JP2024000530A - Escherichia coli fimh mutants and uses thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide designs of mutated FimH polypeptides of Escherichia coli (E. coli), which result in improved biochemical properties and immunogenicity, compositions comprising such polypeptides, and uses thereof.

SOLUTION: Provided is a pharmaceutical composition comprising a mutated FimH polypeptide, which comprises at least one amino acid mutation relative to the amino acid sequence of the wild-type FimH polypeptide, and a pharmaceutically acceptable carrier.

SELECTED DRAWING: None

COPYRIGHT: (C)2024,JPO&INPIT

Description

TECHNICAL FIELD OF THE INVENTION The present disclosure relates to mutated Escherichia coli FimH polypeptides and methods of use thereof.

Urinary tract infections (UTIs) affect one in five women at least once in their lifetime, cause significant morbidity and mortality, and place a substantial burden on the healthcare system. Although several different bacteria can cause UTI, the most common cause (90-95% of cases) is the Gram-negative bacterium Escherichia coli (E. coli). Most E. coli UTIs are caused by uropathogenic E. coli (UPEC), which colonizes the gastrointestinal tract and moves from the fecal flora to the genitourinary tract, where it It adheres to host urothelial cells, thereby establishing a reservoir for ascending infection of the urinary tract. Adhesion is facilitated by pilus adhesins, including type 1 fimbriae, that bind to mannosylated glycoproteins in the epithelial layer or are secreted in the urine. Type 1 fimbriae are highly conserved among clinical UPEC isolates and contain fim and fim, which encode accessory proteins (FimC, FimD), various structural subunits (FimE, FimF, FimG) and an adhesin called FimH. It is encoded by a cluster of genes called FimH is essential for all features of UTI infection in a mouse model that mimics aspects of human bladder infection (Hannan et al., PLoS Pathog. 2010 Aug 12;6(8):e1001042; doi:10.1371/journal. ppat.1001042; Schwartz et al., Infect Immun.2011 Oct;79(10):4250-9.doi:10.1128/IAI.05339-11). Small molecule inhibitors that target FimH by mimicking mannosylated receptors further demonstrate the role of FimH in UTI and show promise as therapeutic agents in animal models (Cusumano CK et al., Sci Transl Med .2011;3(109):109ra115.doi:10.1126/scitranslmed.3003021). In addition, FimH is under positive selection in E. coli human cystitis isolates (Chen SL et al., Proc Natl Acad Sci USA. 2009 Dec 29;106(52):22439-44 doi:10.1073/pnas.0902179106), positively selected residues can influence virulence in a murine model of cystitis (Schwartz, DJ et al., Proc Natl Acad Sci USA 110 , 15530-15537, doi:10.1073/pnas.1315203110 (2013)).

FimH is composed of two domains, a lectin-binding domain (FimH _LD ), which is responsible for binding to mannosylated glycoproteins, and a pilin domain. The pilin domain functions to link FimH to other structural subunits of the fimbriae, such as FimG, by a mechanism called donor strand exchange (Le Trong, I et al., J. Struct Biol. 2010 Dec; 172 ( 3):380-8.doi:10.1016/j.jsb.2010.06.002). The FimH pilin domain forms an incomplete immunoglobulin fold that creates a groove that provides a binding site for the N-terminal β-chain of FimG, forming a strong intermolecular link between FimH and FimG. FimH _LD can be expressed in a soluble, stable form, but full-length FimH can be expressed in peptide form or as a fusion protein unless complexed with the chaperone FimC or complemented with the donor chain peptide of FimG (Barnhart MM et al. , Proc Natl Acad Sci USA. (2000) Jul 5;97(14):7709-14; Sauer MM et al., Nat Commun. (2016) Mar 7;7:10738; Barnhart MM et al., J Bacteriol. 2003 May ; 185(9):2723-30), is unstable alone (Vetsch, M. et al., J. Mol. Biol. 322:827-840 (2002); Barnhart MM et al., Proc Natl Acad Sci USA (2000) Jul 5;97(14):7709-14). The design and expression of full-length FimH molecules by linking a FimG donor peptide to full-length FimH via a glycine-serine linker has been previously described (PCT International Publication No. WO2021/2021, published May 6, 2021). 084429), which was named FimH-DSG.

FimH _LD is considered to be a poor immunogen in terms of its ability to stimulate functional immunogenicity. Several studies suggest that binding antibody titers can be elicited by FimH _LD with and without adjuvant, but functional neutralizing titers were observed only in the presence of adjuvant (May 2021) PCT International Publication Number WO2021/084429 announced on the 6th). Studies suggest that locking FimH in an open conformation with reduced affinity for mannoside ligands improves functional immunogenicity (Kisiela, DI et al., Proc Natl. Acad Sci U S A 110, 19089-19094 (2013). Thus, reduced affinity for mannoside ligands and improved biochemical properties result in improved functional immunogenicity compared to wild-type FimH. There is a need in the art for novel FimH mutants having the following properties.

The present disclosure relates to the design of E. coli FimH mutant polypeptides that provide improved biochemical properties and immunogenicity, compositions containing such polypeptides, and uses thereof. For example, in one aspect, the present disclosure provides a mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of a wild-type FimH polypeptide, wherein the mutation position is F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, A mutated FimH polypeptide selected from the group consisting of V118, A119, A127, L129, Q133, F144, V154, V155, V156, P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59. I will provide a.

In a further aspect, the mutated FimH polypeptide is F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; L34C; L34N; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; 118C; A119C; A119N; A119S; A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; Contains one mutation. For example, mutated FimH polypeptides include mutations G15A and G16A. Further, for example, mutated FimH polypeptides include mutations P12C and A18C. Further, for example, mutated FimH polypeptides include mutations G14C and F144C. Further, for example, mutated FimH polypeptides include mutations P26C and V35C. Further, for example, mutated FimH polypeptides include mutations P26C and V154C. Further, for example, mutated FimH polypeptides include mutations P26C and V156C. Further, for example, mutated FimH polypeptides include mutations V27C and L34C. Further, for example, mutated FimH polypeptides include mutations V28C and N33C. Further, for example, mutated FimH polypeptides include mutations V28C and P157C. Further, for example, mutated FimH polypeptides include mutations Q32C and Y108C. Further, for example, mutated FimH polypeptides include mutations N33C and L109C. Further, for example, mutated FimH polypeptides include mutations N33C and P157C. Further, for example, mutated FimH polypeptides include mutations V35C and L107C. Further, for example, mutated FimH polypeptides include mutations V35C and L109C. Further, for example, mutated FimH polypeptides include mutations S62C and T86C. Further, for example, mutated FimH polypeptides include mutations S62C and L129C. Further, for example, mutated FimH polypeptides include mutations Y64C and L68C. Further, for example, mutated FimH polypeptides include mutations Y64C and A127C. Further, for example, mutated FimH polypeptides include mutations L68C and F71C. Further, for example, mutated FimH polypeptides include mutations V112C and T158C. Further, for example, mutated FimH polypeptides include mutations S113C and G116C. Further, for example, mutated FimH polypeptides include mutations S113C and T158C. Further, for example, mutated FimH polypeptides include mutations V118C and V156C. Further, for example, mutated FimH polypeptides include mutations A119C and V155C. Further, for example, mutated FimH polypeptides include mutations L34N and V27A. Further, for example, mutated FimH polypeptides include mutations L34S and V27A. Further, for example, mutated FimH polypeptides include mutations L34T and V27A. Further, for example, mutated FimH polypeptides include mutations L34D and V27A. Further, for example, mutated FimH polypeptides include mutations L34E and V27A. Further, for example, mutated FimH polypeptides include mutations L34K and V27A. Further, for example, mutated FimH polypeptides include mutations L34R and V27A. Further, for example, mutated FimH polypeptides include mutations A119N and V27A. Further, for example, mutated FimH polypeptides include mutations A119S and V27A. Further, for example, mutated FimH polypeptides include mutations A119T and V27A. Further, for example, mutated FimH polypeptides include mutations A119D and V27A. Further, for example, mutated FimH polypeptides include mutations A119E and V27A. Further, for example, mutated FimH polypeptides include mutations A119K and V27A. Further, for example, mutated FimH polypeptides include mutations A119R and V27A. Further, for example, mutated FimH polypeptides include mutations G15A and V27A. Further, for example, mutated FimH polypeptides include mutations G16A and V27A. Further, for example, mutated FimH polypeptides include mutations G15P and V27A. Further, for example, mutated FimH polypeptides include mutations G16P and V27A. Further, for example, mutated FimH polypeptides include mutations G15A, G16A and V27A. Further, for example, mutated FimH polypeptides include mutations G65A and V27A. Further, for example, mutated FimH polypeptides include mutations V27A and Q133K. Further, for example, mutated FimH polypeptides include mutations G15A, G16A, V27A and Q133K. Further, for example, the mutated FimH polypeptide comprises any one of SEQ ID NOs: 2-58 and 60-64. Further provided, for example, are isolated mutated FimH polypeptides disclosed herein.

In a further example, the present disclosure provides a pharmaceutical composition comprising (i) a mutated FimH polypeptide disclosed herein, and (ii) a pharmaceutically acceptable carrier.

In a further example, the present disclosure provides immunogenic compositions comprising the mutated FimH polypeptides disclosed herein. For example, the immunogenic composition further comprises at least one additional antigen such as a polysaccharide or saccharide conjugate or protein. Additionally, for example, the immunogenic composition further comprises at least one adjuvant.

In a further example, the present disclosure provides a nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence of a mutated FimH polypeptide disclosed herein.

In a further example, the disclosure provides mutated FimH polypeptides disclosed herein that are immunogenic.

The present disclosure further provides recombinant mammalian cells comprising polynucleotides encoding the mutated FimH polypeptides disclosed herein.

The present disclosure provides a culture comprising the recombinant cells disclosed herein, comprising at least 5 liters, at least 10 liters, at least 20 liters, at least 50 liters, at least 100 liters, at least 200 liters, at least 500 liters. , at least 1000 liters, or at least 2000 liters in size.

The present disclosure provides a method comprising: culturing the recombinant mammalian cells disclosed herein under suitable conditions, thereby expressing a polypeptide; and collecting the polypeptide. Further provided are methods for producing mutated FimH polypeptides as disclosed in .

The present disclosure provides methods for (i) inducing an immune response in a subject against extraintestinal pathogenic Escherichia coli (E. coli) or (ii) opsonophagocytosis in a subject specific for extraintestinal pathogenic E. coli (E. coli). Further provided are methods for inducing production of agonistic and/or neutralizing antibodies, the method comprising administering to a subject an effective amount of a composition disclosed herein. In one example, the subject is at risk of developing a urinary tract infection. In a further example, the subject is at risk of developing bacteremia. In a further example, the subject is at risk of developing sepsis. In another example, the subject is at risk of developing Crohn's disease.

The present disclosure further provides a method of eliciting an immune response against E. coli in a mammal, comprising administering to the mammal an effective amount of a composition disclosed herein. In one example, the immune response includes opsonophagocytic and/or neutralizing antibodies against E. coli. In a further example, the immune response protects the mammal from E. coli infection.

The present disclosure further provides a method of preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject, comprising administering to the subject an immunologically effective amount of a composition disclosed herein. .

Figures 1A-1B show the circular dichroism spectra of FimH _LD and FimH-DSG variants. FIG. 1A shows the circular dichroism spectrum in the near UV, and FIG. 1B shows the circular dichroism spectrum in the far UV region. Figure 2 shows the relative immunogenicity of FimH _LD variants in yeast mannan neutralization assays at PD3. Figures 3A-3B show the immunogenicity of FimH _LD and FimH-DSG variants in yeast mannan neutralization assays at PD2 (Figure 3A) and PD3 (Figure 3B). FIG. 4 is a diagram showing the major purification steps utilized to isolate wild type and mutated forms of His-tagged FimH-DsG. Figures 5A-5B show the purification profile of FimH-DSG WT. Figure 5A is the elution profile of FimH-DSG WT on the SP-Sepharose column, and Figure 5B is the SDS-PAGE analysis of the eluted fractions. Figures 6A-6B show the purification profile of FimH-DSG G15A G16A V27A mutant. Figure 6A shows the elution profile of the FimH-DSG G15A G16A V27A variant on the SP-Sepharose column, and Figure 6B shows the SDS-PAGE analysis of the eluted fractions. Figures 7A-7B show analytical SEC of FimH-DSG protein. Analytical SEC of FimH-DSG G15A G16A V27A is shown in Figure 7A, and analytical SEC of wild type FimH-DSG WT is shown in Figure 7B. Figure 8 shows a schematic diagram of the mechanism of FimH HMW complex formation. Figure 9 shows the non-human primate immunization schedule and subsequent challenge described in Example 21 herein. Figure 10 shows the rise in O antigen serotype-specific antibodies after vaccination of NHPs with FimH-DSG G15A G16A V27A variant + quadrivalent E. coli O antigen (O1a, O2, O6 and O25b). . Legend: Placebo (circle); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A+4-valent O antigen (triangle). Figures 11A-11B show that immunization with FimH-DSG G15A G16A V27A+/- 4-element (4plex) O antigen elicits a strong functional anti-FimH antibody response. FIG. 11A shows the results of the direct Luminex FimH IgG assay and FIG. 11B shows the results of the E. coli binding inhibition assay. As used herein, the term "four-element" has the same meaning as, and is interchangeable with, the term "tetravalent." FIG. 12 shows that bacteriuria is reduced in vaccinated non-human primates (NHPs) after challenge as described in Example 21. Legend: Placebo (circle); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A+4-valent O antigen (triangle); *p≦0.007 compared to the placebo group. Figures 13A-13C show that biomarkers of infection were determined as described in Example 21 in three groups: Placebo, FimH-DSG G15A G16A V27A alone and FimH-DSG G15A G16A V27A + after vaccination with quadrivalent O antigen challenge. It is shown that it is reduced in NHP. Figure 13A shows the quantification of MPO in the urine, Figure 13B shows the quantification of IL-8 in the urine, and Figure 13C shows the percentage of animals with increased PMN in the urine sediment. Legend: Placebo (circle); FimH-DSG G15A G16A V27A (square); FimH-DSG G15A G16A V27A+4-valent O antigen (triangle).

Sequence Identifier SEQ ID NO: 1 describes the amino acid sequence of wild type E. coli FimH _LD (FimHLD_WT).
SEQ ID NO: 2 describes the amino acid sequence of mutant E. coli FimHLD_G65A_V27A.
SEQ ID NO: 3 describes the amino acid sequence of mutant E. coli FimHLD_F1I.
SEQ ID NO: 4 describes the amino acid sequence of mutant E. coli FimHLD_F1L.
SEQ ID NO: 5 describes the amino acid sequence of mutant E. coli FimHLD_F1V.
SEQ ID NO: 6 describes the amino acid sequence of mutant E. coli FimHLD_F1M.
SEQ ID NO: 7 describes the amino acid sequence of mutant E. coli FimHLD_F1Y.
SEQ ID NO: 8 describes the amino acid sequence of mutant E. coli FimHLD_F1W.
SEQ ID NO: 9 describes the amino acid sequence of mutant E. coli FimHLD_Q133K.
SEQ ID NO: 10 describes the amino acid sequence of mutant E. coli FimHLD_G15A.
SEQ ID NO: 11 describes the amino acid sequence of mutant E. coli FimHLD_G15P.
SEQ ID NO: 12 describes the amino acid sequence of mutant E. coli FimHLD_G16A.
SEQ ID NO: 13 describes the amino acid sequence of mutant E. coli FimHLD_G16P.
SEQ ID NO: 14 describes the amino acid sequence of mutant E. coli FimHLD_G15A_G16A.
SEQ ID NO: 15 describes the amino acid sequence of mutant E. coli FimHLD_R60P.
SEQ ID NO: 16 describes the amino acid sequence of mutant E. coli FimHLD_G65A.
SEQ ID NO: 17 describes the amino acid sequence of mutant E. coli FimHLD_P12C_A18C.
SEQ ID NO: 18 describes the amino acid sequence of mutant E. coli FimHLD_G14C_F144C.
SEQ ID NO: 19 describes the amino acid sequence of mutant E. coli FimHLD_P26C_V35C.
SEQ ID NO: 20 describes the amino acid sequence of mutant E. coli FimHLD_P26C_V154C.
SEQ ID NO: 21 describes the amino acid sequence of mutant E. coli FimHLD_P26C_V156C.
SEQ ID NO: 22 describes the amino acid sequence of mutant E. coli FimHLD_V27C_L34C.
SEQ ID NO: 23 describes the amino acid sequence of mutant E. coli FimHLD_V28C_N33C.
SEQ ID NO: 24 describes the amino acid sequence of mutant E. coli FimHLD_V28C_P157C.
SEQ ID NO: 25 describes the amino acid sequence of mutant E. coli FimHLD_Q32C_Y108C.
SEQ ID NO: 26 describes the amino acid sequence of mutant E. coli FimHLD_N33C_L109C.
SEQ ID NO: 27 describes the amino acid sequence of mutant E. coli FimHLD_N33C_P157C.
SEQ ID NO: 28 describes the amino acid sequence of mutant E. coli FimHLD_V35C_L107C.
SEQ ID NO: 29 describes the amino acid sequence of mutant E. coli FimHLD_V35C_L109C.
SEQ ID NO: 30 describes the amino acid sequence of mutant E. coli FimHLD_S62C_T86C.
SEQ ID NO: 31 describes the amino acid sequence of mutant E. coli FimHLD_S62C_L129C.
SEQ ID NO: 32 describes the amino acid sequence of mutant E. coli FimHLD_Y64C_L68C.
SEQ ID NO: 33 describes the amino acid sequence of mutant E. coli FimHLD_Y64C_A127C.
SEQ ID NO: 34 describes the amino acid sequence of mutant E. coli FimHLD_L68C_F71C.
SEQ ID NO: 35 describes the amino acid sequence of mutant E. coli FimHLD_V112C_T158C.
SEQ ID NO: 36 describes the amino acid sequence of mutant E. coli FimHLD_S113C_G116C.
SEQ ID NO: 37 describes the amino acid sequence of mutant E. coli FimHLD_S113C_T158C.
SEQ ID NO: 38 describes the amino acid sequence of mutant E. coli FimHLD_V118C_V156C.
SEQ ID NO: 39 describes the amino acid sequence of mutant E. coli FimHLD_A119C_V155C.
SEQ ID NO: 40 describes the amino acid sequence of mutant E. coli FimHLD_L34N_V27A.
SEQ ID NO: 41 describes the amino acid sequence of mutant E. coli FimHLD_L34S_V27A.
SEQ ID NO: 42 describes the amino acid sequence of mutant E. coli FimHLD_L34T_V27A.
SEQ ID NO: 43 describes the amino acid sequence of mutant E. coli FimHLD_A119N_V27A.
SEQ ID NO: 44 describes the amino acid sequence of mutant E. coli FimHLD_A119S_V27A.
SEQ ID NO: 45 describes the amino acid sequence of mutant E. coli FimHLD_A119T_V27A.
SEQ ID NO: 46 describes the amino acid sequence of mutant E. coli FimH-DSG_A115V.
SEQ ID NO: 47 describes the amino acid sequence of mutant E. coli FimH-DSG_V163I.
SEQ ID NO: 48 describes the amino acid sequence of mutant E. coli FimH-DSG_V185I.
SEQ ID NO: 49 describes the amino acid sequence of mutant E. coli FimH-DSG_DSG_V3I.
SEQ ID NO: 50 describes the amino acid sequence of mutant E. coli FimHLD_G15A_V27A.
SEQ ID NO: 51 describes the amino acid sequence of mutant E. coli FimHLD_G16A_V27A.
SEQ ID NO: 52 describes the amino acid sequence of mutant E. coli FimHLD_G15P_V27A.
SEQ ID NO: 53 describes the amino acid sequence of mutant E. coli FimHLD_G16P_V27A.
SEQ ID NO: 54 describes the amino acid sequence of mutant E. coli FimHLD_G15A_G16A_V27A.
SEQ ID NO: 55 describes the amino acid sequence of mutant E. coli FimHLD_V27A_R60P.
SEQ ID NO: 56 describes the amino acid sequence of mutant E. coli FimHLD_G65A_V27A.
SEQ ID NO: 57 describes the amino acid sequence of mutant E. coli FimHLD_V27A_Q133K.
SEQ ID NO: 58 describes the amino acid sequence of mutant E. coli FimHLD_G15A_G16A_V27A_Q133K.
SEQ ID NO: 59 describes the amino acid sequence of wild type E. coli full-length FimH (FimH-DSG_WT) containing the donor chain FimG peptide connected via a linker.
SEQ ID NO: 60 describes the amino acid sequence of mutant E. coli FimH-DSG_V27A.
SEQ ID NO: 61 describes the amino acid sequence of mutant E. coli FimH-DSG_G15A_V27A.
SEQ ID NO: 62 describes the amino acid sequence of mutant E. coli FimH DSG_G15A_G16A_V27A.
SEQ ID NO: 63 describes the amino acid sequence of mutant E. coli FimH DSG_V27A_Q133K.
SEQ ID NO: 64 describes the amino acid sequence of mutant E. coli FimH DSG_G15A_G16A_V27A_Q133K.
SEQ ID NO: 65 describes the amino acid sequence of the mouse Ig kappa signal peptide sequence.
SEQ ID NOS: 66-108 describe the amino acid and nucleic acid sequences of nanostructure-related polypeptides or fragments thereof.
SEQ ID NO: 109 - Primer for PCR.
SEQ ID NO: 110 - Primer for PCR.
SEQ ID NO: 111 - PCR probe.
SEQ ID NO: 112 describes the O25b 2401 WzzB amino acid sequence.
SEQ ID NO: 113 describes the O25a:K5:H1 WzzB amino acid sequence.
SEQ ID NO: 114 describes the O25a ETEC ATCC WzzB amino acid sequence.
SEQ ID NO: 115 describes the K12 W3110 WzzB amino acid sequence.
SEQ ID NO: 116 describes the Salmonella LT2 WzzB amino acid sequence.
SEQ ID NO: 117 describes the O25b 2401 FepE amino acid sequence.
SEQ ID NO: 118 describes the O25a:K5:H1 FepE amino acid sequence.
SEQ ID NO: 119 describes the O25a ETEC ATCC FepE amino acid sequence.
SEQ ID NO: 120 describes the O157 FepE amino acid sequence.
SEQ ID NO: 121 describes the Salmonella LT2 FepE amino acid sequence.
SEQ ID NO: 122 describes the primer sequence for LT2wzzB_S.
SEQ ID NO: 123 describes the primer sequence for LT2wzzB_AS.
SEQ ID NO: 124 describes the primer sequence for O25bFepE_S.
SEQ ID NO: 125 describes the primer sequence for O25bFepE_A.
SEQ ID NO: 126 describes the primer sequence for wzzB P1_S.
SEQ ID NO: 127 describes the primer sequence for wzzB P2_AS.
SEQ ID NO: 128 describes the primer sequence for wzzB P3_S.
SEQ ID NO: 129 describes the primer sequence for wzzB P4_AS.
SEQ ID NO: 130 describes the primer sequence for O157 FepE_S.
SEQ ID NO: 131 describes the primer sequence for O157 FepE_AS.
SEQ ID NO: 132 describes the primer sequence for pBAD33_adaptor_S.
SEQ ID NO: 133 describes the primer sequence for pBAD33_adaptor_AS.
SEQ ID NO: 134 describes the primer sequence for JUMPSTART_r.
SEQ ID NO: 135 describes the primer sequence for gnd_f.
SEQ ID NO: 136 describes the amino acid sequence of the human IgG receptor FcRn large subunit p51 signal peptide.
SEQ ID NO: 137 describes the amino acid sequence of human IL10 protein signal peptide.
SEQ ID NO: 138 describes the amino acid sequence of human respiratory rash virus A (strain A2) fusion glycoprotein F0 signal peptide.
SEQ ID NO: 139 describes the amino acid sequence of influenza A hemagglutinin signal peptide.
SEQ ID NOS: 140-147 describe signal P 4.1 (DTU Bioinformatics) sequences from various species used for signal peptide prediction.

DETAILED DESCRIPTION The present disclosure provides E. coli FimH mutant polypeptides (variants), compositions comprising FimH variants, methods for producing and purifying FimH variants, nucleic acids encoding FimH variants. , host cells containing such nucleic acids, and methods of using compositions containing FimH variants.

The recitation of ranges of values herein is merely intended to serve as a shorthand way of individually referring to each separate value that falls within the range. Unless otherwise indicated herein, each individual value is incorporated herein as if individually recited herein. Any method described herein can be performed in any suitable order, unless indicated otherwise herein or clearly inconsistent with the context. The use of any and all examples or exemplary language (e.g., "etc.") provided herein is merely intended to further explain the disclosure and is not intended to limit the scope of the claims. do not have. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.

Several documents are cited throughout the text of this disclosure. Each of the documents cited herein (including any patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Incorporated herein by reference. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such disclosure.

DEFINITIONS As used herein, the term "about" means approximately or approximately, and in one embodiment, in the context of a numerical value or range stated herein, the enumerated or claimed ±20%, ±10%, ±5% or ±3% of a numerical value or range.

As used in the context of describing the present disclosure (in particular in the context of the claims), the terms "a" and "an" and "the" and similar references This specification is to be construed to cover both the singular and plural forms, unless indicated otherwise or clearly inconsistent with the context.

"Fragment" with reference to an amino acid sequence (peptide or protein) relates to a sequence representing a portion of the amino acid sequence, ie a truncated amino acid sequence at the N-terminus and/or C-terminus. Fragments shortened at the C-terminus (N-terminal fragments) are obtainable, for example, by translation of truncated open reading frames lacking the 3' end of the open reading frame. Fragments truncated at the N-terminus (C-terminal fragments) include, for example, truncated open reading frames that lack the 5' end of the open reading frame, insofar as the truncated open reading frame contains an initiation codon that functions to initiate translation. Translations of open reading frames are available. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the amino acid residues from the amino acid sequence. A fragment of an amino acid sequence preferably comprises at least 6, especially at least 8, at least 12, at least 15, at least 20, at least 30, at least 50 or at least 100 contiguous amino acids from the amino acid sequence.

As used herein, the term "wild type" or "WT" or "native" refers to the amino acid sequence found in nature, including allelic variants. A wild-type amino acid sequence, peptide or protein has an amino acid sequence that has not been intentionally modified.

As used herein, reference to a "variant" or "variant" or "mutated" polypeptide of an amino acid sequence (peptide, protein or polypeptide) refers to an amino acid insertion variant/mutant, an amino acid Includes addition variants/variants, amino acid deletion variants/variants and/or amino acid substitution variants/variants. The term "variant" or "mutant" includes all variants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants and species homologues, especially those of natural origin. The term "variant" or "mutant" specifically includes fragments of amino acid sequences.

Amino acid insertion variants include insertions of single or more than one amino acid in a particular amino acid sequence. In the case of amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific positions in the amino acid sequence, although random insertions are also possible with appropriate screening of the resulting products. Amino acid addition variants include amino and/or carboxy terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from a sequence, such as the removal of 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. Deletions can be made at any position in the protein. Amino acid deletion variants containing deletions at the N-terminal and/or C-terminal ends of a protein are also referred to as N-terminal and/or C-terminal truncation variants. Amino acid substitution variants are characterized by at least one residue in the sequence that is removed and another residue inserted in its place. Preference is given to modifications at positions in the amino acid sequence that are not conserved among homologous proteins or peptides and/or to replacing amino acids with other amino acids with similar properties. Preferably, amino acid changes in peptide and protein variants are conservative amino acid changes, ie, substitutions of similarly charged or uncharged amino acids. Conservative amino acid changes involve the substitution of one of a family of amino acids that are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic (aspartic acid, glutamic acid), basic (lysine, arginine, histidine), nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan and tyrosine are sometimes classified together as aromatic amino acids. In one embodiment, conservative amino acid substitutions include substitutions within the following groups:
glycine, alanine;
Valine, isoleucine, leucine;
Aspartic acid, glutamic acid;
Asparagine, glutamine;
Serine, threonine;
Lysine, arginine; and phenylalanine, tyrosine.

Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of said given amino acid sequence is at least about 60%, 70%, 80%, 81%. %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, It would be 98% or 99%. The degree of similarity or identity is preferably at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, of the total length of the reference amino acid sequence. For amino acid regions that are at least about 70%, at least about 80%, at least about 90% or about 100%. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least About 140, at least about 160, at least about 180 or about 200 amino acids, in some embodiments, are provided for contiguous amino acids. In some embodiments, the degree of similarity or identity is given over the entire length of the reference amino acid sequence. Alignments to determine sequence similarity, preferably sequence identity, are performed using tools known in the art, preferably using the best sequence alignment, e.g. using Align, using standard settings. , preferably using EMBOSS::needle, matrix: Blosum62, gap open 10.0, gap extension 0.5.

As used herein, "sequence similarity" refers to the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between these sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between these sequences.

The terms "% identical", "% identity" or similar terms are specifically intended to refer to the percentage of nucleotides or amino acids that are identical in optimal alignment between the sequences being compared. Said percentage is purely statistical; the difference between two sequences can, but need not be, randomly distributed over the length of the sequences to be compared. Comparisons of two sequences are typically performed by comparing these sequences after optimal alignment with respect to segments or "windows of comparison" to identify local regions of corresponding sequences. Optimal alignment for comparison can be done manually or by Smith and Waterman, 1981, Ads App. Math. 2, 482, by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443 with the help of a local homology algorithm according to Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or a computer program using said algorithm (GAP in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. , BESTFIT, FASTA, BLAST P, BLAST N and TFASTA). In some embodiments, the percent identity of two sequences is determined from the National Center for Biotechnology Information (NCBI) website (e.g., blast.ncbi.nlm.nih.gov/Blast.cgi). ?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq). In some embodiments, the algorithm parameters used for the BLASTN algorithm on the NCBI website are: (i) expected threshold set to 10; (ii) word size set to 28; (iii) set to 0. maximum match in the query range set; (iv) match/mismatch score set to 1, -2; (v) gap cost set to linear; and (vi) for low complexity regions used. Contains filters. In some embodiments, the algorithm parameters used for the BLASTP algorithm on the NCBI website are: (i) expected threshold set to 10; (ii) word size set to 3; (iii) set to 0. Includes maximum match in query range set; (iv) matrix set to BLOSUM62; (v) gap cost set to Existence: 11 Extension: 1; and (vi) conditional composition score matrix adjustment.

Percentage identity determines the number of identical positions to which the sequences to be compared correspond, divide this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiply this result by 100. It can be obtained by

In some embodiments, the degree of similarity or identity is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total length of the reference sequence. % of the area. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is in some embodiments at least about 100, at least about 120, at least about 140, at least about 160, at least about 180 or about 200 nucleotides. , given for consecutive nucleotides. In some embodiments, the degree of similarity or identity is given over the entire length of the reference sequence.

Homologous amino acid sequences according to the present disclosure include at least 40%, in particular at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, preferably at least 95%, at least 98 or at least Exhibiting 99% identity. Amino acid sequence variants/mutants described herein can be readily prepared by those skilled in the art, eg, by recombinant DNA manipulation. Manipulation of DNA sequences to prepare peptides or proteins with substitutions, additions, insertions or deletions is described in detail in, for example, Sambrook et al. (1989). Additionally, the peptides and amino acid variants described herein can be readily prepared with the aid of known peptide synthesis techniques, such as by solid phase synthesis and similar methods.

In one aspect, the fragment or variant/variant of an amino acid sequence (peptide or protein) is preferably a "functional fragment" or "functional variant". The term "functional fragment" or "functional variant/variant" of an amino acid sequence means that it exhibits one or more functional properties identical or similar to that of the amino acid sequence from which it is derived; Regarding any fragment or variant/mutant that is equivalent. For an antigen or antigenic sequence, one particular function is the immunogenic activity or activities exhibited by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant/mutant" as used herein specifically refers to an amino acid in which one or more amino acids have been changed compared to the amino acid sequence of the parent molecule or sequence. Refers to a variant/mutant molecule or sequence containing a sequence that is still capable of performing one or more of the functions of the parent molecule or sequence, such as inducing an immune response. In one aspect, modifications in the amino acid sequence of a parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence. In different embodiments, the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., the immunogenicity of the functional variant is at least 50%, at least 60% that of the parent molecule or sequence. %, at least 70%, at least 80% or at least 90%. However, in other embodiments, the immunogenicity of a functional fragment or variant may be enhanced compared to the parent molecule or sequence.

As used herein, "isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide that occurs naturally in a living animal is not "isolated," but the same nucleic acid or peptide that is partially or completely separated from coexisting materials in its natural state is "single." They are separated.” An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment, such as, for example, a host cell.

I. E. coli FimH Polypeptide Fimbrial adhesins, including type 1 fimbriae, bind to mannosylated glycoproteins in the epithelial layer or are secreted in the urine. Type 1 fimbriae are highly conserved among clinical UPEC isolates and contain fim and fim, which encode accessory proteins (FimC, FimD), various structural subunits (FimE, FimF, FimG) and an adhesin called FimH. It is encoded by a cluster of genes called FimH is composed of two domains, a lectin-binding domain (FimH _LD ), which is responsible for binding to mannosylated glycoproteins, and a pilin domain. The pilin domain functions to link FimH to other structural subunits of the fimbriae, such as FimG, by a mechanism called donor strand exchange. The FimH pilin domain forms an incomplete immunoglobulin fold, providing a groove that provides a binding site for the N-terminal β-strand of FimG, forming a strong intermolecular link between FimH and FimG. Although FimH _LD can be expressed in a soluble, stable form, full-length FimH is ineffective alone, in peptide form or as a fusion protein, unless complexed with the chaperone FimC or complemented with the donor chain peptide of FimG. It is stable. Therefore, expression of stable full-length FimH molecules is enabled by linking a FimG donor peptide to the C-terminus of full-length FimH via a glycine-serine linker, which is designated FimH-DSG.

In one aspect, the present disclosure provides mutated FimH polypeptides, such as those shown in Table 1. Such variants provide mutations in the amino acid sequence compared to the amino acid sequence of the corresponding wild type (WT) FimH polypeptide. In some aspects, such variants are immunogenic against wild-type FimH protein or against bacteria that express wild-type FimH polypeptide. In certain aspects, FimH variants possess certain beneficial characteristics, such as increased immunogenic properties compared to the corresponding wild-type FimH polypeptide.

As used herein, the term "FimH polypeptide" refers to any domain of the full-length wild-type E. coli FimH polypeptide, any domain of the full-length wild-type E. coli FimH polypeptide. Refers to any combination, or the full-length E. coli FimH polypeptide, or a fragment of any of these. For example, in one embodiment, the present disclosure provides a mutated FimH polypeptide that is a mutated FimH _LD polypeptide or a FimH-DSG polypeptide. The present disclosure relates to novel FimH _LD and FimH-DSG variants with reduced affinity for mannoside ligands (verified by biochemical and biophysical analyses) that improve functional immunogenicity. An evaluation of the neutralization response of these mutants compared to wild-type FimH _LD is described.

The introduced amino acid mutations in the FimH variant polypeptide can include amino acid substitutions, deletions or additions. In some embodiments, the only mutation in the amino acid sequence of the FimH polypeptide variant is an amino acid substitution compared to the wild-type FimH protein.

The amino acid sequence of wild-type FimH polypeptides is well known in the art. For example, the amino acid sequence of the FimH _LD domain is provided herein as SEQ ID NO:1. A full-length wild-type FimH polypeptide comprising a FimG donor peptide linked to the C-terminus of full-length FimH via a glycine-serine linker is provided herein as SEQ ID NO: 59. Nucleic acid sequences encoding such amino acid sequences are also well known in the art.

In one aspect of the present disclosure, certain mutated FimH polypeptides are in a locked open conformation that results in reduced affinity for mannoside ligands and improved functional immunogenicity. ). Such FimH variants may therefore be useful as antigens in immunogenic compositions such as vaccines against E. coli infections. Since wild-type FimH _LD is considered a poor immunogen in terms of its ability to stimulate functional immunogenicity, such FimH variants are used in such immunogenic compositions. improved antigens to be used.

In one aspect, as described in Example 1, FimH variants were designed in an attempt to lock the FimH lectin domain into an open conformation to reduce affinity for mannoside ligands. . Such variants can contain at least 1, 2, 3, 4, 5 or more mutations. Mutations include naturally occurring amino acid substitutions common among urinary tract infection isolates (such as V27A); substitutions in the ligand-binding side of FimH _LD (such as those at positions F1 and Q133); glycine substitutions in FimH _LD Switch mutations (such as those at positions G15, G16 and G65); introduction of cysteine pairs for disulfide bond stabilization in the FimH _LD (position pairs P12-A18; G14-F144; P26-V35; P26-V154; P26- V156; V27-L34; V28-N33; V28-P157; Q32-Y108; N33-L109; N33-P157; V35-L107; V35-L109; S62-T86; S62-L129; Y64-A127; L68-F71; V112-T158 _; S113-T158; ); a cavity-filling mutation at the pilin-lectin interface of FimH-DSG (such as at position A115, V163, V185 or V3 within the DSG sequence); or any combination of the types of mutations at the amino acid positions listed above. can include. In another aspect, the disclosure provides FimH variants provided in SEQ ID NOs: 2-58 and 60-64, or any combination of variants set forth in any such sequences. In another aspect, the disclosure provides FimH variants according to any of SEQ ID NOs: 23, 50, 51, 52, 53, 54, 60 and 62. In a further aspect, the present disclosure provides FimH variants according to SEQ ID NO: 62.

In a further aspect, the disclosure provides any of the isolated FimH variants provided in SEQ ID NOs: 2-58 and 60-64. For example, in one aspect, the present disclosure provides an isolated FimH variant according to any of SEQ ID NOs: 23, 50, 51, 52, 53, 54, 60, and 62. In a further aspect, the present disclosure provides an isolated FimH variant according to SEQ ID NO: 62.

Thus, in some specific aspects, the present disclosure provides FimH variants comprising a combination of introduced mutations, the variants provided in Table 1 (i.e., SEQ ID NOS: 2-58 and 60- 64) is provided. Any combination of amino acid substitutions provided for each of the variants in Table 1 can be made to the wild-type FimH polypeptide sequence to arrive at different FimH variants. FimH variants based on the native FimH polypeptide sequence of any other subtype or strain and containing any of the mutation combinations described herein are also within the scope of this disclosure.

Further aspects of the present disclosure provide at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% of SEQ ID NO: 1-64. or polypeptides that are at least 99% identical. In preferred embodiments, the polypeptide has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical. Another aspect of the invention provides at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99% or 99.9% identical. In preferred embodiments, the polypeptide is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% or 99.9% identical.

FimH variants provided by this disclosure can be prepared by routine methods known in the art, such as by expression in recombinant host systems using suitable vectors. Suitable recombinant host cells include, for example, insect cells, mammalian cells, avian cells, bacteria and yeast cells. Examples of suitable insect cells are, for example, Sf9 cells, Sf21 cells, Tn5 cells, Schneider S2 cells and High Five cells (derived from the parent Trichoplusia ni) BTI-TN-5B1-4 cell line (Invitrogen). clonal isolates). Examples of suitable mammalian cells are Chinese hamster ovary (CHO) cells, human fetal kidney cells (HEK293 or Expi 293 cells, typically transformed with sheared adenovirus type 5 DNA), NIH-3T3 cells. 293-T cells, Vero cells and HeLa cells. Suitable avian cells include, for example, chicken embryonic stem cells (e.g., EBx® cells), chicken embryonic fibroblasts, chicken embryonic germ cells, quail fibroblasts (e.g., ELL-O), and duck cells. Contains cells. Suitable insect cell expression systems, such as baculovirus vector systems, are known to those skilled in the art and are described, for example, in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Materials and methods for baculovirus/insect cell expression systems are available from, among others, Invitrogen, San Diego Calif. It is commercially available in kit form. Avian cell expression systems are also known to those skilled in the art and are described, for example, in U.S. Pat. Nos. 5,340,740; 5,656,479; No. 168; and No. 6,500,668. Similarly, bacterial and mammalian cell expression systems are also known in the art and are described, for example, in Yeast Genetic Engineering (Barr et al., eds., 1989) Butterworths, London.

