KR20230173055A - Serum free cell culture medium composition and culture method for stem cell therapy and cultured meat - Google Patents

Abstract

The present invention relates to a serum-free medium composition and a cell culture method using the same. When using the serum-free medium composition of the present invention, it is economical by replacing expensive cell culture medium containing serum, and can reduce side effects such as infection that may occur when containing existing serum. It is expected that it can be useful in cultivating stem cells used for purposes such as beauty and cultured meat.

Description

Serum free cell culture medium composition and culture method for stem cell therapy and cultured meat}

The present invention relates to a serum-free cell culture medium, and more specifically, a method of culturing cells in a serum-free culture medium, analysis of the characteristics of stem cells produced by the method, cell therapy using stem cells and stem cell-derived materials, and This relates to a cell culture method for cultured meat.

Stem cells have self-renewal and differentiation abilities and secrete various bioactive factors, so they are widely used in tissue engineering and regenerative medicine. Active application research is underway using various stem cells such as embryonic stem cells, induced pluripotent stem cells, and mesenchymal stem cells.

In particular, mesenchymal stem cells are isolated from various tissues of the body, such as bone marrow, adipose tissue, umbilical cord, cord blood, muscle, and placenta. They can be cultured by attaching to a plastic surface in a spindle shape, and can be converted into adipocytes, osteocytes, or cartilage cells. It can be differentiated into different types, has low immunogenicity, and can play an immunomodulatory role. In addition, based on humans, it has the characteristic of expressing stem cell-specific cell surface antigens CD73, CD90, and CD105, but not CD34, CD45, CD14, CD11b, CD19, and CD79a. Mesenchymal stem cells with these characteristics have the ability to regulate immunity, so research on regenerative treatment using mesenchymal stem cells is actively underway. Since regenerative treatment using mesenchymal stem cells and the production of cultured meat are cell-based, mesenchymal stem cells When cultivating stem cells, it is important to ensure safety, stability, efficiency, consistency, reproducibility, and productivity.

Fetal bovine serum (FBS), an essential substance for stem cell culture, supplies various substances such as polymers, proteins, adhesion and growth factors, nutrients, hormones, and growth factors to cells in culture to maintain pH and maintain pH during cell culture. It functions to neutralize organophosphorus compounds generated during the oxidation process. However, the biggest obstacle to using stem cells as a cell therapy is related to FBS. First, because FBS is derived from bovine fetuses, there is a risk of disease transmission between heterologous or prion protein-mediated diseases. Second, the quality of FBS may vary from batch to batch during production, causing fluctuations in experimental results, making it difficult to compare and analyze results. Third, because it is a serum-derived substance, there is a possibility of causing an immune response. Due to these shortcomings, the need for serum-free stem cell culture medium is emerging.

As serum plays an important role in cell culture, research is being conducted on the composition of serum-free media containing hormones, growth factors, vitamins, recombinant proteins, adhesion factors, amino acids, fatty acid supplements, etc. In addition, spirulina, silk hemolymph, silk sericin, and silk fibroin have been reported as natural serum substitutes, and cell culture using a chemically defined serum-free medium has been reported. Research is in progress. However, these potential benefits of serum-free media may only apply if cells cultured in serum-free media maintain the same functional properties as those cultured in serum-free media.

KR 10-1707622 B

The present inventors investigated the morphology, cell proliferative capacity, cell cycle, cell viability, gene expression pattern, cell surface antigen expression pattern, and mesenchyme of amniotic fluid derived stem cells (AF-MSC) in serum-free cell culture medium. The present invention was completed by comparing the characteristics of stem cells, such as differentiation ability, with animal-derived serum cell culture medium.

Therefore, an object of the present invention is to provide a serum-free medium composition.

Another object of the present invention is to provide a cell culture method.

The present inventors investigated the morphology, cell proliferative capacity, cell cycle, cell viability, gene expression pattern, cell surface antigen expression pattern, and mesenchyme of amniotic fluid derived stem cells (AF-MSC) in serum-free cell culture medium. Characteristics such as differentiation ability of stem cells were confirmed by comparing them with animal-derived serum cell culture medium.

Accordingly, the present invention relates to a serum-free medium composition and cell culture method.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention relates to a serum-free medium composition, which includes a basic medium and does not contain animal serum.

