenic composition of any one of items C69 to C90, wherein the saccharide further comprises a 3-deoxy-d-manno-oct-2-ulosonic acid (KDO) moiety.

C92. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition, wherein the composition does not further comprise an E. coli R1 moiety.

C93. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition, wherein the composition does not further comprise an E. coli R2 moiety.

C94. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition, wherein the composition does not further comprise an E. coli R3 moiety.

C95. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition, wherein the composition does not further comprise an E. coli R4 moiety.

C96. The method according to any one of items C69 to C85, wherein the saccharide is An immunogenic composition, wherein the composition does not further comprise a coli K-12 moiety.

C97. The immunogenic composition according to any one of items C69 to C90, wherein the saccharide does not further comprise a 3-deoxy-d-manno-oct-2-ulosonic acid (KDO) moiety.

C98. The immunogenic composition of any one of items C69 to C91, wherein the saccharide does not comprise lipid A.

C99. The immunogenic composition of any one of items C69 to C98, wherein the polysaccharide has a molecular weight of 10 kDa to 2,000 kDa, or 50 kDa to 2,000 kDa.

C100. The immunogenic composition according to any one of items C69 to C99, wherein the saccharide has an average molecular weight of 20-40 kDa.

C101. The immunogenic composition according to any one of items C69 to C100, wherein the saccharide has an average molecular weight of 40,000 to 60,000 kDa.

C102. The immunogenic composition of any one of items C69 to C101, wherein n is an integer from 31 to 90.

C103. An immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide according to any one of items C69 to C50, and a saccharide covalently linked to a carrier protein, wherein the saccharide is E. An immunogenic composition derived from coli.

C104. An immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide according to any one of items C69 to C50, and a saccharide according to any of items C69 to C102, covalently linked to a carrier protein.

C105. A mutated FimH polypeptide according to any one of items C69 to C50, or a fragment thereof; and an immunogenic composition comprising the conjugate according to any one of items C69 to C102, wherein the carrier protein is selected from any of the following: poly(L-lysine), CRM ₁₉₇ , diphtheria toxin fragment. B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or exotoxin A from Pseudomonas aeruginosa; blood. Aeruginosa detoxified exotoxin A (EPA), maltose binding protein (MBP), S. aureus hemolysin A, clotting factor A, clotting factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its translated variants, seeds. Jejuni AcrA, Mr. Jejuni natural glycoprotein and streptococcal C5a peptidase (SCP).

C106. The immunogenic composition according to any one of items C103 to C105, wherein the carrier protein is CRM ₁₉₇ .

C107. The immunogenic composition of any one of items C103 to C105, wherein the carrier protein is tetanus toxoid (TT).

C108. The immunogenic composition of any one of items C103 to C105, wherein the carrier protein is poly(L-lysine).

C109. The immunogenic composition of any one of items C103 to C107, wherein the conjugate is prepared by reductive amination.

C110. The immunogenic composition of any one of items C103 to C107, wherein the conjugate is prepared by CDAP chemistry.

C111. The immunogenic composition of any one of items C103 to C107, wherein the conjugate is a single-end linked conjugated saccharide.

C112. The immunogenic composition of any one of items C103 to C107, wherein the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer.

C113. The method of item C112, wherein the saccharide is conjugated to the carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer, wherein the saccharide is linked to the eTEC spacer via a carbamate linkage. An immunogenic composition covalently linked, wherein the carrier protein is covalently linked to an eTEC spacer via an amide linkage.

C114. The immunogenic composition of any one of items C112 to C113, wherein CRM ₁₉₇ comprises 2 to 20, or 4 to 16 lysine residues covalently linked to the polysaccharide via an eTEC spacer.

C115. The immunogenic composition according to any one of items C103 to C114, wherein the saccharide:carrier protein ratio (w/w) is 0.2 to 4.

C116. The immunogenic composition of any one of items C103 to C114, wherein the ratio of saccharide to protein is at least 0.5 and at most 2.