Many suitable vectors for expression of recombinant proteins in insect or mammalian cells are well known and conventional in the art. Suitable vectors can contain a number of components, including, but not limited to, one or more of the following: origins of replication; selectable marker genes; transcriptional control elements (e.g., promoters, enhancers, terminators, ) and/or one or more translation signals; and a signal or leader sequence for targeting to the secretory pathway in the selected host cell (e.g. or from a heterologous mammalian or non-mammalian species). For example, for expression in insect cells, a suitable baculovirus expression vector such as pFastBac (Invitrogen) is used to produce recombinant baculovirus particles. Baculovirus particles are amplified and used to infect insect cells to express recombinant proteins. For expression in mammalian cells, a vector is used that will drive expression of the construct in the desired mammalian host cell (eg, Chinese hamster ovary cells).

FimH variant polypeptides can be isolated using any suitable method. For example, methods are known in the art for purifying FimH protein variant polypeptides by immunoaffinity chromatography. Ruiz-Arguello et al., J. Gen. Virol. , 85:3677-3687 (2004). Suitable methods for purifying desired proteins are well known in the art, including precipitation and various types of chromatography, such as hydrophobic interaction, ion exchange, affinity, chelation and size exclusion. . Two or more of the above or other suitable methods can be used to create a suitable purification scheme. If desired, the FimH variant polypeptide can include a "tag" to facilitate purification, such as an epitope tag or a histidine (His) tag. Such tagged polypeptides can be conveniently isolated, for example, from conditioned media by chelation chromatography or affinity chromatography.

The term "antigen" as used herein refers to a molecule that can be recognized by an antibody. Examples of antigens include polypeptides, peptides, lipids, polysaccharides and nucleic acids containing antigenic determinants, such as those recognized by immune cells.

II. Nucleic Acids Encoding FimH Variants In another aspect, the present disclosure provides nucleic acid molecules encoding FimH variants disclosed herein. Such nucleic acid molecules include DNA, cDNA and RNA sequences. In one embodiment, the nucleic acid molecule can be incorporated into a vector, such as an expression vector.

In one aspect, a nucleic acid encoding an E. coli FimH mutant poly(pol) peptide or any fragment thereof is disclosed. One or more nucleic acid constructs encoding FimH variant polypeptides or fragments thereof can be used for genomic integration and subsequent polypeptide expression. For example, a single nucleic acid construct encoding a FimH variant polypeptide or fragment thereof can be introduced into a host cell. Alternatively, the coding sequence for a polypeptide may be carried by two or more nucleic acid constructs, which are then introduced into a host cell simultaneously or sequentially.

For example, in one exemplary embodiment, a single nucleic acid construct encodes the lectin domain and pilin domain of E. coli FimH. In another exemplary embodiment, one nucleic acid construct encodes a lectin domain of E. coli FimH and a second nucleic acid construct encodes a pilin domain. In some embodiments, genomic integration is achieved.

Nucleic acid constructs may include genomic DNA, including one or more introns, or cDNA. Some genes are expressed more efficiently when introns are present. In some embodiments, the nucleic acid sequence is suitable for expression of an exogenous polypeptide in said mammalian cell.

In some embodiments, the nucleic acid encoding the polypeptide or fragment thereof is codon-optimized to increase the level of expression in any particular cell.

In some embodiments, the nucleic acid construct includes a signal sequence encoding a peptide that directs secretion of the E. coli-derived polypeptide or fragment thereof. In some embodiments, the nucleic acid comprises the natural signal sequence of a polypeptide derived from E. coli FimH. In some embodiments where the E. coli-derived polypeptide or fragment thereof comprises an endogenous signal sequence, the nucleic acid sequence encoding the signal sequence is optimized to increase the level of expression of the protein in the host cell. It can be a codon that is

In some aspects, the signal sequence is of the following lengths: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids in length. Either one. In some embodiments, the signal sequence is 20 amino acids long. In some embodiments, the signal sequence is 21 amino acids long.

In some embodiments, if the polypeptide or fragment thereof includes a signal sequence, the endogenous signal sequence that is naturally associated with the polypeptide is used to increase the level of expression of the polypeptide or fragment thereof in cultured cells. , can be replaced with a signal sequence that is not associated with the wild-type polypeptide. Thus, in some embodiments, the nucleic acid does not include the natural signal sequence of a polypeptide derived from E. coli or a fragment thereof. In some embodiments, the nucleic acid does not include the natural signal sequence of a polypeptide derived from E. coli FimH. In some aspects, the polypeptide derived from E. coli or a fragment thereof is a heterologous peptide, preferably a signal sequence, or a mature protein or polypeptide derived from E. coli or a fragment thereof. can be expressed with other peptides that have a specific cleavage site at the N-terminus. For example, a polypeptide derived from E. coli FimH or a fragment thereof may be a heterologous peptide, preferably a signal sequence (e.g., an IgK signal sequence), or specific to the N-terminus of a mature E. coli FimH protein. can be expressed with other peptides that have specific cleavage sites. In a preferred embodiment, the specific cleavage at the N-terminus of the mature E. coli FimH protein occurs immediately before the first phenylalanine residue of the mature E. coli FimH protein. The heterologous sequence selected is preferably one that is recognized and processed (ie, cleaved by a signal peptidase) by the host cell.

In a preferred embodiment, the signal sequence is an IgK signal sequence. In some embodiments, the nucleic acid encodes a polypeptide having an amino acid sequence set forth in any of SEQ ID NOs: 1-64. In some aspects, the nucleic acid encodes the amino acid sequence SEQ ID NO: 23, 50, 51, 52, 53, 54, 60, 61 or 62. In some embodiments, the nucleic acid encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO:62. In a preferred embodiment, the signal sequence is a mouse IgK signal sequence.

Suitable mammalian expression vectors for producing FimH variant polypeptides or fragments thereof are known in the art and are commercially available, such as the pSecTag2 expression vector from Invitrogen™. An exemplary mouse Ig kappa signal peptide sequence includes the sequence ETDTLLLWVLLLWVPGSTG (SEQ ID NO: 65). In some embodiments, the vector comprises the pBudCE4.1 mammalian expression vector from Thermo Fisher. Additional exemplary suitable vectors include the pcDNA™ 3.1 mammalian expression vector (Thermo Fisher).

In some embodiments, the signal sequence does not include a hemagglutinin signal sequence.

In some embodiments, the nucleic acid comprises the natural signal sequence of a FimH polypeptide or fragment thereof. In some embodiments, the signal sequence is not an IgK signal sequence. In some embodiments, the signal sequence comprises a hemagglutinin signal sequence.

In one aspect, vectors comprising coding sequences for FimH variant polypeptides or fragments thereof are disclosed herein. Exemplary vectors include plasmids that are capable of autonomous replication or replication in mammalian cells. Typical expression vectors contain suitable promoters, enhancers, and terminators that are useful for regulating the expression of the coding sequences in the expression construct. The vector may contain a selectable marker to obtain a phenotypic trait for selecting transformed host cells, such as conferring resistance to antibiotics such as ampicillin or neomycin.

Suitable promoters are known in the art. Exemplary promoters include, for example, the CMV promoter, adenovirus, EF1 a, GAPDH metallothionine promoter, SV40 early promoter, SV40 late promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, etc. It will be done. A promoter may be constitutive or an inducible promoter. One or more vectors can be used (eg, one vector encoding all subunits or domains or fragments thereof, or multiple vectors jointly encoding the subunits or domains or fragments thereof).

Internal ribosome entry sites (IRES) and 2A peptide sequences can also be used. IRES and 2A peptides provide an alternative approach for co-expression of multiple sequences. IRES are nucleotide sequences that allow translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. Normally, in eukaryotes, translation can only be initiated at the 5' end of the mRNA molecule. IRES elements allow expression of multiple genes in one transcript. IRES-based polycistronic vectors that express multiple proteins from one transcript can reduce the leakage of non-expressing clones from selection. The 2A peptide allows multiple proteins in one open reading frame to be translated into a polyprotein, which is subsequently cleaved into individual proteins via a ribosome-skipping mechanism. . The 2A peptide can provide more balanced expression of multiple protein products. Exemplary IRES sequences include, eg, EV71 IRES, EMCV IRES, HCV IRES. Regarding genomic integration, integration can be site-specific or random. Site-specific recombination can be achieved by introducing homologous sequences into the nucleic acid constructs described herein. Such homologous sequences substantially match endogenous sequences at specific target sites in the host genome. Alternatively, random embedding can be used. Sometimes, protein expression levels can vary depending on the site of integration. Therefore, it may be desirable to select a large number of clones according to the expression level of the recombinant protein in order to identify those that achieve the desired expression level.

Exemplary nucleic acid constructs are further described in the figures, eg, FIGS. 2A-2T of PCT International Publication No. WO 2021/084429, published May 6, 2021, which is incorporated herein by reference.

In one aspect, the nucleic acid sequence has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, Encode amino acid sequences having at least 98%, at least 99% identity. In preferred embodiments, the nucleic acid sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least as similar to SEQ ID NO: 62. They encode amino acid sequences with 99% identity. In another aspect of the invention, the nucleic acid sequence has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79% of any of SEQ ID NOs: 1-64. , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98%, 99% or 99.9% identity. In preferred embodiments, the nucleic acid sequence is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , encode amino acid sequences with 99% or 99.9% identity.

In certain aspects of the present disclosure, the RNA is messenger RNA (mRNA), which refers to an RNA transcript that encodes a peptide or protein. As established in the art, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide coding region, and a 3' untranslated region (3'-UTR). In some embodiments, RNA is produced by in vitro transcription or chemical synthesis. In one embodiment, mRNA is produced by in vitro transcription using a DNA template, where DNA refers to nucleic acids containing deoxyribonucleotides. In one aspect, the RNA described herein can have modified nucleosides. In some embodiments, the RNA includes a modified nucleoside in place of at least one (eg, all) uridines.

In some embodiments, a composition or medical preparation described herein comprises RNA encoding an amino acid sequence comprising a FimH variant polypeptide. Similarly, the methods described herein include administration of such RNA. One possible platform for use herein induces robust neutralizing antibodies and concomitant/concomitant T cell responses to achieve protective immunization, preferably with minimal vaccine doses. based on antigen-encoded RNA vaccines for The RNA administered is preferably in-vitro transcribed RNA. Three different RNA platforms are particularly preferred: unmodified uridine-containing mRNA (uRNA), nucleoside-modified mRNA (modRNA) and self-amplified RNA (saRNA). In one particularly preferred embodiment, the RNA is in vitro transcribed RNA.

III. Host Cells In one aspect, the present disclosure relates to cells in which sequences encoding FimH variant polypeptides or fragments thereof are expressed in mammalian host cells. In one embodiment, the polypeptide is expressed transiently in the host cell. In another embodiment, the polypeptide is stably integrated into the genome of the host cell to express the polypeptide or fragment thereof when cultured under suitable conditions. In one preferred embodiment, the polynucleotide sequences are expressed with high efficiency and genomic stability.

Suitable mammalian host cells are known in the art. Preferably, the host cell is suitable for producing proteins on an industrial manufacturing scale. Exemplary mammalian host cells include any one of the following and derivatives thereof: Chinese hamster ovary (CHO) cells, COS cells (a cell line derived from monkey kidney (African green monkey), Vero cells, Hela cells, baby hamster kidney (BHK) cells, human embryonic kidney (HEK) cells, NSO cells (a mouse myeloma cell line), and C127 cells (a non-tumorigenic mouse cell line). Additional exemplary mammalian hosts Cells include mouse Sertoli (TM4), buffalo rat liver (BRL 3A), mouse mammary tumor (MMT), rat hepatocellular carcinoma (HTC), mouse myeloma (NSO), mouse hybridoma (Sp2/0), mouse breast adenoma (EL4), Chinese hamster ovary (CHO) and CHO cell derivatives, mouse embryonic (NIH/3T3, 3T3 Li), rat cardiac muscle (H9c2), mouse myoblast (C2C12), and mouse kidney (miMCD-3) Additional examples of mammalian cell lines include NS0/1, Sp2/0, Hep G2, PER.C6, COS-7, TM4, CV1, VERO-76, MDCK, BRL 3A, W138, MMT 060562. , TR1, MRC5, and FS4.

Any cell capable of cell culture can be used in accordance with the present invention. In some embodiments, the cell is a mammalian cell. Non-limiting examples of mammalian cells that can be used according to the invention include: BALB/c mouse myeloma line (NSO/l, ECACC No: 85110503); human retinoblast cells (PER.C6, Cru cells, Leiden , The Netherlands); monkey kidney CV1 line transformed with SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 cells or 293 cells subcloned for growth in suspension culture, Graham et al. , J. Gen Virol., 36:59, 1977); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells +/- DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA) Mouse 28yophil cells (TM4, Mather, Biol. Reprod., 23:243-251, 1980); Monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1 587); human cervical cancer cells (HeLa, ATCC CCL 2); dog kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals NY Acad. Sci., 383:44-68, 1982) ; MRC 5 cells; FS4 cells; and a human hepatocellular carcinoma line (Hep G2). In some preferred embodiments, the cells are CHO cells. In some preferred embodiments, the cells are GS cells.

Additionally, any number of commercial and non-commercial hybridoma cell lines can be used in accordance with the present invention. The term "hybridoma" as used herein refers to a cell or progeny resulting from the fusion of an immortalized cell and an antibody-producing cell. The hybridomas so obtained are immortalized cells that produce antibodies. The individual cells used to generate hybridomas may be derived from any mammalian source, including, but not limited to, rat, pig, rabbit, sheep, pig, goat, and human. In some embodiments, the hybridoma is a trioma cell line that arises when the progeny of a heterohybrid myeloma fusion, which is the product of a fusion between a human cell and a mouse myeloma cell line, subsequently fuses with a plasma cell. In some embodiments, a hybridoma is any immortalized hybrid cell line that produces antibodies, such as a quadroma (see, eg, Milstein et al., Nature, 537:3053 (1983)). Those skilled in the art will appreciate that hybridoma cell lines may have different nutritional requirements and/or require different culture conditions for optimal growth, and the conditions may be modified as necessary. It will be possible.

In some embodiments, the cell comprises a first gene of interest, where the first gene of interest is chromosomally integrated. In some aspects, the first gene of interest is a reporter gene, a selection gene, a gene of interest (e.g., encoding a polypeptide derived from E. coli or a fragment thereof), a dependent gene, or a combination thereof. including. In some embodiments, the gene of therapeutic interest includes a gene encoding a poorly expressed (DtE) protein.

In some aspects, the first gene of interest is located between two distinct recombination target sites (RTS) in a site-specific integration (SSI) mammalian cell, where the two RTSs are NL1 Chromosomally integrated within the gene locus or the NL2 locus. See, for example, US Patent Application No. 20200002727 for a description of the NL1 locus, NL2 locus, NL3 locus, NL4 locus, NL5 locus, and NL6 locus. In some aspects, the first gene of interest is located within the NL1 locus. In some embodiments, the cell comprises a second gene of interest, where the second gene of interest is chromosomally integrated. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest (such as a FimH variant polypeptide or fragment thereof), a dependent gene, or a combination thereof. In some embodiments, the gene of therapeutic interest includes a gene encoding a DtE protein. In some aspects, the second gene of interest is located between the two RTSs. In some aspects, the second gene of interest is located within the NL1 or NL2 locus. In some embodiments, the first gene of interest is located within the NL1 locus and the second gene of interest is located within the NL2 locus. In some embodiments, the cell comprises a third gene of interest, where the third gene of interest is chromosomally integrated. In some embodiments, the third gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest (such as a polypeptide derived from E. coli or a fragment thereof), a dependent gene, or a combination thereof. . In some embodiments, the gene of therapeutic interest includes a gene encoding a DtE protein. In some aspects, the third gene of interest is located between the two RTSs. In some aspects, the third gene of interest is located within the NL1 or NL2 locus. In some aspects, the third gene of interest is located in a separate locus from the NL1 and NL2 loci. In some embodiments, the first gene of interest, the second gene of interest, and the third gene of interest are in three separate genetic loci. In some aspects, at least one of the first gene of interest, the second gene of interest, and the third gene of interest is within the NL1 locus, and the first gene of interest, the second gene of interest , and at least one of the third gene of interest is within the NL2 locus. In some embodiments, the cell comprises a site-specific recombinase gene. In some embodiments, the site-specific recombinase gene is chromosomally integrated.

In another aspect, the disclosure provides a mammalian cell comprising at least four distinct RTSs, wherein the cell comprises: (a) at least two chromosomally integrated RTSs within the NL1 or NL2 loci; (b) a first gene of interest incorporated between at least two RTSs of (a), including a reporter gene, a gene encoding a DtE protein, a dependent gene, or a combination thereof; (c ) and a reporter gene, a gene encoding a DtE protein (such as a polypeptide from E. coli or a fragment thereof), a dependent gene, or a combination thereof. It contains a second gene of interest integrated within the second chromosomal locus. In some aspects, the present disclosure provides a mammalian cell comprising at least four distinct RTSs, wherein the cell comprises: (a) at least two distinct RTSs that are chromosomally integrated within the Fer1L4 locus; (b) at least two distinct RTSs that are chromosomally integrated within the NL1 or NL2 locus; (c) the Fer1L4 gene, comprising a reporter gene, a gene encoding a DtE protein, a dependent gene, or a combination thereof; a first gene of interest that is chromosomally integrated within the locus; and (d) a reporter gene, a gene encoding a DtE protein (such as a polypeptide derived from E. coli or a fragment thereof), a dependent gene, or the like. (b) a second gene of interest that is chromosomally integrated within the NL1 locus or the NL2 locus.

In some aspects, the disclosure provides a mammalian cell comprising at least six distinct RTSs, wherein the cell comprises: (a) at least two distinct RTSs that are chromosomally integrated within the Fer1L4 locus; and a first gene of interest; (b) at least two distinct RTSs that are chromosomally integrated within the NL1 locus and a second gene of interest; and (c) at least two that are chromosomally integrated within the NL2 locus. Contains a separate RTS and a third gene of interest.

As referred to herein, the terms "in operative combination," "in operative order," and "operably linked" refer to transcription of a given gene and/or desired protein molecule. Refers to the joining of nucleic acid sequences in such a way that a nucleic acid molecule is produced that is capable of directing the synthesis of. The term also refers to the joining of amino acid sequences in such a way that a functional protein is produced. In some embodiments, the gene of interest is operably linked to a promoter, where the gene of interest is chromosomally integrated into the host cell. In some embodiments, the gene of interest is operably linked to a heterologous promoter; in which case the gene of interest is chromosomally integrated into the host cell. In some embodiments, the dependent gene is operably linked to a promoter, where the dependent gene is chromosomally integrated into the host cell genome. In some embodiments, the dependent gene is operably linked to a heterologous promoter; in which case the dependent gene is chromosomally integrated into the host cell genome. In some embodiments, the gene encoding the DtE protein is operably linked to a promoter, wherein the gene encoding the DtE protein is chromosomally integrated into the host cell genome. In some embodiments, the gene encoding the DtE protein is operably linked to a heterologous promoter, wherein the gene encoding the DtE protein is chromosomally integrated into the host cell genome. In some embodiments, the recombinase gene is operably linked to a promoter, where the recombinase gene is chromosomally integrated into the host cell. In some embodiments, the recombinase gene is operably linked to a promoter, where the recombinase gene is chromosomally integrated into the host cell genome. In some embodiments, the recombinase gene is operably linked to a heterologous promoter, wherein the recombinase gene is not chromosomally integrated into the host cell genome. In some embodiments, the recombinase gene is operably linked to a heterologous promoter, wherein the recombinase gene is not chromosomally integrated into the host cell genome.

As referred to herein, the term "chromosomally integrated" or "chromosomal integration" refers to the stable integration of a nucleic acid sequence into the chromosome of a host cell, e.g. a mammalian cell, i.e., a host cell, e.g. Refers to a nucleic acid sequence that is chromosomally integrated into the genomic DNA (gDNA) of mammalian cells. In some embodiments, chromosomally integrated nucleic acid sequences are stable. In some embodiments, the chromosomally integrated nucleic acid sequence is not located on a plasmid or vector. In some embodiments, chromosomally integrated nucleic acid sequences are not excised. In some aspects, chromosomal integration is mediated by clustered regularly interspaced short palindromic repeats (CRISPR) and the CRISPR-associated protein (Cas) gene editing system (CRISPR/CAS). be done.

IV. Compositions and Formulations In one aspect, the present disclosure includes compositions that include at least one FimH variant polypeptide or fragment thereof described herein. In some embodiments, the composition elicits an immune response that includes antibodies that can confer immunity against pathogenic species of E. coli.

In some embodiments, the composition includes a FimH variant polypeptide as the only antigen. In some embodiments, the composition does not include a conjugate.

In some aspects, the composition comprises a FimH variant polypeptide and at least one additional antigen. In some embodiments, the composition comprises a FimH variant polypeptide and an additional E. coli antigen. In some embodiments, the composition comprises a FimH variant polypeptide and an E. coli-derived saccharide conjugate.

In some embodiments, the composition comprises a FimH variant polypeptide and a polypeptide derived from E. coli FimC or a fragment thereof.

In one embodiment, this disclosure provides FimH variant polypeptides and PCT International Publication Nos. WO 2021/084429 and 2020, published May 6, 2021, each of which is incorporated herein by reference in its entirety. A sugar comprising any one of the sugar structures disclosed in WO2020/039359 published on February 27, 2020 and US Patent Application Publication No. US2020/0061177 published on February 27, 2020 and a composition comprising. In one aspect, the disclosure includes a composition comprising a FimH variant polypeptide; (e.g. formula O4:K52 and formula O4:K6), formula O5 (e.g. formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g. formula O6:K2;K13;K15 and formula O6:K54 ), formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (for example, formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28, formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 ( For example, formula O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60 , formula O61, formula O62, formula 62D ₁ , formula O63, formula O64, formula O65, formula O66, formula O68, formula O69, formula O70, formula O71, formula O73 (for example, formula O73 (stock 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90 , formula O91, formula O92, formula O93, formula O95, formula O96, formula O97, formula O98, formula O99, formula O100, formula O101, formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142 , formula O143, formula O144, formula O145, formula O146, formula O147, formula O148, formula O149, formula O150, formula O151, formula O152, formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186, and Formula O187 (where n is 1 to 100, preferably an integer from 31 to 90).

In some embodiments, the composition comprises any one of the sugars disclosed herein. In preferred embodiments, the composition comprises any one of the conjugates disclosed herein.

In some embodiments, the composition comprises at least one saccharide conjugate from E. coli serotype O25, preferably serotype O25b. In one embodiment, the composition comprises at least one saccharide conjugate from E. coli serotype O1, preferably serotype O1a. In one embodiment, the composition comprises at least one saccharide conjugate from E. coli serotype O2. In one embodiment, the composition comprises at least one saccharide conjugate from E. coli serotype O6.

In one embodiment, the composition comprises at least one selected from any one of the following E. coli serotypes O25, O1, O2, and O6, preferably O25b, O1a, O2, and O6. Contains two sugar conjugates. In one embodiment, the composition comprises at least two E. coli serotypes selected from any one of the following E. coli serotypes O25, O1, O2 and O6, preferably O25b, O1a, O2 and O6. Contains sugar conjugates. In another embodiment, the composition comprises at least three selected from any one of the following E. coli serotypes O25, O1, O2 and O6, preferably O25b, O1a, O2 and O6. Contains sugar conjugates of In a further embodiment, the composition comprises a saccharide conjugate from each of the following E. coli serotypes O25, O1, O2 and O6, preferably O25b, O1a, O2 and O6.

In one preferred embodiment, the sugar conjugates of any of the above compositions are individually conjugated to CRM ₁₉₇ . In another preferred embodiment, the sugar conjugates of any of the compositions described above are individually conjugated to the SCP.

Thus, in some embodiments, the composition comprises a FimH variant polypeptide and an O antigen derived from at least one E. coli serotype. In one preferred embodiment, the composition comprises a FimH variant polypeptide and an O antigen derived from more than one E. coli serotype. For example, the composition can include O antigens from two different E. coli serotypes (or "v", valency) and twelve different serotypes (12v). In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from three different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from four different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from five different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from six different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from seven different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from eight different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from nine different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from ten different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 11 different E. coli serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 12 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 13 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 14 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 15 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 16 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 17 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 18 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 19 different serotypes. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 20 different serotypes.

Preferably, the number of E. coli sugars may range from one serotype (or "v", valency) to 26 different serotypes (26v). In one embodiment, one serotype is present. In one embodiment, two different serotypes are present. In one embodiment, there are three different serotypes. In one embodiment, there are four different serotypes. In one embodiment, there are five different serotypes. In one embodiment, there are six different serotypes. In one embodiment, there are seven different serotypes. In one embodiment, there are eight different serotypes. In one embodiment, there are nine different serotypes. In one embodiment, there are ten different serotypes. In one embodiment, there are 11 different serotypes. In one embodiment, there are 12 different serotypes. In one embodiment, there are 13 different serotypes. In one embodiment, there are 14 different serotypes. In one embodiment, there are 15 different serotypes. In one embodiment, there are 16 different serotypes. In one embodiment, there are 17 different serotypes. In one embodiment, there are 18 different serotypes. In one embodiment, there are 19 different serotypes. In one embodiment, there are 20 different serotypes. In one embodiment, there are 21 different serotypes. In one embodiment, there are 22 different serotypes. In one embodiment, there are 23 different serotypes. In one embodiment, there are 24 different serotypes. In one embodiment, there are 25 different serotypes. In one embodiment, there are 26 different serotypes. The sugar is conjugated to a carrier protein to form the sugar conjugates described herein.

In one aspect, the composition comprises a FimH variant polypeptide; and a saccharide conjugate comprising an O antigen from at least one E. coli serogroup, wherein the O antigen is conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide; and O antigens from more than one E. coli serotype, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from two different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from three different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from four different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from five different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from six different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from seven different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from eight different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from nine different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from ten different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises O antigens from FimH variant polypeptides and 11 different E. coli serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 12 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 13 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 14 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 15 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 16 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 17 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 18 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 19 different serotypes, each O antigen conjugated to a carrier protein. In one embodiment, the composition comprises a FimH variant polypeptide and O antigens from 20 different serotypes, each O antigen conjugated to a carrier protein.

In another aspect, the composition comprises an O polysaccharide derived from at least one E. coli serotype. In one preferred embodiment, the composition comprises O polysaccharide from more than one E. coli serotype. For example, the composition can include O polysaccharides from two different E. coli serotypes to twelve different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from three different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from four different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from five different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from six different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from seven different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from eight different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from nine different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from ten different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from 11 different E. coli serotypes. In one embodiment, the composition comprises O polysaccharides from 12 different serotypes. In one embodiment, the composition comprises O polysaccharides from 13 different serotypes. In one embodiment, the composition comprises O polysaccharides from 14 different serotypes. In one embodiment, the composition comprises O polysaccharides from 15 different serotypes. In one embodiment, the composition comprises O polysaccharides from 16 different serotypes. In one embodiment, the composition comprises O polysaccharides from 17 different serotypes. In one embodiment, the composition comprises O polysaccharides from 18 different serotypes. In one embodiment, the composition comprises O polysaccharides from 19 different serotypes. In one embodiment, the composition comprises O polysaccharides from 20 different serotypes.

In one preferred embodiment, the composition comprises an O-polysaccharide derived from at least one E. coli serotype, wherein the O-polysaccharide is conjugated to a carrier protein. In one preferred embodiment, the composition comprises O-polysaccharides from more than one E. coli serotype, each O-polysaccharide conjugated to a carrier protein. For example, the composition comprises O-polysaccharides from two different E. coli serotypes to 12 different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. That's fine. In one embodiment, the composition comprises O-polysaccharides from three different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from four different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from five different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from six different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from seven different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from eight different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from nine different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from ten different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 11 different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 12 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 13 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 14 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 15 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 16 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 17 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 18 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 19 different serotypes, each O-polysaccharide conjugated to a carrier protein. In one embodiment, the composition comprises O-polysaccharides from 20 different serotypes, each O-polysaccharide conjugated to a carrier protein.

In a most preferred embodiment, the composition comprises an O polysaccharide derived from at least one E. coli serotype, wherein the O polysaccharide is conjugated to a carrier protein, and the O polysaccharide is conjugated to an O antigen and an O antigen. Contains core sugars. In a preferred embodiment, the composition comprises O-polysaccharides derived from more than one E. coli serotype, wherein each O-polysaccharide is conjugated to a carrier protein, and the O-polysaccharide comprises an O-antigen and a core saccharide. including. For example, the composition may contain 12 different E. coli serotypes from two different E. coli serotypes, each O polysaccharide conjugated to a carrier protein, and the O polysaccharide containing an O antigen and a core sugar. May contain serotype O polysaccharides. In one embodiment, the composition comprises O polysaccharides from three different E. coli serotypes, each O polysaccharide conjugated to a carrier protein, the O polysaccharides comprising an O antigen and a core saccharide. . In one embodiment, the composition comprises O-polysaccharides from four different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, and the O-polysaccharide comprises an O-antigen and a core saccharide. including. In one embodiment, the composition comprises O polysaccharides from five different E. coli serotypes, each O polysaccharide conjugated to a carrier protein, the O polysaccharides comprising an O antigen and a core saccharide. . In one embodiment, the composition comprises O-polysaccharides from six different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. . In one embodiment, the composition comprises O-polysaccharides from seven different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. . In one embodiment, the composition comprises O-polysaccharides derived from eight different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, and the O-polysaccharide comprises an O-antigen and a core saccharide. including. In one embodiment, the composition comprises O-polysaccharides from nine different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core sugar. including. In one embodiment, the composition comprises O-polysaccharides from ten different E. coli serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. . In one embodiment, the composition comprises O-polysaccharides derived from 11 different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, and the O-polysaccharide comprises an O-antigen and a core saccharide. including. In one embodiment, the composition comprises O-polysaccharides from 12 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 13 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 14 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 15 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 16 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 17 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 18 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 19 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one embodiment, the composition comprises O-polysaccharides from 20 different serotypes, each O-polysaccharide conjugated to a carrier protein, the O-polysaccharides comprising an O-antigen and a core saccharide. In one preferred embodiment, the carrier protein is CRM ₁₉₇ .

In another preferred embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide conjugated to CRM ₁₉₇ , wherein the O polysaccharide has the formula O25a (wherein n is at least 30). and core sugar. In a preferred embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O25b, where n is at least 40, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O1a, where n is at least 30, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O2, where n is at least 30, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O6, where n is at least 30, and a core sugar.

In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O17, where n is at least 30, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O15, where n is at least 30, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising the formula O18A, where n is at least 30, and a core sugar. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O75, where n is at least 30, and a core saccharide. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O4, where n is at least 30, and a core saccharide. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O16, where n is at least 30, and a core saccharide. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O13, where n is at least 30, and a core saccharide. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising formula O7, where n is at least 30, and a core sugar.

In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O8, where n is at least 30, and a core saccharide. In another embodiment, the O polysaccharide comprises the formula O8, where n is 1-20, preferably 2-5, more preferably 3. In another embodiment, the composition further comprises an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide having the formula O9, where n is at least 30, and a core saccharide. In another embodiment, the O polysaccharide comprises the formula O9, where n is 1-20, preferably 4-8, more preferably 5. In another embodiment, the O polysaccharide comprises the formula O9a, where n is 1-20, preferably 4-8, more preferably 5.

In some embodiments, the O polysaccharide is of formula O20ab, formula O20ac, formula O52, formula O97, and formula O101, where n is 1-20, preferably 4-8, more preferably 5. One of them is selected.

As noted above, the composition can include any combination of a FimH variant polypeptide and a conjugated O polysaccharide (antigen). In one exemplary embodiment, the composition comprises a polysaccharide comprising formula O25b, a polysaccharide comprising formula O1A, a polysaccharide comprising formula O2, and a polysaccharide comprising formula O6. More specifically, such compositions include (i) an O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising formula O25b (wherein n is at least 30) and a core sugar; (ii) an O-polysaccharide conjugated to CRM ₁₉₇ , the O-polysaccharide comprising formula O1a (wherein n is at least 30) and a core sugar; (iii) an O-polysaccharide conjugated to CRM ₁₉₇ ; and (iv) an O polysaccharide conjugated to CRM 197, the O polysaccharide comprising formula O2 (wherein n is at least 30) and a core sugar; and (iv) an O polysaccharide conjugated to CRM ₁₉₇ , wherein n is at least 30) and a core sugar.

In one embodiment, the composition comprises a FimH variant polypeptide and at least one O polysaccharide from any E. coli serotype that is not O25a. For example, in one embodiment, the composition does not include a sugar comprising formula O25a. Such compositions can include, for example, an O polysaccharide comprising formula O25b, an O polysaccharide comprising formula O1A, an O polysaccharide comprising formula O2, and an O polysaccharide comprising formula O6.

In one embodiment, the composition comprises a FimH variant polypeptide and two different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising an O antigen and a core saccharide. Contains O polysaccharide derived from. In one embodiment, the composition comprises FimH variant polypeptides and three different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising an O antigen and a core saccharide. Contains O polysaccharide derived from. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from four different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ and an O polysaccharide derived from four different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from five different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ and an O polysaccharide derived from five different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from six different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ and an O polysaccharide derived from six different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from seven different E. coli serotypes, each O polysaccharide being conjugated to CRM ₁₉₇ and an O polysaccharide derived from seven different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from eight different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ and an O polysaccharide derived from eight different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and an O polysaccharide from nine different E. coli serotypes, each O polysaccharide conjugated to CRM ₁₉₇ and an O polysaccharide derived from nine different E. coli serotypes. contains an O antigen and a core sugar. In one embodiment, the composition comprises a FimH variant polypeptide and each O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising an O antigen and a core saccharide of 10 different E. coli serotypes. Contains O polysaccharide derived from. In one embodiment, the composition comprises a FimH variant polypeptide and a respective O polysaccharide conjugated to CRM ₁₉₇ , the O polysaccharide comprising an O antigen and a core saccharide of 11 different E. coli serotypes. Contains O polysaccharide derived from. In one embodiment, the composition comprises a FimH variant polypeptide and O polysaccharides from 12 different serotypes, each O polysaccharide conjugated to CRM ₁₉₇ , and the O polysaccharide comprising an O antigen and a core Contains sugar. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 13 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 14 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 15 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 16 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 17 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 18 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 19 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include. In one embodiment, the composition comprises FimH variant polypeptides and O polysaccharides from 20 different serotypes, where each O polysaccharide is conjugated to CRM ₁₉₇ , and the O polysaccharide includes an O antigen and a core saccharide. include.

In one aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O25b (where n is 15±2 ). In one aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising the formula O25b, where n is 17±2. In one aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising the formula O25b, where n is 55±2. In another aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising the formula O25b, where n is 51±2. In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently linked to a carrier protein, wherein the sugar has the formula O25b (where n is from 30 to preferably n is an integer from 31 to 100). In one embodiment, the sugar further comprises an E. coli R1 core sugar moiety. In another embodiment, the saccharide further comprises an E. coli K12 core sugar moiety. In another embodiment, the sugar further comprises a KDO moiety. Preferably the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is prepared by single end-joint conjugation. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one aspect, the immunogenic composition elicits IgG antibodies in humans, wherein the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, as determined by an ELISA assay; It can bind to E. coli serotype O25B polysaccharide at a concentration of 0.4 pg/ml or 0.5 pg/ml. Therefore, a comparison of the OPA activity of pre- and post-immune sera with the immunogenic compositions of the invention is made and compared for their response to serotype O25B to assess the potential for increase in responders. be able to. In one embodiment, the immunogenic composition elicits IgG antibodies in humans, and the antibodies are capable of killing E. coli serotype O25B as determined by an in vitro opsonophagocytosis assay. can. In one embodiment, the immunogenic composition elicits functional antibodies in humans, and the antibodies are capable of killing E. coli serotype O25B as determined by an in vitro opsonophagocytosis assay. Can be done. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O25B responders (i.e., in vitro
Increase the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition has a titer of at least 1:8 against E. coli serotype O25B in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. cause In one embodiment, the immunogenic compositions of the invention produce E. coli (E. .coli) to elicit a titer of at least 1:8 against serotype O25B. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O25B responders (i.e., in vitro
significantly increases the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition of the invention significantly increases OPA titers in a human subject against E. coli serotype O25B compared to a pre-immune population.

In one aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O1a (where n is greater than 30). preferably n is an integer from 31 to 100). In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently linked to a carrier protein, wherein the sugar has the formula O1a (where n is 39± 2). In another aspect, the invention relates to a conjugate comprising a FimH polypeptide and a saccharide covalently attached to a carrier protein, the saccharide comprising the formula O1a, where n is 13±2. In one embodiment, the sugar further comprises an E. coli R1 core sugar moiety. In one embodiment, the sugar further comprises a KDO moiety. Preferably the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is prepared by single end-joint conjugation. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition raises IgG antibodies in humans, and the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml as determined by an ELISA assay. , can bind to E. coli serotype O1A polysaccharide at a concentration of 0.4 pg/ml or 0.5 pg/ml. Therefore, a comparison of the OPA activity of pre- and post-immune sera with the immunogenic compositions of the invention is made and compared for their response to serotype O1A to assess the potential for increase in responders. be able to. In one embodiment, the immunogenic composition elicits IgG antibodies in humans, and the antibodies are capable of killing E. coli serotype O1A as determined by an in vitro opsonophagocytosis assay. can. In one embodiment, the immunogenic composition elicits functional antibodies in humans, wherein the antibodies are capable of killing E. coli serotype O1A as determined by an in vitro opsonophagocytosis assay. Can be done. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O1A responders (i.e., in vitro
Increase the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition has a titer of at least 1:8 against E. coli serotype O1A in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. cause In one embodiment, the immunogenic compositions of the invention produce E. coli (E. .coli) to elicit a titer of at least 1:8 against serotype O1A. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O1A responders (i.e., in vitro
significantly increases the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition of the invention significantly increases OPA titers in a human subject against E. coli serotype O1A compared to a pre-immune population.

In one aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O2 (where n is greater than 30). preferably n is an integer from 31 to 100). In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O2 (where n is 43± 2). In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O2 (where n is 47± 2). In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently linked to a carrier protein, wherein the sugar has the formula O2 (where n is 17± 2). In another aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O2 (where n is 18± 2). In one embodiment, the sugar further comprises an E. coli R1 core sugar moiety. In another embodiment, the saccharide further comprises an E. coli R4 core sugar moiety. In another embodiment, the sugar further comprises a KDO moiety. Preferably the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is prepared by single end-joint conjugation. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition raises IgG antibodies in humans, and the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml as determined by an ELISA assay. , can bind to E. coli serotype O2 polysaccharide at a concentration of 0.4 pg/ml or 0.5 pg/ml. Therefore, a comparison of the OPA activity of pre- and post-immune sera with the immunogenic compositions of the invention is made and compared for their response to serotype O2 to assess the potential for increase in responders. be able to. In one embodiment, the immunogenic composition elicits IgG antibodies in humans, and the antibodies are capable of killing E. coli serotype O2 as determined by an in vitro opsonophagocytosis assay. can. In one embodiment, the immunogenic composition elicits functional antibodies in humans, and the antibodies are capable of killing E. coli serotype O2 as determined by an in vitro opsonophagocytosis assay. Can be done. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O2 responders (i.e., in vitro
Increase the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition has a titer of at least 1:8 against E. coli serotype O2 in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. cause In one embodiment, the immunogenic compositions of the invention produce E. coli (E. .coli) elicits a titer of at least 1:8 against serotype O2. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O2 responders (i.e., in vitro
significantly increases the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition of the invention significantly increases OPA titers in a human subject against E. coli serotype O2 compared to a pre-immune population.