The serum-free medium composition of the present invention may be used for cultivating stem cells for producing cell therapy products or cultured meat.

The stem cells may be mesenchymal stem cells or muscle stem cells, but are not limited thereto.

In the present invention, “stem cell” refers to a cell having potency and self-renewal. Stem cells are divided into pluripotency, multipotency, or unipotency depending on their differentiation ability.

The stem cells may be one or more selected from the group consisting of embryonic stem cells (ESC), adult stem cells, and induced pluripotent stem cells (iPSC).

In the present invention, “Mesenchymal stem cells (MSC)” are adult stem cells, have multipotency and self-renewal ability, have excellent proliferation ability, and are genetically stable. The mesenchymal stem cells are cells that assist in creating fat, cartilage, bone, bone marrow, muscle, nerve, etc., and are divided into various cells such as fat cells, cartilage cells, osteocytes, nerve cells, liver cells, and muscle cells. It can be differentiated.

The type and origin of the mesenchymal stem cells are not limited as long as they have differentiation ability and self-renewal ability. For example, the mesenchymal stem cells may be derived from mammals, humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, or poultry. Additionally, the mesenchymal stem cells may be derived from isolated umbilical cord, placenta, fat, bone marrow, cord blood, muscle, amniotic fluid, or amniotic membrane. At this time, separating the umbilical cord, placenta, fat, bone marrow, cord blood, muscle, amniotic fluid or amniotic membrane and obtaining stem cells therefrom may be performed by conventional anatomical methods and known methods.

In the present invention, “muscle stem/satellite cells” are adult stem cells, which exist under the basal layer of muscle fibers and are responsible for the regeneration of muscle tissue. Muscle stem cells have been used in research on muscle physiology and regeneration, and have recently been considered an important candidate for the production of cultured meat in livestock. Since the growth environment of muscle stem cells in the body is composed of various types of tissues and cells such as muscle fibers, connective tissue, and stromal cells, the process of isolating muscle stem cells from muscle tissue proceeds through a series of steps. The most widely used methods for sorting muscle stem cells are density gradient centrifugation and preplating methods, which do not require special tools.

For example, the muscle stem cells may be derived from mammals, humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, or poultry.

In the present invention, “culture” refers to the process of artificially growing cells, including living stem cells, outside the body under controlled conditions, and may mean, for example, growth and proliferation. The “growth and proliferation” may mean an increase in the number of cells.

The culture may include subculture. The “subculture” is a method of cell proliferation and means periodically transplanting cells into a new medium every few days in order to preserve them and continue the generation of cells. “Passage” may be the growth and proliferation of stem cells from initial culture in a culture vessel to confluence, when cells actively grow in the same culture vessel.

In the present invention, “differentiation” refers to a phenomenon in which cells become specialized in structure or function while they divide and grow, that is, the shape or function of biological cells, tissues, etc. change to perform a given task. it means. Measuring or determining the degree of differentiation into a specific cell type can be performed by methods well known in the art. The differentiation can also be accomplished by examining cell morphology using light or confocal microscopy, measuring changes in cell surface labeling and cell morphology using techniques such as cell staining techniques, flow cytometry, or immunocytochemistry, or by polymerization. It can be confirmed by measuring changes in gene expression using techniques well known in the art, such as polymerase chain reaction (PCR) and gene-expression profiling.

In the present invention, “media” refers to a material that can support the growth and survival of cells, including stem cells, in vitro .

The basic medium is a known medium commonly used for culturing animal cells, such as DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F- 12, DMEM-F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax, AminoMax Medium, Chang's Medium, MesenCult-XF It may be Medium, etc., but is not limited thereto.

Specifically, the basic medium includes DMEM/F-12, Penicillin/Streptomycin, HEPES (N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)) solution, and Sodium pyruvate. pyruvate, Putrescine, Progesterone, Triiodothyronine, Thyroxine, Insulin, Transferrin, Selenium, Glutamax, It may include L-Glutamine, Epidermal Growth Factor (EGF), and basic Fibroblast Growth Factor (bFGF), or a combination thereof.

The HEPES (N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)) solution and sodium pyruvate can create a stable pH environment. The HEPES solution and sodium pyruvate may be included in a concentration of 0.01 to 100 mM relative to the medium composition.