C117. The immunogenic composition of any one of items C103 to C114, wherein the ratio of saccharide to protein is 0.4 to 1.7.

C118. The immunogenic composition according to any one of items C111 to C117, wherein the saccharide is conjugated to the carrier protein via a 3-deoxy-d-manno-oct-2-ulosonic acid (KDO) moiety.

C119. The method of item C69, wherein the conjugate comprises a saccharide covalently bound to a carrier protein, wherein the saccharide is selected from Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O52, Formula O97 and Formula O101. An immunogenic composition comprising a structure, wherein n is an integer from 1 to 10.

C120. An immunogenic composition comprising a mutated FimH polypeptide and a saccharide according to any one of items C69 to C102, and a pharmaceutically acceptable diluent.

C121. An immunogenic composition comprising a mutated FimH polypeptide and a glycoconjugate according to any one of items C103 to C119, and a pharmaceutically acceptable diluent.

C122. The immunogenic composition of item C121, comprising up to about 25% free saccharide compared to the total amount of saccharide in the composition.

C123. The immunogenic composition of any one of items C120 to C121, further comprising an adjuvant.

C124. The immunogenic composition of any one of items C120 to C121, further comprising aluminum.

C125. The immunogenic composition of any one of items C120 to C121, further comprising QS-21.

C126. The immunogenic composition of any one of items C120 to C121, further comprising a CpG oligonucleotide.

C127. The immunogenic composition of any one of items C120 to C121, wherein the composition does not include an adjuvant.

C128. A mutated FimH polypeptide according to any one of items C69 to C118, and conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. An immunogenic composition comprising a saccharide derived from E. coli, wherein the polysaccharide is covalently linked to an eTEC spacer through a carbamate linkage, and wherein the carrier protein is covalently linked to the eTEC spacer through an amide linkage. Phosphorus immunogenic composition.

C129. Item C128, wherein the saccharide is. An immunogenic composition that is an O-antigen derived from E. coli.

C130. The immunogenic composition of item C128, further comprising a pharmaceutically acceptable excipient, carrier or diluent.

C131. Item C128, wherein the saccharide is. An immunogenic composition that is an O-antigen derived from E. coli.

C132. Immunization comprising a mutated FimH polypeptide and a saccharide according to any one of items C69 to C85 conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer An immunogenic composition, wherein the polysaccharide is covalently linked to the eTEC spacer through a carbamate linkage, and wherein the carrier protein is covalently linked to the eTEC spacer through an amide linkage.

C133. A mutated FimH polypeptide, and (i) covalently coupled to a carrier protein. Conjugate of E. coli O25B antigen, (ii) covalently coupled to a carrier protein. Conjugate of E. coli O1A antigen, (iii) covalently coupled to a carrier protein. An immunogenic composition comprising a conjugate of an E. coli O2 antigen, and (iv) a conjugate of an O6 antigen covalently coupled to a carrier protein, wherein E. The E. coli O25B antigen is an immunogenic composition comprising the structure of formula O25B, where n is an integer greater than 30.

C134. The immunogenic composition of item C133, wherein the carrier protein is selected from any of the following: poly(L-lysine), CRM ₁₉₇ , diphtheria toxin fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or exotoxin A from Pseudomonas aeruginosa; blood. Aeruginosa detoxified exotoxin A (EPA), maltose binding protein (MBP), S. aureus hemolysin A, clotting factor A, clotting factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its translated variants, seeds. Jejuni AcrA, Mr. Jejuni natural glycoprotein and streptococcal C5a peptidase (SCP).

C135. A mutated FimH polypeptide according to any one of items C69 to C118, and (i) covalently coupled to a carrier protein. Conjugate of E. coli O25B antigen, (ii) covalently coupled to a carrier protein. Conjugate of E. coli O4 antigen, (iii) covalently coupled to a carrier protein. An immunogenic composition comprising a conjugate of an E. coli O11 antigen, and (iv) a conjugate of an O21 antigen covalently coupled to a carrier protein, wherein E. The immunogenic composition wherein the coli O25B antigen comprises the structure of formula O75, where n is an integer greater than 30.