In one aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O6 (where n is greater than 30). preferably n is an integer from 31 to 100). In one aspect, the invention provides a composition comprising a FimH variant polypeptide and a conjugate comprising a sugar covalently attached to a carrier protein, wherein the sugar has the formula O6 (where n is 42±2 ). In another aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising formula O6, where n is 50±2. In another aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising formula O6, where n is 17±2. In another aspect, the invention relates to a composition comprising a FimH variant polypeptide and a conjugate comprising a saccharide covalently attached to a carrier protein, the saccharide comprising the formula O6, where n is 18±2. In one embodiment, the sugar further comprises an E. coli R1 core sugar moiety. In one embodiment, the sugar further comprises a KDO moiety. Preferably the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is prepared by single end-joint conjugation. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent.

In one embodiment, the immunogenic composition raises IgG antibodies in humans, and the antibodies are at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml as determined by an ELISA assay. , can bind to E. coli serotype O6 polysaccharide at a concentration of 0.4 pg/ml or 0.5 pg/ml. Therefore, a comparison of the OPA activity of pre- and post-immune sera with the immunogenic compositions of the present invention is made and compared for their response to serotype O6 to assess the potential for increase in responders. be able to. In one embodiment, the immunogenic composition elicits IgG antibodies in humans, and the antibodies are capable of killing E. coli serotype O6 as determined by an in vitro opsonophagocytosis assay. can. In one embodiment, the immunogenic composition elicits functional antibodies in humans, wherein the antibodies are capable of killing E. coli serotype O6 as determined by an in vitro opsonophagocytosis assay. Can be done. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O6 responders (i.e., in vitro
Increase the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition has a titer of at least 1:8 against E. coli serotype O6 in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay. cause In one embodiment, the immunogenic compositions of the invention produce E. coli (E. .coli) to elicit a titer of at least 1:8 against serotype O6. In one embodiment, the immunogenic compositions of the invention are administered to E. coli serotype O6 responders (i.e., in vitro
significantly increases the proportion of individuals with serum with a titer of at least 1:8 as determined by OPA. In one embodiment, the immunogenic composition of the invention significantly increases OPA titers in a human subject against E. coli serotype O6 compared to a pre-immune population.

In one aspect, the composition comprises a conjugate comprising a FimH variant polypeptide and a sugar covalently attached to a carrier protein, wherein the sugar is of formula O1 (e.g., formula O1A, formula O1B, and formula O1C), Formula O2, Formula O3, Formula O4 (e.g., Formula O4:K52 and Formula O4:K6), Formula O5 (e.g., Formula O5ab and Formula O5ac (stock 180/C3)), Formula O6 (e.g., Formula O6:K2; K13; K15 and formula O6: K54), formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (for example, formula O18A , formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b) , formula O26, formula O27, formula O28, formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 (e.g., formula O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D ₁ , Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (For example, Formula O73 (Stock 73-1)), formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105 , formula O106, formula O107, formula O108, formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, formula O136, formula O137, formula O138, formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156 , formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, formula O186, and formula O187 (where n is , an integer of 1 to 100, preferably 31 to 90). In one embodiment, the sugar further comprises an E. coli R1 core sugar moiety. In one embodiment, the sugar further comprises an E. coli R2 core sugar moiety. In one embodiment, the sugar further comprises an E. coli R3 core sugar moiety. In another embodiment, the saccharide further comprises an E. coli R4 core sugar moiety. In one embodiment, the sugar further comprises an E. coli K12 core sugar moiety. In another embodiment, the sugar further comprises a KDO moiety. Preferably the carrier protein is CRM ₁₉₇ . In one embodiment, the conjugate is prepared by single end-joint conjugation. In one embodiment, the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer. In one embodiment, the sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer. Preferably, the composition further comprises a pharmaceutically acceptable diluent. In one embodiment, the composition comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 further comprising up to 30 additional conjugates.

A. Sugar 1. Sugars and O-polysaccharides In one embodiment, sugars are produced by expression (but not necessarily overexpression) of different Wzz proteins (eg, WzzB) to control the size of the sugar.

As used herein, the term "sugar" refers to single sugar moieties or monosaccharide units as well as two or more single sugar moieties covalently linked to form disaccharides, oligosaccharides, and polysaccharides. or a combination of monosaccharide units. Sugars may be linear or branched.

In one embodiment, the sugar is produced in recombinant Gram-negative bacteria. In one embodiment, the sugar is produced in recombinant E. coli cells. In one embodiment, the sugar is produced in recombinant Salmonella cells. Exemplary bacteria include E. coli O25K5H1, E. coli BD559, E. coli GAR2831, E. coli GAR865, E. coli GAR868, E. coli) GAR869, E. coli GAR872, E. coli GAR878, E. coli GAR896, E. coli GAR1902, E. coli O25a ETC NR-5, E. coli (E. coli) O157:H7:K-, Salmonella enterica serotype Typhimurium strain LT2, E. coli GAR2401, Salmonella enterica serotype lititidis (Enteritidis) CVD1943, Salmonella enterica serotype Typhimurium strain CVD1925, Salmonella enterica serotype Paratyphi A CVD1902, and Shigella flexneri CVD1208S are listed. It will be done. In one embodiment, the bacterium is not E. coli GAR2401. This genetic approach to sugar production allows efficient production of O polysaccharide and O antigen molecules as vaccine components.

As used herein, the term "wzz protein" refers to chain length determining polypeptides, such as, for example, wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2. GenBank accession numbers for exemplary wzz gene sequences are AF011910 for E4991/76, AF011911 for F186, AF011912 for M70/1-1, AF011913 for 79/311, AF011914 for Bi7509-41, and C664-1992. AF011915 for C258-94, AF011916 for C722-89, and AF011919 for EDL933. The GenBank accession numbers for the G7 and Bi316-41 wzz gene sequences are U39305 and U39306, respectively. Additional GenBank accession numbers for exemplary wzz gene sequences are: NP_459581 for Salmonella enterica subsp. enterica serovar Typhimurium strain LT2 FepE; E. coli O157:H7 strain EDL933 FepE AIG66859 for Salmonella enterica subspecies enterica serovar Typhimurium strain LT2 WzzB; NP_461024 for E. coli K-12 substrain MG1655 WzzB NP_416531, Escherichia coli (E. coli) K-12 substrain MG1655 FepE is NP_415119. In a preferred embodiment, the WZZ family protein is WZZB, WZZ, WZZ _ST , _Fepe , WZZ _Fepe , WZZ1 and WZZ2, most preferably WZZB, more preferably Fepe.

Exemplary wzzB sequences include those set forth in SEQ ID NOs: 112-116. Exemplary FepE sequences include those set forth in SEQ ID NOs: 117-121.

In some embodiments, a wzz family protein (e.g., fepE) is expressed in a Gram-negative bacterium by expressing (but not necessarily overexpressing) a wzz family protein (e.g., fepE) from a Gram-negative bacterium, and/or a second wzz gene (e.g., wzzB ) is switched off (i.e., suppressed, deleted, removed) to contain an intermediate or long O antigen chain with an increased number of repeat units compared to the corresponding wild type O polysaccharide. By producing high molecular weight sugars such as lipopolysaccharide, modified sugars (modified compared to the corresponding wild type sugar) can be produced. For example, modified sugars can be produced by expressing (but not necessarily overexpressing) wzz2 and switching off wzz1. Alternatively, modified sugars can be produced by expressing (but not necessarily overexpressing) wzz/fepE and switching off wzzB. In another embodiment, modified sugars can be produced by expressing wzzB (but not necessarily overexpressing the progenitor), but switching off wzz/fepE. In another embodiment, modified sugars can be produced by expressing fepE. Preferably, the wzz family protein is derived from a strain that is xenologous to the host cell. Methods for determining sugar length are known in the art. Such methods include, but are not limited to, nuclear magnetic resonance, mass spectrometry and size exclusion chromatography. The methods for producing high molecular weight sugars described herein, such as lipopolysaccharides containing intermediate or long O-antigen chains, are described in PCT International Publication No. No. WO2020/039359 and corresponding US Patent Application Publication No. US2020/0061177.

In some embodiments, the sugars are SEQ ID NO:112, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, and SEQ ID NO:121. an amino acid sequence having at least 30%, 50%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to any one of It is produced by expressing wzz family proteins with In one embodiment, the wzz family proteins are SEQ ID NO:112, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, and SEQ ID NO: 121. Preferably, the wzz family protein has at least 30%, 50%, 70%, 75%, 80%, 85%, have 90%, 95%, 98%, 99% or 100% sequence identity. In some embodiments, the sugar is at least 30%, 50%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequenced with respect to the fepE protein. Produced by expressing proteins with identical amino acid sequences.

In one aspect, the present invention provides for expressing a wzz family protein, preferably fepE, in a Gram-negative bacterium to produce at least 1, 2, 3, 4, or 5 polysaccharides compared to the corresponding wild-type O polysaccharide. It relates to sugars produced by producing high molecular weight sugars containing intermediate or long O-antigen chains with an increase in repeating units. In one aspect, the invention provides intermediate or long O antigens from Gram-negative bacteria that have an increase in at least 1, 2, 3, 4, or 5 repeat units compared to the corresponding wild-type O antigen. It relates to sugars produced by Gram-negative bacteria that express (but do not necessarily overexpress) wzz family proteins (e.g., wzzB) in culture so as to produce high molecular weight sugars containing antigenic chains. For additional exemplary saccharides with increased numbers of repeating units compared to the corresponding wild-type saccharides, see the description of O polysaccharides and O antigens below. The desired chain length is the one that provides improved or maximal immunogenicity in the context of a given vaccine construct.

In another embodiment, the saccharide comprises any one formula selected from Table A, and the number n of repeating units in the saccharide is greater than the number of repeating units in the corresponding wild type O polysaccharide by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more repeat units There are many. Preferably, the sugar is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, Includes an increase of 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 repeat units. Methods for determining sugar length are known in the art. Such methods include nuclear magnetic resonance, mass spectrometry, and size exclusion chromatography.

In a preferred embodiment, the present invention provides a recombinant Escherichia coli (E. coli) derived from a Gram-negative bacterium (e.g. 2) a recombinant E. coli host that produces high molecular weight sugars, such as lipopolysaccharides, that are replaced with the wzz gene (e.g., Salmonella fepE) and contain intermediate or long O-antigen chains. Concerning sugars produced in cells. In some embodiments, the recombinant E. coli host cell comprises a wzz gene from Salmonella, preferably Salmonella enterica.

In one embodiment, the host cell contains a heterologous gene for a wzz family protein as a stably maintained plasmid vector. In another embodiment, the host cell comprises a heterologous gene for a wzz family protein as an integrated gene in the chromosomal DNA of the host cell. Methods for stably expressing plasmid vectors in E. coli host cells and for integrating heterologous genes into the chromosome of E. coli host cells are known in the art. In one embodiment, the host cell contains the heterologous gene for the O antigen as a stably maintained plasmid vector. In another embodiment, the host cell contains a heterologous gene for O antigen as an integrated gene in the chromosomal DNA of the host cell. Methods for stably expressing plasmid vectors in E. coli and Salmonella host cells are known in the art. Methods for incorporating heterologous genes into the chromosomes of E. coli and Salmonella host cells are known in the art.

In one aspect, recombinant host cells are cultured in a medium containing a carbon source. Carbon sources for culturing E. coli are known in the art. Exemplary carbon sources include, but are not limited to, arabinose, cellobiose, fructose, glucose, glycerol, inositol, lactose, maltose, mannitol, mannose, rhamnose, raffinose, sorbitol, sorbose, sucrose, trehalose, pyruvate, Included are sugar alcohols, polyols, aldol sugars or keto sugars, such as succinate and methylamine. In a preferred embodiment, the medium includes glucose. In some embodiments, the medium includes a polyol or aldol sugar, such as mannitol, inositol, sorbose, glycerol, sorbitol, lactose, and arabinose, as a carbon source. All carbon sources may be added to the medium before starting the culture, or may be added in portions or continuously during the culture.

Exemplary culture media for recombinant host cells include _KH2PO4 , _K2HPO4 , ( _NH4 ) _{2SO4 ,} sodium citrate _{, Na2SO4 ,} aspartic acid, glucose, _MgSO4 , FeSO4 _{. 4-7H2O , Na2MoO4-2H2O , H3BO3 , CoCl2-6H2O , CuCl2-2H2O , MnCl2-4H2O , ZnCl2 and CaCl2-2H2O _} Contains an element selected from any one of the following. Preferably, the medium contains KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O, Na 2 MoO ₄ -2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O.

The media used herein may be solid or liquid, synthetic (ie, artificial) or natural, and may contain sufficient nutrients for the culture of recombinant host cells. Preferably, the medium is a liquid medium.

In some embodiments, the medium may further include a suitable inorganic salt. In some embodiments, the medium may further include micronutrients. In some embodiments, the medium may further include growth factors. In some embodiments, the medium may further include an additional carbon source. In some embodiments, the medium may further include suitable inorganic salts, micronutrients, growth factors, and additional carbon sources. Inorganic salts, micronutrients, growth factors, and supplemental carbon sources suitable for culturing E. coli are known in the art.

In some embodiments, the medium optionally contains additional ingredients such as peptone, NZ amine, soybean enzyme hydrolysate, additional yeast extract, malt extract, supplemental carbon sources and various vitamins. May include. In some embodiments, the medium optionally contains such additives as peptone, NZ amine, soybean enzyme hydrolysate, additional yeast extract, malt extract, supplemental carbon sources and various vitamins. Contains no further ingredients.

Examples of suitable supplementary carbon sources include, but are not limited to, glucose, fructose, mannitol, starch or starch hydrolysates, cellulose hydrolysates, and other carbohydrates such as molasses; acetic acid, propionic acid, lactic acid, Organic acids such as formic acid, malic acid, citric acid, and fumaric acid; and alcohols such as glycerol, inositol, mannitol and sorbitol.

In some embodiments, the medium further comprises a nitrogen source. Suitable nitrogen sources for culturing E. coli are known in the art. Examples of suitable nitrogen sources include, but are not limited to, ammonia, including ammonia gas and aqueous ammonia; ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium nitrate, ammonium phosphate, ammonium sulfate, and ammonium acetate; urea; ; nitric acid or nitrite, and amino acids as pure or unpurified preparations, meat extracts, peptones, fishmeal, fish hydrolysates, corn infusions, casein hydrolysates, soybean meal hydrolysates, yeast extracts; , dry yeast, ethanol-yeast distillate, soybean flour, cottonseed flour, and the like.

In some embodiments, the medium includes inorganic salts. Examples of suitable inorganic salts include, but are not limited to, salts of potassium, calcium, sodium, magnesium, manganese, iron, cobalt, zinc, copper, molybdenum, tungsten and other trace elements, and phosphoric acid. Can be mentioned.

In some embodiments, the medium includes suitable growth factors. Examples of suitable micronutrients, growth factors, etc. include, but are not limited to, coenzyme A, pantothenic acid, as pure or partially purified compounds, or as present in natural materials. , pyridoxine-HCl, biotin, thiamine, riboflavin, flavin mononucleotide, flavin adenine dinucleotide, DL-6,8-thioctic acid, folic acid, vitamin B ₁₂ , other vitamins, amino acids such as cysteine and hydroxyproline, adenine, uracil , guanine, thymine and cytosine, sodium thiosulfate, p- or r-aminobenzoic acid, niacinamide, nitriloacetate, and the like. Those skilled in the art can determine the amount empirically according to methods and techniques known in the art.

In another embodiment, the modified sugars described herein (as compared to the corresponding wild-type sugars) are produced synthetically, eg, in vitro. Synthetic production or synthesis of sugars may facilitate the avoidance of costly and time-intensive production processes. In one embodiment, the sugar is synthesized, such as by using a sequential glycosylation strategy or a combination of a sequential glycosylation strategy and a [3+2] block synthesis strategy from suitably protected monosaccharide intermediates. Ru. For example, thiol glycosides and glycosyltrichloroacetimidate derivatives can be used as glycosyl donors in glycosylation. In one embodiment, the sugars synthesized in vitro have the same structure as sugars produced by recombinant means, such as engineering the wzz family proteins described above.

The sugars produced (by recombinant or synthetic means) can be produced, for example, by the following E. coli serotypes: O1 (e.g. O1A, O1B, and O1C), O2, O3, O4 (e.g. O4:K52). and O4:K6), O5 (e.g. O5ab and O5ac (strain 180/C3)), O6 (e.g. O6:K2;K13;K15 and O6:K54), O7, O8, O9, O10, O11, O12, O13, O14, O15, O16, O17, O18 (e.g., O18A, O18ac, O18A1, O18B, and O18B1), O19, O20, O21, O22, O23 (e.g., O23A), O24, O25 (e.g., O25a and O25b) ), O26, O27, O28, O29, O30, O32, O33, O34, O35, O36, O37, O38, O39, O40, O41, O42, O43, O44, O45 (e.g. O45 and O45rel), O46, O48 , O49, O50, O51, O52, O53, O54, O55, O56, O57, O58, O59, O60, O61, O62, 62D ₁ , O63, O64, O65, O66, O68, O69, O70, O71, O73 ( For example, O73 (73-1 stock)), O74, O75, O76, O77, O78, O79, O80, O81, O82, O83, O84, O85, O86, O87, O88, O89, O90, O91, O92, O93 , O95, O96, O97, O98, O99, O100, O101, O102, O103, O104, O105, O106, O107, O108, O109, O110, 0111, O112, O113, O114, O115, O116, O117, O118, O119 , O120, O121, O123, O124, O125, O126, O127, O128, O129, O130, O131, O132, O133, O134, O135, O136, O137, O138, O139, O140, O141, O142, O143, O144, O1 45 , O146, O147, O148, O149, O150, O151, O152, O153, O154, O155, O156, O157, O158, O159, O160, O161, O162, O163, O164, O165, O166, O167, O168, O169, O1 70 , O171, O172, O173, O174, O175, O176, O177, O178, O179, O180, O181, O182, O183, O184, O185, O186, and any E. ．． coli) serotypes.

Individual polysaccharides are typically processed by, for example, dialysis, concentration operations, diafiltration operations, tangential flow filtration, precipitation, elution, centrifugation, sedimentation, ultrafiltration, depth filtration, and/or column chromatography (ion exchange). It is purified (enriched with respect to the amount of polysaccharide-protein conjugate) by methods known in the art, such as chromatography, multimode ion exchange chromatography, DEAE, and hydrophobic interaction chromatography). Preferably, the polysaccharide is purified by a method involving tangential flow filtration.

The purified polysaccharides are activated (e.g., chemically activated) so that they can react (e.g., directly with a carrier protein or via a linker such as an eTEC spacer), and then can be incorporated into the saccharide conjugates of the invention, as further described herein.

In one preferred embodiment, the saccharide of the invention is derived from E. coli serotype, serotype O25a. In another preferred embodiment, the serotype is O25b. In another preferred embodiment, the serotype is O1A. In another preferred embodiment, the serotype is O2. In another preferred embodiment, the serotype is O6. In another preferred embodiment, the serotype is O17. In another preferred embodiment, the serotype is O15. In another preferred embodiment, the serotype is O18A. In another preferred embodiment, the serotype is O75. In another preferred embodiment, the serotype is O4. In another preferred embodiment, the serotype is O16. In another preferred embodiment, the serotype is O13. In another preferred embodiment, the serotype is O7. In another preferred embodiment, the serotype is O8. In another preferred embodiment, the serotype is O9.

As used herein, reference to any of the above serotypes refers to repeating unit structures (O units as described below) that are known in the art and are unique to the corresponding serotype. Refers to serotypes that include. For example, the term "O25a" serotype (also known in the art as serotype "O25") refers to serotypes encompassing the formula O25 shown in Table A. As another example, the term "O25b" serotype refers to serotypes encompassing the formula O25b shown in Table A.

As used herein, serotypes, unless otherwise specified, refer generally to, for example, the term formula "O18" to include formula O18A, formula O18ac, formula 18A1, formula O18B, and formula O18B1. , as generally referred to herein.

As used herein, the term "O1" refers to a formula name as set forth in Table A, such as any one of Formula O1A, Formula O1A1, Formula O1B, and Formula O1C as set forth in Table A, respectively. generally refers to the inclusion of species of formulas containing the generic term "O1". Accordingly, "O1 serotype" generally refers to serotypes encompassing any one of formula O1A, formula O1A1, formula O1B, and formula O1C.

As used herein, the term "O6" refers to the formulas set forth in Table A, such as any one of the formulas O6:K2; K13; K15; and O6:K54 shown in Table A, respectively. Generally refers to species of formulas containing the generic term "O6" in the name. Thus, "O6 serotype" generally refers to a serotype encompassing any one of the formulas O6:K2; K13; K15; and O6:K54.

Other examples of terms that generally refer to species of formulas that include generic names in the formula names listed in Table A include "O4," "O5," "O18," and "O45."

As used herein, the term "O2" refers to the formula O2 shown in Table A. The term "O2 O antigen" refers to a sugar encompassing the formula O2 shown in Table A.

As used herein, references to O antigens derived from the above serotypes refer to sugars encompassing the formula labeled with the corresponding serotype name. For example, the term "O25B O antigen" refers to a sugar encompassing the formula O25B shown in Table A.

As another example, the term "O1 O antigen" generally refers to sugars encompassing formulas containing the term "O1", such as formula O1A, formula O1A1, formula O1B, and formula O1C, respectively, shown in Table A. .

As another example, the term "O6 O antigen" encompasses formulas containing the term "O6", such as formula O6:K2; formula O6:K13; formula O6:K15 and formula O6:K54, respectively, shown in Table A. It generally refers to the sugar that

As used herein, the term "O polysaccharide" refers to any structure that contains the O antigen, provided that the structure does not contain whole cells or lipid A. For example, in one embodiment, the O polysaccharide comprises lipopolysaccharide without lipid A attached. Steps for removing Lipid A are known in the art and include, by way of example, heat treatment with addition of acid. An exemplary process includes treatment with 1% acetic acid for 90 minutes at 100°C. This process is combined with a process to isolate the lipid A that is removed. An exemplary process for isolating lipid A includes ultracentrifugation.

In one embodiment, O-polysaccharide refers to a structure consisting of O-antigen, in which case O-polysaccharide is synonymous with the term O-antigen. In one preferred embodiment, O polysaccharide refers to a structure comprising repeating units of O antigen without a core sugar. Thus, in one embodiment, the O polysaccharide does not include an E. coli R1 core portion. In another embodiment, the O polysaccharide does not include an E. coli R2 core portion. In another embodiment, the O polysaccharide does not include an E. coli R3 core portion. In another embodiment, the O polysaccharide does not include an E. coli R4 core portion. In another embodiment, the O polysaccharide does not include an E. coli K12 core portion. In another preferred embodiment, O polysaccharide refers to a structure that includes an O antigen and a core sugar. In another embodiment, O polysaccharide refers to a structure that includes an O antigen, a core sugar, and a KDO moiety.

Methods for purifying O polysaccharides, including core oligosaccharides, from LPS are known in the art. For example, after purification of LPS, the purified LPS is hydrolyzed by heating in 1% (v/v) acetic acid for 90 minutes at 100°C, followed by ultracentrifugation at 142,000xg for 5 hours at 4°C. Can be separated. The supernatant containing O polysaccharide is lyophilized and stored at 4°C. In certain embodiments, deletion of capsule synthesis genes is described to allow simple purification of O-polysaccharide.

O polysaccharide can be isolated by methods including, but not limited to, weak acid hydrolysis to remove lipid A from LPS. Other embodiments may include the use of hydrazine as the agent for O-polysaccharide preparation. Preparation of LPS can be accomplished by methods known in the art.

In certain embodiments, O polysaccharides purified from wild-type, modified, or attenuated Gram-negative bacterial strains that express (but not necessarily overexpress) Wzz proteins (e.g., wzzB) are used in conjugate vaccines. Provided for use in. In a preferred embodiment, the O-polysaccharide chain is purified from a Gram-negative bacterial strain that expresses (but does not necessarily overexpress) the wzz protein for use as a vaccine antigen as a conjugate or conjugate vaccine.

In one embodiment, the O polysaccharide is about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold compared to the corresponding wild-type O polysaccharide. , 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 21x, 22x, 23x, 24x, 25x, 26x, 27x times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, 38 times, 39 times, 40 times, 41 times, 42 times, 43 times, 44x, 45x, 46x, 47x, 48x, 49x, 50x, 51x, 52x, 53x, 54x, 55x, 56x, 57x, 58x, 59x, 60x , 61x, 62x, 63x, 64x, 65x, 66x, 67x, 68x, 69x, 70x, 71x, 72x, 73x, 74x, 75x, 76x, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 times, It has a molecular weight increased by 94 times, 95 times, 96 times, 97 times, 98 times, 99 times, 100 times or more. In preferred embodiments, the O-polysaccharide has a molecular weight that is increased by at least 1-fold and at most 5-fold compared to the corresponding wild-type O-polysaccharide. In another embodiment, the O-polysaccharide has a molecular weight that is increased by at least 2-fold and at most 4-fold compared to the corresponding wild-type O-polysaccharide. An increase in the molecular weight of the O-polysaccharide compared to the corresponding wild-type O-polysaccharide is preferably associated with an increase in the number of O-antigen repeat units. In one embodiment, the increase in molecular weight of the O polysaccharide is due to wzz family proteins.

In one embodiment, the O polysaccharide is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 as compared to the corresponding wild type O polysaccharide. , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 , 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99, with an increased molecular weight of 100 kDa or more. In one embodiment, the O-polysaccharide of the invention has an increased molecular weight of at least 1 kDa and at most 200 kDa compared to the corresponding wild-type O-polysaccharide. In one embodiment, the molecular weight has increased by at least 5 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 12 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 15 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 18 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 21 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 22 kDa and at most 200 kDa. In one embodiment, the molecular weight is increased by at least 30 kDa and at most 200 kDa. In one embodiment, the molecular weight has increased by at least 1 kDa and at most 100 kDa. In one embodiment, the molecular weight is increased by at least 5 kDa and at most 100 kDa. In one embodiment, the molecular weight has increased by at least 10 kDa and at most 100 kDa. In one embodiment, the molecular weight is increased by at least 12 kDa and at most 100 kDa. In one embodiment, the molecular weight is increased by at least 15 kDa and at most 100 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 100 kDa. In one embodiment, the molecular weight is increased by at least 1 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 5 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 12 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 15 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 18 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 30 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 90 kDa. In one embodiment, the molecular weight is increased by at least 12 kDa and at most 85 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 75 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 70 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 60 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 50 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 49 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 48 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 47 kDa. In one embodiment, the molecular weight is increased by at least 10 kDa and at most 46 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 45 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 44 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 43 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 42 kDa. In one embodiment, the molecular weight is increased by at least 20 kDa and at most 41 kDa. Such an increase in the molecular weight of the O-polysaccharide compared to the corresponding wild-type O-polysaccharide is preferably associated with an increase in the number of O-antigen repeat units. In one embodiment, the increase in molecular weight of the O polysaccharide is due to wzz family proteins.

In another embodiment, the O-polysaccharide comprises any one formula selected from Table A, and the number n of repeating units in the O-polysaccharide is greater than the number of repeating units in the corresponding wild-type O-polysaccharide by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more Many repeat units. Preferably, the sugar is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, Includes an increase of 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 repeat units.

2. O-antigen O-antigen is part of lipopolysaccharide (LPS) in the outer membrane of Gram-negative bacteria. O-antigen is located on the cell surface and is a variable cellular component. O-antigen variability provides the basis for serotyping Gram-negative bacteria. The current E. coli serotyping scheme includes O polysaccharides 1-181.

O-antigens contain oligosaccharide repeat units (O-units), the wild-type structure of which usually contains 2-8 residues derived from a wide range of sugars. Exemplary E. coli O-antigen O units are provided in Table A and in PCT International Publication No. WO2021/084429, published May 6, 2021, which is incorporated herein by reference in its entirety. Are listed. In some embodiments, the present disclosure provides at least one FimH variant polypeptide and the PCT International Publication No. and at least one of the O antigens described in number WO2021/084429.

In one embodiment, the saccharide of the invention may be one oligosaccharide unit. In one embodiment, the saccharide of the invention is a repeating oligosaccharide unit of one of the related serotypes. In such embodiments, the sugar is any one of Formula O1a, Formula O2, Formula O6, Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O25b, Formula O52, Formula O97, and Formula O101. can include structures selected from. In further embodiments, the sugar can include a structure selected from any one of formula O1a, formula O2, formula O6, and formula O25b.

In one embodiment, the saccharide of the invention may be an oligosaccharide. Oligosaccharides have a small number of repeating units (typically 5-15 repeating units) and are typically derived synthetically or by hydrolysis of polysaccharides. In such embodiments, the sugar is any one of Formula O1a, Formula O2, Formula O6, Formula O8, Formula O9a, Formula O9, Formula O20ab, Formula O20ac, Formula O25b, Formula O52, Formula O97, and Formula O101. can include structures selected from. In further embodiments, the sugar can include a structure selected from any one of formula O1a, formula O2, formula O6, and formula O25b.

Preferably, all sugars of the invention and in the immunogenic compositions of the invention are polysaccharides. High molecular weight polysaccharides are capable of inducing certain antibody immune responses due to the epitopes present on their antigenic surfaces. Isolation and purification of high molecular weight polysaccharides is preferably contemplated for use in the conjugates, compositions and methods of the invention.

In some embodiments, the number of repeating O units (and thus the length and molecular weight of the polymer chain) in each individual O-antigen polymer depends on the wzz chain length regulator, an inner membrane protein. Different wzz proteins yield different ranges of mode lengths (from 4 to over 100 repeat units). The term "modal length" refers to the number of repeating O units. Gram-negative bacteria often have two different Wzz proteins, one long and one short, resulting in two different OAg mode chain lengths. Expression (but not necessarily overexpression) of wzz family proteins (e.g., wzzB) in Gram-negative bacteria shifts or biases bacterial production of O antigens in a certain length range and results in high yields. It may allow manipulation of O-antigen length to enhance production of high molecular weight lipopolysaccharides. In one embodiment, "short" mode length as used herein refers to a small number, eg, 1-20 repeating O units. In one embodiment, "long" mode length as used herein refers to a number of repeating O units greater than 20 up to 40. In one embodiment, "very long" mode length as used herein refers to greater than 40 repeating O units.

In one embodiment, the saccharide produced is at least 10 repeat units, 15 repeat units, 20 repeat units, 25 repeat units, 30 repeat units, 35 repeat units, 40 repeat units as compared to the corresponding wild type O polysaccharide. , 45 repeats, 50 repeats, 55 repeats, 60 repeats, 65 repeats, 70 repeats, 75 repeats, 80 repeats, 85 repeats, 90 repeats, 95 repeats, or 100 repeats. have an increase.

In another embodiment, the saccharides of the invention have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 , 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 , 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, with an increase of 100 or more repeat units. Preferably, the sugar is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, Includes an increase of 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 repeat units. See, for example, Table 21. Methods for determining sugar length are known in the art. Such methods include nuclear magnetic resonance, mass spectrometry, and size exclusion chromatography, as described in Example 13.

Methods for determining the number of repeat units in a sugar are also known in the art. For example, the molecular weight of a polysaccharide (not including the molecular weight of the core sugar or KDO residue) can be calculated theoretically as the molecular weight of the repeating unit (i.e., the sum of the molecular weights of each monosaccharide in the formula, e.g. The number of repeating units (or "n" in the formula) can be calculated by dividing by the molecular weight of the structure in the corresponding formula shown in Table 1. The molecular weight of each monosaccharide within the formula is known in the art. For example, the molecular weight of the repeating unit of formula O25b is approximately 862 Da. For example, the molecular weight of the repeating unit of formula O1a is approximately 845 Da. For example, the molecular weight of the repeating unit of formula O2 is approximately 829 Da. For example, the molecular weight of the repeating unit of formula O6 is approximately 893 Da. When determining the number of repeat units in the conjugate, take into account the molecular weight of the carrier protein and the protein:polysaccharide ratio. As defined herein, "n" refers to the number of repeat units in the polysaccharide molecule (shown in parentheses in Table 1). As is known in the art, in biopolymers, repetitive structures may incorporate regions of imperfect repeat, such as, for example, missing branches. Additionally, it is known in the art that polysaccharides isolated and purified from natural sources such as bacteria can be heterogeneous in size and branching. In such cases, n may represent the mean or median value for n of the molecules in the population.

In one embodiment, the O polysaccharide has an increase in at least one repeat unit of O antigen compared to the corresponding wild type O polysaccharide. The repeating unit of O antigen is shown in Table 1. In one embodiment, the O polysaccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 100 or more total repeat units. Preferably, the sugar has a total of at least 3 and at most 80 repeating units. In another embodiment, the O polysaccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 as compared to the corresponding wild type O polysaccharide. , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 , 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99, with an increase of 100 or more repeat units.

In one embodiment, the sugar is such that n in any of the O antigen formulas (such as the formulas shown in Table 1 (see also Figures 9A-9C and Figures 10A-10B)) is at least 1, 2, 3 , 4, 5, 10, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and At most 200, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, or an integer of 50. Any minimum value and any maximum value can be combined to define a range. Exemplary ranges include, for example, at least 1 to at most 1000; at least 10 to at most 500; and at least 20 to at most 80, preferably at most 90. In one preferred embodiment, n is at least 31 and at most 90. In preferred embodiments, n is 40-90, more preferably 60-85.

In one embodiment, the saccharide comprises an O-antigen, where n in any one of the O-antigen formulas is at least 1 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 5 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 10 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 25 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 50 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 75 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 100 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 125 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 150 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 175 and at most 200. In one embodiment, n in any one of the O-antigen formulas is at least 1 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 5 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 10 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 25 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 50 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 75 and at most 100. In one embodiment, n in any one of the O-antigen formulas is at least 1 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 5 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 10 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 20 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 25 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 30 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 40 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 50 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 30 and at most 90. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 85. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 75. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 70. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 60. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 50. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 49. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 48. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 47. In one embodiment, n in any one of the O-antigen formulas is at least 35 and at most 46. In one embodiment, n in any one of the O-antigen formulas is at least 36 and at most 45. In one embodiment, n in any one of the O-antigen formulas is at least 37 and at most 44. In one embodiment, n in any one of the O-antigen formulas is at least 38 and at most 43. In one embodiment, n in any one of the O-antigen formulas is at least 39 and at most 42. In one embodiment, n in any one of the O-antigen formulas is at least 39 and at most 41.

For example, in one embodiment, n in the sugar is 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90, most preferably 40. In another embodiment, n is at least 35 and at most 60. For example, in one embodiment, n is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60, preferably 50. In another preferred embodiment, n is at least 55 and at most 75. For example, in one embodiment, n is 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, or 69, most preferably 60.

Sugar structures can be determined by methods and means known in the art, such as, for example, NMR including 1D, 1H, and/or 13C, 2D TOCSY, DQF-COSY, NOESY, and/or HMQC.

In some embodiments, the purified polysaccharide prior to conjugation has a molecular weight of 5 kDa to 400 kDa. In other such embodiments, the sugar is 10 kDa to 400 kDa; 5 kDa to 400 kDa; 5 kDa to 300 kDa; 5 kDa to 200 kDa; kDa～ 100kDa; 10kDa-200kDa; 15kDa-150kDa; 12kDa-120kDa; 12kDa-75kDa; 12kDa-50kDa; 12-60kDa; 35kDa-75kDa; 40kDa-60kDa; 35kDa-60kDa; kDa; 12kDa to 20kDa; or 20kDa to 50kDa It has a molecular weight of In further embodiments, the polysaccharide is 7 kDa to 15 kDa; 8 kDa to 16 kDa; 9 kDa to 25 kDa; 10 kDa to 100 kDa; 10 kDa to 60 kDa; a ~ 600kDa; 20kDa ~ It has a molecular weight of 400kDa; 30kDa to 1,000kDa; 30kDa to 60kDa; 30kDa to 50kDa or 5kDa to 60kDa. Any full integer within any of the above ranges is contemplated as an embodiment of this disclosure.

As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate is calculated by size exclusion chromatography (SEC) in conjunction with a multi-angle laser light scattering detector (MALLS). Refers to molecular weight.

The polysaccharide may become slightly reduced in size during normal purification procedures. Additionally, the polysaccharide can be subjected to sizing techniques prior to conjugation, as described herein. Mechanical or chemical sizing can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high pressure homogenization shear. The above molecular weight ranges refer to purified polysaccharides prior to conjugation (eg, prior to activation).

3. Core Oligosaccharide The core oligosaccharide is located between lipid A and the O-antigen outer region in wild-type E. coli LPS. More specifically, the core oligosaccharide is the portion of the polysaccharide that includes the linkage between the O antigen and lipid A in wild type E. coli. This bond involves a ketosidic bond between the hemiketal function of the deepest 3-deoxy-d-manno-octa-2-urosonic acid (KDO) residue and the hydroxyl group of the GlcNAc residue of lipid A. The core oligosaccharide region shows high similarity between wild-type E. coli strains. It usually contains a limited number of sugars. The core oligosaccharide includes an inner core region and an outer core region.

More specifically, the inner core is primarily composed of L-glycero-D-manno-heptose (heptose) and KDO residues. The inner core is highly conserved. The KDO residue has the following formula KDO:

を含む。

including.

The outer region of the core oligosaccharide shows greater variation than the inner core region, and differences in this region distinguish five chemotypes in E. coli: R1, R2, R3, R4, and K-12. The generalized structures of the carbohydrate backbones of the outer core oligosaccharides of the five known chemotypes are well known in the art. HepII is the last residue of the inner core oligosaccharide. The outer core oligosaccharides all share a structural theme with a (hexose) _three- carbohydrate backbone and two side chain residues, but the order of the hexoses in the backbone and the nature, position, and bonding of the side chain residues all vary. obtain. The structures of the R1 and R4 outer core oligosaccharides are very similar, differing only in a single β-linked residue.

The core oligosaccharide of wild-type E. coli is classified into five different chemotypes in the art, based on the structure of the distal oligosaccharide: E. coli R1, E. coli R2, E. coli) R3, E. coli R4, and E. coli K12.

In preferred embodiments, the compositions described herein include a saccharide conjugate in which the O polysaccharide comprises a core oligosaccharide linked to an O antigen. In one embodiment, the composition comprises core E. coli chemotypes: E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. coli K12. In another embodiment, the composition induces an immune response against at least two core E. coli chemotypes. In another embodiment, the composition induces an immune response against at least three core E. coli chemotypes. In another embodiment, the composition induces an immune response against at least four core E. coli chemotypes. In another embodiment, the composition induces an immune response against all five core E. coli chemotypes.

In another preferred embodiment, a composition described herein comprises a saccharide conjugate in which the O polysaccharide does not include a core oligosaccharide attached to an O antigen. In one embodiment, such compositions contain core E. coli chemotypes: E. coli R1, E. coli R1, E. coli R1, E. coli R1, E. coli The method induces an immune response against at least one of E. coli R2, E. coli R3, E. coli R4, and E. coli K12.

E. coli serotypes can be characterized according to one of five chemotypes. Table B lists exemplary serotypes characterized according to chemotype. Serotypes in bold represent the serotypes most commonly associated with the indicated core chemotype. Accordingly, in a preferred embodiment, the composition comprises an immune response against any one of the respective corresponding E. coli serotypes: core E. coli chemotype: E. coli R1. , E. coli R2, E. coli R3, E. coli R4, and E. coli K12.