Putrescine, a polyamine, is involved in cell proliferation in vitro and in vivo and can be used as a substitute for serum. The putrescine may be included in the medium composition at a concentration of 1 nM to 0.01 mM.

Progesterone induces cell proliferation, and thyroid hormones triiodothyronine and thyroxine can regulate cell growth, development, and metabolism. The progesterone, triiodothyronine, and thyroxine may be included at a concentration of 5 nM to 0.05 mM relative to the medium composition.

Insulin is a hormone that promotes cell proliferation by promoting the intake of sugar and amino acids into cells, and can promote cell proliferation.

The transferrin is a protein that plays a role in moving iron into cells, and can detoxify free oxygen radicals and peroxides in the medium.

Selenium is a substance that helps selenium-dependent enzymes reduce fat peroxidation and has the role of protecting cell membranes. The selenium may be in the form of selenium itself or a selenium salt, for example, in organic or inorganic form. The organic form of the selenium salt may be the amino acids L(+)-selenomethionine, L(+)-methylselenocysteine or L(+)-selenocysteine. The inorganic form of the selenium salt may be sodium selenite, calcium selenite, or potassium selenite.

The insulin-transferrin-selenium (ITS) may be included at a concentration of 0.001% to 5% based on the medium composition.

The Glutamax is composed of sodium chloride (NaCl) and L-alanyl-L-glutamine and can be used as a substitute for L-glutamine. The Glutamax may be included at a concentration of 0.001% to 5% based on the medium composition.

The L-Glutamine is an amino acid involved in many metabolic processes and can be used as an amino acid enhancer. The L-glutamine may be included at a concentration of 0.02mM to 0.2M relative to the medium composition.

The epidermal growth factor (EGF) can stimulate proliferation and differentiation by binding to the receptor, EGFR. The EGF may be included in the medium composition at a concentration of 0.01 ng/mL to 1 μg/mL.

The fibroblast growth factor (FGF) provides signals for cells to grow and proliferate, thereby inducing a signal transduction process for proliferation. The fibroblast growth factor may include basic fibroblast growth factor (bFGF). The bFGF may be included in the medium composition at a concentration of 0.01 ng/mL to 1 μg/mL.

Additionally, the serum-free medium composition of the present invention contains SR3 (Serum replacement 3), polyvinylpyrrolidone (PVP), albumin, fibronectin, silk fibroin, and spirulina. , or it may further include a combination thereof.

Specifically, the serum-free medium composition of the present invention may further include SR3 (Serum replacement 3) and fibronectin, and according to a specific embodiment of the present invention, the serum-free medium composition of the present invention to which SR3 and fibronectin are added. The medium composition showed excellent cell growth characteristics (see Figures 1a and 1b).

The SR3 may be included at a concentration of 0.02% to 10% based on the medium composition. When used in the above range, it has a cell stabilization effect during long-term culture of adherent cells and suspended cells.

The fibronectin may be included in the medium composition at a concentration of 0.01 μg/mL to 100 μg/mL. When used within the above range, it has the effect of enhancing cell adhesion and proliferation ability.

The serum-free medium composition of the present invention is substantially free of animal-derived serum and its analogues.

The animal may be a cow, horse, pig, mouse, rat, hamster, rabbit, sheep, goat, or chicken, and especially may be a cow, dog, or horse.

A representative analogue of the animal-derived serum is BPE (Bovine Pituitary Extract).

In addition, 'substantially' not containing the animal-derived serum and its analogues means containing the animal-derived serum and/or its analogues at a concentration of 5% (v/v) or less, preferably 3% ( v/v) or less, more preferably 1% (v/v) or less, or most preferably not including serum derived from the animal at all.

Although the medium composition of the present invention does not contain animal-derived serum, it promotes the proliferation of stem cells and maintains the differentiation ability of stem cells. Rather, compared to the serum medium, it showed growth kinetics developed in the early stages of culture, and the expression rates of pluripotency markers and mesenchymal stem cell-specific markers were high. According to a specific embodiment of the present invention, the serum-free medium composition of the present invention not only promotes the proliferation of stem cells (see Figure 1b) and expresses specific markers of stem cells (see Figures 4a and 4b), It was confirmed to be effective in maintaining the differentiation ability of stem cells (see Figure 5).