C136. The immunogenic composition of item C135, wherein the carrier protein is selected from any of the following: poly(L-lysine), CRM ₁₉₇ , diphtheria toxin fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or exotoxin A from Pseudomonas aeruginosa; blood. Aeruginosa detoxified exotoxin A (EPA), maltose binding protein (MBP), S. aureus hemolysin A, clotting factor A, clotting factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its translated variants, seeds. Jejuni AcrA, Mr. Jejuni natural glycoprotein and streptococcal C5a peptidase (SCP).

C137. A method for preparing an immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide and a saccharide conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer, , the method is a) reacting saccharide with 1,1'-carbonyl-di-(1,2,4-triazole) (CDT) or 1,1'-carbonyldiimidazole (CDI) in an organic solvent. generating activated saccharide; b) reacting the activated saccharide with cystamine or cysteamine or a salt thereof to produce a thiolated saccharide; c) reacting the thiolated saccharide with a reducing agent to produce an activated thiolated saccharide comprising at least one free sulfhydryl moiety; d) reacting the activated thiolated saccharide with an activated carrier protein comprising at least one α-haloacetamide group to produce a thiolated saccharide-carrier protein conjugate; and e) a thiolated saccharide-carrier protein conjugate comprising: (i) a first capping reagent capable of capping the unconjugated α-haloacetamide group of the activated carrier protein; and/or (ii) reacting with a second capping reagent capable of capping the unconjugated free sulfhydryl moiety; thereby producing an eTEC linked glycoconjugate, wherein the saccharide is. Derived from E. coli; A production method further comprising expressing a polynucleotide encoding a polypeptide derived from FimH or a fragment thereof in a recombinant mammalian cell, and isolating the polypeptide or fragment thereof.

C138. The method of item C137, comprising preparing an immunogenic composition according to any one of items C69 to C102.

C139. The method of any one of items C137 to C138, wherein the capping step e) comprises the thiolated saccharide-carrier protein conjugate with (i) N-acetyl-L-cysteine as the first capping reagent, and/or (ii) as the second capping reagent. A method comprising reacting with iodoacetamide as a capping reagent.

C140. The method of any one of items C137 to C139, further comprising combining the saccharide by reaction with a triazole or imidazole to provide a blended saccharide, wherein the blended saccharide is prepared prior to step a) A method wherein the shell is frozen, lyophilized, and reconstituted in an organic solvent.

C141. The method of any one of items C137 to C140, further comprising purifying the thiolated polysaccharide produced in step c), wherein the purifying step comprises diafiltration.

C142. The method of any one of items C137 to C141, wherein the method further comprises purifying the eTEC linked glycoconjugate by diafiltration.

C143. The process of any one of items C137 to C142, wherein the organic solvent of step a) is dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP) ), acetonitrile, 1,3-dimethyl-3,4,5,6-tetrahydro-2(1H)-pyrimidinone (DMPU) and hexamethylphosphoramide (HMPA), or mixtures thereof. A method wherein the polar aprotic solvent is selected from

C144. The method of any one of items C137 to C142, wherein the medium is KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ - 7H ₂ O, Na ₂ MoO ₄ -2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O A method that includes elements selected from one.

C145. In item C144, the medium is E. A medium used for cultivating coli.

C146. A method for producing a saccharide according to any one of items C69 to C102, wherein the recombinant E. coli in a medium. Culturing coli; Producing the saccharide by culturing the cells in the medium; A method whereby the cell produces the saccharide.

C147. Item C146, wherein the medium is KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O, Na ₂ Containing an element selected from any one of MoO ₄ -2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O How to do it.

C148. The method of item C146, wherein the medium comprises soy hydrolyzate.

C149. The method of item C146, wherein the medium comprises yeast extract.

C150. The method of item C146, wherein the medium does not further comprise soy hydrolyzate and yeast extract.