In some embodiments, the composition includes, for example, Formula O25a, Formula O6, Formula O2, Formula O1, Formula O75, Formula O4, Formula O16, Formula O8, Formula O18, Formula O9, Formula O13, Formula O20, Formula 021, O91, and O163, where n is from 1 to 100, comprising a structure derived from a serotype having the R1 chemotype. In some embodiments, the saccharide in the composition further comprises an E. coli R1 core moiety.

In some embodiments, the compositions include, for example, Formula O25a, Formula O6, Formula O2, Formula O1, Formula O75, Formula O4, Formula O16, Formula O18, Formula O13, Formula O20, Formula O21, Formula O91, and R1 chemotype selected from sugars having the formula O163, where n is from 1 to 100, preferably from 31 to 100, preferably from 31 to 90, more preferably from 35 to 90, most preferably from 35 to 65. Contains sugars containing structures derived from serotypes with In some embodiments, the saccharide in the composition further comprises an E. coli R1 core moiety within the saccharide.

In some embodiments, compositions include, for example, formulas O21, O44, O11, O89, O162, and O9, where n is 1-100, preferably 31-100, preferably 31 -90, more preferably 35-90, most preferably 35-65), comprising a structure derived from a serotype having the R2 chemotype. In some embodiments, the saccharide in the composition further comprises an E. coli R2 core moiety.

In some embodiments, the compositions include, for example, formula O25b, formula O15, formula O153, formula O21, formula O17, formula O11, formula O159, formula O22, formula O86, and formula O93 (where n is 1 -100, preferably 31-100, preferably 31-90, more preferably 35-90, most preferably 35-65). Contains sugars. In some embodiments, the saccharide in the composition further comprises an E. coli R3 core moiety.

In some embodiments, the compositions include, for example, formula O2, formula O1, formula O86, formula O7, formula O102, formula O160, and formula O166, where n is 1-100, preferably 31-100, preferably from 31 to 90, more preferably from 35 to 90, most preferably from 35 to 65). In some embodiments, the saccharide in the composition further comprises an E. coli R4 core moiety.

In some embodiments, the composition comprises a K-12 chemotype (e.g., a sugar having formula O25b and 35-90, most preferably 35-65). In some embodiments, the saccharide in the composition further comprises an E. coli K-12 core moiety.

In some embodiments, the sugar includes a core sugar. Thus, in one embodiment, the O polysaccharide further comprises an E. coli R1 core portion. In another embodiment, the O polysaccharide further comprises an E. coli R2 core portion. In another embodiment, the O polysaccharide further comprises an E. coli R3 core portion. In another embodiment, the O polysaccharide further comprises an E. coli R4 core portion. In another embodiment, the O polysaccharide further comprises an E. coli K12 core portion.

In some embodiments, the sugar does not include a core sugar. Thus, in one embodiment, the O polysaccharide does not include an E. coli R1 core portion. In another embodiment, the O polysaccharide does not include an E. coli R2 core portion. In another embodiment, the O polysaccharide does not include an E. coli R3 core portion. In another embodiment, the O polysaccharide does not include an E. coli R4 core portion. In another embodiment, the O polysaccharide does not include an E. coli K12 core portion.

4. Conjugated O-antigen Chemical conjugation of O-antigen, or preferably O-polysaccharide, to a protein carrier can improve the immunogenicity of the O-antigen or O-polysaccharide. However, polymer size variability is a practical challenge for production. For commercial use, the size of the saccharide can influence compatibility with various conjugation synthesis strategies, product uniformity, and immunogenicity of the conjugate. Controlling the expression of Wzz family protein chain length regulators by manipulation of the O-antigen synthesis pathway allows for the production of O-antigen chains of desired length in a variety of Gram-negative bacterial strains, including E. coli.

In one embodiment, the purified sugar is chemically activated to produce an activated sugar that can react with a carrier protein. Once activated, each sugar is separately conjugated to a carrier protein to form a conjugate, ie, a sugar conjugate. As used herein, the term "sugar conjugate" refers to a sugar covalently linked to a carrier protein. In one embodiment, the sugar is directly attached to the carrier protein. In another embodiment, the sugar is attached to the carrier protein via a spacer/linker.

Conjugates can be prepared by schemes that link the carrier to the O-antigen at one or more sites along the O-antigen, or by schemes that activate at least one residue of the core oligosaccharide.

In one embodiment, each sugar is conjugated to the same carrier protein.

If the protein carrier is the same for two or more sugars in the composition, the sugars can be conjugated to the same molecule of carrier protein (e.g., a carrier molecule to which two or more different sugars are conjugated). .

In a preferred embodiment, the sugars are each individually conjugated to different molecules of the protein carrier (each molecule of the protein carrier has only one type of sugar conjugated to it). In said embodiments, the sugars are said to be individually conjugated to carrier proteins.

Chemical activation of sugars and subsequent conjugation to carrier proteins can be accomplished by the activation and conjugation methods disclosed herein. After conjugation of the polysaccharide to the carrier protein, the saccharide conjugate is purified (enriched with respect to the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration/diafiltration operations, precipitation/elution, column chromatography, and depth filtration. After the individual saccharide conjugates are purified, they are mixed to formulate the immunogenic compositions of the invention.

a. activation. The invention further provides an activated polysaccharide produced from any of the embodiments described herein, wherein the polysaccharide is activated with a chemical reagent that produces a linker or reactive group for conjugation to a carrier protein. Regarding polysaccharides. In some embodiments, the saccharides of the invention are activated prior to conjugation to a carrier protein. In some embodiments, the degree of activation does not substantially reduce the molecular weight of the polysaccharide. For example, in some embodiments, the degree of activation does not cleave the polysaccharide backbone. In some embodiments, the degree of activation does not significantly affect the degree of conjugation, as measured by the number of modified lysine residues (determined by amino acid analysis) in the carrier protein, such as CRM ₁₉₇ . . For example, in some embodiments, the degree of activation is the number of lysine residues modified in the carrier protein compared to the number of lysine residues modified in the carrier protein of a conjugate with a reference polysaccharide at the same degree of activation. Does not significantly increase the number of lysine residues (as determined by amino acid analysis) by 3-fold. In some embodiments, the degree of activation does not increase the level of unconjugated free sugar. In some embodiments, the degree of activation does not reduce the optimal sugar/protein ratio.

In some embodiments, the activated sugar has a number of moles of thiol per sugar repeat unit of the activated sugar between 1 and 100%, such as between 2 and 80%, between 2 and 50%, between 3 and 50%. 30%, and 4-25%, and so on. The degree of activation is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15% , 16%, 17%, 18%, 19%, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, or about 100% It is. Preferably, the degree of activation is at most 50%, more preferably at most 25%. In one embodiment, the degree of activation is at most 20%. Any minimum value and any maximum value can be combined to define a range.

In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to an amino group on a carrier protein (preferably CRM ₁₉₇ or tetanus toxoid) either directly or via a spacer (linker) group.

For example, the spacer may be a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyryloxy]succinimide ester (GMBS)) or a haloacetylated carrier protein (e.g., using 76yophilized 76e, N-succinimide ester). Dilbromoacetic acid (SBA; SIB), N-succinimidyl (4-iodoacetyl) aminobenzoic acid (SIAB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoic acid (sulfo-SIAB), N-succinimidyl to obtain a thiolated polysaccharide that can be coupled to a carrier by a thioether linkage obtained after reaction with dyliodoacetic acid (SIA) or succinimidyl 3-[bromoacetamido]propionic acid (SBAP)). It may be cystamine or cysteamine. In one embodiment, a cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH) to bind the amino-derivatized sugar to the carboxyl group on the protein carrier. via carbodiimide (eg, EDAC or EDC) chemistry to a carrier protein (eg, CRM ₁₉₇ ).

Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Conjugation may include a carbonyl linker that can be formed by reaction of the free hydroxyl group of the sugar with CDI followed by reaction with a protein to form a carbamate bond. This includes reduction of the anomeric terminus to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and a CDI carbamate intermediate. It may also include coupling with amino groups on proteins (CDI chemistry).

b. Molecular weight. In some embodiments, the saccharide conjugate comprises a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other embodiments, the sugar has a molecular weight of 50 kDa to 1,000 kDa. In other embodiments, the sugar has a molecular weight of 70 kDa to 900 kDa. In other embodiments, the sugar has a molecular weight of 100 kDa to 800 kDa. In other embodiments, the sugar has a molecular weight of 200 kDa to 600 kDa. In further embodiments, the sugar is 100 kDa to 1000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 0kDa to 1,000kDa; 150kDa to 900kDa; 150kDa to 800kDa; 150kDa to 700kDa; 150kDa to 600kDa; 150kDa to 500kDa; 150kDa to 400kDa; 150kDa to 300kDa; 200kDa to 1,000kDa; 0kDa; 200kDa to 700kDa; 200kDa to 600kDa; 200kDa to 500kDa; 200kDa-400kDa; 200kDa-300kDa; 250kDa-1,000kDa; 250kDa-900kDa; 250kDa-800kDa; 250kDa-700kDa; 250kDa-600kDa; 250kDa-500kDa; 250kDa-40 0kDa; 250kDa ~ 350kDa; 300kDa ~ 1,000kDa; 300kDa ~ 900kDa; 300kDa to 800kDa; 300kDa to 700kDa; 300kDa to 600kDa; 300kDa to 500kDa; 300kDa to 400kDa; 400kDa to 1,000kDa; Molecular weight of 0kDa to 700kDa; 400kDa to 600kDa; 500kDa to 600kDa have In one embodiment, a saccharide conjugate having such a molecular weight is produced by single end conjugation. In another embodiment, sugar conjugates having such molecular weights are produced by reductive amination chemistry (RAC) prepared in an aqueous buffer. Any full integer within any of the above ranges is contemplated as an embodiment of this disclosure.

In some embodiments, the saccharide conjugates of the invention are 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; It has a molecular weight of 000 kDa. In other embodiments, the saccharide conjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the saccharide conjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In yet other embodiments, the saccharide conjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa. In further embodiments, the saccharide conjugates of the invention are 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; ~1,000kDa; 500kDa ~ 20,000kDa; 500kDa ~ 15,000kDa; 500kDa ~ 12,500kDa; 500kDa ~ 10,000kDa; 500kDa ~ 7,500kDa; 500kDa ~ 6,000kDa; a; 500kDa ~ 4 ,000kDa; 500kDa to 3,000kDa; 500kDa to 2,000kDa; 500kDa to 1,500kDa; 500kDa to 1,000kDa; 750kDa to 20,000kDa; 750kDa ~ 10,000kDa ;750kDa to 7,500kDa;750kDa to 6,000kDa;750kDa to 5,000kDa;750kDa to 4,000kDa;750kDa to 3,000kDa;750kDa to 2,000kDa;750kDa to 1,500kDa;1,000kDa to 1 5,000kDa ;1,000kDa to 12,500kDa;1,000kDa to 10,000kDa;1,000kDa to 7,500kDa;1,000kDa to 6,000kDa;1,000kDa to 5,000kDa;1,000kDa to 4,000kDa;1 ,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa. In one embodiment, a saccharide conjugate having such a molecular weight is produced by eTEC conjugation as described herein. In another embodiment, a sugar conjugate having such a molecular weight is produced by reductive amination chemistry (RAC). In another embodiment, saccharide conjugates having such molecular weights are produced by reductive amination chemistry (RAC) prepared in DMSO.

In further embodiments, the saccharide conjugates of the invention are 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 2,000 kDa to 10,000 kDa; ;3,000kDa to 20,000kDa;3,000kDa to 15,000kDa;3,000kDa to 12,500kDa;4,000kDa to 10,000kDa;4,000kDa to 7,500kDa;4,000kDa to 6,000kDa; or It has a molecular weight of 5,000 kDa to 7,000 kDa. In one embodiment, a sugar conjugate having such a molecular weight is produced by reductive amination chemistry (RAC). In another embodiment, saccharide conjugates having such molecular weights are produced by reductive amination chemistry (RAC) prepared in DMSO. In another embodiment, a saccharide conjugate having such a molecular weight is produced by eTEC conjugation as described herein.

In further embodiments, the saccharide conjugates of the invention are 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; ,000kDa; 6,000kDa to 15,000kDa; 6,000kDa to 12,500kDa; 6,000kDa to 10,000kDa or 6,000kDa to 7,500kDa.

Molecular weight of sugar conjugates can be determined by SEC-MALLS. Any full integer within any of the above ranges is contemplated as an embodiment of this disclosure. The saccharide conjugates of the invention can also be characterized by the ratio of sugar to carrier protein (weight/weight). In some embodiments, the ratio of polysaccharide to carrier protein (w/w) in the saccharide conjugate is between 0.5 and 3 (e.g., about 0.5, about 0.6, about 0.7, about 0 .8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1 .8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2 .8, about 2.9, or about 3.0). In other embodiments, the sugar to carrier protein ratio (w/w) is between 0.5 and 2.0, between 0.5 and 1.5, between 0.8 and 1.2, between 0.5 and 1.0. , 1.0 to 1.5 or 1.0 to 2.0. In a further embodiment, the sugar to carrier protein ratio (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1. In some such embodiments, the carrier protein is CRM ₁₉₇ .

Sugar conjugates can also be characterized by their molecular size distribution (K _d ). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugate. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugate. Large molecules that are excluded from small pores in the medium elute more quickly than small molecules. Collect the column eluate using a fraction collector. Fractions are tested colorimetrically by sugar assay. For determination of K _d , establish the fraction in which the molecule is completely excluded (V ₀ ), (K _d =0) and the fraction showing maximum retention (V _i ), (K _d =1). calibrate the column. The fraction (V _e ) that reaches a particular sample property is related to K _d by the formula K _d = (V _e −V ₀ )/(V _i −V ₀ ).

c. Free sugar. The saccharide conjugates and immunogenic compositions of the invention may include free sugars that are not covalently conjugated to a carrier protein, but are nevertheless present in the saccharide conjugate composition. The free sugar may be non-covalently associated (ie, non-covalently bound, adsorbed, or entrapped within or with the sugar conjugate). In preferred embodiments, the saccharide conjugate comprises at most 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free polysaccharide compared to the total amount of polysaccharide. In one preferred embodiment, the saccharide conjugate contains less than about 25% free polysaccharide compared to the total amount of polysaccharide. In preferred embodiments, the saccharide conjugate contains at most about 20% free polysaccharide compared to the total amount of polysaccharide. In one preferred embodiment, the saccharide conjugate comprises at most about 15% free polysaccharide compared to the total amount of polysaccharide. In another preferred embodiment, the saccharide conjugate is at most about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, as compared to the total amount of polysaccharides; Contains 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% free polysaccharide. In one preferred embodiment, the saccharide conjugate contains less than about 8% free polysaccharide compared to the total amount of polysaccharide. In one preferred embodiment, the saccharide conjugate comprises at most about 6% free polysaccharide compared to the total amount of polysaccharide. In preferred embodiments, the saccharide conjugate contains at most about 5% free polysaccharide compared to the total amount of polysaccharide.

d. Covalent bond. In other embodiments, the conjugate comprises every 5-10 sugar repeating units; every 2-7 sugar repeating units; every 3-8 sugar repeating units; every 4-9 sugar repeating units; every 7-12 sugar repeat unit; every 8-13 sugar repeat unit; every 9-14 sugar repeat unit; every 10-15 sugar repeat unit; every 2-6 sugar repeat unit; Every 3-7 sugar repeat unit; Every 4-8 sugar repeat unit; Every 6-10 sugar repeat unit; Every 7-11 sugar repeat unit; Every 8-12 sugar repeat unit; 9-13 sugar repeat units For every 10 to 14 sugar repeat units; for every 10 to 20 sugar repeat units; for every 4 to 25 sugar repeat units, or for every 2 to 25 sugar repeat units, at least Contains one covalent bond. In a common embodiment, the carrier protein is CRM ₁₉₇ . In another embodiment, the at least one linkage between the carrier protein and the sugar is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 of the polysaccharide. , 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 sugar repeat units. In one embodiment, the carrier protein is CRM ₁₉₇ . Any full integer within any of the above ranges is contemplated as an embodiment of this disclosure.

e. Lysine residue. Another way to characterize the saccharide conjugates of the invention is to characterize the lysine residue in the carrier protein (e.g. CRM ₁₉₇ ) that becomes conjugated to the saccharide, which can be characterized as the range of conjugated lysines (degree of conjugation). Depends on the number of groups. Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation results in a reduction in the number of lysine residues recovered compared to the carrier protein starting material used to generate the conjugate material. In preferred embodiments, the degree of conjugation of the sugar conjugates of the invention is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3 -13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15 or 10-12. In one embodiment, the degree of conjugation of the sugar conjugates of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14 or about 15. In a preferred embodiment, the degree of conjugation of the sugar conjugates of the invention is between 4 and 7. In some such embodiments, the carrier protein is CRM ₁₉₇ .

The frequency of binding of sugar chains to lysines on carrier proteins is another parameter for characterizing the glycoconjugates of the invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide is present for every 4-saccharide repeat unit of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once per 10-saccharide repeat unit of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once for every 15-saccharide repeat unit of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once for every 25-saccharide repeat unit of the polysaccharide.

f. O-acetylation. In some embodiments, the sugars of the invention are O-acetylated. In some embodiments, the sugar conjugate is 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 75-100%. %, 80-100%, 90-100%, 50-90%, 60-90%, 70-90% or 80-90%. In other embodiments, the degree of O acetylation is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, or It is approximately 100%. % O-acetylation means the percentage of a given sugar relative to 100% (each repeating unit is fully acetylated compared to its acetylated structure).

In some embodiments, sugar conjugates are prepared by reductive amination. In some embodiments, the saccharide conjugate is a single end-linked conjugated saccharide in which the saccharide is covalently linked directly to a carrier protein. In some embodiments, the saccharide conjugate is covalently linked to the carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer.

g. Reductive amination. In one embodiment, the sugar is subjected to reductive amination (US Pat. WO 2008/143709) to a carrier protein.

Reductive amination involves (1) oxidation of the sugar, (2) reduction of the activated sugar and carrier protein to form the conjugate. Prior to oxidation, sugars may be hydrolyzed. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.

The oxidation step may include reaction with periodate. The term "periodate" as used herein refers to both periodate salts and periodic acid. The term also refers to both metaperiodate ( _IO4- ⁾ and orthoperiodate ( _IO65- ) and various salts of periodic acid (e.g. ^, sodium periodate and potassium periodate). Also included. In one embodiment, the polysaccharide is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO ₄ ). In another embodiment, the polysaccharide is oxidized in the presence of orthoperiodate, preferably periodic acid.

In one embodiment, the oxidizing agent is a stable nitroxyl or nitroxide radical compound, such as a piperidine-N-oxy or pyrrolidine-N-oxy compound, in the presence of an oxidizing agent to selectively oxidize primary hydroxyls. . In the reaction, the actual oxidizing agent is the N-oxoammonium salt in the catalytic cycle. In some embodiments, the stable nitroxyl or nitroxide radical compound is a piperidine-N-oxy or pyrrolidine-N-oxy compound. In some embodiments, the stable nitroxyl or nitroxide radical compound is TEMPO (2,2,6,6-tetramethyl-1-piperidinyloxy) or PROXYL (2,2,5,5-tetramethyl-1- pyrrolidinyloxy) moiety. In some embodiments, the stable nitroxyl radical compound is TEMPO or a derivative thereof. In some embodiments, the oxidizing agent is a molecule bearing an N-halo moiety. In some embodiments, the oxidizing agent is N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, dichloroisocyanuric acid, 1,3,5-trichloro-1,3,5-triazinane-2,4,6- trione, dibromoisocyanuric acid, 1,3,5-tribromo-1,3,5-triazinane-2,4,6-trione, diiodoisocyanuric acid and 1,3,5-triiodo-1,3,5-triazinane -2, 4, 6-trion. Preferably, the oxidizing agent is N-chlorosuccinimide.

After the sugar oxidation step, the sugar is said to be activated and is referred to hereinafter as "activated." The activated sugar and carrier protein can be lyophilized (lyophilization-drying) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated sugar and carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and carrier protein are independently lyophilized.

In one embodiment, lyophilization is performed in the presence of non-reducing sugars, which include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

The next step in the conjugation process is the reduction of the activated sugar and carrier protein using a reducing agent to form a conjugate (so-called reductive amination). Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, sodium triacetoxyborohydride or zinc borohydride, pyridineborane, 2-picoline in the presence of Bronsted or Lewis acids. Borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe'PrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridineborane (PEMB), borane-pyridine, or borohydride exchange Examples include amine borane such as resin. In one embodiment, the reducing agent is sodium cyanoborohydride.

In certain embodiments, the reduction reaction is performed in an aqueous solvent (e.g., PBS, MES, HEPES, Bis-Tris, ADA, at pH 6.0-8.5, 7.0-8.0, or 7.0-7.5). In another embodiment, the reaction is carried out in an aprotic solvent. Ru. In certain embodiments, the reduction reaction is performed in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvents can be used to reconstitute the lyophilized activated sugar and carrier protein.

At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped using a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH ₄ ). After conjugation (reduction reaction and optionally capping), the saccharide conjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration/diafiltration operations, tangential flow filtration sedimentation/elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration. Sugar conjugates can be purified by diafiltration and/or ion exchange chromatography and/or size exclusion chromatography. In certain embodiments, the saccharide conjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment, the sugar conjugate is sterile filtered.

In a preferred embodiment, a saccharide conjugate derived from an E. coli serotype selected from any one of O25B, O1a, O2, and O6 is prepared by reductive amination. In a preferred embodiment, saccharide conjugates derived from E. coli serotypes O25B, O1a, O2, and O6 are prepared by reductive amination.

In one aspect, the invention provides a carrier protein, e.g.

［式中、ｎは、１以上の任意の整数である］
によって表される、式Ｏ２５Ｂの糖に連結されているＣＲＭ_１９７を含むコンジュゲートに関する。好ましい実施形態では、ｎは、少なくとも３１、３２、３３、３４、３５、３６、３７、３８、３９、４０、および最大でも２００、１００、９９、９８、９７、９６、９５、９４、９３、９２、９１、９０、８９、８８、８７、８６、８１、８０、７９、７８、７７、７６、７５、７４、７３、７２、７１、７０、６９、６８、６７、６６、６５、６０、５９、５８、５７、５６、５５、５４、５３、５２、５１、または５０の整数である。任意の最小値と任意の最大値とを組み合わせて、範囲を定義することができる。例示的な範囲としては、例えば、少なくとも１～最大でも１０００；少なくとも１０～最大でも５００；および少なくとも２０～最大でも８０が挙げられる。１つの好ましい実施形態では、ｎは少なくとも３１～最大でも９０、より好ましくは４０～９０、最も好ましくは６０～８５である。

[In the formula, n is any integer greater than or equal to 1]
conjugates comprising CRM ₁₉₇ linked to a sugar of formula O25B, represented by In preferred embodiments, n is at least 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and at most 200, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 60, is an integer of 59, 58, 57, 56, 55, 54, 53, 52, 51, or 50. Any minimum value and any maximum value can be combined to define a range. Exemplary ranges include, for example, at least 1 to at most 1000; at least 10 to at most 500; and at least 20 to at most 80. In one preferred embodiment, n is at least 31 and at most 90, more preferably 40-90, most preferably 60-85.

In another aspect, the invention provides a carrier protein conjugated to a sugar having any one of the following structures shown in Table A, where n is an integer greater than or equal to 1. , for example, for conjugates comprising CRM ₁₉₇ .

Without being bound by theory or mechanism, in some embodiments, stable conjugates provide a level of antigen modification that balances preservation of the structural integrity of important immunogenic epitopes of the antigen. considered necessary.

h. Activation and formation of aldehydes. In some embodiments, the sugars of the invention are activated, resulting in the formation of an aldehyde. In such embodiments where the sugar is activated, the percentage (%) activation (or degree of oxidation (DO)) refers to moles of sugar repeat units per mole of aldehyde of the activated polysaccharide. For example, in some embodiments, the sugar is activated by periodate oxidation of adjacent diols on repeating units of the polysaccharide, resulting in the formation of an aldehyde. By varying the molar equivalent (meq) of sodium periodate to sugar repeat unit and the temperature during oxidation, varying levels of degree of oxidation (DO) are obtained.

Sugar and aldehyde concentrations are typically determined by colorimetric assays. An alternative reagent is TEMPO (2,2,6,6-tetramethylpiperidine 1-oxyl radical)-N-chlorosuccinimide (NCS) mixture, which results in the formation of an aldehyde from the primary alcohol group.

In some embodiments, the activated sugar has moles of sugar repeating units per mole of aldehyde of the activated sugar, such as from 2 to 80, from 2 to 50, from 3 to 30, and from 4 to 25 It has an oxidation degree of 1 to 100, such as. The activation degree is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, or 90 or more, or about 100. Preferably, the degree of oxidation (DO) is at least 5 and at most 50, more preferably at least 10 and at most 25. In one embodiment, the degree of activation is at least 10 and at most 25. Any minimum value and any maximum value can be combined to define a range. The value of the degree of oxidation can be expressed as a percentage (%) of activation. For example, in one embodiment, a DO value of 10 refers to 1 activated sugar repeat unit out of a total of 10 sugar repeat units in the activated sugar, in which case a DO value of 10 is This can be expressed as 10% activation.

In some embodiments, the conjugate prepared by reductive amination chemistry comprises a carrier protein and a sugar, wherein the sugar is of formula O1 (e.g., formula O1A, formula O1B, and formula O1C), formula O2 , formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g., formula O6:K2; K13; K15 and formula O6:K54), formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (for example, formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28, formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51, Formula O52, Formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58 , formula O59, formula O60, formula O61, formula O62, formula O62D ₁ , formula O63, formula O64, formula O65, formula O66, formula O68, formula O69, formula O70, formula O71, formula O73 (for example, formula O73 (stock) 73-1)), formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, formula O88 , formula O89, formula O90, formula O91, formula O92, formula O93, formula O95, formula O96, formula O97, formula O98, formula O99, formula O100, formula O101, formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140 , formula O141, formula O142, formula O143, formula O144, formula O145, formula O146, formula O147, formula O148, formula O149, formula O150, formula O151, formula O152, formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, selected from any one of formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, formula O186, and formula O187. Contains structures that In some embodiments, the sugar in the conjugate is an integer from 1 to 1000, from 5 to 1000, preferably from 31 to 100 or from 31 to 90, more preferably from 35 to 90, most preferably from 35 to 65. Contains an expression.

i. Single end-linked conjugate. In some embodiments, the conjugate is a single end-linked conjugated sugar, where the sugar is covalently linked to a carrier protein at one end of the sugar. In some embodiments, a single end-linked conjugated polysaccharide has a terminal sugar. For example, a conjugate is single-end-linked when one end of the polysaccharide (terminal sugar residue) is covalently linked to a carrier protein. In some embodiments, the conjugate is single end-linked, where the terminal sugar residue of the polysaccharide is covalently attached to the carrier protein via a linker. Such linkers include, for example, the cystamine linker (A1), the 3,3'-dithiobis(propanoic acid dihydrazide) linker (A4), and the 2,2'-dithio-N,N'-bis(ethane-2, It may also include a 1-diyl)bis(2-(aminooxy)acetamide) linker (A6).

In some embodiments, the sugar is conjugated to a carrier protein via a 3-deoxy-d-manno-octa-2-urosonic acid (KDO) residue to form a single end-linked conjugate. There is.

In some embodiments, the conjugate is preferably not a bioconjugate. The term "bioconjugate" refers to a conjugate of a protein (e.g., carrier protein) and an antigen, e.g., O antigen (e.g., O25B), prepared in a host cell background, where the host cell A mechanism couples the antigen to the protein (eg, N-linkage). Saccharide conjugates include bioconjugates prepared by means that do not require preparation of the conjugate in host cells, such as conjugation by chemical linkage of proteins and sugars, as well as bioconjugates prepared by conjugation with sugar antigens (e.g., oligosaccharides and polysaccharides)-protein conjugates.

j. Thiol-activated sugar. In some embodiments, the sugars of the invention are thiol activated. In such embodiments where the sugar is thiol activated, the percentage (%) of activation refers to moles of thiol per sugar repeat unit of the activated polysaccharide. Sugar and thiol concentrations are typically determined by Ellman assay for sulfhydryl quantification. For example, in some embodiments, the sugar comprises activation of 2-keto-3-deoxyoctanoic acid (KDO) with a disulfide amine linker. In some embodiments, the sugar is covalently attached to the carrier protein via a divalent heterobifunctional linker (also referred to herein as a "spacer"). The linker preferably provides a thioether linkage between the sugar and the carrier protein, resulting in a sugar conjugate referred to herein as a "thioether sugar conjugate." In some embodiments, the linker further provides a carbamate and amide bond, such as, for example, (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC).

In some embodiments, the single end-linked conjugate comprises a carrier protein and a sugar, where the sugar is of formula O1 (e.g., formula O1A, formula O1B, and formula O1C), formula O2, formula O3, formula O4 ( For example, formula O4:K52 and formula O4:K6), formula O5 (e.g. formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g. formula O6:K2;K13;K15 and formula O6:K54) , formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (for example, formula O18A, formula O18ac, formula O18A1, formula O18B , and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28 , formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 (e.g. , formula O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60, Formula O61, Formula O62, Formula 62D ₁ , Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (for example, Formula O73 (Stock 73-1)), Formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, formula O88, formula O89, formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108 , formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, formula O136, formula O137, formula O138, formula O139, formula O140, formula O141, formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159 , formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, formula O186, and formula O187. In some embodiments, the sugar in the conjugate is an integer from 1 to 1000, from 5 to 1000, preferably from 31 to 100, more preferably from 35 to 90, most preferably from 35 to 65. Contains expressions.

For example, in one embodiment, a single end-linked conjugate is a carrier protein and a carrier protein of formula O8, formula O9a, formula O9, formula O20ab, formula O20ac, formula O52, formula O97, and formula O101, where n is 1 an integer from 10 to 10).

5. eTEC Conjugates In one aspect, the present invention generally relates to (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacers, such as U.S. Pat. saccharide conjugates comprising a saccharide derived from E. coli described above covalently conjugated to a carrier protein via a saccharide (described in International Patent Application Publication WO 2014027302), including such saccharide conjugates. Immunogenic compositions and methods for the preparation and use of such saccharide conjugates and immunogenic compositions. The sugar conjugate is a sugar covalently conjugated to a carrier protein via one or more eTEC spacers, wherein the sugar is covalently conjugated to the eTEC spacer through a carbamate linkage, and the carrier protein is , contains a sugar that is covalently conjugated to the eTEC spacer by an amide bond. The eTEC spacer contains seven linear atoms (i.e., -C(O)NH( _CH2 ) _2SCH2C (O)-), creating _a stable thioether and amide bond between the sugar and the carrier protein. provide.

The eTEC-linked saccharide conjugate of the present invention has the general formula (I):

［式中、ｅＴＥＣスペーサーを構成する原子は、中央のボックス内に含まれる］
によって表され得る。

[where the atoms constituting the eTEC spacer are contained within the central box]
can be represented by

In the sugar conjugate of the present invention, the sugar may be a polysaccharide or an oligosaccharide.

The carrier proteins incorporated into the saccharide conjugates of the invention are selected from the group of carrier proteins generally suitable for such purposes, as further described herein or as known to those skilled in the art. be done. In certain embodiments, the carrier protein is CRM ₁₉₇ .

In another aspect, the invention provides a method of making a sugar conjugate comprising a sugar described herein conjugated to a carrier protein via an eTEC spacer, comprising: a) a sugar and carbonic acid in an organic solvent; b) reacting the activated sugar with cystamine or cysteamine or a salt thereof to produce a thiolated sugar; c) reacting a thiolated sugar with a reducing agent to produce an activated thiolated sugar containing one or more free sulfhydryl residues; d) an activated thiolated sugar; reacting a saccharide with an activated carrier protein containing one or more α-haloacetamide groups to produce a thiolated saccharide-carrier protein conjugate; and e) a thiolated saccharide. - a carrier protein conjugate and (i) a first capping reagent capable of capping unconjugated α-haloacetamide groups of an activated carrier protein; and/or (ii) an activated thiolated α-haloacetamide group; and a second capping reagent capable of capping unconjugated free sulfhydryl residues of a saccharide, whereby an eTEC-linked saccharide conjugate is produced.

In common embodiments, the carbonic acid derivative is 1,1'-carbonyl-di-(1,2,4-triazole) (CDT) or 1,1'-carbonyldiimidazole (CDI). Preferably, the carbonic acid derivative is CDT and the organic solvent is a polar aprotic solvent such as dimethyl sulfoxide (DMSO). In a preferred embodiment, the thiolated sugar is produced by reaction of an activated sugar with a bifunctional symmetric thioalkylamine reagent, cystamine or a salt thereof. Alternatively, thiolated sugars can be formed by reaction of an activated sugar with cysteamine or a salt thereof. The eTEC-linked saccharide conjugate produced by the method of the invention can be represented by general formula (I).

In a common embodiment, the first capping reagent reacts with an unconjugated α-haloacetamide group on a lysine residue of the carrier protein to form an S- that covalently binds to the lysine residue activated by a thioether bond. N-acetyl-L-cysteine, forming the carboxymethylcysteine (CMC) residue.

In other embodiments, the second capping reagent is iodoacetamide (IAA) that reacts with the unconjugated free sulfhydryl group of the activated thiolated sugar to provide a capped thioacetamide. Step e) often includes capping with both a first capping reagent and a second capping reagent. In certain embodiments, step e) comprises capping with N-acetyl-L-cysteine as the first capping reagent and IAA as the second capping reagent.

In some embodiments, capping step e) further comprises reaction with a reducing agent, such as DTT, TCEP, or mercaptoethanol, after reaction with the first and/or second capping reagent.

The eTEC-linked saccharide conjugates and immunogenic compositions of the invention may include free sulfhydryl residues. In some examples, the activated thiolated sugar formed by the methods provided herein contains multiple free sulfhydryl residues, some of which are linked to the carrier protein during the conjugation step. may not undergo covalent conjugation to Such remaining free sulfhydryl residues are capped by reaction with an thiol-reactive capping reagent, such as iodoacetamide (IAA), to cap potentially reactive functional groups. Other thiol-reactive capping reagents are also contemplated, such as maleimide-containing reagents.

Additionally, the eTEC-linked saccharide conjugates and immunogenic compositions of the invention may include residual unconjugated carrier proteins, and may include activated carrier proteins that have been modified during the capping process step. .

In some embodiments, step d) includes an activated thiolated sugar containing one or more α-haloacetamide groups prior to reacting the activated thiolated sugar with the activated carrier protein. The method further includes providing a carrier protein. In common embodiments, the activated carrier protein contains one or more α-bromoacetamide groups.

In another aspect, the invention provides an eTEC-linked saccharide conjugate comprising a saccharide described herein conjugated to a carrier protein via an eTEC spacer produced according to any of the methods disclosed herein. I will provide a.

In some embodiments, the carrier protein is CRM ₁₉₇ and the covalent bond between CRM ₁₉₇ and the polysaccharide through the eTEC spacer is present at least once per 4, 10, 15 or 25 sugar repeat unit of the polysaccharide. .

For each of the aspects of the present invention, particularly certain embodiments of the methods and compositions described herein, the eTEC-linked saccharide conjugate is defined herein as a saccharide derived from E. coli. Contains the sugars listed.

In another aspect, the invention provides a method of preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject, the method comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention. wherein the immunogenic composition comprises an eTEC-linked saccharide conjugate comprising a saccharide as described herein. In some embodiments, the sugar is derived from E. coli.

In some embodiments, the eTEC-linked saccharide conjugate comprises a carrier protein and a formula O1 (e.g., formula O1A, formula O1B, and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and Formula O4:K6), Formula O5 (e.g. Formula O5ab and Formula O5ac (stock 180/C3)), Formula O6 (e.g. Formula O6:K2;K13;K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28, formula O29, formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel) , formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60, formula O61, formula O62, formula O62D ₁ , formula O63, formula O64, formula O65, formula O66, formula O68, formula O69, formula O70, formula O71, formula O73 (for example, formula O73 (stock 73-1)), formula O74, formula O75, formula O76 , formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, formula O88, formula O89, formula O90, formula O91, formula O92, formula O93, formula O95, formula O96, formula O97, formula O98, formula O99, formula O100, formula O101, formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, Formula O111, Formula O112, Formula O113, Formula O114, Formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128 , formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, formula O136, formula O137, formula O138, formula O139, formula O140, formula O141, formula O142, formula O143, formula O144, formula O145, formula O146, formula O147, formula O148, formula O149, formula O150, formula O151, formula O152, formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, Formula O162, Formula O163, Formula O164, Formula O165, Formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178 , Formula O179, Formula O180, Formula O181, Formula O182, Formula O183, Formula O184, Formula O185, Formula O186, and Formula O187. In some embodiments, the sugar in the conjugate has the formula where n is an integer from 1 to 1000, 5 to 1000, preferably 31 to 100, more preferably 35 to 90, most preferably 35 to 65. .

The number of lysine residues in a carrier protein that become conjugated to a sugar can be characterized as the range of lysines that are conjugated. For example, in some embodiments of immunogenic compositions, CRM ₁₉₇ may include 4 to 16 of 39 lysine residues covalently linked to sugars. Another way to express this parameter is that about 10% to about 41% of CRM ₁₉₇ lysines are covalently attached to sugars. In other embodiments, CRM ₁₉₇ may include 2-20 of 39 lysine residues covalently linked to sugars. Another way to express this parameter is that about 5% to about 50% of CRM ₁₉₇ lysines are covalently attached to sugars.

In common embodiments, the carrier protein is CRM ₁₉₇ and the covalent bond between CRM ₁₉₇ and the polysaccharide through the eTEC spacer is present at least once per 4, 10, 15 or 25 sugar repeat unit of the polysaccharide.

In other embodiments, the conjugate comprises every 5-10 sugar repeating units; every 2-7 sugar repeating units; every 3-8 sugar repeating units; every 4-9 sugar repeating units; every 7-12 sugar repeat unit; every 8-13 sugar repeat unit; every 9-14 sugar repeat unit; every 10-15 sugar repeat unit; every 2-6 sugar repeat unit; every 3-7 sugar repeat unit; every 4-8 sugar repeat unit; every 6-10 sugar repeat unit; every 7-11 sugar repeat unit; every 8-12 sugar repeat unit; 9-13 sugar repeat Every unit; every 10-14 sugar repeat unit; every 10-20 sugar repeat unit; or every 4-25 sugar repeat unit contains at least one covalent bond between the carrier protein and the sugar.

In another embodiment, the at least one linkage between the carrier protein and the sugar is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 of the polysaccharide. , 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 sugar repeat units.

6. Carrier Protein A component of the saccharide conjugate of the invention is a carrier protein to which the saccharide is conjugated. The terms "protein carrier" or "carrier protein" or "carrier" can be used interchangeably herein. The carrier protein should be suitable for standard conjugation procedures.

One component of the conjugate is a carrier protein to which the O polysaccharide is conjugated. In one embodiment, the conjugate comprises a carrier protein conjugated to the core oligosaccharide of the O-polysaccharide. In one embodiment, the conjugate comprises a carrier protein conjugated to the O antigen of the O polysaccharide.

The terms "protein carrier" or "carrier protein" or "carrier" can be used interchangeably herein. The carrier protein should be suitable for standard conjugation procedures.

In a preferred embodiment, the carrier protein of the conjugate is TT, DT, DT variant (such as CRM ₁₉₇ ), H. influenzae protein D, PhtX, PhtD, PhtDE fusion (particularly WO 01/98334 and described in WO 03/54007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B, and PsaA. . In certain embodiments, the carrier protein of the conjugates of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the conjugate of the invention is TT (tetanus toxoid). In another embodiment, the carrier protein of the conjugate of the invention is PD (Haemophilus influenzae protein D - see, eg, EP0594610B). In some embodiments, the carrier protein comprises poly(L-lysine) (PLL).