Another aspect of the present invention relates to a cell culture method, comprising culturing stem cells or cells for producing cultured meat in the serum-free medium composition described above.

The stem cells may be horse ( Equus caballus ) amniotic fluid-derived mesenchymal stem cells, but are not limited thereto.

The cells for producing cultured meat may be muscle stem cells, but are not limited thereto.

Since the cell culture method of the present invention uses the serum-free medium composition described above, description of overlapping content is omitted to avoid excessive complexity of the specification.

The present invention relates to a serum-free medium composition and a cell culture method using the same. When using the serum-free medium composition of the present invention, it is economical by replacing expensive cell culture medium containing serum, and can reduce side effects such as infection that may occur when containing existing serum. It is expected that it can be useful in cultivating stem cells used for purposes such as beauty and cultured meat.

Figures 1a and 1b show the results of confirming the cell shape (Figure 1a) and cell proliferation ability (Figure 1b) of AF-MSCs cultured in serum-free medium according to an embodiment of the present invention.
Figure 2 shows the results of confirming the cell cycle and proliferation ability of AF-MSC according to the presence or absence of serum according to an embodiment of the present invention, showing the results of AF-MSC cultured in general serum medium (Figure 2a) and serum-free medium (Figure 2b). This is the result of comparative analysis of cell cycle and proliferation ability through BrdU staining (Figure 2c).
Figure 3 shows the results of confirming the cell viability of AF-MSCs cultured in serum-free medium according to an embodiment of the present invention.
Figures 4a and 4b show the results of confirming the relative expression level of stem cell-specific markers of AF-MSCs cultured in serum-free medium according to an embodiment of the present invention through flow cytometry (Figure 4a) and PCR (Figure 4b). am.
Figure 5 shows the results of quantitative analysis of the expression levels of genes related to 3 lineage differentiation of AF-MSCs cultured in serum-free medium according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Statistical analysis was performed through the Graphpad Prism program. At least three replicates were performed. T-test was used for analysis for MTT assay, growth kinetic and real time PCR. One-way ANOVA was used for analysis of cell proliferation capacity and cell viability. Statistically significant data are indicated with superscripts.

Experimental Example 1. Optimization of serum-free medium conditions for AF-MSC culture

Badge composition

- Serum media

DMEM (Modified Eagle's medium) supplemented with 15% FBS, 1% penicillin-streptomycin, and 1% Glutamax (Gibco) was used.

- Serum free media

A medium consisting of the composition shown in Table 1 below was used. Optionally, the additives shown in Table 2 below were added and used.

ingredient Amount (mL) density Where to buy Base DMEM/F-12(Ham) 462.5 Gibco Penicillin/Streptomycin 5 Gibco Buffering agent Hepes solution 5 10mM Sigma Sodium pyruvate 5 1mM Sigma Polyamines Putrescine 0.5 0.1 μM Sigma Hormones Progesterone 0.5 0.2 μM Sigma Triiodothyronine 0.5 0.5 μM Sigma Thyroxine 0.5 0.45 μM Sigma Compound Insulin-Transferrin-Selenium(ITS) 5 One % Gibco Vitamin Glutamax 5 One % Gibco Amino acid L-Glutamine 5 2mM Sigma Growth factors EGF 0.2 10 ng/mL Sigma bFGF 0.025 10 ng/mL Sigma

ingredient density Where to buy SR3(Serum Replacement 3) N/A Sigma PVP 10% Sigma Albumin 2 % Sigma Fibronectin 1 μg/mL Sigma Silk fibroin 0.05% Sigma Spirulina 1~10% Sigma

Cell culture and morphology observation

AF-MSCs used in the experiment were isolated through the following process:

During the delivery process, it was obtained with a 50 cc syringe equipped with 18 G, filtered using a 100 μM cell strainer, mixed 1:1 with PBS (Phosphate Buffered Saline) containing 5% penicillin/streptomycin, and washed at 3,000 rpm for 10 minutes. The pellet was recovered by centrifugation for a minute. The recovered pellet was washed and centrifuged twice using PBS containing 5% penicillin/streptomycin to separate mononuclear cells.