C151. In item C146, this. A method wherein the coli cell comprises a heterologous wzz family protein selected from any one of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2.

C152. In item C146, this. A method wherein the coli cell comprises a Salmonella enterica wzz family protein selected from any one of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2.

C153. The method of item C152, wherein the wzz family protein comprises a sequence selected from any of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116. .

C154. The method of item C146, wherein the culture produces a yield of >120 OD ₆₀₀ /mL.

C155. The method of item C146, further comprising purifying the saccharide.

C156. The method of item C146, wherein the purification step comprises any of the following: dialysis, concentration operation, diafiltration operation, tangential flow filtration, precipitation, elution, centrifugation, sedimentation, ultrafiltration, depth filtration, and column chromatography. graphy (ion exchange chromatography, multimode ion exchange chromatography, DEAE, and hydrophobic interaction chromatography).

C157. A method of inducing an immune response in a subject, comprising administering to the subject a composition according to any one of items C69 to C136.

C158. The method of item C157, wherein the immune response is anti-E. A method comprising induction of E. coli O-specific polysaccharide serum antibodies.

C159. The method of item C157, wherein the immune response is anti-E. A method comprising inducing an E. coli IgG antibody.

C160. The method of item C157, wherein the immune response is . A method comprising inducing bactericidal activity against E. coli.

C161. The method of item C157, wherein the immune response is . A method comprising inducing opsonophagocytic antibodies against E. coli.

C162. The method of item C157, wherein the immune response comprises a geometric mean titer (GMT) level of at least 1,000 to 200,000 after the initial administration.

C163. Item C157, wherein the composition comprises a saccharide comprising the formula O25, wherein n is an integer from 40 to 100, and wherein the immune response comprises a geometric mean titer (GMT) level of at least 1,000 to 200,000 after the initial administration. How to do it.

C164. Item C157, wherein the subject has urinary tract infection, cholecystitis, cholangitis, diarrhea, hemolytic uremic syndrome, neonatal meningitis, urosepsis, intra-abdominal infection, meningitis, complicated pneumonia, wound infection, post-prostate biopsy-related infection, neonatal/infant sepsis , neutropenic fever, and other bloodstream infections; A method wherein the person is at risk for any one of a condition selected from pneumonia, bacteremia, and sepsis.

C165. The method of item C157, wherein the subject is a mammal.

C166. (i) Extraintestinal pathogenic E. coli in the subject. E. coli, or (ii) extraintestinal pathogenic E. coli in the subject. A method of inducing the production of opsonophagocytic antibodies specific for E. coli, wherein the method comprises administering to a subject an effective amount of a composition according to any one of items C69 to C136.

C167. The method of item C166, wherein the subject is at risk of developing a urinary tract infection.

C168. The method of item C166, wherein the subject is at risk of developing bacteremia.

C169. The method of item C166, wherein the subject is at risk of developing sepsis.

C170. A method of inducing an immune response in a subject, comprising administering to the subject a composition according to any one of items C69 to C136.

C171. The method of item C170, wherein the immune response is anti-E. A method comprising induction of E. coli O-specific polysaccharide serum antibodies.

C172. In item C170, clause-E. A method wherein the coli O-specific polysaccharide serum antibody is an IgG antibody.

C173. In item C170, clause-E. E. coli O-specific polysaccharide serum antibodies. A method of being an IgG antibody having bactericidal activity against E. coli.

C174. In item C69, n corresponds to wild type E. An immunogenic composition that is greater than the number of repeat units in E. coli polysaccharide.

C175. The composition of item C174, wherein n is an integer from 31 to 100.

C176. The composition of item C174, wherein the saccharide comprises a structure according to any one of formula O1A, formula O1B and formula O1C, formula O2, formula O6 and formula O25B.

C177. The method of item C174, wherein the saccharide is SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, A composition produced in a recombinant host cell expressing a wzz family protein having at least 90% sequence identity to any one of SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121.

C178. The composition of item C177, wherein the protein comprises any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116.