In a preferred embodiment, the sugar is conjugated to the CRM ₁₉₇ protein. CRM ₁₉₇ protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM ₁₉₇ is produced by C. difficile infected by the non-toxigenic phage β197tox ⁻ created by nitrosoguanidine mutagenesis of toxigenic corynephage beta. The CRM ₁₉₇ protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change (guanine to adenine) in the structural gene. This single base change causes an amino acid substitution (glutamic acid to glycine) in the mature protein and eliminates the toxicity of diphtheria toxin. CRM ₁₉₇ protein is a safe and effective T cell-dependent carrier for sugars.

Thus, in some embodiments, conjugates of the invention include CRM ₁₉₇ as a carrier protein, with the sugar covalently attached to CRM ₁₉₇ .

In a preferred embodiment, the carrier protein of the glycoconjugate is DT (diphtheria toxoid), TT (tetanus toxoid) or fragment C of TT, CRM197 (a non-toxic but antigenically identical variant of diphtheria toxoid), Other DT mutants (CRM176, CRM228, CRM45 (Uchida et al., J. Biol. Chem. 218:3838-3844, 1973), CRM9, CRM45, CRM102, CRM103 or CRM107; and Nichols and Youle in Geneti Cally Engineered Toxins, Ed : other mutations described by Frankel, Maecel Dekker Inc. 1992; deletions or mutations of Glu-148 to Asp, Gln or Ser and/or Ala158 to Gly and U.S. Pat. No. 4,709,017 and Other mutations disclosed in U.S. Pat. No. 4,950,740; mutations of at least one or more residues of Lys516, Lys526, Phe530 and/or Lys534 and U.S. Pat. , 455,673; or fragments disclosed in US Pat. No. 5,843,711), ply detoxified in some manner, e.g., dPLY-GMBS (WO04081515, PCT /EP2005/010258) or dPLY-formol, a fusion of PhtX containing PhtA, PhtB, PhtD, PhtE (the sequence of PhtA, PhtB, PhtD or PhtE is disclosed in WO00/37105 or WO00/39299) and a Pht protein. pneumolysin (Kuo et al. (1995) Infect lmmun 63:2706-13), including PhtDE fusions, PhtBE fusions, PhtA-E (WO01/98334, WO03/54007, WO2009/000826), OMPC (usually meningococcal outer membrane protein extracted from N. meningitidis serogroup B - EP0372501), PorB (from N. meningitidis), PD (Haemophilus influenzae) (Haemophilus influenzae) protein D - see e.g. /58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO91/01146), engineered proteins containing multiple human CD4+ T cell epitopes derived from various pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816) -3824), for example, N19 protein (Baraldoi et al. (2004) Infect lmmun 72:4884-7), pneumococcal surface protein PspA (WO02/091998), iron uptake protein (WO01/72337), Clostridium difficile toxin A or B (WO 00/61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (particularly its nontoxic variant (carrying a substitution at glutamic acid 553) exotoxin A, etc. (Uchida Cameron DM, RJ Collier. 1987, J. Bacteriol. 169:4967-4971)). Other proteins such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or purified protein derivative of tuberculin (PPD) can also be used as carrier proteins. Other suitable carrier proteins include cholera toxoid (e.g., as described in international patent application WO 2004/083251), E. coli LT, E. coli ST, and Pseudomonas aeruginosa. ) and inactivated bacterial toxins such as exotoxin A derived from

In some embodiments, the carrier protein is, for example, CRM ₁₉₇ , diphtheria toxoid fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or exotoxin A from Pseudomonas aeruginosa; detoxified exotoxin A (EPA) of P. aeruginosa, maltose binding protein (MBP), flagellin, S. aureus ) detoxified hemolysin A, clumping factor A, clumping factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its detoxified variants, Campylobacter jejuni (C. C. jejuni AcrA, C. jejuni natural glycoprotein, and Streptococcal C5a peptidase (SCP). In one embodiment, the carrier protein is detoxified Pseudomonas exotoxin (EPA). In another embodiment, the carrier protein is not detoxified Pseudomonas exotoxin (EPA). In one embodiment, the carrier protein is flagellin. In another embodiment, the carrier protein is not flagellin.

In a preferred embodiment, the carrier protein of the glycoconjugate is TT, DT, DT variant (such as CRM ₁₉₇ ), H. influenzae protein D, PhtX, PhtD, PhtDE fusion (in particular WO 01/98334). and those described in WO 03/54007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B and PsaA. In certain embodiments, the carrier protein of the glycoconjugates of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is TT (tetanus toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (Haemophilus influenzae protein D - see, eg, EP0594610B).

In a preferred embodiment, the capsular saccharide of the invention is conjugated to CRM ₁₉₇ protein. CRM ₁₉₇ protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM ₁₉₇ is a Corynebacterium phage infected with non-toxigenic phage β197tox- created by nitrosoguanidine mutagenesis of toxigenic Corynephage beta (Uchida, T. et al., 1971, Nature New Biology 233:8-11). Produced by C. diphtheriae. The CRM ₁₉₇ protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change (guanine to adenine) in the structural gene. This single base change causes an amino acid substitution (glutamic acid to glycine) in the mature protein and eliminates the toxicity of diphtheria toxin. CRM ₁₉₇ protein is a safe and effective T cell-dependent carrier for sugars. Further details regarding CRM ₁₉₇ and its production can be found, for example, in US Pat. No. 5,614,382.

Thus, in common embodiments, the saccharide conjugates of the invention include CRM ₁₉₇ as a carrier protein, where the capsular polysaccharide is covalently linked to CRM ₁₉₇ .

In a further embodiment, the carrier protein of the saccharide conjugate is SCP (Streptococcal C5a peptidase). All human isolates of β-hemolytic streptococci produce the highly conserved cell wall protein SCP (Streptococcal C5a peptidase), which specifically inactivates C5a. The scp gene encodes a polypeptide containing 1,134-1,181 amino acids (Brown et al., PNAS, 2005, Vol. 102, No. 51, pp. 18391-18396). The first 31 residues are the export signal pre-sequence and are removed upon passage through the cell membrane. The next 68 residues function as a prosequence and need to be removed to produce active SCP. The next 10 residues can be removed without loss of protease activity. At the other end, starting from Lys-1034, four consecutive 17-residue motifs are followed by cell sorting and cell wall adhesion signals. This combined signal is composed of a 20 residue hydrophilic sequence containing the LPTTND sequence, a 17 residue hydrophobic sequence and a short basic carboxyl terminus.

SCPs can be divided into domains (see FIG. 1B in Brown et al., PNAS, 2005, Vol. 102, No. 51, pp. 18391-18396). Such domains include a pre/pro domain (containing an export signal pre-sequence (generally the first 31 residues) and a pro-sequence (generally the next 68 residues)), a protease domain (including two protease-related domain (protease portion 1 is generally from residues 89 to 333/334 and protease domain portion 2 is generally from residues 467/468 to 583/584); (PA domain) (generally residues 333/334 to 467/468), three fibronectin type III (Fn) domains (Fn1, generally residues 583/584 to 712/713; Fn2, generally generally, Fn3, residues 929/930 to 1029/1030/1031) and the cell wall anchor domain (generally residues 1029/1030/1031 to C-terminus).

In certain embodiments, the carrier protein of the glycoconjugates of the invention is GBS-derived SCP (SCPB). An example of SCPB is provided in SEQ ID NO: 3 of WO97/26008. See also SEQ ID NO: 3 of WO00/34487.

In another embodiment, the carrier protein of the glycoconjugate of the invention is GAS-derived SCP (SCPA). Examples of SCPAs can be found in SEQ ID NO: 1 and SEQ ID NO: 2 of WO97/26008. See also SEQ ID NO: 1, 2 and 23 of WO 00/34487.

In a further embodiment, the carrier protein of the glycoconjugate of the invention is an SCP as set forth in SEQ ID NO: 150 or 151 of WO2014/136064.

B. Adjuvants In some aspects, the immunogenic compositions disclosed herein may further include at least one, two, or three adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. Antigens may act primarily as delivery systems, primarily as immune modulators, or have powerful characteristics of both. Suitable adjuvants include those suitable for use in mammals, including humans.

Examples of known suitable delivery system-type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide), calcium phosphate, liposomes, MF59 ( Oil-in-water emulsions such as 4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

In one aspect, the immunogenic compositions disclosed herein include an aluminum salt (alum) (eg, aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a further aspect, the immunogenic compositions disclosed herein include aluminum phosphate or aluminum hydroxide as an adjuvant. In one aspect, the immunogenic compositions disclosed herein contain from 0.1 mg/mL to 1 mg/mL or from 0.2 mg/mL to 0.3 mg/mL of elemental aluminum in the form of aluminum phosphate. include. In one aspect, the immunogenic compositions disclosed herein include about 0.25 mg/mL elemental aluminum in the form of aluminum phosphate.

Examples of known suitable immunomodulatory adjuvants that can be used in humans include, but are not limited to, saponin extract from Aquilla bark (QS21, QuilA), MPL (monophosphoryl lipid A), ), TLR4 agonists such as 3DMPL (3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, various interleukins (e.g. IL-2, IL-12) or GM-CSF. Examples include cytokines and AS01.

Examples of known suitable immunomodulatory adjuvants that exhibit both delivery and immunomodulatory properties that can be used in humans include, but are not limited to, those described by ISCOMS (eg, Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO90/03184, WO96/11711, WO00/48630, WO98/36772, WO00/41720, WO2006/134423 and WO2007/026190) or oil-in-water emulsions with TLR4 agonists. in combination with One example is GLA-EM.

For veterinary applications such as, but not limited to, animal studies, one of ordinary skill in the art can use Freund's complete adjuvant (CFA), Freund's incomplete adjuvant (IFA), Emulsigen, N-acetyl-muramyl. -L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl- L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP19835A, designated as MTP-PE), and 2 RIBI can be used, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a % squalene/Tween 80 emulsion.

Additional exemplary adjuvants for enhancing the effectiveness of the immunogenic compositions disclosed herein include, but are not limited to, (1) such as (a) 10% squalane, 0.5%, SAF containing 4% Tween 80, 5% Pluronic® blocking polymer L121, and thr-MDP microfluidized to submicrometer emulsions or vortexed to produce larger particle size emulsions. , and (b) 2% squalene, 0.2% Tween 80, and monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™), etc. Oil-in-water emulsion formulations such as RIBI™ Adjuvant System (RAS) (Ribi Immunochem, Hamilton, Mont.) containing one or more bacterial cell wall components such as muramyl peptides (see below) or bacterial cell wall components. (2) QS21, STIMULON™ (Cambridge Bioscience, Worcester, Mass.), ABISCO® (Isconova, Sweden); Particles produced therefrom, such as ISCOMATRIX® (Commonwealth Serum Laboratories, Australia) or ISCOM (Immune Stimulating Complex), which can be free of additional detergents (e.g. WO 00/07621) ); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL- 6. Cytokines such as IL-7, IL-12 (e.g. WO99/44636)), interferon (e.g. gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF); (5) Mono Phosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) (see e.g. GB2220211, EP0689454) (see e.g. WO00/56358); (6) 3dMPL and, e.g. QS21 and/or in combination with oil-in-water emulsions (see e.g. EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ethers or polyoxyethylene esters (see e.g. WO99/52549); (8) Polyoxyethylene sorbitan ester surfactants in combination with octoxynol (e.g. WO 01/21207) or polyoxyethylene alkyl ether or ester surfactants in combination with at least one further non-ionic surfactant such as octoxynol (e.g. WO01/21152); (9) saponins and immunostimulatory oligonucleotides (e.g. CpG oligonucleotides) (e.g. WO00/62800); (10) immunostimulants and particles of metal salts (e.g. WO00/23105); (11) saponin and oil-in-water emulsion (e.g. WO99/11241); (12) saponin (e.g. QS21) + 3dMPL+IM2 (optionally + sterol) (e.g. WO98/57659); (13) composition Other substances may be mentioned that act as immunostimulants to enhance the efficacy of the substance. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetyl-muramyl-L-alanyl-D-isoglutamine (nor-MDP). Examples include muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE).

In another embodiment, the adjuvant is a liposomal Quillaja Saponaria-21 (QS21) formulation comprising 5.1 mg/mL QS-21, 5mM succinate, 60mM NaCl, 0.1% PS80, pH 5.6. be. In a further embodiment, the adjuvant is 15 mM phosphate buffer, pH 6.1, 4 mg/mL 1,2-dioleoyl-sn-glycero-3-phosphocholine, with a liposome particle size of 71 nm as determined by dynamic light scattering. (DOPC), 1 mg/mL cholesterol, 0.2 mg/mL MPLA (Lot 00714551-0018-2XLipoMPL). In yet a further embodiment, the adjuvant is 15 mM phosphate buffer, pH 6.1, 4 mg/mL DOPC, 1 mg/mL cholesterol, 0 A liposomal MPLA/QS21 formulation containing .2 mg/mL MPLA and 0.2 mg/mL QS-21 (Lot 00714551-0018-2XlipoMQ).

In a further aspect of the disclosure, the immunogenic compositions disclosed herein include CpG oligonucleotides as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore, these terms are used interchangeably unless otherwise indicated. The immunostimulatory CpG oligodeoxynucleotide optionally contains one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides within the context of certain preferred bases. The methylation status of CpG immunostimulatory motifs generally refers to cytosine residues in dinucleotides. The immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide contains a 5' unmethylated cytosine linked by a phosphate bond to a 3' guanine and is directed to Toll-like receptor 9 (TLR-9). is an oligonucleotide that activates the immune system by binding to In another embodiment, the immunostimulatory oligonucleotide activates the immune system through TLR9, but is not as potent as if the CpG motif were unmethylated. May be contained. A CpG immunostimulatory oligonucleotide may include one or more palindromes, which in turn may include a CpG dinucleotide. CpG oligonucleotides are described in U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; , 339,068, and is described in several issued patents, published patent applications, and other publications.

Various classes of CpG immunostimulatory oligonucleotides have been identified. These are called A, B, C and P classes and are described in more detail in WO2010/125480 on page 3, line 22 to page 12, line 36. The methods of the present disclosure include the use of these different classes of CpG immunostimulatory oligonucleotides.

V. Methods of Purification and Production In one aspect, the present disclosure relates to methods of producing FimH mutant polypeptides. Such methods can include, for example, culturing mammalian cells under suitable conditions, thereby expressing the FimH variant polypeptide. The method can further include harvesting the polypeptide from the culture. The process can further include purifying the polypeptide.

In some embodiments, the method produces FimH variant polypeptide in a yield of about 0.1 g/L to 0.5 g/L. In some aspects, the yield of FimH mutant polypeptide is at least about 1 mg/L, at least about 2 mg/L, at least about 3 mg/L, at least about 4 mg/L, at least about 5 mg/L, at least about 6 mg/L. L, at least about 7 mg/L, at least about 8 mg/L, at least about 9 mg/L, at least about 10 mg/L, at least about 11 mg/L, at least about 12 mg/L, at least about 13 mg/L, at least about 14 mg/L, at least about 15 mg/L, at least about 16 mg/L, at least about 17 mg/L, at least about 18 mg/L, at least about 19 mg/L, at least about 20 mg/L, at least about 25 mg/L, at least about 30 mg/L, at least about 35 mg/L, at least about 40 mg/L, at least about 45 mg/L, at least about 50 mg/L, at least about 55 mg/L, at least about 60 mg/L, at least about 65 mg/L, at least about 70 mg/L, at least about 75 mg/L L, at least about 80 mg/L, at least about 85 mg/L, at least about 90 mg/L, at least about 95 mg/L or at least about 100 mg/L.

In some aspects, cell cultures suitable for this disclosure are fed-batch cultures. The term "batch culture" as used herein refers to a method of culturing cells in which additional components are fed to the culture one or more times after the initiation of the culturing process. Such feed components typically include nutritional components for the cells that are depleted during the culturing process. A fed-batch culture is typically stopped at some point and the cells and/or components in the medium are collected and optionally isolated. In some embodiments, the fed-batch culture comprises a basal medium supplemented with feed medium.

In some embodiments, cells can be grown in batch or fed-batch culture, where the culture is terminated after sufficient expression of the polypeptide, after which the expressed polypeptide is harvested and Optionally isolated. In some embodiments, cells can be grown in perfusion culture, where the culture is not terminated and new nutrients and other components are added to the culture periodically or continuously; Meanwhile, the expressed polypeptide is collected periodically or continuously.

In some aspects, the expression level or activity of the FimH variant polypeptide is at least 2-fold, at least 3x, at least 5x, at least 10x, at least 20x, at least 30x, at least 40x, at least 50x, at least 60x, at least 70x, at least 75x, at least 80x, at least 90x, at least 100x make it big

In some embodiments, cells can be grown in small scale reactors to form cell cultures with volumes ranging from a few milliliters to a few liters. In some embodiments, the cells can be grown in a large scale commercial bioreactor to form a cell culture, where the cell culture is about at least 1 liter to 10, 100, 250, 500, 1, The volume may range from 000, 2,500, 5,000, 8,000, 10,000, 12,000 liters or more or any volume therebetween. In some embodiments, the cell culture size is 10L to 5000L, 10L to 10,000L, 10L to 20,000L, 10L to 50,000L, 40L to 50,000L, 100L to 50,000L, 500L to 50 ,000L, 1000L~50,000L, 2000L~50,000L, 3000L~50,000L, 4000L~50,000L, 4500L~50,000L, 1000L~10,000L, 1000L~20,000L, 1000L~25,000L , 1000L to 30,000L, 15L to 2000L, 40L to 1000L, 100L to 500L, 200L to 400L, or any integer range therebetween.

The temperature of the cell culture is determined by the range of temperatures at which the cell culture remains viable and produces high levels of polypeptides, the temperature at which the production or accumulation of metabolic waste products is minimized, and/or is determined by the technician. The selection will be primarily based on a combination of any of the above or other factors that appear to be appropriate. As a non-limiting example, CHO cells grow well and produce high levels of proteins or polypeptides at approximately 37°C. Generally, most mammalian cells can grow well and/or produce high levels of proteins or polypeptides within a range of about 25°C to 42°C; however, the methods taught by this disclosure , but not limited to these temperatures. Certain mammalian cells can grow well and/or produce high levels of proteins or polypeptides within a range of about 35°C to 40°C. In certain aspects, the cell culture is at 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C at one or more points during the cell culture process. , 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C Grown at a temperature of ℃.

The terms "culture" and "cell culture" as used herein refer to a population of cells suspended in a medium under conditions suitable for the survival and/or proliferation of the cell population. As will be appreciated by those skilled in the art, in some embodiments these terms, as used herein, refer to a combination comprising a cell population and a medium in which the population is suspended. In some embodiments, the cells of the cell culture include mammalian cells.

In some embodiments, cells can be grown in one of a variety of chemically defined media, where the components of the media are known and controlled. In some embodiments, cells can be grown in complex media where not all of the components of the media are known and/or controlled. Chemically defined growth media for culturing mammalian cells have been widely developed and published over the last several decades. All components of defined media are well characterized and such defined media do not contain complex additives such as serum or hydrolysates. Early media formulations were developed to allow cell growth and survival with little or no concerns regarding protein production. Recently, media formulations have been developed for the express purpose of supporting the culture of highly proliferating recombinant protein producing cells. Such media are preferred for use in the methods of the invention. Such media generally contain large amounts of nutrients, particularly amino acids, that support growth and/or maintenance of cells at high density. If necessary, these media can be modified by those skilled in the art for use in the methods of the invention. For example, one skilled in the art can reduce the amount of phenylalanine, tyrosine, tryptophan and/or methionine in these media for use as basal or feed media in the methods disclosed herein.

Not all of the components of complex media are well characterized, and complex media therefore contain, inter alia, simple and/or complex carbon sources, simple and/or complex nitrogen sources, and additives such as serum. can contain. In some embodiments, complex media suitable for the present invention contain additives, such as hydrolysates, in addition to the other components of defined media described herein. In some embodiments, defined media typically contain approximately 50 chemical entities at known concentrations in water. Many of them also contain one or more well-characterized proteins such as insulin, IGF-1, transferrin or BSA, while others do not require a protein component and are therefore protein-free. It is called a containing defined medium. Typical chemical components of media fall into five broad categories: amino acids, vitamins, inorganic salts, trace elements, and miscellaneous categories that cannot be concisely classified.

The cell culture medium may optionally be supplemented with supplementary components. The term "supplemental ingredients" as used herein includes, but is not limited to, hormones and/or other growth factors, certain ions (such as sodium, chloride, calcium, magnesium, and phosphate), Growth beyond minimal percentages, including buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds usually present in very low final concentrations), amino acids, lipids, and/or glucose or other energy sources and/or refers to components that enhance survival. In some embodiments, supplemental components can be added to the initial cell culture. In some embodiments, supplemental components can be added after initiation of cell culture. Typically, trace elements refer to various inorganic salts present at micromolar or lower levels. For example, commonly included trace elements include zinc, selenium, copper, etc. In some embodiments, iron (ferrous or ferric salts) may be included as a trace element in micromolar concentrations initially in the cell culture medium. Among the trace elements, manganese is also often included as a divalent cation (MnCl ₂ or MnSO ₄ ) in nanomolar to micromolar concentrations. A number of less common trace elements are usually added in nanomolar concentrations.

In some aspects ^{, the} medium used in the methods of the invention ^is used in cell culture ^, e.g. It is a suitable medium to support high cell densities, such as cells/mL, 1×10 ⁸ cells/mL or 5×10 ⁸ cells/mL. In some embodiments, the cell culture is a mammalian cell fed-batch culture, preferably a CHO cell fed-batch culture.

In some aspects, the cell culture medium contains phenylalanine less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5 Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or between 0.5mM and 0.5mM of tyrosine. Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2 mM tryptophan, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or 0.5 Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains methionine less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5 Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5 Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5mM of serine. Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2mM threonine, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5 Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0.5mM of glycine. Contains at concentrations between ~1mM. In some aspects, the cell culture medium contains two of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 2 mM. Included at a concentration between 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0. Contains at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains phenylalanine and tryptophan at less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or 0. Contains at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains phenylalanine and methionine at less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or 0. Contains at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0. Contained at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0. Contained at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains tryptophan and methionine of less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, or 0. Contained at concentrations between .5 and 1 mM. In some aspects, the cell culture medium contains three of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine at less than 2 mM, between 0.1 and 2 mM, between 0.1 and 2 mM. Included at a concentration between 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, phenylalanine, tyrosine and tryptophan. or at a concentration between 0.5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, phenylalanine, tyrosine, and methionine. or at a concentration between 0.5 and 1 mM.

In some aspects, the cell culture medium comprises less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, phenylalanine, tryptophan and methionine. or at a concentration between 0.5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, between 0.5 and 1.5mM, tyrosine, tryptophan and methionine. or at a concentration between 0.5 and 1 mM.

In some aspects, the cell culture medium contains four of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine at less than 2 mM, less than 1 mM, between 0.1 and 2 mM, and 1mM, between 0.5 and 1.5mM, or between 0.5 and 1mM.

In some embodiments, the cell culture medium contains phenylalanine, tyrosine, tryptophan, and methionine at less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, and between 0.5 and 1.5 mM. or at a concentration between 0.5 and 1 mM. In some aspects, the cell culture medium contains five of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Included at a concentration between 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some embodiments, the cell culture medium contains six of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine at a concentration of less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 2mM. Included at a concentration between 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some aspects, the cell culture medium contains seven of the following: phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Included at a concentration between 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some aspects, the cell culture medium contains less than 2mM, less than 1mM, between 0.1 and 2mM, between 0.1 and 1mM, phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine. Included at a concentration between 0.5 and 1.5mM, or between 0.5 and 1mM. In some embodiments, the cell culture medium comprises at least 1, 2, 3, 4, 5 of glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine; 6, 7, 8, 9, 10, 11, 12 or 13 at a concentration of 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably greater than 2mM. In some embodiments, the cell culture medium contains at least five of glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2mM, 3mM, 4mM, Further comprising at a concentration greater than 5mM, 10mM, 15mM, preferably 2mM. In some aspects, the cell culture medium contains glycine, valine, leucine, isoleucine, proline, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, and asparagine at 2mM, 3mM, 4mM, 5mM, 10mM, 15mM. , preferably at a concentration greater than 2mM. In some embodiments, the cell culture medium contains at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 of valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate, and asparagine. further comprising at a concentration of 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably greater than 2mM. In some embodiments, the cell culture medium contains at least five of valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate and asparagine at 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably , at a concentration greater than 2mM. In some embodiments, the cell culture medium contains valine, isoleucine, proline, lysine, arginine, histidine, aspartate, glutamate and asparagine at a concentration of greater than 2mM, 3mM, 4mM, 5mM, 10mM, 15mM, preferably greater than 2mM. Including further. In some aspects, the cell culture medium comprises serine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium comprises valine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium comprises cysteine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some aspects, the cell culture medium comprises isoleucine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM.

In some aspects, the cell culture medium comprises leucine at a concentration of 3mM, 5mM, 7mM, 10mM, 15mM or 20mM, preferably greater than 10mM. In some embodiments, the cell culture media described above are for use in the methods disclosed herein. In some aspects, the cell culture media described above are used as basal media in the methods disclosed herein. In some aspects, the cell culture media described above are used as feed media in the methods disclosed herein.

The methods of the present disclosure can be used with any cell culture method suitable for the desired process (eg, production of recombinant proteins). As a non-limiting example, cells can be grown in batch or fed-batch culture, where the culture is terminated after sufficient expression of the recombinant protein (e.g., antibody), and then The collected proteins are collected. Alternatively, as another non-limiting example, cells can be grown in batch-refeed, where the culture is not terminated and new nutrients and other components are regularly added to the culture. The expressed recombinant protein is added periodically or continuously, while the expressed recombinant protein is collected periodically or continuously. Other suitable methods (eg, spin tube culture) are known in the art and can be used to practice the invention.

Cells can be grown in any convenient volume selected by the practitioner. For example, cells can be grown in small scale reaction vessels ranging in volume from a few milliliters to a few liters. Alternatively, the cells have a volume ranging from approximately at least 1 liter to 10, 50, 100, 250, 500, 1000, 2500, 5000, 8000, 10,000, 12,000, 15,000, 20,000 or more than 25,000 liters; , or any volume in between can be grown in large-scale commercial bioreactors.

The temperature of cell culture will be selected primarily based on the temperature range in which cell culture is still viable and in which high levels of the desired product (eg, recombinant protein) are produced. Generally, most mammalian cells can grow well and produce the desired product (e.g., recombinant protein) within a range of about 25°C to 42°C; temperature. Certain mammalian cells can grow well and produce the desired product (eg, a recombinant protein or antibody) within a range of about 35°C to 40°C. In certain aspects, the cell culture is at 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C at one or more points during the cell culture process. , 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C Grown at a temperature of ℃. One skilled in the art will be able to select a suitable temperature or temperature for growing the cells depending on the particular needs of the cells and the particular production requirements of the practitioner. Cells can be grown for any amount of time depending on the needs of the practitioner and the demands of the cells themselves. In some embodiments, cells are grown at 37°C. In some embodiments, the cells are grown at 36.5°C.

In some embodiments, cells can be grown in the initial growth phase (or growth phase) for a greater or lesser amount of time, depending on the needs of the technician and the cells themselves. In some embodiments, the cells are grown for a sufficient period of time to achieve a predefined cell density. In some embodiments, cells are grown for a period of time sufficient to achieve a cell density that is a given percentage of the maximum cell density that the cells would eventually reach if grown undisturbed. For example, a desired 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99 percent of the maximum cell density. The cells can be grown for a sufficient period of time to achieve a viable cell density of . In some aspects, the cells have a cell density of 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, It is grown until it no longer increases by more than 4%, 3%, 2% or 1%. In some embodiments, cells are grown until cell density no longer increases by more than 5% per day of culture.

In some embodiments, the cells are grown for a defined period of time. For example, depending on the starting concentration of the cell culture, the temperature at which the cells are grown, and the inherent growth rate of the cells, the cells may be grown at 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, , 12, 13, 14, 15, 16, 17, 18, 19, 20 days or more, preferably 4 to 10 days. In some cases, cells can be grown for one month or more. The practitioner of the invention will be able to choose the duration of the initial growth phase depending on the protein production requirements and the needs of the cell itself.

The cell culture can be agitated or shaken during the initial culture phase to increase oxygenation and distribution of nutrients to the cells. In the present invention, those skilled in the art will appreciate that it is advantageous to control or adjust certain internal conditions of the bioreactor during the initial growth phase, including, but not limited to, pH, temperature, oxygenation, etc. You will understand what you get.

At the end of the initial growth phase, a second set of culture conditions can be applied to shift at least one of the culture conditions such that a metabolic shift occurs in the culture. Metabolic shifts can be achieved, for example, by changes in temperature, pH, osmolarity or chemical induction levels of the cell culture. In one non-limiting embodiment, culture conditions are shifted by shifting the temperature of the culture. However, as is known in the art, temperature shifts are not the only mechanism by which favorable metabolic shifts can be achieved. For example, such metabolic shifts can also be achieved by shifting other culture conditions including, but not limited to, pH, osmolality, and sodium butyrate levels. The timing of culture shifts will be determined by the practitioner of the invention based on protein production requirements or the needs of the cells themselves.

When shifting the temperature of a culture, the temperature shift may be relatively gradual. For example, it may take several hours or days to complete a temperature change. Alternatively, the temperature shift may be relatively sudden. For example, the temperature change may be completed in less than a few hours. Given suitable production and control equipment as is standard in commercial large scale production of polypeptides or proteins, temperature changes can be completed in less than an hour.

In some embodiments, once the conditions of the cell culture are shifted as described above, the cell culture can be grown with the desired polypeptides at commercially relevant levels, promoting cell culture survival and viability. A second set of culture conditions appropriate for expression of the peptide or protein is maintained during the subsequent production phase.

As described above, cultures can be shifted by shifting one or more of a number of culture conditions, including, but not limited to, temperature, pH, osmolality, and sodium butyrate levels. can. In some embodiments, the temperature of the culture is shifted. In this embodiment, during the subsequent production phase, the culture is maintained at a lower temperature or temperature range than that of the initial growth phase. As discussed above, multiple discrete temperature shifts can be used to increase cell density or viability, or to increase expression of recombinant proteins.

The term "titer" as used herein, for example, refers to the total amount of recombinantly expressed protein produced by a cell culture in a given volume of media. Titer is typically expressed in grams of protein per liter of medium.

In some embodiments, cell proliferation is increased by at least 5%, 10%, 15%, 20% or 25% compared to a control culture. In some embodiments, cell proliferation is increased by at least 10% compared to a control culture. In some embodiments, cell proliferation is increased by at least 20% compared to a control culture.

In some embodiments, productivity is determined by titer and/or volumetric productivity. In some embodiments, productivity is determined by titer. In some embodiments, productivity is increased by at least 5%, 10%, 15%, 20% or 25% compared to a control culture. In some embodiments, productivity is increased by at least 10% compared to a control culture. In some embodiments, productivity is increased by at least 20% compared to a control culture.

Purification In some embodiments, methods for producing FimH variant polypeptides include isolating and/or purifying the polypeptide. In some embodiments, the expressed polypeptide is secreted into the culture medium and thus cells and other solids can be removed by centrifugation and/or filtration. In preferred embodiments, the polypeptide or fragment thereof is soluble.

FimH mutant polypeptides produced according to the methods described herein can be harvested from host cells and isolated using any suitable method, generally known in the art ( For example, Ruiz-Arguello et al., J. Gen. Virol., 85:3677-3687 (2004)). Suitable methods for purifying polypeptides include precipitation and various types of chromatography, such as hydrophobic interaction, ion exchange, affinity, chelation and size exclusion, all of which are well known in the art. It is publicly known. Suitable purification schemes may include two or more of these or other suitable methods. In some aspects, one or more of the polypeptides can include a "tag" to facilitate purification or detection. Examples include, for example, His tags (binds metal ions, e.g. hexahistidine), antibodies, maltose binding protein (MBP) (binds amylose), glutathione-S-transferase (GST) (binds glutathione), Includes FLAG tag (binds to anti-flag antibodies), Strep tag (binds to streptavidin or its derivatives). Such tagged polypeptides can be conveniently isolated, for example, from conditioned media by chelation chromatography or affinity chromatography. Optionally, the tag sequence can be cleaved after purification. In one aspect, the FimH variant polypeptide does not include a purification tag.

In one aspect, FimH variant polypeptides can be isolated by first obtaining a cell culture supernatant and then subjecting the supernatant to both ultrafiltration and diafiltration methods. Such filtration methods are known to those skilled in the art. After ultrafiltration and diafiltration, the resulting cell-free solution is then subjected to a chromatography step, such as, for example, Ni-NTA chromatography using a nickel-affinity resin. This step can then be followed by dialysis, which can then be followed by cation exchange chromatography, such as with an SP column. Acidic pH (eg, less than about 6.0, less than about 5.5, less than about 5.0, less than about 4.5, about 4.4, about 4.3, about 4.0 2, about 4.1 or about 4.0) may be desirable under certain conditions.

Although specific strains of E. coli may be referred to herein, polypeptides or fragments thereof derived from E. coli are referred to as specific strains, unless specified. It should be understood that there is no limitation.

VI. Uses of Compositions In one aspect, the present disclosure provides a method of use as a medicament or for the manufacture of a medicament for raising an immune response to or preventing an E. coli infection in a subject. Provided are uses of FimH variant polypeptides, nucleic acids encoding such variants, vectors for expressing such variants, and compositions comprising such variants or nucleic acids, in.

In other aspects, the present disclosure provides for administering to a subject an effective amount of a FimH variant polypeptide, a nucleic acid molecule encoding a FimH variant polypeptide, or a composition comprising a FimH variant polypeptide or nucleic acid molecule. A method of eliciting an immune response against E. coli in a subject, such as a human, is provided. The present disclosure also provides for administering to a subject an effective amount of a pharmaceutical composition, such as a vaccine, comprising a FimH variant polypeptide, a nucleic acid encoding a FimH variant polypeptide, or a vector expressing a FimH variant polypeptide. A method of preventing E. coli infection in a subject is provided. In certain embodiments, the pharmaceutical composition comprises a FimH variant polypeptide disclosed herein. In some embodiments of the methods provided herein above, the subject is a human.

In other aspects, the present disclosure provides methods for inducing an immune response in a subject against extraintestinal pathogenic E. coli, or in a subject specific for extraintestinal pathogenic E. coli. and/or a method for inducing the production of neutralizing antibodies, comprising administering to a subject an effective amount of a composition as described herein, such as a composition comprising a FimH variant polypeptide as described herein. A method comprising administering any of the compositions comprising: In further aspects of such methods, the subject is at risk of developing a urinary tract infection, and/or at risk of developing bacteremia, and/or at risk of developing sepsis.

In a further aspect, the present disclosure provides methods for raising an immune response against E. coli in a mammal, comprising administering to the mammal an effective amount of any of the compositions described herein. provide a method. For example, in one aspect, the immune response comprises opsonophagocytic and/or neutralizing antibodies against E. coli. In a further aspect, the immune response protects the mammal from E. coli infection.

In a further aspect, the present disclosure provides methods for preventing, treating or treating a bacterial infection, disease or condition in a subject comprising administering to the subject an immunologically effective amount of any of the compositions described herein. Provide ways to improve.

In the methods of the present disclosure, compositions can be administered to a subject with or without administration of an adjuvant. An effective amount administered to a subject is an amount sufficient to elicit an immune response in the subject against an E. coli antigen, such as a FimH protein. Subjects who may be selected for treatment are at risk of developing a urinary tract infection and/or at risk of developing bacteremia due to exposure or potential exposure to E. coli. including subjects who are at risk of developing an E. coli infection, such as subjects who are at risk of developing an E. coli infection and/or who are at risk of developing sepsis.

As used herein, "subject" means a mammal, preferably a human. In one embodiment, the subject has a urinary tract infection, cholecystitis, cholangitis, diarrhea, hemolytic uremic syndrome, neonatal meningitis, urosepsis, intra-abdominal infection, meningitis, complicated pneumonia, wound infection. , post-prostate biopsy associated infections, neonatal/infant sepsis, neutropenic fever and other bloodstream infections; pneumonia, bacteremia, and sepsis. be.

Administration of compositions provided by this disclosure, such as pharmaceutical compositions, can be carried out using standard routes of administration. Non-limiting embodiments include parenteral administration, such as intradermal, intramuscular, subcutaneous, transdermal, mucosal, or oral administration.

The total dose of the composition provided to a subject in a single administration may be varied as is known to those skilled in the art.

It is also possible to provide one or more booster doses of one or more of the immunogenic compositions. When boosting vaccination is performed, such boosting vaccination typically occurs after administration of the composition to the subject for the first time (in such cases referred to as a "priming vaccination"). It will be administered to the same subject at times between 1 week and 10 years, preferably between 2 weeks and 6 months. In an alternative boosting regimen, after the priming vaccination, the subject is given a different vector, e.g., one or more adenoviruses or other vectors, e.g., modified Ankara vaccinia virus (MVA), or DNA, or protein. It is also possible to administer. The immunogenic compositions provided by this disclosure can be used in conjunction with one or more other immunogenic compositions.

Dosage of Compositions Dosage regimens can be adjusted to produce the optimal desired response. For example, a single dose of the mutated FimH polypeptide can be administered, several divided doses can be administered over time, or the dose is proportionally reduced as indicated by the exigencies of the situation. Or it can be increased. It should be noted that dosage values may vary with the type and severity of the condition being alleviated and may include single or multiple doses. It is further understood that, for any particular subject, the specific dosage regimen should be adjusted over time according to the needs of the individual and the professional judgment of the person administering or supervising the administration of the composition; It is to be understood that the dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.

In some embodiments, the amount of FimH variant polypeptide in the composition can range from about 10 μg to about 300 μg of each protein antigen. In some embodiments, the amount of FimH variant polypeptide in the composition can range from about 20 μg to about 200 μg of each protein antigen.

The amount of glycoconjugate in each dose is selected as an amount that induces an immunoprotective response without significant adverse side effects in typical vaccines. Such amounts will vary depending on which particular immunogen is used and how it is provided. The amount of a particular saccharide conjugate in an immunogenic composition can be calculated based on the total polysaccharide for that conjugate (conjugated and unconjugated). For example, a saccharide conjugate containing 20% free polysaccharide will have about 80 g of conjugated polysaccharide and about 20 g of unconjugated polysaccharide in a 100 g polysaccharide dose. The amount of saccharide conjugate can vary depending on the E. coli serotype. Sugar concentration can be determined by uronic acid assay.

The "immunogenic amounts" of different polysaccharide components in an immunogenic composition can be different, each being about 1.0 g, about 2.0 g, about 3.0 g, about 4.0 g, about 5.0 g. 0g, about 6.0g, about 7.0g, about 8.0g, about 9.0g, about 10.0g, about 15.0g, about 20.0g, about 30.0g, about 40.0pg, about 50. 0 pg, about 60.0 pg, about 70.0 pg, about 80.0 pg, about 90.0 pg or about 100.0 g of any particular polysaccharide antigen. Generally, each dose will contain from 0.1 g to 100 g, in particular from 0.5 g to 20 g, more particularly from 1 g to 10 g, even more particularly from 2 g to 5 g, for a given serotype. Dew. Any full integer within any of the above ranges is contemplated as an embodiment of this disclosure. In one embodiment, each dose will contain 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9 g, 10 g, 15 g or 20 g of polysaccharide for a given serotype.