AF-MSCs were cultured in a cell culture dish at 1 x 10 ⁵ cells/cm ² , and the next day, the medium was completely replaced to remove dead cells or cell debris. After 2 to 3 days, the cell morphology was observed when the confluence was more than 80%. Differences in shape depending on the type of additive added were confirmed through diff-quik staining.

Confirmation of cell proliferation ability

The proliferative ability of AF-MSCs cultured in serum-free medium was expressed as a percentage (%) of the total number of cells relative to the serum medium using a cell counter.

result

As can be seen in Figures 1a and 1b, the morphology of AF-MSCs cultured in serum-free medium was observed from the day after the start of culture. Compared with serum medium, AF-MSC morphology in serum-free medium, albumin-supplemented medium, and silk fibroin-supplemented medium aggregated over time and did not proliferate well. On the other hand, in the case of SR3 (Serrum replacement 3) or fibronectin-added medium, there was no abnormal shape and the proliferation ability was improved compared to serum medium.

Accordingly, subsequent experiments were performed with AF-MSCs cultured using serum-free medium supplemented with 2% SR3 and 1 μg/mL fibronectin.

Experimental Example 2. Cell cycle confirmation

Culture AF-MSCs at passage 7 in a ^cell culture dish ^{at 2} did. For propidium iodide (PI) staining, cells were centrifuged and washed with PBS. PI-stained cells were analyzed by flow cytometry (BD bioscience).

As a result, as can be seen in Figure 2, it was confirmed that the cell cycle was normally activated in AF-MSCs cultured in serum-free medium (Figure 2b), compared to AF-MSCs cultured in serum medium (Figure 2a). Although the ratio of G0/G1 phase in serum-free medium tended to be higher than that in serum medium, the number of cells entering S phase was similar to that in serum medium when compared with BrdU (Figure 2c).

Experimental Example 3. Confirmation of cell viability

To check cell viability in serum-free medium, AF-MSCs were cultured at 1 x 10 ⁴ cells/well in a 96-well plate and cultured for 48 hours, followed by CyQUANT?? MTT assay was performed using the MTT Cell Viability Assay kit (ThermoFisher).

Specifically, for serum medium and serum-free medium, all medium was removed and replaced with 100 μL fresh medium, then 10 μL of 12 mM MTT solution was added to each well and incubated at 37°C for 4 hours. Afterwards, 85 μL of the supernatant was removed, 50 μL of DMSO was added, and the cells were incubated again at 37°C for 10 minutes, and cell proliferation ability was evaluated using a microplate reader set at 550 nm.

As a result, as can be seen in Figure 3, the cell survival rates of AF-MSCs cultured in serum-free medium and AF-MSCs cultured in serum medium were similar.

Experimental Example 4. Confirmation of cell surface marker expression

To analyze the expression pattern of stem cell-specific cell surface antigen factors in serum-free medium, flow cytometry was performed as follows.

Specifically, AF-MSCs were prepared with at least 5 x 10 ⁵ cells per marker and fixed with 4% paraformaldehyde (PFA). The fixed cells were CD29 (PE anti-human CD29 antibody, BioLegend), CD44 (PE anti-mouse/human CD44 antibody, BioLegend), CD90 (PE Mouse Anti-Rat CD90/Mouse CD90.1, BD biosciences), and CD105 ( Mouse Anti Human CD105: FITC, Bio-Rad), CD14 (Porcine/Equine CD14 Antibody, R&D system), CD34 (FITC Mouse Anti-Human CD34, BD pharmigen), CD38 (FITC anti-human CD38 Antibody, BioLegend), CD45 (Mouse Anti-Human CD45-FITC, Southern Biotech), and FACS histogram data were analyzed using a major histocompatibility class II (MHC Class II antibody, clone CVS20, FITC, LS bio) antibody against FlowJo. did.

Next, in order to evaluate the relative expression level of stem cell-specific markers, real-time PCR was performed on AF-MSCs cultured in serum-free medium based on the gene expression level of AF-MSCs cultured in serum medium. Gene expression levels were normalized.

Specifically, first, mRNA was extracted using an RNA extraction mini kit (Qiagen, Hilden, Germany). After determining RNA purity using a nanodrop spectrophotometer (BioSpec, Bartlesville, OK, USA), cDNA was synthesized from 1 μg of total RNA using a commercial cDNA synthesis kit (Bioneer, Daejeon, South Korea).