C179. The composition of item C174, wherein the saccharide is synthesized synthetically.

C180. A conjugate comprising a mutated FimH polypeptide according to any one of items C1 to C55, and (a) a carrier protein covalently linked to a saccharide comprising the formula O25b, where n is an integer from 31 to 90, (b) ) a conjugate comprising a carrier protein covalently bound to a saccharide having the formula O1A (where n is an integer from 31 to 90), (c) a saccharide comprising the formula O2 (where n is an integer from 31 to 90) a conjugate comprising a carrier protein covalently bound to a saccharide, and (d) a conjugate comprising a carrier protein covalently bound to a saccharide comprising the formula O6, where n is an integer from 31 to 90. Immunogenic composition.

C181. Item C180, wherein the carrier protein is covalently linked to a saccharide comprising a structure selected from any of the following formulas O15, O16, O17, O18 and O75, where n is an integer from 31 to 90. An immunogenic composition further comprising a conjugate comprising:

C182. The immunogenic composition of item C180, comprising at most 25% free saccharide compared to the total amount of saccharide in the composition.

C183. E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C180 to C182. Methods for eliciting an immune response against coli.

C184. The method of item C183, wherein the immune response is . A method comprising an opsonophagocytic antibody against E. coli.

C185. The method of item C183, wherein the immune response is . A method of protecting a mammal from coli infection.

C186. (a) a recombinant mammalian cell comprising a first gene of interest encoding a mutated FimH polypeptide of any one of items C1 to C55, wherein the gene is integrated between at least two recombination target sites (RTS) Mammalian cells.

C187. The embodiment of item C186, wherein the two RTS are chromosomally-integrated within the NL1 locus or the NL2 locus.

C188. The embodiment of item C186, wherein the first gene of interest further comprises a reporter gene, a gene encoding a difficult-to-express protein, an accessory gene, or a combination thereof.

C189. Item C186, further comprising a second gene of interest integrated into a second chromosomal locus distinct from the locus of (a), wherein the second gene of interest is a reporter gene, a gene encoding a protein that is difficult to express, an accessory gene Or embodiments comprising combinations thereof.

C190. The recombinant cell of C186, wherein the polynucleotide sequence is integrated into the genomic DNA of said mammalian cell.

C191. The recombinant cell of C186, wherein the polynucleotide sequence is a codon optimized for expression in the cell.

C192. The recombinant cell of C186, wherein the cell is a human embryonic kidney cell.

C193. The recombinant cell of C192, wherein the human embryonic kidney cell comprises a HEK293 cell.

C194. The recombinant cell of C193, wherein the HEK293 cell is selected from any one of HEK293T cells, HEK293TS cells and HEK293E cells.

C195. The recombinant cell of C186, wherein the cell is a CHO cell.

C196. The recombinant cell of C195, wherein the CHO cell is a CHO-K1 cell, a CHO-DUXB11 cell, a CHO-DG44 cell, or a CHO-S cell.

C197. The recombinant cell of C186, wherein the polypeptide is soluble.

C198. The recombinant cell of C186, wherein the polypeptide is secreted from the cell.

C199. A culture comprising recombinant cells of C186, wherein the culture is at least 5 liters in size.

C200. The culture according to C199, wherein the yield of polypeptide or fragment thereof is at least 0.05 g/L.

C201. The culture according to C199, wherein the yield of polypeptide or fragment thereof is at least 0.10 g/L.

C202. culturing the recombinant mammalian cell according to C186 under suitable conditions, thereby expressing the polypeptide or fragment thereof; And harvesting the polypeptide or fragment thereof. A method of producing a polypeptide or fragment thereof derived from E. coli.

C203. The method of C202, further comprising purifying the polypeptide or fragment thereof.

C204. The method of item C54, wherein any K selected from the group consisting of O1, O2, O3 and O5. An immunogenic composition further comprising at least one saccharide derived from a pneumoniae type.

C205. In item C204, K. An immunogenic composition further comprising a saccharide derived from Pneumoniae type O1.