VII. Combinations with sugars and/or polypeptides or fragments thereof derived from Klebsiella pneumoniae Klebsiella pneumoniae (K. pneumoniae) is used to treat urinary tract infections, bacteremia and sepsis. It is a Gram-negative pathogen known to cause. Multidrug-resistant K. pneumoniae infections are an increasing cause of mortality in at-risk and vulnerable populations. O-antigen serotypes are highly prevalent among strains that cause invasive disease worldwide, and derived O-antigen glycoconjugates are attractive as vaccine antigens.

In one aspect, any of the compositions disclosed herein include O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8 , and at least one saccharide derived therefrom. In a preferred embodiment, any of the compositions disclosed herein are derived from a polypeptide or an immunogenic fragment thereof derived from K. pneumoniae type I pili protein; or an immunogenic fragment thereof; or a combination thereof;

As is known in the art, the K. pneumoniae O1 and O2 O antigens and their corresponding v1 and v2 subtypes are polymeric galactans that differ in the structure of their repeating units. The K. pneumoniae O1 and O2 antigens contain homopolymeric galactose units (or galactans). The K. pneumoniae O1 and O2 antigens each contain a D-galactan I unit (sometimes referred to as the O2a repeat unit), whereas the O1 antigen contains a D-galactan II cap structure. It differs in that it has D-galactan III (d-Gal-III) is a variant of D-galactan I. The structures of the basal galactans I and III, which define two distinct serotype O2 subtypes, O2v1 and O2v2; and the structures of the derived chimeras resulting from capping with galactan II, giving rise to subtypes O1v1 and O1v2, were described by Kelly SD et al. J Biol Chem 2019; 294:10863-76; and Clarke BR et al. J Biol Chem 2018; 293:4666-79.

In some embodiments, the sugar derived from K. pneumoniae O1 is [→3)-β-D-Galf-(1→3)-α-D-Galp-(1→] In some embodiments, the sugar derived from K. pneumoniae O1 is [→3)-α-D-Galp-(1→3)-β-D-Galp- (1→]. In some embodiments, the sugar derived from K. pneumoniae O1 is [→3)-β-D-Galf-(1→3)-α -D-Galp-(1→], and [→3)-α-D-Galp-(1→3)-β-D-Galp-(1→]. In embodiments, the sugar derived from K. pneumoniae O1 is →3)-β-D-Galf-(1→3)-[α-D-Galp-(1→4)]-α -D-Galp-(1→] repeat unit (referred to as D-Gal-III repeat unit) (Kol O. et al. (1992) Carbohydr. Res. 236, 339-344; Whitfield C. et al. 1991) J. Bacteriol. 173, 1420-1431).

In some embodiments, the sugar derived from K. pneumoniae O2 is [→3)-α- _D -Galp-(1→3)-β- _D -Galf-(1→]( which may be an element of the K. pneumoniae serotype O2a antigen. In some embodiments, the sugar derived from K. pneumoniae O2 is [→ 3) Contains a repeating unit of -β- _D -GlcpNAc-(1→5)-β- _D -Galf-(1→], which may be a component of the K. pneumoniae serotype O2c antigen. In some embodiments, the sugar derived from K. pneumoniae O2 comprises a modification of the O2a repeat unit by side chain addition of a (1→4)-linked Galp residue (K. pneumoniae (K. In some embodiments, the sugar derived from K. pneumoniae O2 may be a component of the O2afg antigen by side chain addition of a (1→2)-linked Galp residue. (Whitfield C. et al. (1992) J. Bacteriol. 174, 4913-4919).

Without being bound by mechanism or theory, the O-antigen polysaccharide structures of K. pneumoniae serotypes O3 and O5 are similar to those of E. coli serotypes O9a (formula O9a) and O8 (formula O9a), respectively. O8) is disclosed in the art to be identical to that of O8).

In some embodiments, the sugar derived from K. pneumoniae O4 is [→4)-α-D-Galp-(1→2)-β-D-Ribf-(1→)] Contains repeating units. In some embodiments, the sugar derived from K. pneumoniae O7 is [→2-a-L-Rhap-(1→2)-β-D-Ribf-(1→3)- α-L-Rhap-(1→3)-α-L-Rhap-(1→]. In some embodiments, a saccharide derived from K. pneumoniae O8 serotype. contains the same repeating unit structure as K. pneumoniae O2a, but is non-stoichiometrically O-acetylated. In some embodiments, K. pneumoniae O12 The saccharide derived from the serotype contains repeat units of [α-Rhap-(1→3)-β-GlcpNAc] disaccharide repeat units.

In one aspect, the invention provides polypeptides or fragments thereof derived from E. coli FimH; and O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3 , O4, O5, O7, O8, and O12. In some embodiments, the composition comprises saccharides from or derived from one or more of serotypes O1, O2, O3, and O5, or combinations thereof. In some embodiments, the composition comprises saccharides from or derived from each of serotypes O1, O2, O3, and O5.

In another aspect, the invention provides at least one selected from O1 (and d-Gal-III variant), O2 (and d-Gal-III variant), O2ac, O3, O4, O5, O7, O8 and O12. at least one saccharide of or derived from a K. pneumoniae serotype; , formula O4:K52 and formula O4:K6), formula O5 (e.g. formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g. formula O6:K2;K13;K15 and formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18 (e.g., Formula O18A, Formula O18ac, Formula O18A1, Formula O18B, and Formula O18B1), Formula O19, Formula O20, Formula O21, Formula O22, Formula O23 (e.g., Formula O23A), Formula O24, Formula O25 (e.g., Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 (e.g. O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60, formula O61 , formula O62, formula 62D1, formula O63, formula O64, formula O65, formula O66, formula O68, formula O69, formula O70, formula O71, formula O73 (for example, formula O73 (stock 73-1)), formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, formula O88, formula O89, formula O90, formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102, Formula O103, Formula O104, Formula O105, Formula O106, Formula O107, Formula O108, Formula O109 , formula O110, formula 0111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, formula O136, formula O137, formula O138, formula O139, formula O140, formula O141, formula O142, formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153, Formula O154, Formula O155, Formula O156, Formula O157, Formula O158, Formula O159, Formula O160 , formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula Any one of O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, formula O186, and formula O187 (in the formula, n is an integer from 1 to 100) Escherichia coli (E. coli) O antigen. In some embodiments, the composition contains sugars from or derived from one or more of K. pneumoniae serotypes O1, O2, O3, and O5, or combinations thereof. include. In some embodiments, the composition comprises a saccharide from or derived from each of K. pneumoniae serotypes O1, O2, O3, and O5. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O9 and does not include a saccharide derived from K. pneumoniae serotype O3. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O8 and does not include a saccharide derived from K. pneumoniae serotype O5.

In another aspect, the invention provides polypeptides or fragments thereof derived from E. coli FimH; and O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, at least one saccharide of or derived from at least one K. pneumoniae serotype selected from O3, O4, O5, O7, O8, and O12; and at least one saccharide of formula O1 (e.g., formula O1A , formula O1B, and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g., formula O6:K2;K13;K15 and formula O6:K54), formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (e.g., formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24, formula O25 (For example, Formula O25a and Formula O25b), Formula O26, Formula O27, Formula O28, Formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 (e.g., formula O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D ₁ , Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, Formula O71, formula O73 (for example, formula O73 (stock 73-1)), formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101, Formula O102 , formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152, Formula O153 , formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, formula O186, and O187, where n is an integer from 1 to 100, preferably from 31 to 90. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O9 and does not include a saccharide derived from K. pneumoniae serotype O3. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O8 and does not include a saccharide derived from K. pneumoniae serotype O5.

In some embodiments, the composition comprises at least one saccharide from any one K. pneumoniae type selected from the group consisting of O1, O2, O3, and O5.

In some embodiments, the composition comprises at least one sugar derived from K. pneumoniae type O1. In one aspect of this embodiment, the K. pneumoniae O antigen is selected from subtype v1 (O1v1) or subtype v2 (O1v2). In one aspect of this embodiment, the K. pneumoniae O antigen is selected from subtype v1 (O1v1) and subtype v2 (O1v2). In some embodiments, the composition comprises at least one sugar derived from K. pneumoniae type O2. In one aspect of this embodiment, the K. pneumoniae O antigen is selected from subtype v1 (O2v1) or subtype v2 (O2v2). In one aspect of this embodiment, the K. pneumoniae O antigen is selected from subtype v1 (O2v1) and subtype v2 (O2v2). In another aspect, the K. pneumoniae O antigen is a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 ( O2v1) and d) serotype O2 subtype v2 (O2v2). In one aspect of this embodiment, the K. pneumoniae O antigen is subtype v1 (O1v1). In one aspect of this embodiment, the K. pneumoniae O antigen is subtype v2 (O1v2). In one aspect of this embodiment, the K. pneumoniae O antigen is subtype v1 (O2v1). In one aspect of this embodiment, the K. pneumoniae O antigen is subtype v2 (O2v2). In another aspect of this embodiment, the composition comprises a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 (O2v1), and d ) 1, 2, 3 or 4 K. pneumoniae O antigens selected from the group consisting of serotype O2 subtype v2 (O2v2). In some embodiments, the composition comprises a combination of sugars derived from K. pneumoniae, wherein the first sugar is selected from the group consisting of O1, O2, O3, and O5. the second sugar is O1 (and d-Gal-III variant), O2 (and d-Gal-III variant), O2ac, Derived from sugars derived from any one of the K. pneumoniae types selected from the group consisting of O3, O4, O5, O7, O8, and O12. For example, in some embodiments, the composition comprises at least one sugar derived from K. pneumoniae type O1 and at least one sugar derived from K. pneumoniae type O2. include. In one preferred embodiment, the sugar derived from K. pneumoniae is conjugated to a carrier protein; the sugar derived from E. coli is conjugated to a carrier protein.

In another aspect, the invention provides a polypeptide or fragment thereof derived from E. coli FimH; and any one of Klebsiella pneumoniae (K) selected from the group consisting of O1, O2, O3, and O5. .pneumoniae).

In another aspect, the present invention provides at least one sugar derived from any one K. pneumoniae type selected from the group consisting of O1, O2, O3, and O5; and formula O1 (e.g. , formula O1A, formula O1B, and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (stock 180/C3) ), formula O6 (e.g., formula O6:K2;K13;K15 and formula O6:K54), formula O7, formula O8, formula O9, formula O10, formula O11, formula O12, formula O13, formula O14, formula O15, formula O16, formula O17, formula O18 (e.g., formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g., formula O23A), formula O24 , formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28, formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, formula O37, formula O38, formula O39, formula O40, formula O41, formula O42, formula O43, formula O44, formula O45 (e.g., formula O45 and formula O45rel), formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, Formula O54, Formula O55, Formula O56, Formula O57, Formula O58, Formula O59, Formula O60, Formula O61, Formula O62, Formula 62D ₁ , Formula O63, Formula O64, Formula O65, Formula O66, Formula O68, Formula O69, Formula O70, formula O71, formula O73 (for example, formula O73 (stock 73-1)), formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, formula O80, formula O81, formula O82, formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97, Formula O98, Formula O99, Formula O100, Formula O101 , formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula O111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, formula O132, formula O133, formula O134, formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148, Formula O149, Formula O150, Formula O151, Formula O152 , formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, formula O182, formula O183, formula O184, formula O185, Escherichia coli (E. Contains at least one sugar derived from E. coli. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O9 and does not include a saccharide derived from K. pneumoniae serotype O3. In some embodiments, the composition includes a saccharide derived from the E. coli O antigen having the formula O8 and does not include a saccharide derived from K. pneumoniae serotype O5.

In some embodiments, the composition has at least one saccharide derived from K. pneumoniae type O1; and a structure selected from the group consisting of formula O8 and formula O9. ) containing at least one sugar derived from In another embodiment, the composition has at least one saccharide derived from K. pneumoniae type O2; and E. coli having a structure selected from the group consisting of formula O8 and formula O9. Contains at least one sugar derived from. In another embodiment, the composition comprises at least one sugar derived from K. pneumoniae type O1; and at least one sugar derived from K. pneumoniae type O2; and of the formula O8. and at least one sugar derived from E. coli having a structure selected from the group consisting of formula O9.

In one embodiment, the invention provides for administering to a subject an immunologically effective amount of an immunogenic composition comprising at least one saccharide conjugate from E. coli serotype O8 or O9. A method of inducing an immune response against K. pneumoniae in a subject, comprising: inducing a saccharide conjugate from K. pneumoniae serotype O5 or O3, the immunogenic composition comprising: Does not include, provides a method. In one aspect, the composition includes a saccharide derived from the E. coli O antigen having the formula O8 and does not include a saccharide derived from K. pneumoniae serotype O5. In another aspect, the composition includes a saccharide derived from the E. coli O antigen having the formula O9 and does not include a saccharide derived from K. pneumoniae serotype O3.

In another embodiment, the present invention provides for administering to a subject an immunogenic drug comprising an immunologically effective amount of at least one glycoconjugate from K. pneumoniae serotypes O5 or O3 or variants thereof. A method of inducing an immune response against E. coli in a subject, the immunogenic composition comprising administering a composition comprising saccharides derived from E. coli serotype O8 or O9. A conjugate-free method is provided. In one aspect, the composition includes a saccharide derived from K. pneumoniae serotype O5 and does not include a saccharide derived from E. coli O antigen having the formula O8. In another aspect, the composition includes a saccharide derived from K. pneumoniae serotype O3 and does not include a saccharide derived from E. coli O antigen having formula O9.

In some embodiments, the composition is selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8, and O12. at least one saccharide of or derived from at least one K. pneumoniae serotype; derived from E. coli having a structure selected from the group consisting of formula O8 and formula O9; contains at least one sugar that In some embodiments, the composition is selected from O1 (and d-Gal-III variants), O2 (and d-Gal-III variants), O2ac, O3, O4, O5, O7, O8, and O12. at least one saccharide of or derived from at least one K. pneumoniae serotype; a structure selected from the group consisting of formula O1A, formula O1B, formula O2, formula O6, and formula O25B; at least one sugar derived from E. coli having a

In some embodiments, the composition comprises a polypeptide derived from a K. pneumoniae type I pilus protein or an immunogenic fragment thereof; or a K. pneumoniae type III pilus protein. or an immunogenic fragment thereof, or a combination thereof. The sequences of said polypeptides are known in the art.

VIII. Nanoparticles In another aspect, disclosed herein are immunogenic complexes that include 1) a nanostructure; and 2) at least one pilus polypeptide antigen or fragment thereof. Preferably, the fimbrial polypeptide or fragment thereof is derived from E. coli fimbrial H (fimH). In a preferred embodiment, the pilin polypeptide is selected from any one of the pilin polypeptides described above. For example, a pili polypeptide can include any one amino acid sequence selected from SEQ ID NOs: 1-65.

In some embodiments, an antigen is fused or conjugated to the exterior of the nanostructure to stimulate the generation of an adaptive immune response against the presented epitope. In some embodiments, the immunogenic complex is externally attached and/or encapsulated within the cage to help match the type of immune response generated with each pathogen. further include adjuvants or other immunomodulatory compounds.

In some embodiments, the nanostructure comprises a single assembly that includes a plurality of identical first nanostructure-associated polypeptides.

In an alternative embodiment, the nanostructure comprises a plurality of assemblies comprising a plurality of identical first nanostructure-related polypeptides and a plurality of second assemblies, each of the second assemblies comprising a plurality of identical second containing nanostructure-related polypeptides.

A variety of nanostructure platforms can be used in producing the immunogenic compositions described herein. In some embodiments, the nanostructures used are formed by multiple copies of a single subunit. In some embodiments, the nanostructures used are formed by multiple copies of multiple different subunits.

Nanostructures are typically ball-like in shape and/or have rotational symmetry (eg, 3-fold and 5-fold axes), eg, with the icosahedral structure exemplified herein.

In some embodiments, antigens are presented on self-assembled nanoparticles, such as self-assembled nanostructures derived from ferritin (FR), E2p, Qβ, and I3-01. E2p is a redesigned variant of dihydrolipoyl acyltransferase from Bacillus stearothermophilus. I3-01 is an engineered protein that can self-assemble into ultrastable nanoparticles. The sequences of these protein subunits are known in the art. In a first aspect, the nanostructure-related polypeptide is at least 75% identical over its length to the amino acid sequence of the nanostructure-related polypeptide selected from the group consisting of SEQ ID NOs: 66-105, and at least one identified interface. Disclosed herein are nanostructure-related polypeptides comprising amino acid sequences that are identical in position. Nanostructure-related polypeptides can be used, for example, to prepare nanostructures. Nanostructure-associated polypeptides were designed such that they can self-assemble in pairs to form nanostructures, such as icosahedral nanostructures.

In some embodiments, the nanostructure comprises (a) a plurality of first assemblies, each of the first assemblies comprising a plurality of identical first nanostructure-associated polypeptides; a plurality of first assemblies, wherein the nanostructure-related polypeptide comprises an amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 66-105; and (b) a plurality of second assemblies, , each of the second assemblies comprises a plurality of identical second nanostructure-associated polypeptides, the second nanostructure-associated polypeptides comprising a nanostructure-associated polypeptide selected from the group consisting of SEQ ID NOS: 66-105. a plurality of second assemblies comprising an amino acid sequence of a peptide, the second nanostructure-associated polypeptide being different from the first nanostructure-associated polypeptide, and the plurality of first assemblies comprising a plurality of second assemblies; It non-covalently interacts with the assembly to form a nanostructure.

The nanostructure is a symmetrically repeated non-natural non-covalent polypeptide-polypeptide that orients the first assembly and the second assembly into a nanostructure, such as a nanostructure with icosahedral symmetry. Contains interfaces.

SEQ ID NOS: 66-105 provide amino acid sequences of exemplary nanostructure-related polypeptides. The number of interfacial residues of the exemplary nanostructure-related polypeptides of SEQ ID NOs: 66-105 ranges from 4 to 13 residues. In various embodiments, the nanostructure-associated polypeptide comprises an amino acid sequence of a nanostructure-associated polypeptide selected from the group consisting of SEQ ID NOs: 66-105 and at least 75%, 80%, 85%, 90% over its length. %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical and at least 1, 2, 3, 4, 5, 6, 7, 8, 9 , comprising amino acid sequences that are identical at 10, 11, 12 or 13 identified interfacial positions (depending on the number of interfacial residues of a given nanostructure-related polypeptide). In other embodiments, the nanostructure-associated polypeptide has an amino acid sequence of a nanostructure-associated polypeptide selected from the group consisting of SEQ ID NOs: 66-105 and at least 75%, 80%, 85%, 90% over its length. %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical and at least 20%, 25%, 33%, 40% of the identified interface locations , 50%, 60%, 70%, 75%, 80%, 90% or 100% identical amino acid sequences. In further embodiments, the nanostructure-related polypeptide comprises a nanostructure-related polypeptide having an amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOs: 66-105.

In one non-limiting embodiment, nanostructure-associated polypeptides can be modified to facilitate covalent attachment to a "cargo" of interest. In one non-limiting example, nanostructure-associated polypeptides can be modified, such as by introducing various cysteine residues at defined positions, to promote binding to one or more antigens of interest. The nanostructures of the nanostructure-associated polypeptides can then provide a scaffold that provides multiple antigens for delivery as a vaccine, resulting in an improved immune response.

In some embodiments, some or all natural cysteine residues present in the nanostructure-associated polypeptide but not intended for use in conjugation are mutated to other amino acids to can promote conjugation at the position. In another non-limiting embodiment, nanostructure-associated polypeptides can be modified by conjugation (covalent or non-covalent) with moieties that help promote "endosomal escape." In applications involving the delivery of molecules of interest to target cells, such as targeted delivery, a critical step can be escape from the endosome (membrane-bound organelle), which is the entry point of the delivery vehicle into the cell. Endosomes mature into lysosomes and degrade their contents. Therefore, unless the delivery vehicle somehow "escapes" from the endosome before the endosome becomes a lysosome, the delivery vehicle will be degraded and will not perform its function. There are various lipids or organic polymers that disrupt endosomes and allow escape into the cytosol. Thus, in this embodiment, nanostructure-associated polypeptides are modified, for example, by introducing cysteine residues that allow chemical conjugation to the monomers or resulting assembly surfaces of such lipids or organic polymers. be able to. In another non-limiting example, nanostructures can be created by, for example, introducing cysteine residues that enable chemical conjugation of fluorophores or other imaging agents that enable visualization of nanostructures in vitro or in vivo. Structurally related polypeptides can be modified.

Surface amino acid residues on nanostructure-associated polypeptides can be mutated to improve the stability or solubility of protein subunits or assembled nanostructures. As one skilled in the art will appreciate, if a nanostructure-related polypeptide has significant sequence homology to an existing protein family, multiple sequence alignments of other proteins from that family can be used. can guide the selection of amino acid mutations at non-conserved positions that can increase protein stability and/or solubility, a process called consensus protein design (9).

Surface amino acid residues on nanostructure-associated polypeptides can be positively charged (Arg, Lys) or negatively charged (Asp, Glu) to impart a total positive or negative charge to the protein surface. Can be mutated into amino acids. In one non-limiting embodiment, surface amino acid residues on the nanostructure-associated polypeptide can be mutated to impart a high net charge to the internal surface of the self-assembling nanostructure. Such nanostructures can then be used to package or encapsulate cargo molecules with opposite net charges due to electrostatic interactions between the nanostructure internal surface and the cargo molecules. In one non-limiting embodiment, surface amino acid residues on the nanostructure-associated polypeptide are mutated primarily to arginine or lysine residues to impart a net positive charge to the internal surface of the self-assembling nanostructure. can be done. A solution containing nanostructure-associated polypeptides is then added to dsDNA, ssDNA, dsRNA, ssRNA, cDNA, miRNA, etc. to encapsulate the nucleic acids inside the self-assembled nanostructures. , siRNA, shRNA, piRNA, or other nucleic acids. Such nanostructures could be used, for example, to protect, deliver, or concentrate nucleic acids.

In one embodiment, the nanostructures have icosahedral symmetry. In this embodiment, the nanostructure may include 60 copies of a first nanostructure-associated polypeptide and 60 copies of a second nanostructure-associated polypeptide. In one such embodiment, the number of identical first nanostructure-associated polypeptides in each first assembly is greater than the number of identical second nanostructure-associated polypeptides in each second assembly. different from the number of For example, in one embodiment, the nanostructure includes 12 first assemblies and 20 second assemblies; in this embodiment, each first assembly includes, for example, 5 copies of the same first assembly. Each second assembly may contain, for example, three copies of the same second nanostructure-associated polypeptide. In another embodiment, the nanostructures include 12 first assemblies and 30 second assemblies; in this embodiment, each first assembly includes, for example, 5 copies of the same first nanostructure. Each second assembly may include, for example, two copies of the same second nanostructure-related polypeptide. In a further embodiment, the nanostructures include 20 first assemblies and 30 second assemblies; in this embodiment, each first assembly includes, for example, 3 copies of the same first nanostructure. Each second assembly may include, for example, two copies of the same second nanostructure-associated polypeptide. All of these embodiments can form synthetic nanomaterials with icosahedral symmetry.

In order that the present disclosure may be better understood, the following examples are included. These examples are for illustrative purposes only and should not be construed as limiting the scope of the disclosure in any way.

(Example 1)
Antigen Design Mutations in FimH _LD or FimH-DSG were designed to lock the FimH lectin domain in an open conformation with the goal of improving functional immunogenicity. The mutations were of different classes as listed in Tables 2-9 below. The amino acid sequences of various mutated FimH polypeptides are shown in Table 1.

(Example 2)
Antigen expression and purification DNA encoding FimH _LD and FimH-DSG variants was cloned into pcDNA3.1 containing the mouse IgK signal peptide and as previously described (PCT International, published May 6, 2021). Publication number WO2021/084429) was expressed in Expi293™ cells. For protein characterization and immunogenicity studies, proteins were isolated using nickel affinity resin and size exclusion chromatography as described in PCT International Publication No. WO2021/084429, published May 6, 2021. I let go.

(Example 3)
Fluorescence Polarization Assay To determine the dissociation constants of FimH mutants toward mannoside ligands, fluorescein conjugated to mannoside ligands with high affinity for FimH was used as described by Rabbani et al. (J. Biol. A fluorescence polarization assay was developed based on the method described by .Chem.293:1835-1849 (2018)). FimH protein was diluted in 20 mM HEPES pH 7.4, 150 mM NaCl, 0.05 mg/mL plus BSA 0.05% in an 11-point 3-fold titration in black flat-bottomed 96-well polypropylene plates (Greiner) with a final volume of 50 μL. 50 μL of 0.7 nM fluorescein octylbiphenylmannopyranoside ligand in the same buffer was added to each well. Plates were incubated overnight at room temperature with shaking at 100 rpm. After 20-24 hours, plates were read on a ClarioStar Plus plate reader with fluorescein excitation at 488 nm and emission at 530 nm.

(Example 4)
Thermostability assay (ThermoFluor assay)
A 384-well thermostability assay using SYPRO Orange was developed to determine the melting temperature of isolated proteins in the apo (unbound) form and in the presence of ligand. A mannoside compound (methyl α-D-mannopyranoside (Sigma M6882)), which mimics FimH's natural ligand (mannose), was used to analyze association to proteins. FimH protein stock solution was prepared by diluting the protein to 4 μM in 40mM Tris pH 8, 400mM NaCl (assay buffer); 1:10 dilution of SYPRO orange dye (Invitrogen S6650) in assay buffer. For a 10 μL final reaction volume in a MicroAmp EnduraPlate Optical 384-well plate (Applied Biosystems 4483285), 4 μM FimH variant (5 μL) was diluted in 1:10 SYPRO orange dye (0.1 μL) and assay buffer. (5 μL) of either the liquid or the ligand. Plates were subjected to melting curve analysis on a QuantStudio 5 real-time PCR system (ThermoFisher) using a 20°C to 98°C dissociation protocol at 0.05°C/sec. TAMRA was designated as target and reporter and ROX as passive reference (but not used for any analysis). Data were plotted as a Maxwell-Boltzmann distribution with temperature (20°C to 98°C) on the X-axis and fluorescence from the TAMRA channel shown on the Y-axis (in the melting curve, assigned specific fluorescence excitation values for the TAMRA reporter). each temperature point read). We established a normalization algorithm to equalize fluorescence intensities between wells and samples, so the Y-axis of fluorescence can be compared between plates on a scale of 0 (no fluorescence) to 1 (highest recorded fluorescence). did it. This equation is shown below. Using the search function in Microsoft Excel (also shown below), record a relative fluorescence (after normalization) value of 0.5 (indicating that approximately half of the protein is dissociated) and correlated. In this way, this temperature of the protein, ie the resulting melting temperature (T _m ), was calculated. The shift in melting temperature (ΔT _m ) was calculated by subtracting the T _m of protein + ligand from the apo condition. T _m was organized from the plate layout using a pivot table in Microsoft Excel.

Equation to normalize TAMRA fluorescence signal:
Normalized value (between 0 and 1) =
(Raw Fluorescence Value - Minimum Fluorescence Value from Whole Well (20°C to 98°C))/
Maximum fluorescence value from whole well - Minimum fluorescence value from whole well

Excel search function to identify T _m (0.5 normalized fluorescence, or 50% protein melting):
=LOOKUP(0.5, start of normalized fluorescence value: end of value, start of $temperature value: end of $value)

(Example 5)
Confirmation of the conformational state of FimH mutants using FimH-specific neutralizing monoclonal antibodies Confirmation of the conformational state of FimH mutants using neutralizing monoclonal antibodies 299-3, 304-1 and 440-2 (developed in-house) confirmed that 229-3 and 304-1 bind to similar epitopes as MAbs 475 and 926 (Kisiela, DI, et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013)); On the other hand, 440-2 appears to recognize a different epitope and bind preferentially to FimH _LD in the open conformation. Variants that maintain structural integrity similar to the wild type are expected to bind all antibodies. For all kinetic real-time biomolecular interaction experiments, ForteBio's Octet HTX was used to measure antibody reactivity with each variant. Experiments were performed at 30° C. with 1000 rpm agitation in 96-well black plates containing 240 μL per well. Equilibrate the Ni-NTA biosensor in a buffer containing 1x PBS buffer (PBT) containing 0.5% BSA and 0.05% Tween 20, then inject the His tag at 5 μg/mL for 5 min. The attached FimH mutant protein was loaded. Biosensors loaded with FimH were allowed to reestablish baseline in PBT for 3 minutes and then associated with antibodies from different bins at 5 μg/mL for 5 minutes. For kinetic analysis of the association step, Octet data analysis software is used and responses in nm shifts are obtained (tabulated).

(Example 6)
Circular dichroism spectroscopy FimH _LD and Far UV (320-250 nm) and near UV (260-200 nm) circular dichroism spectra were recorded for the FimH-DSG mutant. For far UV, a 1 mm cell was used, and for near UV, a 10 mm cell was used. Proteins were diluted to 0.3 mg/mL in PBS and spectra were recorded at 20° C. using cells with 1 mm (far UV) or 10 mm (near UV) path lengths. Scans were run at 100 nm/min with DIT set to 1 second, bandwidth to 3 seconds, and data pitch to 0.1 nm. Sensitivity was set to standard. Ten spectra were accumulated and averaged, respectively for near UV and five for far UV measurements. Spectra were manually corrected for background using the CD spectrum resulting from a blank PBS run and EQ. 1 was used to convert to average residue ellipticity. where θMRE is the calculated average residue ellipticity, θEXP is the experimentally measured CD signal, MW is the protein molecular weight, N is the number of amino acid residues, and C is the protein concentration in mg/mL and l is the optical path length in cm.

EQ. 1
θ _MRE = (θ _EXP・MW)/(10・N・C・l)

(Example 7)
Animal immunogenicity study EC-1678
6-8 week old CD-1 mice were obtained from Charles River Laboratories. Per group, 20 animals were treated at weeks 0, 4 and 8 from a 5.1 mg/mL QS-21 stock solution containing 5mM succinate, 60mM NaCl, 0.1% PS80, pH 5.6. Immunizations were made subcutaneously with 10 μg FimH protein mixed with 20 μg Quillaja Saponaria-21 (QS-21).

(Example 8)
FimH Whole Cell Neutralization Assay To assess the ability of serum from vaccinated animals to inhibit the binding of fimbriated E. coli to mannosylated substrates, FimH whole cell neutralization assay using yeast mannan was performed in whole cells using yeast mannan. The sum assay was used as described in PCT International Publication No. WO2021/084429, published May 6, 2021.

(Example 9)
Purification of FimH-DSG WT and FimH-DSG G15A G16A V27A mutants from CHO cells The proteins were expressed in CHO cells as secreted proteins with a C-terminal His tag. Cell culture supernatants were collected and 1M Tris pH 7.4 and 5M NaCl were added to a final concentration of 20mM and 150mM, respectively. The 5kDa TFF cassette buffer was rinsed and equilibrated in 20mM Tris pH 7.5, 500mM NaCl and 40mM imidazole. The supernatant was concentrated 2x and diafiltered against 6 volumes of 20mM Tris pH 7.5, 500mM NaCl, 40mM imidazole. The Retentate was collected and rinsed with 50-100 mL of 20mM Tris pH 7.5, 500mM NaCl, 40mM Imidazole. The retentate was filtered and rinsed using a 0.2 μm bottle top filter. An XK26/20 column was packed with Ni-Sepharose 6 Fast Flow resin (Cytiva Life Sciences) and equilibrated with 5 column volumes of 20mM Tris pH 7.5, 500mM NaCl, 40mM imidazole. Retentate was applied at half flow rate and washed until a stable baseline was reached (approximately 55 column volumes). Bound proteins were eluted with 20mM Tris, 500mM NaCl, 500mM imidazole, pH 7.5. Fractions containing the protein of interest were pooled and dialyzed in a 2kDa dialysis cassette against 20mM sodium acetate, pH 4.3 at 4°C with two buffer changes. Proteins were applied to an SP-Sepharose cation exchange column (Cytiva Life Sciences) equilibrated with the same buffer. Material bound to the cation exchange resin was eluted with a linear gradient of NaCl using 20 mM sodium acetate, pH 4.3, 1M NaCl buffer. Fractions were pooled and dialyzed against TBS, pH 7.4.

(Example 10)
Analytical size exclusion chromatography (SEC) on FimH-DSG WT and FimH-DSG G15A G16A V27A mutant
Analytical SEC was performed using a Waters X bridge Protein BEH SEC 125 Å 2.5 μm, 4.6 x 300 mm column in TBS, pH 7.4 buffer containing 10 mM EDTA at 25°C. The injection volume was 10 μl and the flow rate was 0.5 mL/min.

(Example 11)
Monosaccharide analysis by high pH anion exchange chromatography (HPAEC-PAD) using amperometric electrochemical detection Aqueous samples of FimH-DSG wild type and FimH-DSG triple mutant (G15A, G16A, V27A) were Digested in fluoroacetic acid for 2 hours at 120°C. After that time, the sample was evaporated to dryness under vacuum at 45° C. for 6 hours. Samples were reconstituted in Milli-Q H ₂ O and evaluated by HPAEC-PAD on a DIONEX ICS 3000 ion chromatography system. A Dionex CarboPac PA1 column (4 x 250 mm) with isocratic elution using a mixture of H ₂ O and 200 mM NaOH was used. Monosaccharide composition was confirmed by comparing the retention times of peaks detected in FimH samples with solutions of known monosaccharide standards.

(Example 12)
Detection of O-antigen sugar moiety binding to FimH-DSG WT and FimH-DSG G15A G16A V27A mutants FimH-DSG WT and FimH-DSG WT and Possible O-antigen interaction with FimH-DSG G15A G16A V27A mutant was determined. Experiments were performed at 30° C. with 1000 rpm agitation in 96-well black plates containing 240 μl per well. Equilibrate the Ni-NTA biosensor in 1× PBS buffer and buffer containing 0.5% BSA and 0.05% Tween 20 (PBT) into which the His tag was added at 5 μg/ml for 5 min. loaded with FimH-DSG WT or FimH-DSG G15A G16A V27A mutant. Biosensors loaded with FimH-DSG WT or FimH-DSG G15A G16A V27A were allowed to reestablish baseline in PBT for 3 minutes, whereupon they were treated with O-antigen polysaccharide CRM conjugate, O9 or O25b or O1a or O2. A fold titration (200-3.125 μg/ml) was loaded. An antigen-loaded biosensor without any polysaccharide was used as a reference. The biosensor loaded with FimH and O antigen titrations was soaked in PBT for 3 minutes to establish a new baseline. Detection of O-antigen binding to the variants was tested in an association step with 5 μg/mL O-antigen-specific mAbs for 5 min (MAb 601 to O9, MAb ECO-80-11 to O25b, MAb ECO-48-2 against O1a and MAb ECO-172-13 against O2). Octet data analysis software is used for kinetic analysis of the association step with reference and the response in nm shifts obtained (tabulated).

(Example 13)
Protein Expression and Purification FimH _LD and FimH-DSG variants were expressed in Expi293 cells and isolated from the supernatant by nickel affinity capture followed by size exclusion chromatography. Note that some mutants had insufficient expression levels and did not proceed to biochemical or biophysical evaluation (e.g., FimH _LD P26C V35C, N33C P157C, N33C L109C, V35C L107C, V35C L109C, S113C T158C). Mutants that were able to obtain sufficient yield were evaluated in thermostability and ligand binding assays.

(Example 14)
Identification of FimH _LD and FimH-DSG variants with improved thermal stability and reduced melting temperature shifts in the presence of mannoside ligands using a SYPRO orange thermal shift-based differential scanning fluorometric assay. Determine the melting temperature of the FimH mutant protein, where T _m designates the temperature at which 50% of the protein is unfolded. Non-covalent ligands often stabilize protein targets through specific binding, resulting in an increase in protein melting temperature. Therefore, the melting temperature was determined in the presence of methyl alpha-D-mannopyranoside, which is a derivative of alpha-D-mannose and has micromolar affinity for FimH (Bouckaert, J. et al., Mol Microbiol. 55, 441-455 (2005)), the difference in melting temperature (ΔT _m ) of the protein in the presence of the ligand compared to the apo form was calculated.

The wild type (WT) FimH-DSG protein exhibited a significantly higher melting temperature and had a lower ΔT _m in the presence of ligand compared to FimH _LD WT (Table 10, Table 11). FimH-DSG WT had a melting temperature of 71.66°C, while the melting temperature of FimH _LD WT was significantly lower (61.54°C). In the presence of methyl alpha-D-mannopyranoside, the melting temperature of FimH _LD WT shifted by 10.99°C, while the temperature of FimH-DSG in the presence of the ligand shifted by 2.13°C. This suggests that FimH _LD is more efficiently stabilized by ligand compared to FimH-DSG, which may reflect reduced ligand binding by FimH-DSG.

The mutations affected the melting temperature of the FimH protein in the apo state and in the presence of ligand. Previously described (Kisiela, D.I. et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, V.B. et al., J Biol Chem 288, 24128-24139 (2013)) The FimH _LD- locked mutant V27C L34C exhibits a lower melting temperature (51.42°C) compared to wild-type FimH _LD (61.54°C), consistent with published data (Kisiela, D.I. et al. Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, V.B. et al., J Biol Chem 288, 24128-24139 (2013)). Incubation of FimH _LD V27C L34C with methyl alpha-D-mannopyranoside increases the melting temperature by 7.27°C compared to the apo form, suggesting that this variant is partially stabilized by the ligand and that the residual ligand binding efficiency This suggests that it is possible to have In the context of FimH-DSG, the V27C L34C variant has lower thermostability (T _m =63.29°C) compared to WT, and the temperature shift in the presence of ligand is lower compared to WT. It was slightly reduced in the V27C L34C mutant (ΔT _m =1.29°C). Five of the six Phe1 FimH _LD variants had decreased melting temperatures compared to WT FimH _LD , except for F1L, which had similar melting temperatures. In the presence of ligand, 4 of the 6 FimH _LD Phe1 mutants show small ΔTm, suggesting insufficient stabilization by the ligand. In contrast, the most conservative amino acid substitutions F1W and F1Y exhibited intermediate and comparable ΔTm values, respectively, relative to Phe1 wild-type FimH _LD . Regarding overall thermostability, the R60P reference mutation (previously described - Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018); Rodriguez, V.B. et al., J Biol Chem 288, 24128-24139 (2013)) and several novel mutations designed in-house had significantly increased melting temperatures compared to V27C L34C. Interestingly, FimH _LD V28C N33C (both sites shifted just one residue away from the reference FimH _LD V27C L34C) has the highest melting temperature of any FimH _LD variant (T _m =65 .77°C), with a ΔT _m of 2.81°C in the presence of methyl alpha-D-mannopyranoside, suggesting reduced affinity for the ligand. Mutations in the glycine loop region (G15A, G16A) in FimH _LD significantly increased thermostability compared to V27C L34C, and a much lower shift in melting temperature was observed in the presence of the ligand. The glycine loop mutations also slightly increased the thermostability of FimH-DSG, and no ligand-induced temperature shift was observed, indicating that the FimH _LD and FimH-DSG mutants are not stabilized by the ligand and, therefore, compared to the wild type. Collectively, we suggest that it may have a reduced coupling efficiency compared to .

The sequence of FimH _LD WT is derived from E. coli UTI isolate J96 (Hull, RA et al., Infect Immun 33, 933-938 (1981)). V27A is a natural variant associated with virulent UTI isolates and isolates associated with Crohn's disease (Schwartz, DJ et al., Proc Natl Acad Sci USA 110, 15530-15537 (2013); Cespedes et al., Front Microbiol 8:639 (2017)). Incorporation of V27A into FimH _LD slightly reduced the melting temperature of FimH _LD WT, and compared to WT, a smaller shift was observed with V27A in the presence of methyl alpha-D-mannopyranoside. On the other hand, V27A appears to have a stabilizing effect in the context of glycine loop mutants G15A, G16A, G15P, G16P in FimH _LD , all of which have higher melting temperatures due to V27A compared to without it. and had a ΔTm of <2°C in the presence of V27A compared to a maximum of 6.05°C without this mutation (G16P). In addition, the FimH-DSG variant containing V27A had slightly increased thermostability with no detectable temperature shift in the presence of ligand. Taken together, this suggests that V27A has a stabilizing effect on the melting temperature of FimH and reduces the ligand binding efficiency.