Based on the synthesized cDNA, PCR was performed with equi primers based on the equine ( Equus caballus ) sequence available at the National Center for Biotechnology Information (NCBI) using the SYBR kit (Bioneer). The primers used are shown in Table 3 below. mRNA levels of β-actin; pluripotency markers (Pou5f1, c-Myc, and Klf4); and MSC markers (Pax6, Endoglin, Integrin β1, THY-1, and HCAM) were analyzed. PCR was performed at 95°C for 4 minutes, 40 cycles of 95°C for 30 seconds, 58°C for 30 seconds, and 73°C for 15 seconds. Data were normalized to β-actin RNA levels. Relative fold gene expression of samples was calculated using the delta-delta Ct method, and AF-MSC cultured in serum-free medium (SFM) compared to AF-MSC cultured in serum medium (SM). The gene expression level of MSCs was calculated using the following equation:

△△Ct = △Ct(SFM) - △Ct(SM)

Name Accession No. Sequence (5'-3') bp beta-actin NM_001081838.1 (F) GGATGCAGAAGGAGATCACAG
(SEQ ID NO: 1) 125 (R) CTGGAAGGTGGACAATGAGG
(SEQ ID NO: 2) POU5F1 XM_001490108 (F) TCTCCCATGCACTCAAACTG
(SEQ ID NO: 3) 197 (R) AACTTCACCTTCCCTCCCAAC
(SEQ ID NO: 4) c-Myc XM_023655154 (F) GCCCATAAAATTGCCAAGAGG
(SEQ ID NO: 5) 132 (R) AGCCCTGACCTTTGAATGAC
(SEQ ID NO: 6) Klf4 XM_023629843.1 (F) ACCTCGCCTTACACATGAAG
(SEQ ID NO: 7) 218 (R) TGGTTTCCTCATTGTCTCCTG
(SEQ ID NO: 8) PAX6 XM_023646553.1 (F) TGTTTGCCCGAGAAAGACTAG
(SEQ ID NO: 9) 224 (R)AGAGGTGAAGGATGAAACAGG
(SEQ ID NO: 10) Integrin-b1 XM_005606848.3 (F) CTTATTGGCCTTGCATTGCT
(SEQ ID NO: 11) 169 (R) TTCCCTCGTACTTCGGATTG
(SEQ ID NO: 12) HCAM XM_005598012 (F)ATCCTCACGTCCAACACCTC
(SEQ ID NO: 13) 165 (R) CTCGCCTTTCTTGGTGTAGC
(SEQ ID NO: 14) Endoglin XM_003364144 (F) AAGAGCTCATCTCGAGTCTG
(SEQ ID NO: 15) 162 (R) TGACGACCACCTCATTACTG
(SEQ ID NO: 16) THY-1 AF134236.1 (F) TGAGAATACCACCGCCACAC
(SEQ ID NO: 17) 192 (R) CATGTGTAGAGCCCCTCGTC
(SEQ ID NO: 18)

As a result, as can be seen in Figure 4a, AF-MSCs cultured in serum-free medium showed expression of mesenchymal stem cell negative markers (CD14, CD34, CD38, CD45, MHC Class II) at less than 1%. On the other hand, mesenchymal stem cell positive markers (CD29, CD44, CD90, CD105) showed positive expression patterns. In addition, as can be seen in Figure 4b, the expression levels of pluripotency markers (Pou5f1, c-Myc, and Klf4) and mesenchymal stem cell-specific markers (Pax6, Endoglin, integrin β1, THY-1, and HCAM) were significantly increased. .

These results suggest that AF-MSCs maintain the characteristics of mesenchymal stem cells even in serum-free media.

Experimental Example 5. Induction of differentiation of mesenchymal stem cells

To confirm whether AF-MSCs cultured in serum-free medium maintain the tri-lineage differential capacity into adipocytes, chondrocytes, and osteocytes, which are characteristic of mesenchymal stem cells, adipocytes (A, D) ), differentiation into chondrocytes (B, E), and osteocytes (C, F) was induced.