C206. In item C204, K. An immunogenic composition further comprising a saccharide derived from Pneumoniae type O2.

C207. In item C204, K. A composition further comprising a saccharide derived from Pneumoniae type O3.

C208. In item C204, K. An immunogenic composition further comprising a saccharide derived from Pneumoniae type O5.

C209. In item C204, K. Saccharide and K derived from Pneumoniae type O1. An immunogenic composition further comprising a saccharide derived from Pneumoniae type O2.

C210. The immunogenic composition according to any one of items C204 to C209, further comprising at least one saccharide comprising a structure selected from any of the following: Formula O1, Formula O1A, Formula O1B, Formula O1C, Formula O2, Formula O3, formula O4, formula O4:K52, formula O4:K6, formula O5, formula O5ab, formula O5ac, formula O6, formula O6:K2; K13; K15, Formula O6:K54, Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18, Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, Formula O18B1, Formula O19, Formula O20, Formula O21, Formula O22, Formula O23, Formula O23A, Formula O24, Formula O25, Formula O25a, Formula O25b, Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45, Formula O45, Formula O45rel , Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D1, Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73, Formula O73, Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97 , Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109, Formula O110, Formula 0111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148 , Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160, Formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186, Formula O187, where n is an integer from 1 to 100, more preferably 31 to 90.

C211. In item C210, K. A saccharide derived from Pneumoniae is conjugated to a carrier protein; this. An immunogenic composition comprising a saccharide derived from E. coli conjugated to a carrier protein.

C212. E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C204-C211. Methods for eliciting an immune response against coli.

C213. The method of item C212, wherein the immune response is . A method comprising an opsonophagocytic antibody against E. coli.

C214. The method of item C212, wherein the immune response is . A method of protecting a mammal from coli infection.

C215. K. in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C204-C211. Methods for eliciting an immune response to pneumoniae.

C216. The method of item C215, wherein the immune response is K. A method comprising an opsonophagocytic antibody against Pneumoniae.

C217. The method of item C215, wherein the immune response is K. A method of protecting a mammal from pneumonia infection.

C218. The method of any one of items C204 to C217, where K. Compositions and methods wherein the pneumoniae serotype O1 comprises variant O1V1 or O1V2.

C219. The method of any one of items C204 to C217, where K. Compositions and methods wherein the pneumoniae serotype O2 comprises variant O2V1 or O2V2.

C220. Use of the composition set forth in any one of items C1-C219 as set forth herein.

C221. In item C211, K. Pneumoniae O-antigens are present in a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 (O2v1), and d) serotype O2. A composition selected from the group consisting of subtype v2 (O2v2).

C222. A nucleic acid comprising nucleotides encoding the polypeptide of any one of items C1-C221.

C223. The nucleic acid of item C222, wherein the nucleic acid is RNA.

C224. Nanoparticles comprising the nucleic acid of item C222 or C223.

C225. The invention further comprising at least one conjugate with a saccharide selected from the group consisting of Formula O4, Formula O11, Formula O13, Formula O21 and Formula O86, wherein n is an integer from 1 to 100, preferably from 31 to 90. Immunogenic composition of.

C226. Immunogenicity of the invention further comprising at least one conjugate with a saccharide selected from the group consisting of Formula O1a, Formula O2, Formula O6 and Formula O25b, where n is an integer from 1 to 100, preferably from 31 to 90. Composition.