Some FimH _LD disulfide and nonpolar to polar residue variants are expressed at low levels, poorly thermostable, or exhibit significant temperature shifts in the presence of mannoside compounds, and these (Table 12). These were tested in single replicates and excluded from further analysis. Similarly, we analyzed the thermostability of several other FimH-DSG variants, two of which had improved thermostability and reduced shifts with the ligand (FimH-DSG V27A Q133K and FimH-DSG G15A G16A V27A Q133K) (Table 13). The Q133K mutation is a mutation in the binding pocket of FimH that eliminates ligand binding, previously described (Schwartz et al., Proc Natl Acad Sci USA 110:15530-15537 (2013)). These mutants were not analyzed further.

(Example 15)
Identification of FimH mutants with reduced affinity for mannoside ligands FimH mutants with reduced affinity for mannoside ligands were identified using a direct-bond fluorescence polarization assay with fluorescein-conjugated octylbiphenyl mannopyranoside (BPMP) ligands. The dissociation constant (K _d ) was determined. K _d values of FimH _LD mutants compared to WT are shown in Table 14. FimH _LD WT and V27A showed similar high affinity for BPMP. Reference lock mutant FimH _LD V27C L34C (Kisiela, D.I. et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013); Rodriguez, V.V. et al., J Biol Chem 288:24128-24 139 (2013) ) has a 91-fold lower affinity for the ligand compared to FimH _LD WT, while FimH _LD R60P V27A (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018)) had a 179-fold lower affinity. The variants disclosed herein were compared to reference locked variants. No binding was detected for the glycine loop mutants FimH _LD G15A V27A, G15P V27A, G16P V27A and G16A G16A V27A, whereas G16A V27A had a 156-fold increase in K _d compared to WT. All glycine loop mutations in combination with V27A exhibit significantly higher K _d than the glycine loop mutant alone, with V27A having an unclear stabilizing effect but having little effect on the K _d of FimH _LD WT. suggests. Inclusion of V27A also further decreased the binding affinity of FimH _LD R60P.

Three novel disulfide-locked mutants were tested in this assay and all had a slight reduction in ligand binding affinity compared to FimH _LD WT (33-43 fold lower affinity). FimH _LD mutants containing nonpolar to polar mutations (A119T V27A, A119N V27A, L34T V27A, L34N V27A) had high affinity for BPMP, similar to FimH _LD WT. FimH _LD F1 mutants exhibited poor binding, except for F1Y, which had similar binding affinity to FimH _LD WT.

The ligand binding affinities of the FimH-DSG constructs are shown in Table 15. The K _d of FimH-DSG WT is more than 100 times higher than that of FimH _LD WT, which may reflect _the different conformational states of the two forms of FimH. FimH-DSG V27A also had lower affinity compared to FimH-DSG WT. This is consistent with previous data showing that full-length FimH with A27 complexed with FimC and FimG has reduced binding affinity for mannosides compared to FimH V27 (Schwartz et al., Proc. Natl Acad Sci USA 110:15530-15537 (2013)). Introduction of the locking mutation V27C L34C into FimH-DSG reduced its affinity for BPMP by two-fifths, while the glycine loop mutant FimH-DSG G15A G16A V27A reduced its affinity for BPMP by 28 min compared to FimH-DSG WT. It had an affinity of 1. The K _d for FimH-DSG G15A V27A and FimH-DSG G16A V27A could not be calculated, suggesting that these mutants are unable to bind BPMP. Mutations designed to stabilize FimH-DSG in the open conformation by altering the pilin-lectin domain interface (A115I, V185I) were associated with FimH-DSG, as suggested by thermostability data (Example 14). - Improved binding affinity compared to DSG WT.

In summary, glycine loop mutations in either FimH _LD or FimH-DSG proteins were identified that had very low binding affinity for BPMP. Based on these and thermostability data, glycine mutants were selected for evaluation in functional immunogenicity studies in mice.

(Example 16)
Confirmation of conformational state of FimH mutants by circular dichroism spectroscopy FimH _LD and FimH-DSG mutants (Example 14 and 15) was subjected to secondary and tertiary structure analysis by circular dichroism (CD). Wild type and conformationally locked FimH _LD mutants have distinct tertiary CD profiles (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018)). The secondary and tertiary structures of selected FimH _LD and FimH-DSG wild type and mutant proteins were tested by far-UV CD (secondary structure) and near-UV CD (tertiary structure) (see Figure 1). The far-UV CD spectra of FimH _LD are consistent with previously published data (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018)), and the far-UV spectra of both FimH _LD and FimH-DSG is characteristic of proteins with high beta-sheet content. FimH _LD V27C L34C has a slightly different far-UV spectrum compared to wild-type FimH _LD , as observed by others (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018)). , reflecting an open conformational state. The secondary structure profile of the naturally occurring FimH _LD V27A variant also varied slightly. Overall, the secondary structure of FimH _LD or FimH-DSG mutants is highly similar to the wild-type protein (Figure 1), indicating that the overall secondary structure is not altered in these mutants. suggests. The tertiary structure profile of the FimH _LD variants closely resembles the in-house and published CD spectra of FimH _LD V27 L34C and V27A R60P stabilized in the open conformation state (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018)). The profile of the mutants described herein is also significantly different compared to wild-type FimH _LD or FimH _LD V27A. Taken together, these data demonstrate that the introduced mutations shift the conformation of FimH _LD toward an open conformation, whereas the FimH-DSG tertiary structure is affected by the conformation-stabilizing mutations evaluated herein. suggests that much remains unchanged after the introduction of .

(Example 17)
Characterization of FimH mutants using neutralizing monoclonal antibodies. The conformation was characterized. Competition experiments (not shown) showed that antibodies 229-3 and 304-1 bind to similar ligand binding site epitopes as MAbs 475 and 926 (Kisiela et al., Proc Natl Acad Sci USA 110:19089-19094 (2013)). It has been demonstrated that Monoclonal antibody 440-2 appears to bind to a different epitope and preferentially binds FimH _LD in the open conformation. Antibodies 229-3 and 304-1 were able to recognize all FimH _LD (Table 16) and FimH-DSG (Table 17) variants, but binding was reduced for FimH _LD V27A. In contrast, responses to antibody 440-2 were higher in all FimH _LD or FimH-DSG mutants compared to WT or V27A. This is consistent with the CD spectroscopy profile shown in Figure 1 and suggests that the FimH _LD mutant is in an open conformation. The response by 440-2 was also increased in FimH-DSG WT, which, in combination with the overlapping CD spectroscopy profiles of the FimH-DSG mutant and WT (Example 16), suggests that this protein Whether present or absent, it suggests an open conformational state.

(Example 18)
FimH Mutant Neutralization Data To assess the relative immunogenicity of selected mutants, mice were vaccinated with FimH mutants. of FimH mutants that elicit functional antibody titers using the whole-cell yeast mannan neutralization assay described above and previously (PCT International Publication No. WO2021/084429, published May 6, 2021). Efficacy was quantified. Briefly, pilus-bearing E. coli was incubated with serum and allowed to bind to yeast mannan-coated microtiter plates. The plates were washed and a luminescent probe was used to detect the number of viable E. coli bound to the plates. Serum neutralizing titers that inhibit binding of pilus-bearing bacteria to yeast mannan were determined from an 8-point 2-fold dilution series of serum from vaccinated mice. Titer represents the reciprocal of the serum dilution at which 50% of the bacteria remain bound to the plate. A summary of mean titers and responses is shown in Table 18. Plots of individual mouse IC ₅₀ responses after doses 2 and 3 are shown in FIGS. 2 and 3.

Previous work (PCT International Publication No. WO2021/084429, published May 6, 2021) demonstrated that the previously described disulfide-locked mutant FimH _LD V27C L34C (Kisiela et al., Proc Natl Acad Sci USA 110:19089~ 19094 (2013)) did not improve functional immunogenicity compared to FimH _LD WT. The functional immunogenicity of a novel FimH _LD variant and another previously described conformationally constrained variant FimH _LD V27A R60P (Rabbani et al., J. Biol. Chem. 293:1835-1849 (2018) , are directly compared in Figure 2. Mutants FimH _LD G16A V27A, FimH _LD G15A G16A V27A and FimH _LD V27A R60P had a higher number of responders and higher titers than FimH _LD WT (p-value < Other mutations (G15A V27A, G16P V27A, V28C N33C) did not significantly enhance functional immunogenicity, although high titers were observed in responding mice. , the number of responders in these groups was similar to that in the FimH _LD WT group. Thus, we designed to enhance the functional immunogenicity of FimH _LD by locking _it into an open conformation. Several mutants tested had improved functional immunogenicity compared to FimH _LD WT. After vaccination with two doses of FimH _LD and the FimH-DSG variant, significantly more animals compared to FimH _LD and produced neutralizing titers in the group vaccinated with FimH-DSG (Figure 3). This trend persisted after dose 3, with 95% to 100% of mice vaccinated with FimH-DSG V27A, The IC ₅₀ geometric mean titer (GMT) also increased in all vaccinated FimH-DSG variants after dose 3. Similar FimH-DSG mutants (V27A, G15A V27A, G15A G16A V27A) produced higher GMT compared to the FimH _LD mutant (p-value of <0.05).

(Example 19)
FimH-DSG G15A G16A V27A does not bind to host glycans and can be isolated to homogeneity. FimH-DSG WT and FimH-DSG G15A G16A V27A mutant proteins are secreted proteins that contain a C-terminal His tag. The protein was expressed in CHO cells as a protein. Purification of the recombinant His-tagged form of FimH-DSG was performed as shown in FIG.

After ultrafiltration and diafiltration, the cell-free culture medium containing FimH-DSG WT was isolated on nickel affinity resin and subjected to cation exchange chromatography. The elution peak was rather broad and exhibited some characteristic shoulders, suggesting possible heterogeneity of the FimH-DSG WT species (Figure 5). Interestingly, when the eluted fractions were analyzed by SDS-PAGE, only a single band corresponding to FimH-DSG WT was detected in each fraction.

During the purification process, FimH-DSG exhibited characteristics suggesting that it had poor solubility. In particular, the FimH-DSG WT Ni-Sepharose eluate always appeared cloudy by visual inspection. A shift to acidic pH (4.3) for subsequent purification in SP-Sepharose resulted in clarification of the protein solution. However, poor solubility and aggregation tendency of the FimH-DSG WT preparation was again observed after transfer (dialysis) of the isolated protein into TBS, pH 7.4. This results in a gradual loss of protein due to aggregation and precipitation. Removal of the precipitate by centrifugation does not terminate or slow down the aggregation process, even though the protein concentration at this point is typically reduced to 0.2-0.4 mg/mL. Protein loss due to aggregation can be controlled in the presence of 10% glycerol incorporated into the storage (TBS, pH 7.4) buffer. However, the presence of glycerol did not prevent the formation of HMW soluble aggregates, which were detected spectrophotometrically by monitoring light scattering at 350 nm.

When the same process was utilized to isolate the FimH-DSG G15A G16A V27A mutant, several differences were observed. Firstly, they include the complete absence of any signs of haziness after elution of the protein from the Ni-Sepharose column. Second, the elution peak profile from the SP-Sepharose column was not as broad as that observed with WT FimH-DSG (Figure 6). And finally, the FimH-DSG G15A G16A V27A variant remained completely soluble after transfer to physiological pH buffer (TBS pH 7.4). At concentrations up to 5-6 mg/mL, FimH-DSG G15A G16A V27A mutant did not show any signs of aggregation or precipitation.

Analysis of the isolated FimH-DSG WT and FimH-DSG G15A G16A V27A mutants further revealed characteristic differences between these two variants of FimH-DSG. Analytical size exclusion chromatography (SEC) demonstrated the FimH-DSG G15A G16A V27A variant eluted as a single peak with a retention time consistent with its molecular weight. In contrast, the elution profile of wild-type FimH-DSG was composed of several peaks, and the retention time of the main peak was less than that of the mutant shown in Figure 7. These data clearly demonstrate that FimH-DSG WT forms high molecular mass complexes that are detectable by SEC. The presence of the HMW complex formed by FimH-DSG WT and its propensity to aggregate can be related to the functional activity of its N-terminal lectin-binding domain. Applicants hypothesized that during CHO fermentation and after secretion into the culture medium, FimH-DSG WT binds to glycan molecule(s) released from the surface of host CHO cells. Due to the branched nature of glycans, more than one copy of FimH-DSG molecules can be accommodated by each glycan. Successive "decoration" of glycans by increasing numbers of FimH-DSGs will lead to the formation of various HMW complexes, eventually resulting in loss of solubility and precipitation (see Figure 8). To test this hypothesis, isolated wild-type and mutant FimH-DSG (and FimH _LD ) species were analyzed by high pH anion-exchange chromatography and amperometric electrochemical detection (HPAEC-PAD). ) was subjected to analysis. This method allows the identification of oligosaccharides or glycans in a protein sample and provides information on the composition of these oligosaccharides. Briefly, acid hydrolysis is performed to release monosaccharides, followed by analysis of the peaks compared to monosaccharide standards. The results of HPAEC-PAD analysis showed that isolated FimH-DSG WT (glycosylated) and FimH _LD (non-glycosylated, data not shown) preparations contained significant amounts of monosaccharides. announced that it would. A summary of the identified monosaccharides in FimH-DSG WT and FimH-DSG G15A G16A V27A mutants is shown in Table 19. The content of monosaccharides in FimH-DSG G15A G16A V27A mutant was significantly lower than that of FimH-DSG WT. Furthermore, it is entirely possible that the low monosaccharide content detected represents the sugar moiety of the N-glycan predicted to modify N235.

(Example 20)
FimH _LD and FimH-DSG G15A G16A V27A variants do not bind to E. coli O antigen The repeating units of E. coli O antigens O8 and O9 are composed of polymannose residues. This raised the question whether FimH could bind to the O-antigen conjugate in a FimH-O-antigen conjugate combination vaccine. Biolayer interferometry experiments were designed to determine whether FimH _LD WT is able to bind to either free O9 polysaccharide or CRM-conjugated O9 polysaccharide and to mannoside ligands in binding assays. We tested whether the FimH _LD G15A G16A V27A variant, which was shown to have undetectable affinity, was able to bind. O-antigen binding data is shown in Table 20. At high concentrations of free polysaccharide, a response was observed with FimH _LD WT. A higher response was observed with CRM conjugated polysaccharides. However, detectable binding was abolished by the mutant protein FimH _LD G15A G16A V27A. Similar experiments were set up for FimH-DSG and FimH-DSG WT or FimH-DSG G15A G16A V27A mutants binding to free or CRM-conjugated O antigens of different serotypes (O9, O25b, O1a and O2). The performance was tested (Table 21). As expected from their mannoside ligand binding properties, the overall binding affinity of FimH-DSG WT was significantly lower than the corresponding FimH _LD variant. At the highest concentration of CRM conjugate, some titratable binding was observed with FimH-DSG WT, with only slightly above background levels of binding seen with free polysaccharide. Similar to the FimH _LD G15A G16A V27A mutant, the FimH-DSG G15A G16A V27A protein did not bind to either free or CRM-conjugated polysaccharides. In conclusion, unlike the parental WT FimH _LD or WT FimH-DSG antigens, the derived G15A G16A V27A variant is unable to bind O antigen and has the potential to advance the development of combined FimH and O antigen vaccines. provide a clear path.

(Example 21)
Non-human primates vaccinated with FimH-DSG G15A G16A V27A variant with and without O antigen A. Method 1. FimH IgG dLIA
E. coli mutant fimbrial antigens FimH-DSG G15A G16A V27A coupled to spectrally distinct MagPlex-C microspheres (Luminex) were incubated at room temperature for 1 hour with shaking immediately prior to assay primary incubation. Diluted in blocking buffer to a concentration of 50,000 beads/mL over ~2 hours. Bind the diluted microsphere mixture to the pilin domain of FimH-DSG, an appropriately diluted non-human primate serum sample, control and reference standard, for overnight incubation at 2-8°C with shaking. was added to an assay plate containing a humanized in-house monoclonal antibody (FimH Y202). After washing away unbound components, purified R-phycoerythrin goat anti-human IgG, Fcγ fragment-specific secondary antibody (Jackson ImmunoResearch Laboratories, 109-116-170) was added to the microsphere mixture and incubated at room temperature with shaking. and incubated for 90 minutes. The magnitude of the fluorescent PE signal measured by the Luminex FLEXMAP 3D reader is directly proportional to the amount of anti-FimH-DSG IgG bound to the protein-coupled microspheres. Data were analyzed using a custom SAS application that uses a standard curve log/log linear regression model to interpolate antigen-specific antibody concentration (μg/mL) from median fluorescence intensity. A lower limit of quantification (LLOQ) of 0.763 μg/mL was calculated from the standard curve bias.

2.4-valent O-Ag IgG dLIA
E. coli long O-antigen polysaccharides of serotypes O25b, O1a, O2, and O6 are covalently conjugated to poly-L-lysine, and the resulting conjugate is transferred to a standard EDC/NHS-mediated cup. Coupled to spectrally distinct MagPlex-C microspheres (Luminex) by a ring protocol. Microspheres were incubated with serially diluted non-human primate serum samples, controls and polyclonal standards for overnight incubation at 2-8°C with shaking. After washing, bound serotype specificity was detected using PE-conjugated goat anti-human IgG, Fcγ fragment-specific secondary antibody (Jackson ImmunoResearch Laboratories, 109-115-098) after 90 min incubation at room temperature with shaking. Target IgG was detected. Fluorescence was measured by a Luminex 200 reader for each of the four spectrally distinct regions and expressed as the median fluorescence intensity. Standard curve plots of polyclonal standard titrations yield linear slope profiles with arbitrary assignments, from which signals can be interpolated as serotype-specific antibody levels (U/mL).

3. Non-human primates (NHP)
Female cynomolgus macaques (Cynomolgus Macaque) (Macaca fasciularis) were originally obtained from Charles River Laboratories (Houston, TX) and subsequently purchased from Pfizer, Pearl River, NY (age range: 4-5 years, weight range) :3.1~5.9kg). NHPs were housed in standard quad caging and had free access to water and food. A microchip was implanted under the animal's skin to monitor its internal temperature. Only NHPs without E. coli infection were enrolled based on negative urine qPCR results (see Methods Section 10 below).

4. Vaccination and blood collection in combination with vehicle control (PBS, pH 6.2), monomeric fimbrial antigen FimH-DSG G15A G16A V27A (50 μg/dose), or monomeric fimbrial antigen FimH-DSG G15A G16A V27A (50 μg/dose) Cynomolgus monkeys were immunized intramuscularly (0.55 mL) at weeks 0, 4, and 14 with either a mixture of quadrivalent O25b, O1a, O2, and O6 O antigen polysaccharide conjugates (1 μg/dose). The vaccine antigen was adjuvanted with AS01b (50 μg MPL and 50 μg QS-21 per dose).

At weeks 0, 6 and 16, 10 mL of blood was collected via the femoral vein into one serum separation tube (BD Vacutainer) using a 21 g safety needle/vacutainer. The collection tube was left at room temperature for 30 minutes and centrifuged at 3000g for 10 minutes. Serum in supernatant was collected, aliquoted and stored at -80°C.

5. E. coli Clinical Isolates Pfizer-supported Antimicrobial Testing Leadership and Surveilla maintained by the International Health Management associates (IHMA) patient age and sample from UPEC strains collected as part of the nce (ATLAS) database. One representative ST131 O25b clinical isolate was selected based on the origin of collection (PFEEC0578, male, age 38, bladder origin). This clinical laboratory strain has a gene encoding the production of an unknown type of capsular polysaccharide.

6. UPEC Strain Stock Preparation E. coli stocks were prepared by inoculating 12 mL of LB broth (Teknova, #L8198) followed by overnight incubation at 37° C. under agitation at 275 rpm. After 18 hours, the 12 mL culture was diluted into 113 mL of LB broth in a 250 mL flask (Corning, #431407). Cultures were incubated for 2-3 hours at 37° C. at approximately 275 rpm until the OD ₆₀₀ was between 2.1 and 2.7. 25 mL of glycerol (80%, MP, #3055-044) was mixed into the culture. 5 mL aliquots were frozen at -80°C for long-term storage. Confirm the concentration of viable bacteria per vial by plating serial dilutions of the stock onto TSA plates (BD, BBL Trypticase soy agar (soy bean casein digested agar) catalog #B21283X) and Analyzed after 18 hours incubation at °C.

7. Non-human primate model of cystitis NHPs were anesthetized with a ketamine/Dexdomitor mixture administered intramuscularly. To prevent bladder contamination from urinary catheter placement, the anogenital area was thoroughly wiped with sterile gauze moistened with sterile saline and/or disinfectant wipes containing benzalkonium chloride. A sterile 5 French red rubber catheter, previously coated with Surgi Lube to prevent tissue irritation, was gently introduced into the bladder through the urethra. The bladder was then emptied completely by either natural flow or suction with a syringe. A volume of 1 mL containing 10 ⁸ CFU of UPEC strain PFEEC0578 was administered directly into the bladder through the catheter.

8. Post-challenge animal monitoring After challenge, animals were monitored twice a day for the first week and once a day for subsequent weeks. NHP was monitored up to 30 days after challenge. Monitoring included visual observation of urine output, changes in behavior or appetite, signs of pain/discomfort and temperature measurements.

9. Urine Collection by Catheterization To enable the collection of clean urine samples, the bladders of anesthetized NHPs were catheterized as described above. After catheter placement, urine was emptied to empty the bladder either by natural flow or by suction with a syringe. If the bladder did not contain urine, 10 mL of saline was instilled and suction through the catheter was repeated. All samples taken were immediately stored on ice.

10. DNA extraction E. coli from up to three replicates of NHP urine samples using the Qiagen Minelute DNA extraction kit (Qiagen, Ref #51306, content was sometimes limited by the sample volume collected). DNA extraction was performed. The manufacturer's blood and body fluid spin protocol was followed with the following modifications: Sample starting volume was increased to 500 μL (if sample volume allowed), Buffer AL volume was increased to 500 μL. , proteinase K volume was increased to 50 μL, 50 μL of molecular grade water (Corning Inc., Ref #46-000-CM) warmed to 37° C. was used in place of elution buffer EB. Finally, after addition of 37°C molecular grade water, the spin column was incubated at room temperature for 5 minutes prior to the final spin.

11. Quantitative real-time PCR (qPCR)
Quantitative real-time PCR (qPCR) was used to assess bacterial load in NHP urine samples. E. coli O25b serotype-specific DNA was amplified by qPCR using the following primers: forward, TTGAAAGTGATGGTTTGGTAAGAAAT (SEQ ID NO: 109); reverse, TGCAGCACGTATGATAACTTCAAAG (SEQ ID NO: 110), probed and sequenced with a Fam fluorescent reporter. Replication was quantified using AGGATATTTTACCCAGCAGTGCCCCGT (SEQ ID NO: 111).

The O25b serotype-specific amplicon corresponds to part of the O25b serotype orf10 region. Primers and probes were custom designed and purchased in lyophilized form from Integrated DNA Technologies and reconstituted in Buffer TE (Corning Inc., Ref #46-009-CM) to a concentration of 100 nmol/mL.

DNA samples obtained from the DNA extraction procedure described above were assayed in a 96-well Applied Biosystems MicroAmp Optical 96-well reaction plate (Applied Biosystems, Ref #N8010560). 12.5 μL per well Applied Biosystems 2X Taqman Fast Advanced Master Mix (Applied Biosystems, Ref #4444554), 0.125 μL of each refolding primer, 0.5 μL probe, 1.75 μL molecules Biological grade water (Corning Inc., Ref. #46-000-CM) and 10 μL of sample were used to run the qPCR reaction in a total volume of 25 μl.

Reaction conditions for DNA amplification were: 50°C for 2 min, then 95°C for 2 min, with runs performed on either an Applied Biosystems 7500 Real-Time PCR System or an Applied Biosystems QuantStudio 6 Real-Time PCR System (Applied Biosystems). and 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds.

A linear standard curve was generated to allow quantification. An aliquot of the same E. coli frozen stock used in each challenge experiment (preparation described above) was prepared at 1 x 10 CFU/mL in sterile PBS (Corning, 21-040-CM). It was diluted so that Subsequent serial dilutions were performed to obtain E. coli at concentrations of 1×10 ⁸ , 1×10 ⁷ , 1×10 ⁶ , 1×10 ⁵ , 1×10 ⁴ , 1000, 100, and 10 CFU/mL. A solution containing . Serial dilutions were prepared in sterile PBS (Corning, 21-040-CM) or in pooled, twice-filtered NHP urine collected from subjects prior to inoculation. Dilutions in PBS and pooled twice-filtered NHP urine were later found to be equivalent. The content of viable bacteria present in each dilution was confirmed by plating on TSA plates (BD, BBL Trypticase Soy Agar Catalog #B21283X). DNA extraction was performed at each serial dilution using the same method used to extract DNA from samples as described above. These qPCR standards were run in all qPCR assay plates in duplicate.

Linear regression analysis was performed using Applied Biosystems QuantStudio software. Statistical analysis determined that the standard curve generated behaved linearly between 100 and 1×10 ⁸ bacteria/mL. Consequently, the lower limit of quantification (LLOQ) was determined to be 100 bacteria/mL. In some cases, the sample reached the fluorescence threshold, but in other cases it did not reach the fluorescence threshold at all (undetermined value) in cycles corresponding to content below the LLOQ. If any of these conditions occur, the value is reported herein as the LLOQ value (100 bacteria/mL).

12. Myeloperoxidase (MPO) ELISA
Myeloperoxidase (MPO) was quantified in NHP urine using the Invitrogen Myeloperoxidase Instant ELISA Kit (Invitrogen, Ref #BMS2038INST). PIPES buffer was added to the pure urine sample to a final concentration of 5% 0.5M PIPES buffer pH 6.8 (Alfa Aesar, Ref #J61786-AK). Samples were vortexed for 15 seconds and then diluted 1:1 with manufacturer supplied sample diluent. Samples were assayed in duplicate and the manufacturer's instructions were followed for the remainder of the assay. At the final endpoint, color intensity was measured at 450 nm on a Spectramax Plus instrument (Molecular Devices). A standard curve was generated using the standards included in the assay kit. For analysis, the assay kit's low standard (156.25 pg/mL) was understood to be the lower limit of detection (LLOD). Companion software for the Spectramax instrument (Softmax, Molecular Devices) allows extrapolation beyond low standard values. The half value of LLOD (78.125 pg/mL) was substituted for any value extrapolated below that value or if any assay result was completely below the limit of detection.

13. IL-8 Luminex Assay Interleukin-8 (IL-8) was measured using a custom Bio-Rad IL-8 Human Cytokine Screening Panel Luminex Assay Kit (BioRad Laboratories Inc., REF #17005177). PIPES buffer was added to the pure urine sample to a final concentration of 5% 0.5M PIPES buffer pH 6.8 (Alfa Aesar, Ref #J61786-AK). Samples were vortexed for 15 seconds and then diluted 1:1 with 50% of modified LXA-4 buffer (PBS 1×, 0.5% BSA, 0.025% sodium azide). Samples were assayed in duplicate and the manufacturer's instructions were followed for the remainder of the assay. Assay plates were read on a BioPlex 200 Luminex instrument (BioRad Laboratories Inc.). A standard curve was generated and sample concentration was extrapolated from fluorescence intensity using the companion software "BioPlex Manager" of the Bio-Plex 200 Luminex instrument and the standards included in the assay kit. The BioPlex Manager software determines the lower limit of quantitation (LLOQ).

14. Total Nucleated Cell Count and Light Microscopy Analysis of Urine Sediments Within 1 hour of collection, urine samples (500 μl to 1 mL) were fixed in formalin at a final concentration of 1% and sent to Pfizer Groton, CT on ice overnight. Upon receipt, total nucleated cells (epithelial cells and polymorphonuclear cells) were counted in a hemocytometer. A total of approximately 300 μL was loaded into a Thermo Scientific Shandon EZ double cyto funnel, with 100 μL in one funnel and 200 μL in the other funnel. Samples were cytocentrifuged on Shandon Double Cytoslide Microscope coated glass slides for 5 minutes at 750 rpm using a Thermo Scientific CytoSpin 4 cytocentrifuge. For samples with high cell counts, urine was first diluted 1:10 with 0.9% saline before cytocentrifugation. Cytoprep slides were then briefly fixed in methanol and stained with Giemsa and May-Grunwald stains using a Sysmex SP-10 instrument. For each urine sample, one slide was prepared per urine sample with the two sample volumes listed above.

Cytospin slides containing enriched and stained urinary sediment were divided into segmented cells containing expanded polymorphonuclear cells (PMNs, i.e., generally composed of neutrophils, but also containing eosinophils and basophils). The presence or absence of granulocytes (or granulocytes with reniform nuclei) was assessed by light microscopy. The absence of enlarged PMN cells was determined based on the observation of absence or rarity of PMNs. The presence of increased PMNs was determined based on the observation that PMNs were more abundant than rare compared to the background epithelial cell population.

B. Result 1. Vaccination with FimH-DSG G15A G16A V27A variant with and without O antigen elicits potent total and neutralizing antibodies in non-human primates. , O1a, O2) and the FimH-DSG G15A G16A V27A mutant with or without AS01b adjuvant (Fig. 9). In the FimH-DSG G15A G16A V27A and quadrivalent O-antigen vaccinated groups, O-antigen serotype-specific antibody titers increased nearly 400-fold at 6 weeks post-vaccination (Figure 10 and Table 22). Total anti-FimH antibody titers were quantified using direct luminex immunoassay (dLIA) (Figure 11A and Table 23). Animals in the placebo group had titers below the limit of quantification of the assay. In both vaccinated groups, titers increased after the second dose and could be boosted with the third dose. Overall, titers were slightly lower in animals vaccinated with FimH-DSG G15A G16A V27A and O antigen compared to FimH-DSG G15A G16A V27A alone.

To assess the ability of anti-FimH antibodies to block E. coli binding to yeast mannan, serum was evaluated in an E. coli binding inhibition assay (FIG. 11B and Table 24). The mean IC ₅₀ of sera from animals vaccinated with FimH-DSG G15A G16A V27A alone increased to 293.65 after dose 2 and 1698.39 after dose 3, while in combination with O antigen The mean IC ₅₀ for animals vaccinated with FimH-DSG G15A G16A V27A was 480.12 after dose 2 and 756.45 after dose 3.

Taken together, these data demonstrate that FimH-DSG G15A G16A V27A elicits strong antibody responses in non-human primates and, when combined with O antigen, yields high titers, although slightly lower than with FimH alone. Show that.

2. Vaccination with FimH-DSG G15A G16A V27A variant with and without O antigen reduces bacteriuria and biomarkers of infection in a non-human primate model. Five weeks after the final boost, vaccinated and placebo-treated NHPs 108 CFU of UPEC isolate PFEEC0578 was inoculated via intravesical catheterization. Bacteriuria was monitored in catheter-collected urine over a period of 28 days. In all placebo-treated animals, instillation of live bacteria resulted in high levels of bacteriuria on days 2 and 7 post-challenge (approximately 10 6 bacteria/geometric mean of 1 mL of urine). Compared to the placebo group, animals vaccinated with FimH-DSG G15A G16A V27A or FimH-DSG G15A G16A V27A + 4-valent O antigen had 300 times less geometric mean bacteriuria or It exhibited a reduction of 1/1000.

At day 14, approximately 50% of the placebo-vaccinated animals still exhibited bacteriuria >105 bacteria/mL of urine. Finally, the majority of placebo NHPs cleared the infection on days 21 and 28. In contrast, most FimH-DSG G15A G16A V27A or FimH-DSG G15A G16A V27A + quadrivalent O antigen vaccinated animals cleared the infection by day 14 (Figure 12).

Next, various inflammatory biomarkers were monitored in the urine of loaded NHPs. Seven days post-challenge, all placebo-treated animals exhibited elevated levels of polymorphonuclear (PMN) cells in the urine sediment, as confirmed by cytological analysis. In contrast, less than 25% of FimH-DSG G15A G16A V27A vaccinated NHPs had increased levels of PMN cells in the urine sediment, and FimH-DSG G15A G16A V27A + quadrivalent O antigen-immunized animals had increased levels of PMN cells in the urine sediment. (Figure 13C). In parallel, applicants measured myeloperoxidase (MPO) and interleukin 8 (IL-8) levels in urine samples over a period of 7 days. On day 2 post-challenge, both vaccinated groups exhibited a two-fold reduction in MPO levels (geometric mean of nearly 200 pg/mL) compared to the placebo group (geometric mean of 470 pg/mL). ) (Figure 13A).

In addition, on days 2 and 7 post-infection, urinary concentrations of IL-8 in FimH-DSG G15A G16A V27A vaccinated animals were lower than levels measured in the urine of placebo-treated NHPs (54.2 pg/mL and 32 (geometric mean of 5.9 pg/mL and 9.8 pg/mL), respectively. In a similar trend, urinary levels of IL-8 on days 2 and 7 in FimH-DSG G15A G16A V27A immunized NHPs in combination with O antigen compared with IL-8 concentrations observed in placebo-treated animals. were approximately reduced by a factor of five and a factor of three, respectively (geometric mean of 11.3 pg/mL) (FIG. 13B).

C. Conclusion FimH-DSG G15A G16A V27A variant induces high anti-FimH IgG titers in NHPs that can be boosted with a third dose. Animals vaccinated with the combination of FimH-DSG G15A G16A V27A variant and quadrivalent O antigen showed high O antigen IgG titers.

FimH-DSG G15A G16A V27A elicits potent neutralizing antibodies in non-human primates. The combination with tetravalent O antigen is similarly immunogenic.

FimH-DSG G15A G16A V27A variants with or without tetravalent O antigen reduce bacteriuria and biomarkers of infection in a cynomolgus monkey urinary tract infection model.

The following items describe additional aspects of the disclosure:

C1. A mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of a wild-type FimH polypeptide, wherein the mutation position is F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129, Q133, A mutated FimH polypeptide selected from the group consisting of F144, V154, V155, V156, P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59.

C2. F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; P26C; V27A; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; L107C; Y108C; L109C; 119D; A119E; A119K; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; Mutated FimH polypeptide.

C3. Mutated FimH polypeptide according to item C2, comprising mutations G15A and G16A.

C4. Mutated FimH polypeptide according to item C2, comprising mutations P12C and A18C.

C5. Mutated FimH polypeptide according to item C2, comprising mutations G14C and F144C.

C6. Mutated FimH polypeptide according to item C2, comprising mutations P26C and V35C.

C7. Mutated FimH polypeptide according to item C2, comprising mutations P26C and V154C.

C8. Mutated FimH polypeptide according to item C2, comprising mutations P26C and V156C.

C9. Mutated FimH polypeptide according to item C2, comprising mutations V27C and L34C.

C10. Mutated FimH polypeptide according to item C2, comprising mutations V28C and N33C.

C11. Mutated FimH polypeptide according to item C2, comprising mutations V28C and P157C.

C12. Mutated FimH polypeptide according to item C2, comprising mutations Q32C and Y108C.

C13. Mutated FimH polypeptide according to item C2, comprising mutations N33C and L109C.

C14. Mutated FimH polypeptide according to item C2, comprising mutations N33C and P157C.

C15. Mutated FimH polypeptide according to item C2, comprising mutations V35C and L107C.

C16. Mutated FimH polypeptide according to item C2, comprising mutations V35C and L109C.

C17. Mutated FimH polypeptide according to item C2, comprising mutations S62C and T86C.

C18. Mutated FimH polypeptide according to item C2, comprising mutations S62C and L129C.

C19. Mutated FimH polypeptide according to item C2, comprising mutations Y64C and L68C.

C20. Mutated FimH polypeptide according to item C2, comprising mutations Y64C and A127C.

C21. Mutated FimH polypeptide according to item C2, comprising mutations L68C and F71C.

C22. Mutated FimH polypeptide according to item C2, comprising mutations V112C and T158C.

C23. Mutated FimH polypeptide according to item C2, comprising mutations S113C and G116C.

C24. Mutated FimH polypeptide according to item C2, comprising mutations S113C and T158C.

C25. Mutated FimH polypeptide according to item C2, comprising mutations V118C and V156C.

C26. Mutated FimH polypeptide according to item C2, comprising mutations A119C and V155C.

C27. Mutated FimH polypeptide according to item C2, comprising mutations L34N and V27A.

C28. Mutated FimH polypeptide according to item C2, comprising mutations L34S and V27A.

C29. Mutated FimH polypeptide according to item C2, comprising mutations L34T and V27A.

C30. Mutated FimH polypeptide according to item C2, comprising mutations L34D and V27A.

C31. Mutated FimH polypeptide according to item C2, comprising mutations L34E and V27A.

C32. Mutated FimH polypeptide according to item C2, comprising mutations L34K and V27A.

C33. Mutated FimH polypeptide according to item C2, comprising mutations L34R and V27A.

C34. Mutated FimH polypeptide according to item C2, comprising mutations A119N and V27A.

C35. Mutated FimH polypeptide according to item C2, comprising mutations A119S and V27A.

C36. Mutated FimH polypeptide according to item C2, comprising mutations A119T and V27A.

C37. Mutated FimH polypeptide according to item C2, comprising mutations A119D and V27A.

C38. Mutated FimH polypeptide according to item C2, comprising mutations A119E and V27A.

C39. Mutated FimH polypeptide according to item C2, comprising mutations A119K and V27A.

C40. Mutated FimH polypeptide according to item C2, comprising mutations A119R and V27A.

C41. Mutated FimH polypeptide according to item C2, comprising mutations G15A and V27A.

C42. Mutated FimH polypeptide according to item C2, comprising mutations G16A and V27A.

C43. Mutated FimH polypeptide according to item C2, comprising mutations G15P and V27A.

C44. Mutated FimH polypeptide according to item C2, comprising mutations G16P and V27A.

C45. Mutated FimH polypeptide according to item C2, comprising mutations G15A, G16A and V27A.

C46. Mutated FimH polypeptide according to item C2, comprising mutations G65A and V27A.

C47. Mutated FimH polypeptide according to item C2, comprising mutations V27A and Q133K.

C48. Mutated FimH polypeptide according to item C2, comprising mutations G15A, G16A, V27A and Q133K.

C49. A mutated FimH polypeptide according to item C2, comprising a sequence of any one of SEQ ID NOs: 2-58 and 60-64.

C50. A mutated FimH polypeptide according to any of items C1-C49, which has been isolated.

C51. A pharmaceutical composition comprising (i) a mutated FimH polypeptide according to any one of items C1-C50, and (ii) a pharmaceutically acceptable carrier.

C52. An immunogenic composition comprising a mutated FimH polypeptide according to any one of items C1-C50.

C53. The immunogenic composition according to item C52, further comprising at least one additional antigen.

C54. The immunogenic composition according to item C53, wherein the at least one additional antigen is a sugar or a polysaccharide or a sugar conjugate or a protein.

C55. The immunogenic composition according to item C52, further comprising at least one adjuvant.

C56. A nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence of a mutated FimH polypeptide according to any one of items C1-C49.

C57. A mutated FimH polypeptide according to any of items C1-C50, which is immunogenic.

C58. A recombinant mammalian cell comprising a polynucleotide encoding a mutated FimH polypeptide according to any one of items C1-C50.