Specifically ^, cells were cultured in ^a 12-well cell culture plate at ^a concentration of ¹ Gibco) was used to induce mesenchymal 3 lineage differentiation. Cells were stained after 7, 14, or 21 days of fat/cartilage/bone induction. Differentiation into adipocytes, chondrocytes, and osteocytes was confirmed by staining with Oil red O, Alcian blue, and Alizarin red S solutions (all from Sigma-Aldrich), respectively. Cells were observed microscopically using an Eclipse TE2000-U microscope (Nikon, Tokyo, Japan). Next, real-time PCR was performed to quantitatively analyze the expression levels of genes related to 3 lineage differentiation of AF-MSCs.

As a result, as can be seen in Figure 5, adipocytes formed from adipocytes differentiated from AF-MSCs, cartilage matrix formed from chondrocytes differentiated from AF-MSCs, and metal components from osteocytes differentiated from AF-MSCs are all It was dyed.

These results suggest that AF-MSCs maintain their differentiation ability even in serum-free media.

<110> mkbiotech.co.ltd <120> Serum free cell culture medium composition and culture method for stem cell therapy and cultured meat <130>WP223042 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-Actin Primer-F <400> 1 ggatgcagaa ggagatcaca g 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-Actin Primer-R <400> 2 ctggaaggtg gacaatgagg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> POU5F1 Primer-F <400> 3 tctcccatgc actcaaactg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> POU5F1 Primer-R <400> 4 aacttcacct tccctccaac 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223>c-Myc Primer-F <400> 5 gcccataaaa ttgccaagag g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223>c-Myc Primer-R <400> 6 agccctgacc tttgaatgac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klf4 Primer-F <400> 7 acctcgcctt acacatgaag 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Klf4 Primer-R <400> 8 tggtttcctc attgtctcct g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PAX6 Primer-F <400> 9 tgtttgcccg agaaagacta g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PAX6 Primer-R <400> 10 agaggtgaag gatgaaacag g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Integrin-b1 Primer-F <400> 11 cttattggcc ttgcattgct 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Integrin-b1 Primer-R <400> 12 ttccctcgta cttcggattg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HCAM Primer-F <400> 13 atcctcacgt ccaacacctc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HCAM Primer-R <400> 14 ctcgcctttc ttggtgtagc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Endoglin Primer-F <400> 15 aagagctcat ctcgagtctg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Endoglin Primer-R <400> 16 tgacgaccac ctcattactg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> THY-1 Primer-F <400> 17 tgagaatacc accgccacac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> THY-1 Primer-R <400> 18 catgtgtaga gcccctcgtc 20

Claims (10)

A serum-free medium composition for stem cell culture, comprising basic medium, albumin, transferrin, insulin, and fibronectin, and containing no animal serum,
A serum-free medium composition, wherein the albumin is contained in less than 2% of the total serum-free medium composition. According to paragraph 1,
A serum-free medium composition in which the fibronectin is added directly to the medium at a concentration of 0.01 μg/mL to 100 μg/mL. According to paragraph 1,
A serum-free medium composition wherein the stem cells are mesenchymal stem cells or muscle stem cells. According to paragraph 3,
The muscle stem cells are equine ( Equus caballus ) amniotic fluid-derived mesenchymal stem cells, a serum-free medium composition. According to paragraph 1,
The basic medium is DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM-F12, α-MEM (α-Minimal Essential Medium) ), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AminoMax Medium, Chang's Medium, and MesenCult-XF Medium, a serum-free medium composition selected from the group consisting of. According to paragraph 1,
The basic medium is a serum-free medium composition containing Glutamax and L-Glutamine. According to paragraph 1,
The basic medium includes DMEM/F-12, Penicillin/Streptomycin, HEPES (N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)) solution, Sodium pyruvate, Putrescine, Progesterone, Triiodothyronine, Thyroxine, Selenium, Glutamax, L-Glutamine, Epidermal Cell Growth Factor A serum-free medium composition comprising Epidermal Growth Factor (EGF), and basic Fibroblast Growth Factor (bFGF). A cell culture method comprising culturing mesenchymal stem cells or muscle stem cells in the serum-free medium composition according to any one of claims 1 to 7. A method for producing cultured meat, comprising culturing muscle stem cells in the serum-free medium composition according to any one of claims 1 to 7. Cultured meat manufactured by the method of claim 9.