Claims (19)

(i) A mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of the wild-type FimH polypeptide, wherein the mutation positions are F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129, Q133, F144, V154, V155, V156, A pharmaceutical composition comprising a mutated FimH polypeptide selected from the group consisting of P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59, and (ii) a pharmaceutically acceptable carrier. The method of claim 1, wherein the mutated FimH polypeptide is F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; P26C; V27A; V27C; V28C; Q32C; N33C; L34C; L34N; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; L107C; Y108C; L109C; V112C; S113C; A115V; G116C; V118C; A119C; A119N; A119S; A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; V163I; and V185I, or any combination thereof. The pharmaceutical composition of claim 2, wherein the mutated FimH polypeptide comprises a mutation selected from the group consisting of:
a) Mutations G15A and G16A;
b) mutants P12C and A18C;
c) mutations G14C and F144C;
d) mutations P26C and V35C;
e) mutations P26C and V154C;
f) mutations P26C and V156C;
g) mutations V27C and L34C;
h) mutations V28C and N33C;
i) mutations V28C and P157C;
j) mutations Q32C and Y108C;
k) mutations N33C and L109C;
l) mutations N33C and P157C;
m) mutations V35C and L107C;
n) mutations V35C and L109C;
o) mutations S62C and T86C;
p) mutations S62C and L129C;
q) mutations Y64C and L68C;
r) mutations Y64C and A127C;
s) mutations L68C and F71C;
t) mutations V112C and T158C;
u) mutations S113C and G116C;
v) mutations S113C and T158C;
w) mutations V118C and V156C;
x) mutations A119C and V155C;
y) mutations L34N and V27A;
z) mutations L34S and V27A;
aa) mutations L34T and V27A;
ab) mutations L34D and V27A;
ac) mutations L34E and V27A;
ad) mutations L34K and V27A;
ae) mutations L34R and V27A;
af) mutations A119N and V27A;
ag) mutations A119S and V27A;
ah) Mutations A119T and V27A;
ai) mutations A119D and V27A;
aj) mutations A119E and V27A;
ak) mutations A119K and V27A;
al) mutations A119R and V27A;
am) mutations G15A and V27A;
an) mutations G16A and V27A;
ao) mutations G15P and V27A;
ap) mutations G16P and V27A;
aq) mutations G15A, G16A and V27A;
ar) mutations G65A and V27A;
as) mutations V27A and Q133K; and
at) mutations G15A, G16A, V27A and Q133K. The pharmaceutical composition of claim 2, wherein the mutated FimH polypeptide comprises the sequence of any one of SEQ ID NOs: 2-58 and 60-64. 5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the mutated FimH polypeptide is isolated. (i) an immunogenic composition comprising a mutated FimH polypeptide as described in any one of claims 1 to 4, and (ii) a pharmaceutical composition comprising a pharmaceutically acceptable carrier. 7. The pharmaceutical composition according to claim 6, wherein the immunogenic composition further comprises at least one additional antigen. 8. The pharmaceutical composition according to claim 7, wherein the at least one additional antigen is a polysaccharide or protein. 7. The pharmaceutical composition of claim 6, wherein the immunogenic composition further comprises at least one adjuvant. A pharmaceutical composition comprising (i) a nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence of a mutated FimH polypeptide as described in any one of claims 1 to 4, and (ii) a pharmaceutically acceptable carrier. . 5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the mutated FimH polypeptide is immunogenic. The method according to any one of claims 1 to 4, wherein (i) in the subject, extraintestinal pathogenic E. induce an immune response against E. coli , or (ii) extraintestinal pathogenic E. coli in the subject. A pharmaceutical composition for inducing the production of opsonophagocytic and/or neutralizing antibodies specific for E. coli. 13. The pharmaceutical composition of claim 12, wherein the subject is at risk of developing a urinary tract infection. The pharmaceutical composition according to claim 12, wherein the subject is at risk of developing bacteremia. The pharmaceutical composition according to claim 12, wherein the subject is at risk of developing sepsis. The method according to any one of claims 1 to 4, wherein E. coli in a mammal. Pharmaceutical composition for eliciting an immune response against coli. 17. The method of claim 16, wherein the immune response is E. A pharmaceutical composition comprising an opsonic phagocytic and/or neutralizing antibody against E. coli. 17. The method of claim 16, wherein the immune response is E. A pharmaceutical composition for protecting mammals from coli infection. The pharmaceutical composition according to any one of claims 1 to 4 for preventing, treating or ameliorating a bacterial infection, disease or condition in a subject.