C59. A culture comprising a recombinant cell according to item C58, the culture being at least 5 liters in size.

C60. A method for producing a mutated FimH polypeptide according to any one of items C1 to C50, comprising culturing a recombinant mammalian cell according to item C58 under suitable conditions, thereby comprising: A method comprising: expressing a polypeptide; and collecting the polypeptide.

C61. (i) for inducing an immune response in a subject against extraintestinal pathogenic E. coli, or (ii) for opsonophagocytosis and/or in a subject specific for extraintestinal pathogenic E. coli. A method for inducing the production of neutralizing antibodies, the method comprising administering to a subject an effective amount of a composition according to any one of items C51-C55.

C62. The method of item C61, wherein the subject is at risk of developing a urinary tract infection.

C63. The method according to item C61, wherein the subject is at risk of developing bacteremia.

C64. The method according to item C61, wherein the subject is at risk of developing sepsis.

C65. A method of eliciting an immune response against E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C51 to C55.

C66. The method according to item C65, wherein the immune response comprises opsonophagocytosis and/or neutralizing antibodies against E. coli.

C67. The method of item C65, wherein the immune response protects the mammal from E. coli infection.

C68. A method of preventing, treating or ameliorating a bacterial infection, disease or condition in a subject, comprising administering to the subject an immunologically effective amount of a composition according to any one of items C51-C55.

C69. Additional antigens may include formula O1 (e.g., formula O1A, formula O1B and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and Formula O5ac (stock 180/C3)), Formula O6 (e.g. Formula O6:K2;K13;K15 and Formula O6:K54), Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13 , formula O14, formula O15, formula O16, formula O17, formula O18 (e.g., formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O19, formula O20, formula O21, formula O22, formula O23 (e.g. , formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O27, formula O28, formula O29, formula O30, formula O32, formula O33, formula O34, formula O35, formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45 (e.g., Formula O45 and Formula O45rel), Formula O46, Formula O48, Formula O49, Formula O50, Formula O51 , formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60, formula O61, formula O62, formula 62D ₁ , formula O63, formula O64, formula O65, formula O66, Formula O68, Formula O69, Formula O70, Formula O71, Formula O73 (for example, Formula O73 (stock 73-1)), Formula O74, Formula O75, Formula O76, Formula O77, Formula O78, Formula O79, Formula O80, Formula O81 , formula O82, formula O83, formula O84, formula O85, formula O86, formula O87, formula O88, formula O89, formula O90, formula O91, formula O92, formula O93, formula O95, formula O96, formula O97, formula O98, formula O99, formula O100, formula O101, formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula 0111, formula O112, formula O113, formula O114, formula O115, Formula O116, Formula O117, Formula O118, Formula O119, Formula O120, Formula O121, Formula O123, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O129, Formula O130, Formula O131, Formula O132, Formula O133 , formula O134, formula O135, formula O136, formula O137, formula O138, formula O139, formula O140, formula O141, formula O142, formula O143, formula O144, formula O145, formula O146, formula O147, formula O148, formula O149, formula O150, formula O151, formula O152, formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, Formula O167, Formula O168, Formula O169, Formula O170, Formula O171, Formula O172, Formula O173, Formula O174, Formula O175, Formula O176, Formula O177, Formula O178, Formula O179, Formula O180, Formula O181, Formula O182, Formula O183 , formula O184, formula O185, formula O186 and formula O187 (wherein n is an integer from 1 to 100), the immunogen according to item C54. sexual composition.

C70. The sugar is of formula O1 (e.g., formula O1A, formula O1B, and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g., formula O6:K2;K13;K15 and formula O6:K54), formula O7, formula O10, formula O16, formula O17, formula O18 (e.g., formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O21, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O28, formula O44, formula O45 (e.g., formula O45 and formula O45rel), formula O55, formula O56, formula O58, formula O64, formula O69, formula O73 (e.g., formula O73 (stock 73-1)), formula O75, formula O77, formula O78, Formula O86, Formula O88, Formula O90, Formula O98, Formula O104, Formula O111, Formula O113, Formula O114, Formula O119, Formula O121, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O136, Formula O138 , Formula O141, Formula O142, Formula O143, Formula O147, Formula O149, Formula O152, Formula O157, Formula O158, Formula O159, Formula O164, Formula O173, Formula O62D ₁ , Formula O22, Formula O35, Formula O65, Formula O66, An item containing a structure selected from formula O83, formula O91, formula O105, formula O116, formula O117, formula O139, formula O153, formula O167, and formula O172 (wherein n is an integer from 31 to 100) The immunogenic composition described in C69.

C71. The sugar is of formula O1 (e.g., formula O1A, formula O1B, and formula O1C), formula O2, formula O3, formula O4 (e.g., formula O4:K52 and formula O4:K6), formula O5 (e.g., formula O5ab and formula O5ac (stock 180/C3)), formula O6 (e.g., formula O6:K2;K13;K15 and formula O6:K54), formula O7, formula O10, formula O16, formula O17, formula O18 (e.g., formula O18A, formula O18ac, formula O18A1, formula O18B, and formula O18B1), formula O21, formula O23 (e.g., formula O23A), formula O24, formula O25 (e.g., formula O25a and formula O25b), formula O26, formula O28, formula O44, formula O45 (e.g., formula O45 and formula O45rel), formula O55, formula O56, formula O58, formula O64, formula O69, formula O73 (e.g., formula O73 (stock 73-1)), formula O75, formula O77, formula O78, Formula O86, Formula O88, Formula O90, Formula O98, Formula O104, Formula O111, Formula O113, Formula O114, Formula O119, Formula O121, Formula O124, Formula O125, Formula O126, Formula O127, Formula O128, Formula O136, Formula O138 , formula O141, formula O142, formula O143, formula O147, formula O149, formula O152, formula O157, formula O158, formula O159, formula O164, formula O173, and formula 62D ₁ (where n is an integer from 31 to 100 The immunogenic composition according to item C70, comprising a structure selected from:

C72. Formula O1 (e.g., Formula O1A, Formula O1B, and Formula O1C), Formula O2, Formula O6 (e.g., Formula O6:K2;K13;K15 and Formula O6:K54), Formula O15, Formula O16, Formula O21, Formula O25 (e.g., Formula O25a and Formula O25b), and Formula O75.

C73. The immunogenic composition according to item C70, comprising a structure selected from formula O4, formula O11, formula O21, and formula O75.

C74. The immunogenic composition according to item C69, which does not contain a structure selected from formula O8, formula O9a, formula O9, formula 20ab, formula O20ac, formula O52, formula O97, and formula O101.

C75. The immunogenic composition according to item C69, which does not contain a structure selected from formula O12.

C76. The immunogenic composition according to item C72, produced by expressing a wzz family protein in a Gram-negative bacterium that produces said sugar.

C77. The immunogenic composition according to item C76, wherein the wzz family protein is selected from the group consisting of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2.

C78. The immunogenic composition according to item C76, wherein the wzz family protein is wzzB.

C79. The immunogenic composition according to item C76, wherein the wzz family protein is fepE.

C80. The immunogenic composition according to item C76, wherein the wzz family proteins are wzzB and fepE.

C81. The immunogenic composition according to item C76, wherein the wzz family protein is derived from Salmonella enterica.

C82. The wzz family protein is any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121. An immunogenic composition according to item C76, comprising a sequence selected from.

C83. 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116. genic composition.

C84. The immunogenic composition according to item C76, wherein the wzz family protein comprises a sequence selected from any one of SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121.

C85. The immunogenic composition according to item C69, wherein the sugar is synthetically synthesized.

C86. The immunogenic composition according to any one of items C69 to C85, further comprising an E. coli R1 portion.

C87. The immunogenic composition according to any one of items C69 to C85, further comprising an E. coli R2 portion.

C88. The immunogenic composition according to any one of items C69 to C85, further comprising an E. coli R3 portion.

C89. The immunogenic composition according to any one of items C69 to C85, further comprising an E. coli R4 moiety.

C90. The immunogenic composition according to any one of items C69 to C85, further comprising an E. coli K-12 moiety.

C91. The immunogenic composition according to any one of items C69 to C90, further comprising a 3-deoxy-d-manno-octa-2-urosonic acid (KDO) moiety.

C92. The immunogenic composition according to any one of items C69 to C85, further not comprising an E. coli R1 moiety.

C93. The immunogenic composition according to any one of items C69 to C85, further not comprising an E. coli R2 moiety.

C94. The immunogenic composition according to any one of items C69 to C85, further not comprising an E. coli R3 moiety.

C95. The immunogenic composition according to any one of items C69 to C85, further not comprising an E. coli R4 moiety.

C96. The immunogenic composition according to any one of items C69 to C85, further not comprising an E. coli K-12 moiety.

C97. The immunogenic composition according to any one of items C69 to C90, which further does not contain a 3-deoxy-d-manno-octa-2-urosonic acid (KDO) moiety.

C98. The immunogenic composition according to any one of items C69 to C91, which does not contain lipid A.

C99. The immunogenic composition according to any one of items C69 to C98, wherein the polysaccharide has a molecular weight of 10 kDa to 2,000 kDa, or 50 kDa to 2,000 kDa.

The immunogenic composition according to any one of items C69 to C99, having an average molecular weight of C100.20 to 40 kDa.

C101. The immunogenic composition according to any one of items C69 to C100, wherein the sugar has an average molecular weight of 40,000 to 60,000 kDa.

C102. The immunogenic composition according to any one of items C69 to C101, wherein n is an integer from 31 to 90.

C103. An immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide according to any one of items C69-C50 and a sugar covalently linked to a carrier protein, wherein the sugar is ), an immunogenic composition derived from
C104. An immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide according to any one of items C69-C50 and a saccharide according to any one of items C69-C102 covalently linked to a carrier protein. .

C105. An immunogenic composition comprising a mutated FimH polypeptide or a fragment thereof according to any one of items C69 to C50; and a conjugate according to any one of items C69 to C102, the composition comprising: a carrier; If the protein is poly(L-lysine), CRM ₁₉₇ , diphtheria toxoid fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or P. aeruginosa Exotoxin A derived from Pseudomonas aeruginosa; detoxifying exotoxin A (EPA) of Pseudomonas aeruginosa, maltose binding protein (MBP), detoxifying hemolysin A of S. aureus, clan Ping factor A, clumping factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its detoxified variants, C. jejuni AcrA, C. jejuni natural glycoprotein , and Streptococcal C5a peptidase (SCP).

C106. The immunogenic composition according to any one of items C103 to C105, wherein the carrier protein is CRM ₁₉₇ .

C107. The immunogenic composition according to any one of items C103 to C105, wherein the carrier protein is tetanus toxoid (TT).

C108. The immunogenic composition according to any one of items C103 to C105, wherein the carrier protein is poly(L-lysine).

C109. The immunogenic composition according to any one of items C103 to C107, wherein the conjugate is prepared by reductive amination.

C110. The immunogenic composition according to any one of items C103 to C107, which is prepared by CDAP chemistry.

C111. The immunogenic composition according to any one of items C103 to C107, which is a single end-linked conjugated saccharide.

C112. The immunogenic composition of any one of items C103 to C107, conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer.

C113. The sugar is conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer, the sugar is covalently attached to the eTEC spacer via a carbamate bond, and the carrier protein is conjugated to an amide bond. The immunogenic composition according to item C112, wherein the immunogenic composition is covalently linked to the eTEC spacer via.

C114. The immunogenic composition of any one of items C112 to C113, wherein CRM ₁₉₇ comprises 2 to 20, or 4 to 16 lysine residues covalently linked to the polysaccharide via an eTEC spacer.

C115. The immunogenic composition according to any one of items C103 to C114, wherein the sugar:carrier protein ratio (w/w) is between 0.2 and 4.

C116. The immunogenic composition according to any one of items C103 to C114, wherein the sugar to protein ratio is at least 0.5 and at most 2.

C117. The immunogenic composition according to any one of items C103 to C114, wherein the sugar to protein ratio is between 0.4 and 1.7.

C118. Immunogenicity according to any one of items C111 to C117, wherein the sugar is conjugated to a carrier protein via a 3-deoxy-d-manno-octa-2-urosonic acid (KDO) residue. Composition.

C119. The conjugate comprises a sugar covalently attached to a carrier protein, wherein the sugar is of formula O8, formula O9a, formula O9, formula O20ab, formula O20ac, formula O52, formula O97 and formula O101, where n is 1-10 an integer of ).

C120. An immunogenic composition comprising a mutated FimH polypeptide and a saccharide according to any one of items C69 to C102, and a pharmaceutically acceptable diluent.

C121. An immunogenic composition comprising a mutated FimH polypeptide and a saccharide conjugate according to any one of items C103 to C119, and a pharmaceutically acceptable diluent.

C122. The immunogenic composition of item C121, comprising at most about 25% free sugars compared to the total amount of sugars in the composition.

C123. The immunogenic composition according to any one of items C120 to C121, further comprising an adjuvant.

C124. The immunogenic composition according to any one of items C120 to C121, further comprising aluminum.

C125. The immunogenic composition according to any one of items C120 to C121, further comprising QS-21.

C126. The immunogenic composition according to any one of items C120 to C121, further comprising a CpG oligonucleotide.

C127. The immunogenic composition according to any one of items C120 to C121, which does not contain an adjuvant.

C128. A mutated FimH polypeptide according to any of items C69 to C118 and an E. coli (E. An immunogenic composition comprising a saccharide derived from E. coli, wherein the polysaccharide is covalently linked to the eTEC spacer via a carbamate bond, and the carrier protein is covalently linked to the eTEC spacer via an amide bond. An immunogenic composition linked by.

C129. The immunogenic composition according to item C128, wherein the sugar is an O antigen derived from E. coli.

C130. The immunogenic composition according to item C128, further comprising a pharmaceutically acceptable excipient, carrier or diluent.

C131. The immunogenic composition according to item C128, wherein the sugar is an O antigen derived from E. coli.

C132. a mutated FimH polypeptide, and a polysaccharide covalently attached to the eTEC spacer via a carbamate bond, and a carrier protein covalently attached to the eTEC spacer via an amide bond, (2-((2-oxoethyl)thio) An immunogenic composition comprising a saccharide according to any one of items C69 to C85, conjugated to a carrier protein via an ethyl) carbamate (eTEC) spacer.

C133. A conjugate of a mutated FimH polypeptide and (i) an E. coli O25B antigen covalently coupled to a carrier protein, (ii) an E. coli covalently coupled to a carrier protein. (iii) a conjugate of an E. coli O2 antigen covalently coupled to a carrier protein; and (iv) a conjugate of an O6 antigen covalently coupled to a carrier protein. An immunogenic composition, wherein the E. coli O25B antigen comprises a structure of formula O25B, where n is an integer greater than 30.

C134. The carrier protein is poly(L-lysine), CRM ₁₉₇ , diphtheria toxoid fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or green Exotoxin A from Pseudomonas aeruginosa; detoxified exotoxin A (EPA) of P. aeruginosa, maltose binding protein (MBP), detoxified exotoxin A of S. aureus hemolysin A, clumping factor A, clumping factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its detoxified variants, C. jejuni AcrA, The immunogenic composition according to item C133, selected from any one of C. jejuni natural glycoprotein and Streptococcal C5a peptidase (SCP).

C135. A conjugate of a mutated FimH polypeptide according to any one of items C69 to C118, and (i) an E. coli O25B antigen covalently coupled to a carrier protein, (ii) a carrier protein. (iii) a conjugate of an E. coli O11 antigen covalently coupled to a carrier protein; and (iv) a carrier protein. An immunogenic composition comprising a conjugate of an O21 antigen covalently coupled to a protein, wherein the E. coli O25B antigen has the formula O75 (where n is an integer greater than 30). ).

C136. The carrier protein is poly(L-lysine), CRM ₁₉₇ , diphtheria toxoid fragment B (DTFB), DTFB C8, diphtheria toxoid (DT), tetanus toxoid (TT), fragment C of TT, pertussis toxoid, cholera toxoid, or green Exotoxin A from Pseudomonas aeruginosa; detoxifying exotoxin A (EPA) of P. aeruginosa, maltose binding protein (MBP), detoxifying hemolysin A of S. aureus, Clumping factor A, clumping factor B, cholera toxin B subunit (CTB), Streptococcus pneumoniae pneumolysin and its detoxified variants, C. jejuni AcrA, C. jejuni natural sugar The immunogenic composition according to item C135, selected from any one of proteins, and Streptococcal C5a peptidase (SCP).

C137. Creating an immunogenic composition comprising a conjugate comprising a mutated FimH polypeptide and a sugar conjugated to a carrier protein via a (2-((2-oxoethyl)thio)ethyl)carbamate (eTEC) spacer a) reacting a sugar with 1,1'-carbonyl-di-(1,2,4-triazole) (CDT) or 1,1'-carbonyldiimidazole (CDI) in an organic solvent; , producing an activated sugar; b) reacting the activated sugar with cystamine or cysteamine or a salt thereof to produce a thiolated sugar; c) reacting the thiolated sugar with a reducing agent to produce one or producing an activated thiolated sugar containing a plurality of free sulfhydryl residues; d) reacting the activated thiolated sugar with an activated carrier protein containing one or more α-haloacetamide groups to produce a thiol producing a high saccharide-carrier protein conjugate; and e) converting the thiolated saccharide-carrier protein conjugate into a first step capable of capping the unconjugated α-haloacetamide groups of the activated carrier protein (i). and/or (ii) a second capping reagent capable of capping unconjugated free sulfhydryl residues, thereby producing an eTEC-linked saccharide conjugate, wherein the saccharide is expressing a polynucleotide encoding a FimH-derived polypeptide or fragment thereof in a recombinant mammalian cell; and isolating said polypeptide or fragment thereof. How to further include.

C138. The method according to item C137, comprising making an immunogenic composition according to any one of items C69 to C102.

C139. Capping step e) comprises a thiolated sugar-carrier protein conjugate and (i) N-acetyl-L-cysteine as a first capping reagent, and/or (ii) iodine as a second capping reagent. The method according to any one of items C137 to C138, comprising reacting with acetamide.

C140. further comprising the step of mixing the sugars by reaction with a triazole or imidazole to provide a mixed sugar, and prior to step a), the mixed sugars are shell frozen, lyophilized and reconstituted in an organic solvent. The method according to any one of items C137 to C139.

C141. The method of any one of items C137 to C140, further comprising purifying the thiolated polysaccharide produced in step c), the purification step comprising diafiltration.

C142. The method of any one of items C137 to C141, further comprising purifying the eTEC-linked saccharide conjugate by diafiltration.

C143. The organic solvent in step a) is dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP), acetonitrile, 1,3-dimethyl-3,4,5 , 6-tetrahydro-2(1H)-pyrimidinone (DMPU) and hexamethylphosphoramide (HMPA), or a mixture thereof. The method described in paragraph (1).

C144. The medium contains KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O, Na ₂ MoO ₄ - an element selected from any one of 2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O; The method according to any one of items C137 to C142, including:

C145. The medium according to item C144, used for culturing E. coli.

C146. Cultivating recombinant E. coli in a medium; producing the sugar by culturing the cell in the medium, whereby the cell produces the sugar. Item C69 A method for producing a sugar according to any one of item C102 from.

C147. The medium contains KH ₂ PO ₄ , K ₂ HPO ₄ , (NH ₄ ) ₂ SO ₄ , sodium citrate, Na ₂ SO ₄ , aspartic acid, glucose, MgSO ₄ , FeSO ₄ -7H ₂ O, Na ₂ MoO ₄ - an element selected from any one of 2H ₂ O, H ₃ BO ₃ , CoCl ₂ -6H ₂ O, CuCl ₂ -2H ₂ O, MnCl ₂ -4H ₂ O, ZnCl ₂ and CaCl ₂ -2H ₂ O; The method according to item C146, comprising:

C148. The method according to item C146, wherein the medium comprises soybean hydrolyzate.

C149. The method of item C146, wherein the medium comprises a yeast extract.

C150. The method of item C146, wherein the medium is further free of soybean hydrolyzate and yeast extract.

C151. The method of item C146, wherein the E. coli cell comprises a heterologous wzz family protein selected from any one of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2.

C152. The E. coli cells are infected with Salmonella enterica selected from any one of wzzB, wzz, wzz _SF , wzz _ST , fepE, wzz _fepE , wzz1 and wzz2. Items containing ica) wzz family proteins The method described in C146.

C153. The method of item C152, wherein the wzz family protein comprises a sequence selected from any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116.

C154. The method of item C146, wherein the culturing results in a yield of greater than 120 OD ₆₀₀ /mL.

C155. The method of item C146, further comprising purifying the sugar.

C156. The purification step is one of the following: dialysis, concentration operation, diafiltration operation, tangential flow filtration, sedimentation, elution, centrifugation, sedimentation, ultrafiltration, depth filtration, and column chromatography (ion exchange chromatography, The method of item C146, comprising multimode ion exchange chromatography, DEAE, and hydrophobic interaction chromatography).

C157. A method for inducing an immune response in a subject, comprising administering to the subject a composition according to any one of items C69 to C136.

C158. The method of item C157, wherein the immune response comprises induction of anti-E. coli O-specific polysaccharide serum antibodies.

C159. The method of item C157, wherein the immune response comprises induction of anti-E. coli IgG antibodies.

C160. The method of item C157, wherein the immune response comprises inducing bactericidal activity against E. coli.

C161. The method of item C157, wherein the immune response comprises induction of opsonophagocytic antibodies against E. coli.

C162. The method of item C157, wherein the immune response comprises a geometric mean titer (GMT) level of at least 1,000-200,000 after the first administration.

C163. wherein the composition comprises a saccharide having the formula O25, where n is an integer from 40 to 100, and the immune response is at a geometric mean titer (GMT) level of at least 1,000 to 200,000 after the first administration. The method according to item C157, comprising:

C164. Targets include urinary tract infection, cholecystitis, cholangitis, diarrhea, hemolytic uremic syndrome, neonatal meningitis, urinary sepsis, intra-abdominal infection, meningitis, combined pneumonia, wound infection, and post-prostate biopsy related infection. , neonatal/infant sepsis, neutropenic fever, and other bloodstream infections; pneumonia, bacteremia, and sepsis.

C165. The method according to item C157, wherein the subject is a mammal.

C166. (i) for inducing an immune response in the subject against extraintestinal pathogenic E. coli, or (ii) opsonophagocytic antibodies in the subject that are specific for extraintestinal pathogenic E. coli. A method for inducing the production of a composition comprising administering to a subject an effective amount of a composition according to any one of items C69 to C136.

C167. The method of item C166, wherein the subject is at risk of developing a urinary tract infection.

C168. The method of item C166, wherein the subject is at risk of developing bacteremia.

C169. The method of item C166, wherein the subject is at risk of developing sepsis.

C170. A method for inducing an immune response in a subject, comprising administering to the subject the composition according to any one of items C69 to C136.

C171. The method of item C170, wherein the immune response comprises induction of anti-E. coli O-specific polysaccharide serum antibodies.

C172. The method according to item C170, wherein the anti-E. coli O-specific polysaccharide serum antibody is an IgG antibody.

C173. The method according to item C170, wherein the anti-E. coli O-specific polysaccharide serum antibody is an IgG antibody having bactericidal activity against E. coli.

C174. The immunogenic composition of item C69, wherein n is greater than the number of repeat units in the corresponding wild type E. coli polysaccharide.

C175. The composition according to item C174, wherein n is an integer from 31 to 100.

C176. The composition according to item C174, wherein the sugar comprises a structure according to any one of formula O1A, formula O1B, and formula O1C, formula O2, formula O6, and formula O25B.

C177. The sugar is relative to any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121. The composition according to item C174, wherein the composition is produced in a recombinant host cell that expresses a wzz family protein having at least 90% sequence identity.

C178. The composition according to item C177, wherein the protein comprises any one of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, and SEQ ID NO: 116.

C179. Sugar according to item C174, which is synthetically synthesized.

C180. a mutated FimH polypeptide according to any one of items C1 to C55, and (a) a carrier protein covalently attached to a sugar comprising formula O25b, where n is an integer from 31 to 90; (b) a conjugate comprising a carrier protein covalently attached to a sugar comprising formula O1A, where n is an integer from 31 to 90; (c) a conjugate comprising a carrier protein of formula O2, where n is an integer from 31 to 90; and (d) a carrier protein covalently attached to a sugar comprising the formula O6, where n is an integer from 31 to 90. An immunogenic composition comprising a conjugate comprising a carrier protein.

C181. a carrier protein covalently bonded to a sugar comprising a structure selected from any one of formula O15, formula O16, formula O17, formula O18 and formula O75, where n is an integer from 31 to 90; The immunogenic composition of item C180, further comprising a conjugate comprising:

C182. The immunogenic composition of item C180, comprising at most about 25% free sugars compared to the total amount of sugars in the composition.

C183. A method of eliciting an immune response against E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C180 to C182.

C184. The method of item C183, wherein the immune response comprises opsonophagocytic antibodies against E. coli.

C185. The method of item C183, wherein the immune response protects the mammal from E. coli infection.

C186. (a) a recombinant mammalian cell comprising a first gene of interest encoding a mutated FimH polypeptide according to any one of items C1-C55, wherein the gene has at least two recombinant targets; Recombinant mammalian cells integrated between sites (RTS).

C187. The embodiment according to item C186, wherein the two RTSs are chromosomally integrated within the NL1 or NL2 locus.

C188. Embodiment according to item C186, wherein the first gene of interest further comprises a reporter gene, a gene encoding a protein that is difficult to express, an auxiliary gene or a combination thereof.

C189. further comprising a second gene of interest integrated within a second chromosomal locus different from the locus of (a), the second gene of interest carrying a reporter gene, a protein difficult to express; Embodiment according to item C186, comprising an encoding gene, an accessory gene or a combination thereof.

C190. The recombinant cell according to C186, wherein the polynucleotide sequence is integrated into the genomic DNA of said mammalian cell.

C191. A recombinant cell according to C186, wherein the polynucleotide sequence is codon optimized for expression in the cell.

C192. The recombinant cell according to C186, which is a human embryonic kidney cell.

C193. The recombinant cell according to C192, wherein the human embryonic kidney cell comprises a HEK293 cell.

C194. The recombinant cell according to C193, wherein the HEK293 cell is selected from any one of HEK293T cells, HEK293TS cells, and HEK293E cells.

C195. The recombinant cell according to C186, which is a CHO cell.

C196. The recombinant cell according to C195, wherein the CHO cell is a CHO-K1 cell, CHO-DUXB11, CHO-DG44 cell, or CHO-S cell.

C197. The recombinant cell according to C186, wherein the polypeptide is soluble.

C198. A recombinant cell according to C186, wherein the polypeptide is secreted from the cell.

C199. A culture comprising a recombinant cell according to C186, which is at least 5 liters in size.

C200. The culture according to C199, wherein the yield of polypeptide or fragment thereof is at least 0.05 g/L.

C201. The culture according to C199, wherein the yield of polypeptide or fragment thereof is at least 0.10 g/L.

C202. A method for producing a polypeptide or a fragment thereof derived from E. coli, the polypeptide or a fragment thereof being produced by culturing the recombinant mammalian cells described in C186 under suitable conditions. and collecting the polypeptide or fragment thereof.

C203. The method of C202, further comprising purifying the polypeptide or fragment thereof.

C204. The immunogenic composition according to item C54, further comprising at least one saccharide derived from any one K. pneumoniae type selected from the group consisting of O1, O2, O3 and O5.

C205. The immunogenic composition according to item C204, further comprising a saccharide derived from K. pneumoniae type O1.

C206. The immunogenic composition of item C204, further comprising a sugar derived from K. pneumoniae type O2.

C207. The composition according to item C204, further comprising a sugar derived from K. pneumoniae type O3.

C208. The immunogenic composition according to item C204, further comprising a saccharide derived from K. pneumoniae type O5.

C209. The immunogenic composition according to item C204, further comprising a sugar derived from K. pneumoniae type O1 and a sugar derived from K. pneumoniae type O2.

C210. Formula O1, Formula O1A, Formula O1B, Formula O1C, Formula O2, Formula O3, Formula O4, Formula O4:K52, Formula O4:K6, Formula O5, Formula O5ab, Formula O5ac, Formula O6, Formula O6:K2; K13; K15, Formula O6: K54, Formula O7, Formula O8, Formula O9, Formula O10, Formula O11, Formula O12, Formula O13, Formula O14, Formula O15, Formula O16, Formula O17, Formula O18, Formula O18A, Formula O18ac, Formula O18A1, formula O18B, formula O18B1, formula O19, formula O20, formula O21, formula O22, formula O23, formula O23A, formula O24, formula O25, formula O25a, formula O25b, formula O26, formula O27, formula O28, formula O29, Formula O30, Formula O32, Formula O33, Formula O34, Formula O35, Formula O36, Formula O37, Formula O38, Formula O39, Formula O40, Formula O41, Formula O42, Formula O43, Formula O44, Formula O45, Formula O45, Formula O45rel , formula O46, formula O48, formula O49, formula O50, formula O51, formula O52, formula O53, formula O54, formula O55, formula O56, formula O57, formula O58, formula O59, formula O60, formula O61, formula O62, formula 62D1, formula O63, formula O64, formula O65, formula O66, formula O68, formula O69, formula O70, formula O71, formula O73, formula O73, formula O74, formula O75, formula O76, formula O77, formula O78, formula O79, Formula O80, Formula O81, Formula O82, Formula O83, Formula O84, Formula O85, Formula O86, Formula O87, Formula O88, Formula O89, Formula O90, Formula O91, Formula O92, Formula O93, Formula O95, Formula O96, Formula O97 , formula O98, formula O99, formula O100, formula O101, formula O102, formula O103, formula O104, formula O105, formula O106, formula O107, formula O108, formula O109, formula O110, formula 0111, formula O112, formula O113, formula O114, formula O115, formula O116, formula O117, formula O118, formula O119, formula O120, formula O121, formula O123, formula O124, formula O125, formula O126, formula O127, formula O128, formula O129, formula O130, formula O131, Formula O132, Formula O133, Formula O134, Formula O135, Formula O136, Formula O137, Formula O138, Formula O139, Formula O140, Formula O141, Formula O142, Formula O143, Formula O144, Formula O145, Formula O146, Formula O147, Formula O148 , formula O149, formula O150, formula O151, formula O152, formula O153, formula O154, formula O155, formula O156, formula O157, formula O158, formula O159, formula O160, formula O161, formula O162, formula O163, formula O164, formula O165, formula O166, formula O167, formula O168, formula O169, formula O170, formula O171, formula O172, formula O173, formula O174, formula O175, formula O176, formula O177, formula O178, formula O179, formula O180, formula O181, A structure selected from any one of formula O182, formula O183, formula O184, formula O185, formula O186, formula O187 (wherein n is an integer of 1 to 100, more preferably 31 to 90) The immunogenic composition according to any one of items C204-C209, further comprising at least one saccharide comprising.

C211. and wherein the sugar derived from K. pneumoniae is conjugated to a carrier protein; and the sugar derived from E. coli is conjugated to a carrier protein. Immunogenic composition.

C212. A method of eliciting an immune response against E. coli in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C204 to C211.

C213. The method of item C212, wherein the immune response comprises opsonophagocytic antibodies against E. coli.

C214. The method of item C212, wherein the immune response protects the mammal from E. coli infection.

C215. A method of eliciting an immune response against K. pneumoniae in a mammal, comprising administering to the mammal an effective amount of a composition according to any one of items C204 to C211.

C216. The method of item C215, wherein the immune response comprises opsonophagocytic antibodies against K. pneumoniae.

C217. The method of item C215, wherein the immune response protects the mammal from K. pneumoniae infection.

C218. The composition and method of any of items C204 to C217, wherein K. pneumoniae serotype O1 comprises variant O1V1 or O1V2.

C219. The composition and method of any of items C204 to C217, wherein K. pneumoniae serotype O2 comprises variant O2V1 or O2V2.

C220. Use of a composition according to any one of items C1 to C219 herein.

C221. Klebsiella pneumoniae O antigen is present in a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype O2 subtype v1 (O2v1) and d) The composition according to item C211, selected from the group consisting of serotype O2 subtype v2 (O2v2).

C222. A nucleic acid comprising a nucleotide encoding a polypeptide according to any one of items C1 to C221.

C223. The nucleic acid according to item C222, which is RNA.

C224. Nanoparticles comprising the nucleic acid according to item C222 or C223.

C225. one or more having a sugar selected from the group consisting of formula O4, formula O11, formula O13, formula O21 and formula O86, where n is an integer from 1 to 100, preferably from 31 to 90 An immunogenic composition of the invention further comprising a conjugate of.

C226. One or more conjugates with a sugar selected from the group consisting of formula O1a, formula O2, formula O6 and formula O25b, where n is an integer from 1 to 100, preferably from 31 to 90. An immunogenic composition of the invention further comprising:

Claims (21)

(i) a mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of a wild-type FimH polypeptide, wherein the mutation position is F1, P12, G14, G15, G16, A18; , P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129 , Q133, F144, V154, V155, V156, P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59, and (ii) a pharmaceutical A pharmaceutical composition comprising a carrier acceptable to. The mutated FimH polypeptide is F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; ;A119N;A119S; At least one mutation selected from the group consisting of A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; 2. A pharmaceutical composition according to claim 1, comprising a mutation. The mutated FimH polypeptide
a) Mutations G15A and G16A;
b) mutations P12C and A18C;
c) mutations G14C and F144C;
d) mutations P26C and V35C;
e) mutations P26C and V154C;
f) mutations P26C and V156C;
g) mutations V27C and L34C;
h) mutations V28C and N33C;
i) mutations V28C and P157C;
j) mutations Q32C and Y108C;
k) mutations N33C and L109C;
l) mutations N33C and P157C;
m) mutations V35C and L107C;
n) mutations V35C and L109C;
o) mutations S62C and T86C;
p) mutations S62C and L129C;
q) mutations Y64C and L68C;
r) mutations Y64C and A127C;
s) mutations L68C and F71C;
t) mutations V112C and T158C;
u) mutations S113C and G116C;
v) mutations S113C and T158C;
w) mutations V118C and V156C;
x) mutations A119C and V155C;
y) mutations L34N and V27A;
z) mutations L34S and V27A;
aa) mutations L34T and V27A;
ab) mutations L34D and V27A;
ac) mutations L34E and V27A;
ad) mutations L34K and V27A;
ae) mutations L34R and V27A;
af) mutations A119N and V27A;
ag) mutations A119S and V27A;
ah) mutations A119T and V27A;
ai) mutations A119D and V27A;
aj) mutations A119E and V27A;
ak) mutations A119K and V27A;
al) mutations A119R and V27A;
am) mutations G15A and V27A;
an) mutations G16A and V27A;
ao) mutations G15P and V27A;
ap) mutations G16P and V27A;
aq) mutations G15A, G16A and V27A;
ar) mutations G65A and V27A;
as) mutations V27A and Q133K; and at) mutations G15A, G16A, V27A and Q133K
3. A pharmaceutical composition according to claim 2, comprising a mutation selected from the group consisting of. 3. The pharmaceutical composition of claim 2, wherein the mutated FimH polypeptide comprises a sequence of any one of SEQ ID NOs: 2-58 and 60-64. 5. A pharmaceutical composition according to any one of claims 1 to 4, wherein the mutated FimH polypeptide is isolated. A mutated FimH polypeptide comprising at least one amino acid mutation compared to the amino acid sequence of a wild-type FimH polypeptide, wherein the mutation position is F1, P12, G14, G15, G16, A18, P26, V27, V28, Q32, N33, L34, V35, R60, S62, Y64, G65, L68, F71, T86, L107, Y108, L109, V112, S113, A115, G116, V118, A119, A127, L129, Q133, An immunogenic composition comprising a mutated FimH polypeptide selected from the group consisting of F144, V154, V155, V156, P157, T158, V163 and V185, wherein the amino acid positions are numbered according to SEQ ID NO: 59. The mutated FimH polypeptide is F1I; F1L; F1V; F1M; F1Y; F1W; P12C; G14C; G15A; G15P; G16A; G16P; A18C; L34S; L34T; L34D; L34E; L34K; L34R; V35C; R60P; S62C; Y64C; G65A; L68C; F71C; T86C; L107C; Y108C; ;A119N;A119S; At least one mutation selected from the group consisting of A119T; A119D; A119E; A119K; A119R; A127C; L129C; Q133K; F144C; V154C; V156C; P157C; T158C; 7. The immunogenic composition of claim 6, comprising a mutation. The mutated FimH polypeptide
a) Mutations G15A and G16A;
b) mutations P12C and A18C;
c) mutations G14C and F144C;
d) mutations P26C and V35C;
e) mutations P26C and V154C;
f) mutations P26C and V156C;
g) mutations V27C and L34C;
h) mutations V28C and N33C;
i) mutations V28C and P157C;
j) mutations Q32C and Y108C;
k) mutations N33C and L109C;
l) mutations N33C and P157C;
m) mutations V35C and L107C;
n) mutations V35C and L109C;
o) mutations S62C and T86C;
p) mutations S62C and L129C;
q) mutations Y64C and L68C;
r) mutations Y64C and A127C;
s) mutations L68C and F71C;
t) mutations V112C and T158C;
u) mutations S113C and G116C;
v) mutations S113C and T158C;
w) mutations V118C and V156C;
x) mutations A119C and V155C;
y) mutations L34N and V27A;
z) mutations L34S and V27A;
aa) mutations L34T and V27A;
ab) mutations L34D and V27A;
ac) mutations L34E and V27A;
ad) mutations L34K and V27A;
ae) mutations L34R and V27A;
af) mutations A119N and V27A;
ag) mutations A119S and V27A;
ah) mutations A119T and V27A;
ai) mutations A119D and V27A;
aj) mutations A119E and V27A;
ak) mutations A119K and V27A;
al) mutations A119R and V27A;
am) mutations G15A and V27A;
an) mutations G16A and V27A;
ao) mutations G15P and V27A;
ap) mutations G16P and V27A;
aq) mutations G15A, G16A and V27A;
ar) mutations G65A and V27A;
as) mutations V27A and Q133K; and at) mutations G15A, G16A, V27A and Q133K
8. The immunogenic composition of claim 7, comprising a mutation selected from the group consisting of: 8. The immunogenic composition of claim 7, wherein the mutated FimH polypeptide comprises a sequence of any one of SEQ ID NOs: 2-58 and 60-64. 10. An immunogenic composition according to any one of claims 6 to 9, wherein the mutated FimH polypeptide is isolated. 11. Immunogenic composition according to any one of claims 6 to 10, further comprising at least one additional antigen. 12. The immunogenic composition of claim 11, wherein the at least one additional antigen is a polysaccharide or a protein. 11. Immunogenic composition according to any one of claims 6 to 10, further comprising at least one adjuvant. (i) for inducing an immune response in a subject against extraintestinal pathogenic E. coli, or (ii) for opsonophagocytosis and/or in a subject specific for extraintestinal pathogenic E. coli. 14. A medicament for inducing the production of neutralizing antibodies, the medicament comprising an effective amount of a composition according to any one of claims 1 to 13. 15. The medicament of claim 14, wherein the subject is at risk of developing a urinary tract infection. 15. The medicament of claim 14, wherein the subject is at risk of developing bacteremia. 15. The medicament of claim 14, wherein the subject is at risk of developing sepsis. 14. A medicament for eliciting an immune response against E. coli in a mammal, comprising an effective amount of a composition according to any one of claims 1 to 13. 19. The agent according to claim 18, wherein the immune response comprises opsonophagocytic and/or neutralizing antibodies against E. coli. 19. The agent of claim 18, wherein the immune response protects the mammal from E. coli infection. 14. A medicament for preventing, treating or ameliorating a bacterial infection, disease or condition in a subject, comprising an immunologically effective amount of a composition according to any one of claims 1 to 13.

Images